Clone Information

BLAST Search Result

Clone Name	rbasd20b13
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	emb\|Z48624.1\|HVGRP3 H.vulgare mRNA for glycine-rich RNA binding ...	541	e-151
2	gb\|U32310.1\|TAU32310 Triticum aestivum single-stranded nucleic a...	66	8e-08
3	gb\|AC084310.16\| Mus musculus chromosome 1, clone RP23-10C10, com...	46	0.071
4	emb\|AL929389.9\| Zebrafish DNA sequence from clone CH211-51H4 in ...	46	0.071
5	gb\|AC011774.9\| Homo sapiens chromosome 18, clone RP11-380C8, com...	46	0.071
6	gb\|AC015878.7\| Homo sapiens, clone RP11-296E23, complete sequence	46	0.071
7	emb\|BX571944.15\| Zebrafish DNA sequence from clone RP71-84D1 in ...	46	0.071
8	gb\|AC173483.1\| Mus musculus BAC clone RP23-281C13 from chromosom...	46	0.071
9	gb\|AC153907.1\| Mus musculus BAC RP23-205F6 (Roswell Park Cancer...	44	0.28
10	gb\|AC153985.4\| Mus musculus 6 BAC RP24-507D15 (Roswell Park Canc...	44	0.28
11	gb\|AC098570.7\| Mus musculus chromosome 1, clone RP23-278N11, com...	44	0.28
12	gb\|AC167724.6\| Mus musculus 10 BAC RP23-331P17 (Roswell Park Can...	44	0.28
13	gb\|AC132107.3\| Mus musculus BAC clone RP24-251C17 from chromosom...	44	0.28
14	gb\|AC005103.3\| Homo sapiens BAC clone CTA-357J21 from 7, complet...	44	0.28
15	emb\|BX323879.11\| Zebrafish DNA sequence from clone DKEY-30L21 in...	44	0.28
16	emb\|CR388060.19\| Zebrafish DNA sequence from clone DKEY-208J8 in...	44	0.28
17	gb\|AC127552.3\| Mus musculus BAC clone RP24-550N13 from chromosom...	44	0.28
18	gb\|AC122465.4\| Mus musculus BAC clone RP24-304I22 from chromosom...	44	0.28
19	gb\|AF047825.1\| Homo sapiens PAC 50H2 in the CUTL1 locus, complet...	44	0.28
20	gb\|AC150314.5\| Mus musculus BAC clone RP23-269O24 from chromosom...	44	0.28
21	emb\|AL139041.17\| Human DNA sequence from clone RP11-408O19 on ch...	44	0.28
22	emb\|CR384099.6\| Zebrafish DNA sequence from clone DKEY-266I18 in...	44	0.28
23	emb\|BX324145.12\| Zebrafish DNA sequence from clone CH211-207C13 ...	44	0.28
24	emb\|BX897657.8\| Zebrafish DNA sequence from clone DKEYP-84C2, co...	44	0.28
25	emb\|BX323883.14\| Zebrafish DNA sequence from clone CH211-285M21 ...	44	0.28
26	dbj\|AB072928.1\| Oryzias latipes olmt2-mmp mRNA for membrane-type...	44	0.28
27	dbj\|BS000234.1\| Pan troglodytes chromosome 22 clone:PTB-190I13, ...	44	0.28
28	gb\|AC155327.3\| Mus musculus 6 BAC RP24-176G23 (Roswell Park Canc...	44	0.28
29	emb\|BX284684.8\| Zebrafish DNA sequence from clone DKEY-14I10 in ...	44	0.28
30	emb\|CT030184.14\| Mouse DNA sequence from clone RP23-9C19 on chro...	44	0.28
31	emb\|CR388128.18\| Zebrafish DNA sequence from clone CH211-127B17 ...	44	0.28
32	emb\|BX927218.17\| Zebrafish DNA sequence from clone DKEY-14O18 in...	44	0.28
33	emb\|AL606705.23\| Zebrafish DNA sequence from clone BUSM1-175P5 i...	44	0.28
34	gb\|AC109256.11\| Mus musculus chromosome 8, clone RP23-11D11, com...	44	0.28
35	gb\|AC107689.7\| Mus musculus chromosome 3, clone RP24-283F19, com...	44	0.28
36	dbj\|AP001751.1\| Homo sapiens genomic DNA, chromosome 21q, sectio...	44	0.28
37	gb\|AC008734.7\| Homo sapiens chromosome 19 clone CTD-2529P6, comp...	44	0.28
38	emb\|CT030166.8\| Mouse DNA sequence from clone RP23-320I11 on chr...	44	0.28
39	emb\|CR848667.23\| Zebrafish DNA sequence from clone CH211-257P13 ...	44	0.28
40	emb\|AL935289.4\| Zebrafish DNA sequence from clone CH211-232C12, ...	44	0.28
41	emb\|AL773564.8\| Zebrafish DNA sequence from clone CH211-204C7, c...	44	0.28
42	gb\|AC171970.3\| Mus musculus BAC RP23-116G8 (Roswell Park Cancer...	44	0.28
43	emb\|AL603843.15\| Mouse DNA sequence from clone RP23-412D17 on ch...	44	0.28
44	dbj\|AP001046.1\| Homo sapiens genomic DNA, chromosome 21, clone:K...	44	0.28
45	gb\|AC102381.12\| Mus musculus chromosome 8, clone RP24-180I19, co...	42	1.1
46	gb\|AC152076.4\| Mus musculus BAC clone RP23-326O10 from chromosom...	42	1.1
47	gb\|AC161528.14\| Mus musculus chromosome 8, clone RP23-369H18, co...	42	1.1
48	gb\|AC164398.8\| Mus musculus chromosome 7, clone RP23-307M24, com...	42	1.1
49	gb\|AC119252.10\| Mus musculus chromosome 8, clone RP24-279M13, co...	42	1.1
50	gb\|AC093353.11\| Mus musculus chromosome 10, clone RP23-19C22, co...	42	1.1
51	gb\|AC150916.3\| Bos taurus BAC CH240-309L24 (Children's Hospital...	42	1.1
52	gb\|AC149679.2\| Bos taurus BAC CH240-27A8 (Children's Hospital O...	42	1.1
53	gb\|AF241735.2\| Homo sapiens chromosome X clone CTD-2324A24 map p...	42	1.1
54	gb\|AF241734.2\| Homo sapiens chromosome X clone RP1-34M10 map p11...	42	1.1
55	gb\|AC091810.4\| Homo sapiens chromosome X clone CTD-2324A24 map p...	42	1.1
56	gb\|AC150412.2\| Branchiostoma floridae clone CH302-60C21, complet...	42	1.1
57	gb\|AC147337.3\| Pan troglodytes BAC clone CH251-104M9 from Y, com...	42	1.1
58	gb\|AC147977.2\| Pan troglodytes BAC clone CH251-486H24 from 7, co...	42	1.1
59	gb\|AC145999.3\| Pan troglodytes BAC clone RP43-138L12 from 7, com...	42	1.1
60	gb\|AC102545.9\| Mus musculus chromosome 9, clone RP23-118J13, com...	42	1.1
61	gb\|AC159238.2\| Mus musculus BAC clone RP24-477O8 from chromosome...	42	1.1
62	gb\|AC122935.3\| Mus musculus BAC clone RP23-20E4 from chromosome ...	42	1.1
63	gb\|AC124449.3\| Mus musculus BAC clone RP24-212N10 from chromosom...	42	1.1
64	emb\|BX248397.8\| Zebrafish DNA sequence from clone CH211-233H19 i...	42	1.1
65	gb\|AC146215.2\| Pan troglodytes BAC clone CH251-299B14 from Y, co...	42	1.1
66	gb\|AC134559.5\| Mus musculus BAC clone RP24-332C4 from chromosome...	42	1.1
67	gb\|AC127554.4\| Mus musculus BAC clone RP24-323K23 from chromosom...	42	1.1
68	gb\|AC134441.4\| Mus musculus BAC clone RP24-544J6 from chromosome...	42	1.1
69	gb\|AC133100.5\| Mus musculus BAC clone RP23-98O11 from chromosome...	42	1.1
70	emb\|CR536619.20\| Zebrafish DNA sequence from clone CH211-194H19 ...	42	1.1
71	gb\|AC124381.4\| Mus musculus BAC clone RP24-406E24 from chromosom...	42	1.1
72	gb\|AC124415.4\| Mus musculus BAC clone RP24-298J2 from chromosome...	42	1.1
73	emb\|CR854834.11\| Zebrafish DNA sequence from clone DKEYP-92B10 i...	42	1.1
74	gb\|AC124578.4\| Mus musculus BAC clone RP23-166C2 from 18, comple...	42	1.1
75	gb\|AC123061.4\| Mus musculus BAC clone RP23-216H22 from 14, compl...	42	1.1
76	gb\|AC122830.4\| Mus musculus BAC clone RP23-224I23 from 8, comple...	42	1.1
77	emb\|CR759824.9\| Zebrafish DNA sequence from clone DKEY-81E3 in l...	42	1.1
78	emb\|CR407547.14\| Zebrafish DNA sequence from clone DKEY-62A12 in...	42	1.1
79	gb\|AC117185.2\| Mus musculus BAC clone RP23-37M7 from 8, complete...	42	1.1
80	gb\|AC005019.1\| Homo sapiens BAC clone GS1-250A16 from 7, complet...	42	1.1
81	emb\|CR700058.2\|CNS0G346 Tetraodon nigroviridis full-length cDNA	42	1.1
82	emb\|CR693293.2\|CNS0FXW9 Tetraodon nigroviridis full-length cDNA	42	1.1
