>gb|AY074784.1| Triticum aestivum dehydroascorbate reductase (DHAR) mRNA, complete
           cds
          Length = 956

 Score =  262 bits (132), Expect = 9e-67
 Identities = 171/186 (91%)
 Strand = Plus / Minus

                                                                       
Query: 259 ggcgggggagcttacgggttcaccttcggcgcccacccggcgatcangttctncttggtc 318
           |||||| | |||||||||||||| |||||||||||||||||||||| ||||| |||||||
Sbjct: 724 ggcgggagggcttacgggttcactttcggcgcccacccggcgatcaggttctccttggtc 665

                                                                       
Query: 319 ggcttggtcttgacgaacgactngcggctgaagagagcctnggngtaggcatggacgctg 378
           | |||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||
Sbjct: 664 gccttggtcttgacgaacgactcgcggctgaagagagcctcggtgtaggcatggacgctg 605

                                                                       
Query: 379 gtcagtgtttcagggaccttccagcctttgaagtgctccanggcaacctggaggtggaag 438
           ||||| |||||||||||||||||||| ||||||||||||| ||| |||||||| ||| ||
Sbjct: 604 gtcagggtttcagggaccttccagcccttgaagtgctccagggcgacctggagatggtag 545

                 
Query: 439 agcttc 444
           ||||||
Sbjct: 544 agcttc 539



 Score = 44.1 bits (22), Expect = 0.38
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 149 aggctcgctcgcattattccaa 170
           ||||||||||||||||||||||
Sbjct: 806 aggctcgctcgcattattccaa 785

>gb|DQ090998.1| Puccinellia tenuiflora dehydroascorbate reductase protein mRNA,
           partial cds
          Length = 202

 Score =  210 bits (106), Expect = 3e-51
 Identities = 157/176 (89%)
 Strand = Plus / Minus

                                                                       
Query: 268 gcttacgggttcaccttcggcgcccacccggcgatcangttctncttggtcggcttggtc 327
           |||||||||||||| || |||||||| |||||||||| ||||| |||||| |||||||||
Sbjct: 200 gcttacgggttcactttgggcgcccatccggcgatcaggttctccttggtgggcttggtc 141

                                                                       
Query: 328 ttgacgaacgactngcggctgaagagagcctnggngtaggcatggacgctggtcagtgtt 387
           |||||||| || |  |||||||| ||||||| || ||||||||||||||||||||| |||
Sbjct: 140 ttgacgaaggattcccggctgaacagagccttggtgtaggcatggacgctggtcagggtt 81

                                                                   
Query: 388 tcagggaccttccagcctttgaagtgctccanggcaacctggaggtggaagagctt 443
           || ||||||||||| |||||||| ||||||| |||||||||||| |||||||||||
Sbjct: 80  tcggggaccttccatcctttgaaatgctccagggcaacctggagatggaagagctt 25

>gb|DQ093638.1| Eustoma grandiflorum dehydroascorbate reductase protein mRNA,
           partial cds
          Length = 195

 Score =  208 bits (105), Expect = 1e-50
 Identities = 153/171 (89%)
 Strand = Plus / Minus

                                                                       
Query: 273 cgggttcaccttcggcgcccacccggcgatcangttctncttggtcggcttggtcttgac 332
           ||||||||| || |||||||| |||||||||| ||||| |||||| ||||||||||||||
Sbjct: 195 cgggttcactttgggcgcccatccggcgatcaggttctccttggtgggcttggtcttgac 136

                                                                       
Query: 333 gaacgactngcggctgaagagagcctnggngtaggcatggacgctggtcagtgtttcagg 392
           ||| || |  |||||||| ||||||| || ||||||||||||||||||||| ||||||||
Sbjct: 135 gaaggattcccggctgaacagagccttggtgtaggcatggacgctggtcagggtttcagg 76

                                                              
Query: 393 gaccttccagcctttgaagtgctccanggcaacctggaggtggaagagctt 443
           ||||||||| |||||||| ||||||| |||||||||||| |||||||||||
Sbjct: 75  gaccttccatcctttgaaatgctccagggcaacctggagatggaagagctt 25

