>emb|AJ277210.1|ASA277210 Avena sativa mRNA for chlorophyll synthase (chlG gene)
          Length = 1428

 Score = 44.1 bits (22), Expect = 0.27
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 296  cgtcagtggctggtcgccaggg 317
            ||||||||||||||||||||||
Sbjct: 1139 cgtcagtggctggtcgccaggg 1118

>gb|AE013059.1| Thermoanaerobacter tengcongensis MB4, section 86 of 244 of the
            complete genome
          Length = 9205

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 128  tacaggtacagcagcagaag 147
            ||||||||||||||||||||
Sbjct: 1380 tacaggtacagcagcagaag 1399

>gb|AC140331.2| Mus musculus BAC clone RP23-406J20 from chromosome 13, complete
             sequence
          Length = 192473

 Score = 40.1 bits (20), Expect = 4.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 214   cttattccactaactgtgtt 233
             ||||||||||||||||||||
Sbjct: 84523 cttattccactaactgtgtt 84542


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,944,700
Number of Sequences: 3902068
Number of extensions: 1944700
Number of successful extensions: 39819
Number of sequences better than 10.0: 4
Number of HSP's better than 10.0 without gapping: 4
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39814
Number of HSP's gapped (non-prelim): 5
length of query: 317
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 295
effective length of database: 17,147,199,772
effective search space: 5058423932740
effective search space used: 5058423932740
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)