83	emb\|CR685962.2\|CNS0FS8M Tetraodon nigroviridis full-length cDNA	42	1.1
84	emb\|CR690080.2\|CNS0FVF0 Tetraodon nigroviridis full-length cDNA	42	1.1
85	emb\|CR687426.2\|CNS0FTDA Tetraodon nigroviridis full-length cDNA	42	1.1
86	gb\|AC069285.8\| Homo sapiens BAC clone RP11-196D18 from 7, comple...	42	1.1
87	gb\|AC159140.10\| Mus musculus chromosome 7, clone RP24-84I4, comp...	42	1.1
88	gb\|AC145925.2\| Pan troglodytes BAC clone RP43-40L5 from 7, compl...	42	1.1
89	emb\|AL163280.2\|HS21C080 Homo sapiens chromosome 21 segment HS21C080	42	1.1
90	emb\|CR855321.8\| Zebrafish DNA sequence from clone CH211-87E10 in...	42	1.1
91	emb\|Z68323.2\|HSN13G6 Human DNA sequence from clone LL22NC03-13G6...	42	1.1
92	emb\|Z82202.1\|HS34P24 Human DNA sequence from clone RP1-34P24 on ...	42	1.1
93	emb\|BX649443.16\| Human DNA sequence from clone CTD-2589D3 on chr...	42	1.1
94	emb\|AL355591.13\| Human DNA sequence from clone RP11-300B7 on chr...	42	1.1
95	emb\|AL355809.11\| Human DNA sequence from clone RP4-650K8 on chro...	42	1.1
96	gb\|AF235104.5\| Homo sapiens chromosome 8 clone GS1-251I7 map p21...	42	1.1
97	emb\|AL109828.22\|HSJ586J11 Human DNA sequence from clone RP4-586J...	42	1.1
98	emb\|BX890581.13\| Zebrafish DNA sequence from clone CH211-222O19 ...	42	1.1
99	emb\|BX323824.17\| Zebrafish DNA sequence from clone DKEY-37F18 in...	42	1.1
100	gb\|AC175363.2\| Pan troglodytes chromosome X clone CH251-7A1 map ...	42	1.1
101	gb\|AC118283.5\| Homo sapiens BAC clone RP11-1398P2 from 4, comple...	42	1.1
102	emb\|AL596215.7\| Mouse DNA sequence from clone RP23-278I21 on chr...	42	1.1
103	gb\|AC153146.5\| Mus musculus BAC clone RP23-217F11 from chromosom...	42	1.1
104	emb\|AL845512.9\| Zebrafish DNA sequence from clone CH211-286M4 in...	42	1.1
105	gb\|AC103758.14\| Homo sapiens chromosome 8, clone CTD-3135A9, com...	42	1.1
106	gb\|AC136964.2\| Sus scrofa domestica clone RP44-154L9, complete s...	42	1.1
107	emb\|BX927303.11\| Zebrafish DNA sequence from clone CH211-67L13 i...	42	1.1
108	emb\|BX571701.10\| Zebrafish DNA sequence from clone CH211-233M11 ...	42	1.1
109	emb\|CR385074.10\| Zebrafish DNA sequence from clone CH211-258K6 i...	42	1.1
110	gb\|AC157561.10\| Mus musculus chromosome 7, clone RP23-356A20, co...	42	1.1
111	emb\|BX571949.19\| Zebrafish DNA sequence from clone DKEY-25F1 in ...	42	1.1
112	emb\|BX901978.14\| Zebrafish DNA sequence from clone DKEY-155M6 in...	42	1.1
113	emb\|AL929566.30\| Zebrafish DNA sequence from clone CH211-159C13 ...	42	1.1
114	emb\|BX469920.6\| Zebrafish DNA sequence from clone DKEY-237J21 in...	42	1.1
115	emb\|BX510999.11\| Zebrafish DNA sequence from clone CH211-157P22 ...	42	1.1
116	emb\|CR382344.9\| Zebrafish DNA sequence from clone DKEY-150D12 in...	42	1.1
117	dbj\|BS000598.1\| Pan troglodytes chromosome Y clone:PTB-224I01, c...	42	1.1
118	gb\|DP000054.1\| Pan troglodytes chromosome Y, partial sequence	42	1.1
119	gb\|AC011499.5\| Homo sapiens chromosome 19 clone CTB-54O9, comple...	42	1.1
120	emb\|BX470133.27\| Zebrafish DNA sequence from clone DKEY-169N7 in...	42	1.1
121	gb\|AC021553.14\| Homo sapiens chromosome 15, clone RP11-709B3, co...	42	1.1
122	gb\|AC158604.5\| Mus musculus 10 BAC RP23-130B2 (Roswell Park Canc...	42	1.1
123	gb\|AC091988.3\| Homo sapiens chromosome 5 clone RP11-73G8, comple...	42	1.1
124	gb\|AC013643.10\| Homo sapiens chromosome 8, clone RP11-16P20, com...	42	1.1
125	gb\|AC022832.13\| Homo sapiens chromosome 8, clone RP11-145O15, co...	42	1.1
126	emb\|BX324129.11\| Zebrafish DNA sequence from clone CH211-221D5 i...	42	1.1
127	gb\|AC182231.2\| Mus musculus BAC clone RP23-356C18 from chromosom...	42	1.1
128	gb\|AC157511.2\| Mus musculus BAC clone RP24-456J10 from chromosom...	42	1.1
129	gb\|AC101979.13\| Mus musculus chromosome 3, clone RP24-338A7, com...	42	1.1
130	gb\|AC096627.28\| Mus musculus strain C57BL/6J clone rp23-77b23 ma...	42	1.1
131	gb\|AC153579.10\| Mus musculus 6 BAC RP23-21F2 (Roswell Park Cance...	42	1.1
132	dbj\|AK086407.1\| Mus musculus 15 days embryo head cDNA, RIKEN ful...	42	1.1
133	dbj\|AK037455.1\| Mus musculus 16 days neonate thymus cDNA, RIKEN ...	42	1.1
134	emb\|BX323039.6\| Zebrafish DNA sequence from clone CH211-145A11 i...	42	1.1
135	gb\|AC090386.13\| Homo sapiens chromosome 18, clone RP11-797E24, c...	42	1.1
136	gb\|AC107739.9\| Mus musculus chromosome 7, clone RP23-345M1, comp...	42	1.1
137	gb\|AC154876.7\| Mus musculus chromosome 3, clone RP23-190D19, com...	42	1.1
138	gb\|AC147067.4\| Homo sapiens BAC clone RP13-1016M1 from 4, comple...	42	1.1
139	gb\|AC007879.4\| Homo sapiens BAC clone RP11-309L6 from 2, complet...	42	1.1
140	gb\|AC015974.10\| Homo sapiens BAC clone RP11-467A18 from 2, compl...	42	1.1
141	gb\|AC005479.2\|AC005479 Homo sapiens PAC clone RP3-449M8 from 14q...	42	1.1
142	gb\|AC087557.20\| Mus musculus strain C57BL/6J chromosome 9 clone ...	42	1.1
143	gb\|AF456419.1\| Takifugu rubripes PDGFRalpha (PDGFRalpha) gene, c...	42	1.1
144	gb\|AC096678.4\| Pan troglodytes clone RP43-140G16, complete sequence	42	1.1
145	gb\|AC084064.6\| Homo sapiens chromosome 16 clone RP11-467I17, com...	42	1.1
146	gb\|AC093332.10\| Homo sapiens chromosome 18, clone RP11-802O5, co...	42	1.1
147	emb\|BX088528.7\| Zebrafish DNA sequence from clone CH211-226D23 i...	42	1.1
148	emb\|BX276091.6\| Zebrafish DNA sequence from clone CH211-267P9 in...	42	1.1
149	emb\|BX248393.5\| Zebrafish DNA sequence from clone CH211-233O13, ...	42	1.1
150	emb\|BX537113.8\| Zebrafish DNA sequence from clone CH211-207G17 i...	42	1.1
151	gb\|AC153382.1\| Mus musculus 10 BAC RP23-9F3 (Roswell Park Cancer...	42	1.1
152	emb\|BX296535.7\| Zebrafish DNA sequence from clone CH211-234I2, c...	42	1.1
153	gb\|AC117735.8\| Mus musculus chromosome 5, clone RP24-132L16, com...	42	1.1
154	emb\|CT025582.12\| Zebrafish DNA sequence from clone DKEY-220G3 in...	42	1.1
155	emb\|CR931778.23\| Zebrafish DNA sequence from clone DKEY-265O4 in...	42	1.1
156	emb\|CR790375.9\| Zebrafish DNA sequence from clone CH211-251O16 i...	42	1.1
157	emb\|CR846099.7\| Zebrafish DNA sequence from clone DKEY-182M23 in...	42	1.1
158	emb\|CR751229.6\| Zebrafish DNA sequence from clone CH211-116I17 i...	42	1.1
159	emb\|BX927361.31\| Zebrafish DNA sequence from clone CH211-121K8 i...	42	1.1
160	emb\|CR387935.16\| Zebrafish DNA sequence from clone CH211-212O1 i...	42	1.1
161	emb\|CR382286.9\| Zebrafish DNA sequence from clone CH211-12J10 in...	42	1.1
162	emb\|BX649350.9\| Zebrafish DNA sequence from clone CH211-161F1 in...	42	1.1
163	emb\|CR318592.7\| Zebrafish DNA sequence from clone CH211-51F17 in...	42	1.1
164	emb\|BX890545.7\| Zebrafish DNA sequence from clone CH211-253N4 in...	42	1.1
165	emb\|BX901967.4\| Zebrafish DNA sequence from clone CH211-195J16 i...	42	1.1
166	emb\|BX247873.15\| Zebrafish DNA sequence from clone CH211-198O12 ...	42	1.1