>emb|AJ622892.1| Triticum durum partial mRNA for DRP5 protein (drg5 gene)
          Length = 478

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 61/66 (92%)
 Strand = Plus / Plus

                                                                       
Query: 379 gtcagtgtttcagggaccttccagcctttgaagtgctccanggcaacctggaggtggaag 438
           ||||| |||||||||||||||||||| ||||||||||||| ||| |||||||||||| ||
Sbjct: 1   gtcagggtttcagggaccttccagcccttgaagtgctccagggcgacctggaggtggtag 60

                 
Query: 439 agcttc 444
           ||||||
Sbjct: 61  agcttc 66

>gb|AY106435.1| Zea mays PCO106999 mRNA sequence
          Length = 1141

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 134/167 (80%)
 Strand = Plus / Minus

                                                                       
Query: 277 ttcaccttcggcgcccacccggcgatcangttctncttggtcggcttggtcttgacgaac 336
           |||||||| |||||||| || || |||| || || || ||  ||||| |||||||| || 
Sbjct: 728 ttcaccttgggcgcccatcccgcaatcacgtgctcctcggatggcttagtcttgacaaaa 669

                                                                       
Query: 337 gactngcggctgaagagagcctnggngtaggcatggacgctggtcagtgtttcagggacc 396
           || |  |||||||| ||||||| || |||||| |||||| |||| ||  |||| |||| |
Sbjct: 668 gattcacggctgaaaagagccttggtgtaggcgtggacgttggttaggttttctgggatc 609

                                                          
Query: 397 ttccagcctttgaagtgctccanggcaacctggaggtggaagagctt 443
           |||||||||||||| |||||||  || | ||| |||||||| |||||
Sbjct: 608 ttccagcctttgaaatgctccagtgcgatctgtaggtggaaaagctt 562

>gb|AC078977.6| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0496H07,
             complete sequence
          Length = 164477

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                  
Query: 391   gggaccttccagcctttgaagtgctccanggcaacctggaggtggaagagctt 443
             |||| ||||||||||||||| |||||||  ||||||||||| ||| |||||||
Sbjct: 50721 gggatcttccagcctttgaaatgctccagagcaacctggagatggtagagctt 50773

>gb|AC108504.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1654_B10,
              complete sequence
          Length = 140282

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                   
Query: 391    gggaccttccagcctttgaagtgctccanggcaacctggaggtggaagagctt 443
              |||| ||||||||||||||| |||||||  ||||||||||| ||| |||||||
Sbjct: 118740 gggatcttccagcctttgaaatgctccagagcaacctggagatggtagagctt 118792

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5,
              complete sequence
          Length = 29737217

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 47/53 (88%)
 Strand = Plus / Plus

                                                                   
Query: 391    gggaccttccagcctttgaagtgctccanggcaacctggaggtggaagagctt 443
              |||| ||||||||||||||| |||||||  ||||||||||| ||| |||||||
Sbjct: 846298 gggatcttccagcctttgaaatgctccagagcaacctggagatggtagagctt 846350

>gb|AY074786.1| Oryza sativa dehydroascorbate reductase (DHAR) mRNA, complete cds
          Length = 1067

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 391 gggaccttccagcctttgaagtgctccanggcaacctggaggtggaagagctt 443
           |||| ||||||||||||||| |||||||  ||||||||||| ||| |||||||
Sbjct: 600 gggatcttccagcctttgaaatgctccagagcaacctggagatggtagagctt 548

>dbj|AK070895.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023074C02, full
           insert sequence
          Length = 1198

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 391 gggaccttccagcctttgaagtgctccanggcaacctggaggtggaagagctt 443
           |||| ||||||||||||||| |||||||  ||||||||||| ||| |||||||
Sbjct: 601 gggatcttccagcctttgaaatgctccagagcaacctggagatggtagagctt 549

>dbj|AK061836.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-D08, full
           insert sequence
          Length = 1053