167	emb\|AL953910.14\| Zebrafish DNA sequence from clone DKEY-31E10 in...	42	1.1
168	emb\|AL935282.14\| Zebrafish DNA sequence from clone CH211-281O21 ...	42	1.1
169	emb\|BX469898.9\| Zebrafish DNA sequence from clone DKEY-180H12 in...	42	1.1
170	emb\|AL845365.9\| Zebrafish DNA sequence from clone DKEY-150H13 in...	42	1.1
171	emb\|BX470240.8\| Zebrafish DNA sequence from clone CH211-92L17 in...	42	1.1
172	emb\|BX511140.4\| Zebrafish DNA sequence from clone DKEY-264G21 in...	42	1.1
173	emb\|AL590148.8\| Zebrafish DNA sequence from clone RP71-30I22 in ...	42	1.1
174	emb\|CR848722.7\| Zebrafish DNA sequence from clone CH211-253H1 in...	42	1.1
175	emb\|BX927333.11\| Zebrafish DNA sequence from clone CH211-69C15 i...	42	1.1
176	gb\|AC158127.3\| Mus musculus chromosome 19, clone RP23-135N12, co...	42	1.1
177	emb\|AL352976.3\|CNS05TBV Human chromosome 14 DNA sequence BAC R-4...	42	1.1
178	emb\|BX629356.1\|CNS09SBW Tetraodon nigroviridis BAC sequence	42	1.1
179	emb\|BX296559.14\| Zebrafish DNA sequence from clone CH211-285F17 ...	42	1.1
180	emb\|CR548632.13\| Zebrafish DNA sequence from clone DKEY-175H17 i...	42	1.1
181	emb\|AL928856.5\| Mouse DNA sequence from clone RP23-413G24 on chr...	42	1.1
182	gb\|AC005796.1\|AC005796 Homo sapiens chromosome 19, cosmid R31408...	42	1.1
183	emb\|AL954327.12\| Zebrafish DNA sequence from clone DKEY-18H14 in...	42	1.1
184	emb\|CR854829.14\| Zebrafish DNA sequence from clone DKEY-285B23 i...	42	1.1
185	emb\|AL807828.14\| Mouse DNA sequence from clone RP23-184N11 on ch...	42	1.1
186	emb\|AL935202.7\| Zebrafish DNA sequence from clone CH211-197E11, ...	42	1.1
187	emb\|AL732611.21\| Mouse DNA sequence from clone RP23-135A21 on ch...	42	1.1
188	emb\|CR456684.10\| Zebrafish DNA sequence from clone DKEY-46I8 in ...	42	1.1
189	gb\|AC159826.1\| Gallus gallus BAC clone CH261-57J20 from chromoso...	42	1.1
190	emb\|AL929124.13\| Zebrafish DNA sequence from clone CH211-128D23,...	42	1.1
191	emb\|AL953866.5\| Zebrafish DNA sequence from clone DKEY-60I9 in l...	42	1.1
192	emb\|AL807818.14\| Zebrafish DNA sequence from clone CH211-225H24,...	42	1.1
193	emb\|AL772300.10\| Zebrafish DNA sequence from clone CH211-165G14,...	42	1.1
194	gb\|AC108836.23\| Mus musculus chromosome 19, clone RP23-276L15, c...	42	1.1
195	emb\|AL645547.14\| Mouse DNA sequence from clone RP23-158M12 on ch...	42	1.1
196	emb\|AL732590.7\| Mouse DNA sequence from clone RP23-464C2 on chro...	42	1.1
197	emb\|AJ279975.1\|CFA279975 Canis familiaris microsatellite DNA, cl...	42	1.1
198	gb\|AC117789.17\| Mus musculus chromosome 1, clone RP24-548D18, co...	42	1.1
199	gb\|AF121897.4\| Homo sapiens chromosome 21 clone RP1-160L9 map 21...	42	1.1
200	dbj\|AP003496.1\| Homo sapiens genomic DNA, chromosome 8q23, clone...	42	1.1
201	dbj\|AP003494.1\| Homo sapiens genomic DNA, chromosome 8q23, clone...	42	1.1
202	emb\|AL627342.15\| Mouse DNA sequence from clone RP23-281G20 on ch...	42	1.1
203	emb\|AL645668.15\| Mouse DNA sequence from clone RP23-32L21 on chr...	42	1.1
204	gb\|AC110244.10\| Mus musculus chromosome 5, clone RP23-247E10, co...	40	4.4
205	gb\|AC115947.8\| Mus musculus chromosome 5, clone RP24-560A18, com...	40	4.4
206	gb\|AC114663.8\| Mus musculus chromosome 1, clone RP24-172O22, com...	40	4.4
207	gb\|AC154262.1\| Mus musculus chromosome 14 clone RP24-304G19, com...	40	4.4
208	gb\|AC108429.11\| Mus musculus chromosome 7, clone RP23-161B5, com...	40	4.4
209	gb\|AC102892.9\| Mus musculus chromosome 5, clone RP24-362B10, com...	40	4.4
210	gb\|AC171406.3\| Mus musculus BAC RP24-475O6 (Roswell Park Cancer...	40	4.4
211	gb\|AC129545.5\| Mus musculus chromosome 1, clone RP23-264E23, com...	40	4.4
212	gb\|AC131995.14\| Mus musculus chromosome 1, clone RP24-338G10, co...	40	4.4
213	gb\|AC165157.4\| Mus musculus BAC clone RP23-267A24 from chromosom...	40	4.4
214	gb\|AC131747.5\| Mus musculus BAC clone RP23-36O24 from chromosome...	40	4.4
215	gb\|AC102457.11\| Mus musculus chromosome 19, clone RP24-312C18, c...	40	4.4
216	gb\|AC166991.5\| Mus musculus BAC clone RP24-91J15 from chromosome...	40	4.4
217	gb\|AC167972.3\| Mus musculus BAC clone RP24-73H24 from chromosome...	40	4.4
218	gb\|AC166821.2\| Mus musculus BAC clone RP24-68F22 from chromosome...	40	4.4
219	gb\|AC166158.3\| Mus musculus BAC clone RP24-244P14 from chromosom...	40	4.4
220	gb\|AC139293.4\| Mus musculus BAC clone RP24-381N4 from chromosome...	40	4.4
221	gb\|AC132617.4\| Mus musculus BAC clone RP23-230A6 from chromosome...	40	4.4
222	gb\|AC123952.5\| Mus musculus BAC clone RP23-195B3 from chromosome...	40	4.4
223	gb\|AC167126.6\| Mus musculus chromosome 1, clone RP24-104I19, com...	40	4.4
224	gb\|AC158803.11\| Mus musculus 10 BAC RP24-186E11 (Roswell Park Ca...	40	4.4
225	gb\|AC163020.9\| Mus musculus chromosome 7, clone RP23-36L11, comp...	40	4.4
226	gb\|AC119874.12\| Mus musculus chromosome 8, clone RP24-289B21, co...	40	4.4
227	gb\|AC161516.9\| Mus musculus chromosome 5, clone RP23-130C18, com...	40	4.4
228	gb\|AC164410.5\| Mus musculus chromosome 5, clone RP23-6J21, compl...	40	4.4
229	gb\|AC167232.5\| Mus musculus BAC RP24-496C19 (Roswell Park Cance...	40	4.4
230	gb\|AC125267.18\| Mus musculus chromosome 10, clone RP24-483E18, c...	40	4.4
231	gb\|AC161412.10\| Mus musculus chromosome 7, clone RP24-78I5, comp...	40	4.4
232	gb\|AC168273.3\| Mus musculus BAC RP23-184H4 (Roswell Park Cancer...	40	4.4
233	gb\|BT018915.1\| Zea mays clone EL01T0403H03.d mRNA sequence	40	4.4
234	gb\|AC113547.27\| Mus musculus chromosome 12, clone RP23-263J2, co...	40	4.4
235	gb\|AC115930.10\| Mus musculus chromosome 3, clone RP24-534H10, co...	40	4.4
236	gb\|AC137110.11\| Mus musculus chromosome 7, clone RP23-399P8, com...	40	4.4
237	gb\|AY591719.1\| Mus musculus clone IgKVk4-58 immunoglobulin kappa...	40	4.4
238	gb\|AC162171.7\| Mus musculus chromosome 5, clone RP23-143N11, com...	40	4.4
239	gb\|AY368673.1\| Triticum turgidum HMW-glutenin locus, complete se...	40	4.4
240	gb\|AY225963.1\| Lymnaea stagnalis microsatellite D5 sequence	40	4.4
241	gb\|AY024069.1\| Oryza sativa microsatellite MRG6394 containing (G...	40	4.4
242	gb\|AC138210.10\| Mus musculus chromosome 1, clone RP23-346B12, co...	40	4.4
243	gb\|AY258673.1\| Xiphophorus maculatus microsatellite Msd027 sequence	40	4.4
244	gb\|AC093481.8\| Mus musculus chromosome 18, clone RP23-62E19, com...	40	4.4
245	gb\|AC165170.2\| Mus musculus BAC clone CH25-458O4 from chromosome...	40	4.4
246	gb\|AC164622.3\| Mus musculus BAC clone CH36-287E13 from chromosom...	40	4.4
247	gb\|AC156576.3\| Mus musculus BAC clone RP23-7C22 from chromosome ...	40	4.4
248	gb\|AC165091.3\| Mus musculus BAC clone RP23-25M19 from chromosome...	40	4.4
249	gb\|AC166357.3\| Mus musculus BAC clone RP23-360N1 from chromosome...	40	4.4
250	gb\|AC164096.3\| Mus musculus BAC clone RP23-356H17 from chromosom...	40	4.4
251	gb\|AC161480.9\| Mus musculus chromosome 15, clone RP23-404I10, co...	40	4.4
252	gb\|AC167221.9\| Mus musculus 10 BAC RP23-3P24 (Roswell Park Cance...	40	4.4
253	gb\|AC166082.11\| Mus musculus 10 BAC RP23-150M2 (Roswell Park Can...	40	4.4
254	gb\|AC108504.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	4.4
255	gb\|AC107452.10\| Mus musculus chromosome 15, clone RP23-236C21, c...	40	4.4
256	gb\|AC102090.14\| Mus musculus chromosome 1, clone RP23-7I3, compl...	40	4.4
257	gb\|AC123746.20\| Mus musculus chromosome 1, clone RP24-122E21, co...	40	4.4
258	gb\|AC105324.11\| Mus musculus chromosome 15, clone RP24-311E18, c...	40	4.4
259	gb\|AC008345.4\| Drosophila melanogaster clone BACR22J12, complete...	40	4.4
260	gb\|AC146430.4\| Pan troglodytes BAC clone RP43-21F8 from 7, compl...	40	4.4
261	gb\|AC008346.6\| Drosophila melanogaster clone BACR45K04, complete...	40	4.4
262	gb\|AC108879.3\| Homo sapiens chromosome X clone RP11-265P11 map p...	40	4.4
263	gb\|AC091808.4\| Homo sapiens chromosome X clone RP11-157D23 map p...	40	4.4
264	gb\|AC119982.6\| Mus musculus chromosome 19, clone RP24-498L9, com...	40	4.4
265	gb\|AC115706.7\| Mus musculus chromosome 8, clone RP23-382B3, comp...	40	4.4
266	gb\|AC012297.12\| Mus musculus chromosome 7, clone RP23-78H9, comp...	40	4.4
267	gb\|AC146610.4\| Mus musculus BAC clone RP23-68E7 from chromosome ...	40	4.4
268	gb\|AC130828.4\| Mus musculus BAC clone RP23-406H14 from chromosom...	40	4.4
269	gb\|AC142145.3\| Mus musculus BAC clone RP24-69D13 from chromosome...	40	4.4
270	gb\|AC132119.2\| Mus musculus BAC clone RP23-467E2 from chromosome...	40	4.4
271	gb\|AC112155.3\| Mus musculus BAC clone RP24-100G17 from chromosom...	40	4.4
272	gb\|AC132355.4\| Mus musculus BAC clone RP24-114M18 from chromosom...	40	4.4
273	gb\|AC111109.6\| Mus musculus chromosome 1, clone RP23-199D23, com...	40	4.4
274	gb\|AC134735.3\| Rattus norvegicus 20 BAC CH230-1P16 (Children's H...	40	4.4
275	gb\|AC098598.2\| Oryza sativa (japonica cultivar-group) chromosome...	40	4.4
276	gb\|AC125221.4\| Mus musculus BAC clone RP23-74N13 from chromosome...	40	4.4
277	gb\|AC134442.4\| Mus musculus BAC clone RP24-104I4 from chromosome...	40	4.4
278	gb\|AC122006.3\| Mus musculus BAC clone RP24-344B12 from chromosom...	40	4.4
279	gb\|AC127546.4\| Mus musculus BAC clone RP24-485N8 from chromosome...	40	4.4
280	gb\|AC134569.4\| Mus musculus BAC clone RP24-240H21 from chromosom...	40	4.4
281	gb\|AY329626.1\| Mus musculus microsomal glutathione S-transferase...	40	4.4
282	gb\|AC146408.3\| Pan troglodytes BAC clone RP43-41L7 from 7, compl...	40	4.4
283	gb\|AC129330.4\| Mus musculus BAC clone RP23-61B8 from chromosome ...	40	4.4
284	gb\|AC122895.5\| Mus musculus BAC clone RP23-69K14 from chromosome...	40	4.4
285	gb\|AC147045.2\| Mus musculus BAC clone RP23-100E5 from chromosome...	40	4.4
286	gb\|AC147566.2\| Mus musculus BAC clone RP23-106L10 from chromosom...	40	4.4
287	gb\|AC134560.5\| Mus musculus BAC clone RP24-100B13 from chromosom...	40	4.4
288	gb\|AC164402.3\| Mus musculus chromosome 15, clone RP23-463G20, co...	40	4.4
289	gb\|AC158215.3\| Mus musculus chromosome 7, clone RP24-180E12, com...	40	4.4
290	gb\|AC126421.12\| Mus musculus chromosome 1, clone RP23-167H24, co...	40	4.4
291	gb\|AC091458.5\| Mus musculus chromosome 12, clone RP23-68M8, comp...	40	4.4
292	gb\|AC152166.4\| Mus musculus BAC clone RP23-425A3 from chromosome...	40	4.4
293	gb\|AC144702.2\| Danio rerio clone CH211-138D14, complete sequence	40	4.4
294	gb\|AF235096.5\| Homo sapiens chromosome 8 clone RP11-562D1 map q2...	40	4.4
295	gb\|AC159888.2\| Mus musculus BAC clone RP24-133O9 from chromosome...	40	4.4
296	gb\|AC113033.13\| Mus musculus chromosome 7, clone RP23-220I5, com...	40	4.4
297	gb\|AC112675.12\| Mus musculus chromosome 1, clone RP23-138J12, co...	40	4.4
298	gb\|AC144712.2\| Danio rerio clone CH211-4G3, complete sequence	40	4.4
299	gb\|AC166939.2\| Mus musculus BAC clone RP23-72K19 from chromosome...	40	4.4
300	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	40	4.4
301	gb\|AC122746.7\| Mus musculus chromosome 17, clone RP23-144A20, co...	40	4.4
302	gb\|AC156937.4\| Mus musculus BAC clone RP23-355I5 from chromosome...	40	4.4
303	gb\|AC164086.3\| Mus musculus BAC clone RP23-25E6 from chromosome ...	40	4.4
304	gb\|AC162901.4\| Mus musculus BAC clone RP23-417K5 from chromosome...	40	4.4
305	gb\|AC141885.3\| Mus musculus BAC clone RP24-104I20 from chromosom...	40	4.4
306	gb\|AC148932.3\| Pan troglodytes BAC clone CH251-571G8 from chromo...	40	4.4
307	gb\|AC131679.2\| Mus musculus BAC clone RP23-339I6 from chromosome...	40	4.4
308	gb\|AC131786.3\| Mus musculus BAC clone RP24-397H7 from chromosome...	40	4.4
309	gb\|AC139940.5\| Mus musculus chromosome 15, clone RP23-468K16, co...	40	4.4
310	gb\|AC113311.9\| Mus musculus chromosome 1, clone RP23-440J24, com...	40	4.4
311	gb\|AC127272.4\| Mus musculus BAC clone RP24-63G5 from chromosome ...	40	4.4
312	gb\|AC122376.4\| Mus musculus BAC clone RP23-472G10 from chromosom...	40	4.4
313	gb\|AC129013.3\| Mus musculus BAC clone RP24-550P17 from chromosom...	40	4.4
314	gb\|AC122321.4\| Mus musculus BAC clone RP23-319I22 from chromosom...	40	4.4
315	emb\|CR925737.7\| Zebrafish DNA sequence from clone DKEY-263O8 in ...	40	4.4
316	emb\|CR762443.6\| Zebrafish DNA sequence from clone DKEY-3A5 in li...	40	4.4
317	emb\|CR396586.7\| Zebrafish DNA sequence from clone DKEY-184A18 in...	40	4.4
318	emb\|CR759732.9\| Zebrafish DNA sequence from clone DKEY-183E23 in...	40	4.4
319	emb\|CR926129.9\| Zebrafish DNA sequence from clone DKEY-261J15 in...	40	4.4
320	emb\|BX072551.7\| Zebrafish DNA sequence from clone CH211-117G17 i...	40	4.4
321	emb\|CR381560.8\| Zebrafish DNA sequence from clone CH211-172L8 in...	40	4.4
322	emb\|AJ315971.1\|PFL315971 Platichthys flesus microsatellite DNA, ...	40	4.4
323	emb\|CT009480.7\| Mouse DNA sequence from clone RP23-126N4 on chro...	40	4.4
324	emb\|CR407546.16\| Zebrafish DNA sequence from clone CH211-276E3 i...	40	4.4
325	emb\|CR376860.38\| Zebrafish DNA sequence from clone DKEY-111H22 i...	40	4.4
326	gb\|AC025219.6\| Homo sapiens chromosome 15, clone RP11-276M12, co...	40	4.4
327	emb\|CR933003.18\| Zebrafish DNA sequence from clone DKEY-149P6 in...	40	4.4
328	emb\|CT009767.6\| Mouse DNA sequence from clone RP23-24A13 on chro...	40	4.4
329	emb\|CR392002.14\| Zebrafish DNA sequence from clone DKEY-61D19 in...	40	4.4
330	emb\|BX248114.23\| Zebrafish DNA sequence from clone CH211-209I22 ...	40	4.4
331	emb\|CR931792.9\| Zebrafish DNA sequence from clone DKEY-180L1 in ...	40	4.4
332	gb\|AC099948.9\| Mus musculus chromosome 10, clone RP23-19D21, com...	40	4.4
333	gb\|AC102543.9\| Mus musculus chromosome 14, clone RP23-112K14, co...	40	4.4