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 391 gggaccttccagcctttgaagtgctccanggcaacctggaggtggaagagctt 443
           |||| ||||||||||||||| |||||||  ||||||||||| ||| |||||||
Sbjct: 605 gggatcttccagcctttgaaatgctccagagcaacctggagatggtagagctt 553

>dbj|AB037970.1| Oryza sativa (japonica cultivar-group) DHAR1 mRNA for GSH-dependent
           dehydroascorbate reductase 1, complete cds
          Length = 1044

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 391 gggaccttccagcctttgaagtgctccanggcaacctggaggtggaagagctt 443
           |||| ||||||||||||||| |||||||  ||||||||||| ||| |||||||
Sbjct: 570 gggatcttccagcctttgaaatgctccagagcaacctggagatggtagagctt 518

>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome
          Length = 2560265

 Score = 44.1 bits (22), Expect = 0.38
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 315     ggtcggcttggtcttgacgaacgact 340
               ||||||| ||||||||||||||||||
Sbjct: 1119794 ggtcggcctggtcttgacgaacgact 1119769

>gb|AC109221.32| Mus musculus chromosome 7, clone RP23-207N2, complete sequence
          Length = 195657

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 83    agccaggcagggggcagacag 103
             |||||||||||||||||||||
Sbjct: 71257 agccaggcagggggcagacag 71277

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 272    acgggttcaccttcggcgccc 292
              |||||||||||||||||||||
Sbjct: 209716 acgggttcaccttcggcgccc 209736

>gb|AC168056.3| Mus musculus BAC clone RP24-189B1 from chromosome 13, complete sequence
          Length = 179458

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 425   cctggaggtggaagagcttc 444
             ||||||||||||||||||||
Sbjct: 51516 cctggaggtggaagagcttc 51497

>ref|XM_366481.1| Magnaporthe grisea 70-15 chromosome VII predicted protein
           (MG02557.4) partial mRNA
          Length = 966

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 318 cggcttggtcttgacgaacg 337
           ||||||||||||||||||||
Sbjct: 216 cggcttggtcttgacgaacg 197

>ref|XM_714685.1| Candida albicans SC5314 hypothetical protein (CaO19_14092), mRNA
          Length = 1569

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 210  tactactgccatcactactggcac 233
            ||||||||||| ||||||||||||
Sbjct: 1363 tactactgccagcactactggcac 1340

>ref|XM_714802.1| Candida albicans SC5314 hypothetical protein (CaO19_6800), mRNA
          Length = 1569

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 210  tactactgccatcactactggcac 233
            ||||||||||| ||||||||||||
Sbjct: 1363 tactactgccagcactactggcac 1340

>gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete sequence
          Length = 161430

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 130    caggcagagcacacagcaga 149
              ||||||||||||||||||||
Sbjct: 111810 caggcagagcacacagcaga 111829

>gb|AC063918.21| Homo sapiens 3 BAC RP11-49C18 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 97001

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 386   tttcagggaccttccagcct 405
             ||||||||||||||||||||
Sbjct: 18007 tttcagggaccttccagcct 17988

>emb|BX088727.14| Zebrafish DNA sequence from clone DKEY-218A22 in linkage group 2,
             complete sequence
          Length = 185178

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 156   ctcgcattattccaaaccca 175
             ||||||||||||||||||||
Sbjct: 28852 ctcgcattattccaaaccca 28833

>emb|Z84494.1|HSLUCA7 Human DNA sequence from clone XXcos-7 on chromosome 3, complete
             sequence
          Length = 16950

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 83    agccaggcagggggcagaca 102
             ||||||||||||||||||||
Sbjct: 12882 agccaggcagggggcagaca 12863


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,405,458
Number of Sequences: 3902068
Number of extensions: 2405458
Number of successful extensions: 45518
Number of sequences better than 10.0: 23
Number of HSP's better than 10.0 without gapping: 23
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 45429
Number of HSP's gapped (non-prelim): 89
length of query: 444
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 422
effective length of database: 17,147,199,772
effective search space: 7236118303784
effective search space used: 7236118303784
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)