334	gb\|AC110524.11\| Mus musculus chromosome 9, clone RP23-403L22, co...	40	4.4
335	emb\|CR925863.7\| Zebrafish DNA sequence from clone DKEY-184N1 in ...	40	4.4
336	gb\|AC132120.3\| Mus musculus BAC clone RP23-479B19 from chromosom...	40	4.4
337	gb\|AC125073.4\| Mus musculus BAC clone RP23-463H17 from chromosom...	40	4.4
338	gb\|AC125375.3\| Mus musculus BAC clone RP23-464K21 from chromosom...	40	4.4
339	gb\|AC126031.2\| Mus musculus BAC clone RP24-84F17 from chromosome...	40	4.4
340	gb\|AC123828.4\| Mus musculus BAC clone RP24-111G17 from chromosom...	40	4.4
341	gb\|AC126935.3\| Mus musculus BAC clone RP24-186K24 from chromosom...	40	4.4
342	gb\|AC126244.3\| Mus musculus BAC clone RP24-319A6 from chromosome...	40	4.4
343	gb\|AC122255.2\| Mus musculus BAC clone RP23-178F22 from chromosom...	40	4.4
344	gb\|AC129322.3\| Mus musculus BAC clone RP23-220F4 from chromosome...	40	4.4
345	gb\|AC129020.4\| Mus musculus BAC clone RP23-234A5 from chromosome...	40	4.4
346	gb\|AC127304.4\| Mus musculus BAC clone RP23-285C13 from chromosom...	40	4.4
347	gb\|AC132427.4\| Mus musculus BAC clone RP23-326N11 from chromosom...	40	4.4
348	gb\|AC133207.3\| Mus musculus BAC clone RP23-116L23 from chromosom...	40	4.4
349	gb\|AC132474.3\| Mus musculus BAC clone RP23-114G13 from chromosom...	40	4.4
350	gb\|AC002492.1\|HUAC002492 Human Chromosome 16 BAC clone CIT987SK-...	40	4.4
351	emb\|CR751226.12\| Zebrafish DNA sequence from clone DKEY-253E7 in...	40	4.4
352	emb\|CR788248.24\| Zebrafish DNA sequence from clone CH211-112B1 i...	40	4.4
353	gb\|AC113307.12\| Mus musculus chromosome 3, clone RP23-437A2, com...	40	4.4
354	gb\|AC127250.3\| Mus musculus BAC clone RP24-482H23 from chromosom...	40	4.4
355	gb\|AC124363.3\| Mus musculus BAC clone RP24-531A9 from chromosome...	40	4.4
356	gb\|AC124422.5\| Mus musculus BAC clone RP24-326L13 from chromosom...	40	4.4
357	gb\|AC124371.2\| Mus musculus BAC clone RP24-556P1 from chromosome...	40	4.4
358	gb\|AC010178.40\| Homo sapiens 12 BAC RP11-303O9 (Roswell Park Can...	40	4.4
359	gb\|AC126251.4\| Mus musculus BAC clone RP23-457L16 from chromosom...	40	4.4
360	gb\|AC124500.5\| Mus musculus BAC clone RP24-69C19 from chromosome...	40	4.4
361	gb\|AC124482.3\| Mus musculus BAC clone RP24-120B3 from chromosome...	40	4.4
362	emb\|BX664703.21\| Zebrafish DNA sequence from clone DKEYP-74A8 in...	40	4.4
363	emb\|BX899180.11\| Zebrafish DNA sequence from clone DKEY-287G19 i...	40	4.4
364	gb\|AC124465.6\| Mus musculus BAC clone RP24-156M16 from chromosom...	40	4.4
365	gb\|AC124700.3\| Mus musculus BAC clone RP24-199L11 from chromosom...	40	4.4
366	gb\|AC121930.3\| Mus musculus BAC clone RP24-205C1 from chromosome...	40	4.4
367	gb\|AC124741.5\| Mus musculus BAC clone RP23-357D17 from chromosom...	40	4.4
368	gb\|AC124598.5\| Mus musculus BAC clone RP23-22P3 from 13, complet...	40	4.4
369	emb\|CR626886.6\| Zebrafish DNA sequence from clone CH211-255I3 in...	40	4.4
370	gb\|AC122890.4\| Mus musculus BAC clone RP23-63O14 from 8, complet...	40	4.4
371	gb\|AC125329.4\| Mus musculus BAC clone RP23-198F7 from 10, comple...	40	4.4
372	gb\|AC122845.4\| Mus musculus BAC clone RP23-155G2 from 1, complet...	40	4.4
373	gb\|AC122245.5\| Mus musculus BAC clone RP23-151P21 from 18, compl...	40	4.4
374	emb\|BX890598.10\| Zebrafish DNA sequence from clone DKEYP-22H4 in...	40	4.4
375	gb\|AC122274.4\| Mus musculus BAC clone RP23-228J3 from 14, comple...	40	4.4
376	gb\|AC122804.4\| Mus musculus BAC clone RP23-296J10 from 6, comple...	40	4.4
377	gb\|AC098738.2\| Mus musculus BAC clone RP23-122F7 from 8, complet...	40	4.4
378	emb\|CR382290.16\| Zebrafish DNA sequence from clone CH211-236D22 ...	40	4.4
379	emb\|CR735141.14\| Zebrafish DNA sequence from clone CH211-128E9 i...	40	4.4
380	gb\|AC117188.3\| Mus musculus BAC clone RP23-42E3 from 1, complete...	40	4.4
381	gb\|AC117227.3\| Mus musculus BAC clone RP23-380C5 from 13, comple...	40	4.4
382	emb\|BX936420.9\| Zebrafish DNA sequence from clone DKEY-7F16 in l...	40	4.4
383	gb\|AC117230.3\| Mus musculus BAC clone RP23-385F15 from 16, compl...	40	4.4
384	gb\|AC116594.4\| Mus musculus BAC clone RP24-127F20 from 19, compl...	40	4.4
385	gb\|AC121929.2\| Mus musculus BAC clone RP24-204J10 from 5, comple...	40	4.4
386	gb\|AC122037.2\| Mus musculus BAC clone RP24-426D9 from 3, complet...	40	4.4
387	gb\|AC112261.4\| Mus musculus BAC clone RP23-204O17 from 3, comple...	40	4.4
388	gb\|AC098721.3\| Mus musculus BAC clone RP23-2O23 from 2, complete...	40	4.4
389	gb\|AC113068.9\| Mus musculus chromosome 1, clone RP23-269F19, com...	40	4.4
390	emb\|CR705322.2\|CNS0G76E Tetraodon nigroviridis full-length cDNA	40	4.4
391	emb\|CR698410.2\|CNS0G1UE Tetraodon nigroviridis full-length cDNA	40	4.4
392	emb\|CR689764.2\|CNS0FV68 Tetraodon nigroviridis full-length cDNA	40	4.4
393	gb\|AC073048.7\| Homo sapiens BAC clone RP11-54E21 from 7, complet...	40	4.4
394	emb\|CR682691.2\|CNS0FPPR Tetraodon nigroviridis full-length cDNA	40	4.4
395	ref\|XM_729242.1\| Plasmodium chabaudi chabaudi hypothetical prote...	40	4.4
396	gb\|AC092688.3\| Homo sapiens BAC clone RP11-803A21 from 7, comple...	40	4.4
397	emb\|CR681707.2\|CNS0FOYF Tetraodon nigroviridis full-length cDNA	40	4.4
398	gb\|AC119432.7\| Mus musculus chromosome 18, clone RP24-114K9, com...	40	4.4
399	gb\|AC103645.6\| Mus musculus chromosome 19, clone RP24-510J20, co...	40	4.4
400	gb\|AC108434.12\| Mus musculus chromosome 18, clone RP23-198I24, c...	40	4.4
401	gb\|AC101142.9\| Mus musculus chromosome 13, clone RP23-170P21, co...	40	4.4
402	gb\|AC123714.6\| Mus musculus chromosome 9, clone RP23-393E20, com...	40	4.4
403	gb\|AC138101.8\| Mus musculus chromosome 5, clone RP23-149H20, com...	40	4.4
404	gb\|AC102132.3\| Mus musculus chromosome 18, clone RP23-231D1, com...	40	4.4
405	gb\|AC154722.2\| Mus musculus BAC clone RP24-371J2 from chromosome...	40	4.4
406	gb\|AC156953.9\| Mus musculus 6 BAC RP24-568F14 (Roswell Park Canc...	40	4.4
407	gb\|AC165350.3\| Mus musculus BAC clone RP23-249A17 from chromosom...	40	4.4
408	gb\|AC163289.4\| Mus musculus BAC clone RP23-269K2 from chromosome...	40	4.4
409	gb\|AC163650.2\| Mus musculus BAC clone RP24-383A20 from chromosom...	40	4.4
410	gb\|AC159983.8\| Mus musculus BAC clone RP23-192C23 from chromosom...	40	4.4
411	gb\|AC145866.3\| Pan troglodytes BAC clone RP43-21B7 from 7, compl...	40	4.4
412	gb\|AC109169.13\| Mus musculus chromosome 6, clone RP23-5D6, compl...	40	4.4
413	gb\|AC124230.6\| Mus musculus chromosome 1, clone RP23-474K11, com...	40	4.4
414	gb\|AC112683.10\| Mus musculus chromosome 17, clone RP23-332P1, co...	40	4.4
415	gb\|AC160032.7\| Mus musculus 6 BAC RP24-179I4 (Roswell Park Cance...	40	4.4
416	gb\|AC114600.4\| Mus musculus chromosome 5, clone RP23-332O18, com...	40	4.4
417	gb\|AC159149.10\| Mus musculus 10 BAC RP23-56F17 (Roswell Park Can...	40	4.4
418	emb\|BX901913.8\| Zebrafish DNA sequence from clone CH211-241E15 i...	40	4.4
419	gb\|AC154580.2\| Mus musculus BAC clone RP23-380H1 from chromosome...	40	4.4
420	gb\|AC166575.1\| Mus musculus BAC clone RP23-99E16 from chromosome...	40	4.4
421	gb\|AC154836.2\| Mus musculus BAC clone RP24-574D17 from chromosom...	40	4.4
422	emb\|BX510331.13\| Zebrafish DNA sequence from clone CH211-42B22 i...	40	4.4
423	emb\|BX936363.13\| Zebrafish DNA sequence from clone CH211-112P19 ...	40	4.4
424	gb\|AC112342.14\| Rattus norvegicus 14 BAC CH230-253H12 (Children'...	40	4.4
425	gb\|AC007607.6\| Homo sapiens chromosome 16 clone RP11-369H7, comp...	40	4.4
426	emb\|BX855598.22\| Zebrafish DNA sequence from clone DKEY-52J13 in...	40	4.4
427	emb\|CR450835.4\| Zebrafish DNA sequence from clone CH211-179C12 i...	40	4.4
428	emb\|CR937051.2\|RN394C12 Rattus norvegicus chromosome 1 BAC CH230...	40	4.4
429	emb\|BX897686.8\| Zebrafish DNA sequence from clone DKEY-145M5 in ...	40	4.4
430	emb\|AJ391220.1\|APY391220 Aethia pygmaea microsatellite DNA, clon...	40	4.4
431	emb\|Z75744.2\|HSN117B5 Human DNA sequence from clone LL22NC03-117...	40	4.4
432	emb\|AL732314.18\| Human DNA sequence from clone RP13-465B17 on ch...	40	4.4
433	emb\|BX470150.13\| Zebrafish DNA sequence from clone DKEY-164K14 i...	40	4.4
434	emb\|BX324178.8\| Human DNA sequence from clone WI2-81516E3 on chr...	40	4.4
435	emb\|BX640514.3\| Human DNA sequence from clone WI2-87327B8 on chr...	40	4.4
436	emb\|AL732479.6\| Human DNA sequence from clone RP11-351D13 on chr...	40	4.4
437	emb\|AL672277.20\| Human DNA sequence from clone RP11-309M23 on ch...	40	4.4
438	emb\|AL592549.7\| Human DNA sequence from clone RP11-374B16 on chr...	40	4.4
439	emb\|AL590097.16\| Human DNA sequence from clone RP11-117C7 on chr...	40	4.4
440	emb\|AL590551.7\| Human DNA sequence from clone RP11-243O10 on chr...	40	4.4
441	emb\|AL450267.10\| Human DNA sequence from clone RP11-344B23 on ch...	40	4.4
442	emb\|AL445605.7\| Human DNA sequence from clone RP11-335D7 on chro...	40	4.4
443	emb\|AL391724.7\| Human DNA sequence from clone RP11-350A18 on chr...	40	4.4
444	emb\|AL445929.5\| Human DNA sequence from clone RP11-408M7 on chro...	40	4.4
445	emb\|AL390994.30\| Human DNA sequence from clone RP11-190J18 on ch...	40	4.4
446	emb\|AL390788.15\| Human DNA sequence from clone RP11-384P5 on chr...	40	4.4
447	emb\|AL359180.17\| Human DNA sequence from clone RP11-320G21 on ch...	40	4.4
448	gb\|AC130313.3\| Homo sapiens chromosome 8, clone RP11-460A11, com...	40	4.4
449	emb\|AL357892.13\| Human DNA sequence from clone RP11-707H15 on ch...	40	4.4
450	emb\|AL355812.23\| Human DNA sequence from clone RP11-810O3 on chr...	40	4.4
451	emb\|AL355392.7\| Human DNA sequence from clone RP5-1187J4 on chro...	40	4.4
452	emb\|AL356289.6\| Human DNA sequence from clone RP11-193P11 on chr...	40	4.4
453	emb\|AL160408.24\| Human DNA sequence from clone RP4-781K5 on chro...	40	4.4
454	emb\|AL159159.21\| Human DNA sequence from clone RP11-88J11 on chr...	40	4.4
455	emb\|AL158212.15\| Human DNA sequence from clone RP11-57H14 on chr...	40	4.4
456	emb\|AL138997.18\| Human DNA sequence from clone RP11-10O23 on chr...	40	4.4
457	emb\|AL138926.13\| Human DNA sequence from clone RP11-173E24 on ch...	40	4.4
458	emb\|AL157896.9\| Human DNA sequence from clone RP11-397C18 on chr...	40	4.4
459	emb\|AL121756.14\|HSDJ726C3 Human DNA sequence from clone RP4-726C...	40	4.4
460	emb\|AL121898.23\|HSA430K20 Human DNA sequence from clone RP11-430...	40	4.4
461	gb\|AC087650.12\| Homo sapiens, clone RP11-100E5, complete sequence	40	4.4
462	gb\|AF009430.1\|AH006708S03 Homo sapiens clone 22 gene, intron A a...	40	4.4
463	emb\|AL035410.7\|HS591B8 Human DNA sequence from clone RP4-591B8 o...	40	4.4
464	gb\|AC160467.3\| Mus musculus chromosome 1, clone RP23-382C4, comp...	40	4.4
465	emb\|BX510944.11\| Zebrafish DNA sequence from clone DKEY-286H17 i...	40	4.4
466	gb\|AC120768.5\| Rattus norvegicus 7 BAC CH230-152B10 (Children's ...	40	4.4
467	emb\|AL008638.1\|HS992D9 Human DNA sequence from clone CTA-992D9 o...	40	4.4
468	emb\|AL008636.1\|HS722E9 Human DNA sequence from clone CTA-722E9 o...	40	4.4
469	emb\|CR352233.9\| Zebrafish DNA sequence from clone CH211-193J5 in...	40	4.4
470	emb\|CR377214.13\| Zebrafish DNA sequence from clone CH211-261F19 ...	40	4.4
471	emb\|BX936341.12\| Zebrafish DNA sequence from clone CH211-149C18 ...	40	4.4
472	emb\|CR936380.6\| Zebrafish DNA sequence from clone CH73-122H24 in...	40	4.4
473	gb\|AC121799.5\| Mus musculus BAC clone RP23-429M22 from chromosom...	40	4.4
474	gb\|AC160460.5\| Mus musculus chromosome 8, clone RP23-15B11, comp...	40	4.4
475	gb\|AC166172.1\| Mus musculus BAC clone RP23-106N22 from chromosom...	40	4.4
476	gb\|AC159819.2\| Mus musculus BAC clone RP23-180C14 from chromosom...	40	4.4
477	gb\|AC092263.7\| Oryza sativa chromosome 3 BAC OSJNBa0033P04 genom...	40	4.4
478	gb\|AF468557.1\| Crassostrea gigas clone d100 microsatellite sequence	40	4.4
479	emb\|AL606466.12\| Mouse DNA sequence from clone RP23-348N2 on chr...	40	4.4
480	emb\|AL591492.11\| Zebrafish DNA sequence from clone BUSM1-261O22 ...	40	4.4
481	emb\|AL591430.8\| Mouse DNA sequence from clone RP23-41B20 on chro...	40	4.4
482	emb\|AL031227.1\|DMC66A1 Drosophila melanogaster cosmid 66A1	40	4.4
483	gb\|AC144905.10\| Mus musculus chromosome 1, clone RP23-293I7, com...	40	4.4
484	emb\|AJ544897.1\|TNI544897 Tetraodon nigroviridis tf2 gene for tis...	40	4.4
485	emb\|AJ439060.1\|AGA439060 Anopheles gambiae DNA from 2R chromosom...	40	4.4
486	gb\|AC158920.4\| Mus musculus chromosome 5, clone RP24-238C7, comp...	40	4.4
487	gb\|AY988132.1\| Felis catus clone FCA731 microsatellite sequence	40	4.4
488	emb\|BX537273.16\| Zebrafish DNA sequence from clone CH211-151F2 i...	40	4.4
489	emb\|CR925780.8\| Zebrafish DNA sequence from clone CH211-112B19 i...	40	4.4
490	emb\|BX927291.8\| Zebrafish DNA sequence from clone CH211-261A10 i...	40	4.4
491	emb\|CR354535.11\| Zebrafish DNA sequence from clone CH211-199M16 ...	40	4.4
492	emb\|BX927088.11\| Zebrafish DNA sequence from clone CH211-212M21 ...	40	4.4
493	emb\|CR388091.9\| Zebrafish DNA sequence from clone CH211-114H16 i...	40	4.4
494	emb\|CR626890.8\| Zebrafish DNA sequence from clone DKEY-83J7 in l...	40	4.4
495	emb\|CR391995.4\| Zebrafish DNA sequence from clone CH211-229I10, ...	40	4.4
496	emb\|BX908733.14\| Zebrafish DNA sequence from clone CH211-190N7 i...	40	4.4
497	emb\|CR450798.13\| Zebrafish DNA sequence from clone DKEY-21P1 in ...	40	4.4
498	emb\|CR855273.7\| Zebrafish DNA sequence from clone DKEYP-34E1 in ...	40	4.4
499	emb\|CR788320.11\| Zebrafish DNA sequence from clone DKEY-217F16 i...	40	4.4
500	emb\|AL662841.10\| Mouse DNA sequence from clone RP23-31O3 on chro...	40	4.4

>emb|Z48624.1|HVGRP3 H.vulgare mRNA for glycine-rich RNA binding protein
          Length = 907

 Score =  541 bits (273), Expect = e-151
 Identities = 322/333 (96%), Gaps = 5/333 (1%)
 Strand = Plus / Minus

                                                                       
Query: 1   accgagtt-aaacataggatn-ccaacatcacatcccaattacagtccaagacaggatga 58
           |||||||| |||||||||||  ||||||||||||||||||||||||||||||||||| ||
Sbjct: 868 accgagttcaaacataggatcaccaacatcacatcccaattacagtccaagacaggaaga 809

                                                                       
Query: 59  gggattgctgnntcaccgacgacagaccgaccgactgaaagataagacatgttgtttctt 118
           ||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 808 gggattgctgcatcaccgacgacagaccgaccgactgaaagataagacatgttgtttctt 749

                                                                       
Query: 119 cctcgcgtaacacagagaccactcgagctcgcgatcaaaaacaccacaggaccggacaga 178
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 748 cctcgcgtaacacagagaccactcgagctcgcgatcaaaaacaccacaggaccggacaga 689

                                                                       
Query: 179 cacacaaacacgactcagactgacacaccgaaaatagataacttgctgacgaagacggta 238
           |||||||||||||||||||||||||||||| | |||||| ||||||||||| ||||||||
Sbjct: 688 cacacaaacacgactcagactgacacaccg-agatagat-acttgctgacg-agacggta 632

                                                                       
Query: 239 gacgatagatggatggatggataactgggcgatgagacggggtccggcgctcaggacctc 298
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 631 gacgatagatggatggatggataactgggcgatgagacggggtccggcgctcaggacctc 572

                                            
Query: 299 cactggccgccggagtcnccgccgccgcgctgg 331
           ||||||||||||||||| |||||||||||||||
Sbjct: 571 cactggccgccggagtcgccgccgccgcgctgg 539

to top

>gb|U32310.1|TAU32310 Triticum aestivum single-stranded nucleic acid binding protein
           (whGRP-1) gene, complete cds
          Length = 937

 Score = 65.9 bits (33), Expect = 8e-08
 Identities = 50/55 (90%), Gaps = 3/55 (5%)
 Strand = Plus / Minus

                                                                  
Query: 78  cgacagaccgaccgactgaaagata---agacatgttgtttcttcctcgcgtaac 129
           |||| ||||||||||||||||||||   | |||||||||||||||||||||||||
Sbjct: 826 cgaccgaccgaccgactgaaagatagtaacacatgttgtttcttcctcgcgtaac 772



 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 29/29 (100%)
 Strand = Plus / Minus

                                        
Query: 138 cactcgagctcgcgatcaaaaacaccaca 166
           |||||||||||||||||||||||||||||
Sbjct: 743 cactcgagctcgcgatcaaaaacaccaca 715



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 295 cctccactggccgccggagtcnccgccgcc 324
           ||||||||||||||||||||| ||||||||
Sbjct: 598 cctccactggccgccggagtcgccgccgcc 569

to top

>gb|AC084310.16| Mus musculus chromosome 1, clone RP23-10C10, complete sequence
          Length = 194800

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 235   ggtagacgatagatggatggatggata 261
             |||||| ||||||||||||||||||||
Sbjct: 36075 ggtagatgatagatggatggatggata 36101

to top

>emb|AL929389.9| Zebrafish DNA sequence from clone CH211-51H4 in linkage group 11,
             complete sequence
          Length = 166353

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 238   agacgatagatggatggatggat 260
             |||||||||||||||||||||||
Sbjct: 69765 agacgatagatggatggatggat 69743

to top

>gb|AC011774.9| Homo sapiens chromosome 18, clone RP11-380C8, complete sequence
          Length = 208039

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 242    gatagatggatggatggataact 264
              |||||||||||||||||||||||
Sbjct: 202485 gatagatggatggatggataact 202463

to top

>gb|AC015878.7| Homo sapiens, clone RP11-296E23, complete sequence
          Length = 160569

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 242   gatagatggatggatggataact 264
             |||||||||||||||||||||||
Sbjct: 44372 gatagatggatggatggataact 44350

to top

>emb|BX571944.15| Zebrafish DNA sequence from clone RP71-84D1 in linkage group 13, complete
              sequence
          Length = 152139

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 239    gacgatagatggatggatggata 261
              |||||||||||||||||||||||
Sbjct: 145278 gacgatagatggatggatggata 145300



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 145448 gatagatggatggatggata 145467

to top

>gb|AC173483.1| Mus musculus BAC clone RP23-281C13 from chromosome 12, complete
             sequence
          Length = 182922

 Score = 46.1 bits (23), Expect = 0.071
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 235   ggtagacgatagatggatggatggata 261
             |||||| ||||||||||||||||||||
Sbjct: 35624 ggtagatgatagatggatggatggata 35598



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 237   tagacgatagatggatggatggat 260
             |||| |||||||||||||||||||
Sbjct: 36183 tagatgatagatggatggatggat 36160



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 35857 gatagatggatggatggata 35838

to top

>gb|AC153907.1| Mus musculus  BAC RP23-205F6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 196286

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 240    acgatagatggatggatggata 261
              ||||||||||||||||||||||
Sbjct: 162425 acgatagatggatggatggata 162446

to top

>gb|AC153985.4| Mus musculus 6 BAC RP24-507D15 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 148264

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 240   acgatagatggatggatggata 261
             ||||||||||||||||||||||
Sbjct: 43234 acgatagatggatggatggata 43255

to top

>gb|AC098570.7| Mus musculus chromosome 1, clone RP23-278N11, complete sequence
          Length = 193097

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 240   acgatagatggatggatggata 261
             ||||||||||||||||||||||
Sbjct: 35065 acgatagatggatggatggata 35086

to top

>gb|AC167724.6| Mus musculus 10 BAC RP23-331P17 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 230186

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 242    gatagatggatggatggataac 263
              ||||||||||||||||||||||
Sbjct: 227899 gatagatggatggatggataac 227920

to top

>gb|AC132107.3| Mus musculus BAC clone RP24-251C17 from chromosome 8, complete sequence
          Length = 141785

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 242   gatagatggatggatggataac 263
             ||||||||||||||||||||||
Sbjct: 66144 gatagatggatggatggataac 66123

to top

>gb|AC005103.3| Homo sapiens BAC clone CTA-357J21 from 7, complete sequence
          Length = 146006

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 245   agatggatggatggataactgg 266
             ||||||||||||||||||||||
Sbjct: 61684 agatggatggatggataactgg 61705

to top

>emb|BX323879.11| Zebrafish DNA sequence from clone DKEY-30L21 in linkage group 10,
              complete sequence
          Length = 243476

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 241    cgatagatggatggatggataa 262
              ||||||||||||||||||||||
Sbjct: 135908 cgatagatggatggatggataa 135887

to top

>emb|CR388060.19| Zebrafish DNA sequence from clone DKEY-208J8 in linkage group 16,
              complete sequence
          Length = 213586

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 239    gacgatagatggatggatggat 260
              ||||||||||||||||||||||
Sbjct: 117533 gacgatagatggatggatggat 117554



 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 236    gtagacgatagatggatggatggata 261
              ||||||||| ||||||||||||||||
Sbjct: 117482 gtagacgatggatggatggatggata 117507

to top

>gb|AC127552.3| Mus musculus BAC clone RP24-550N13 from chromosome 3, complete sequence
          Length = 156534

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 235   ggtagacgatagatggatggatggat 260
             |||||| |||||||||||||||||||
Sbjct: 47280 ggtagatgatagatggatggatggat 47255

to top

>gb|AC122465.4| Mus musculus BAC clone RP24-304I22 from chromosome 13, complete
             sequence
          Length = 142340

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 237   tagacgatagatggatggatggataa 262
             |||| |||||||||||||||||||||
Sbjct: 97284 tagatgatagatggatggatggataa 97309

to top

>gb|AF047825.1| Homo sapiens PAC 50H2 in the CUTL1 locus, complete sequence
          Length = 151964

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 245   agatggatggatggataactgg 266
             ||||||||||||||||||||||
Sbjct: 86937 agatggatggatggataactgg 86916

to top

>gb|AC150314.5| Mus musculus BAC clone RP23-269O24 from chromosome 10, complete sequence
          Length = 243006

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 242    gatagatggatggatggataactggg 267
              ||||||||||||||||||||| ||||
Sbjct: 175382 gatagatggatggatggataaatggg 175357



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 244    tagatggatggatggataactggg 267
              ||||||||||||||||||| ||||
Sbjct: 175412 tagatggatggatggataaatggg 175389



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 167544 gatagatggatggatggata 167563

to top

>emb|AL139041.17| Human DNA sequence from clone RP11-408O19 on chromosome 9p11.2-21
             Contains the 3' end of the gene for a novel protein
             similar to sorting nexin 7 (SNX7), the TSCOT gene for
             thymic stromal co-transporter, a pseudogene similar to Mus
             musculus major urinary proteins and a CpG island, complete
             sequence
          Length = 141659

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 242   gatagatggatggatggataac 263
             ||||||||||||||||||||||
Sbjct: 50463 gatagatggatggatggataac 50442

to top

>emb|CR384099.6| Zebrafish DNA sequence from clone DKEY-266I18 in linkage group 24,
             complete sequence
          Length = 121857

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 235   ggtagacgatagatggatggatggat 260
             |||||| |||||||||||||||||||
Sbjct: 23017 ggtagatgatagatggatggatggat 23042

to top

>emb|BX324145.12| Zebrafish DNA sequence from clone CH211-207C13 in linkage group 16,
             complete sequence
          Length = 196595

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 242   gatagatggatggatggataac 263
             ||||||||||||||||||||||
Sbjct: 37234 gatagatggatggatggataac 37255

to top

>emb|BX897657.8| Zebrafish DNA sequence from clone DKEYP-84C2, complete sequence
          Length = 194258

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 239   gacgatagatggatggatggat 260
             ||||||||||||||||||||||
Sbjct: 72954 gacgatagatggatggatggat 72933

to top

>emb|BX323883.14| Zebrafish DNA sequence from clone CH211-285M21 in linkage group 1,
             complete sequence
          Length = 195250

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 242   gatagatggatggatggataac 263
             ||||||||||||||||||||||
Sbjct: 10630 gatagatggatggatggataac 10651



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 238   agacgatagatggatggatggata 261
             ||||||| ||||||||||||||||
Sbjct: 10147 agacgatggatggatggatggata 10170

to top

>dbj|AB072928.1| Oryzias latipes olmt2-mmp mRNA for membrane-type matrix
            metalloproteinase, complete cds
          Length = 2713

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 245  agatggatggatggataactgg 266
            ||||||||||||||||||||||
Sbjct: 2430 agatggatggatggataactgg 2409

to top

>dbj|BS000234.1| Pan troglodytes chromosome 22 clone:PTB-190I13, map 22, complete
             sequences
          Length = 174520

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 242   gatagatggatggatggataactggg 267
             ||||||||||||||||||||| ||||
Sbjct: 45604 gatagatggatggatggataaatggg 45579



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   atagatggatggatggataa 262
             ||||||||||||||||||||
Sbjct: 45515 atagatggatggatggataa 45496

to top

>gb|AC155327.3| Mus musculus 6 BAC RP24-176G23 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 148183

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 242   gatagatggatggatggataac 263
             ||||||||||||||||||||||
Sbjct: 59195 gatagatggatggatggataac 59174

to top

>emb|BX284684.8| Zebrafish DNA sequence from clone DKEY-14I10 in linkage group 8, complete
              sequence
          Length = 163766

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 240    acgatagatggatggatggata 261
              ||||||||||||||||||||||
Sbjct: 101745 acgatagatggatggatggata 101724

to top

>emb|CT030184.14| Mouse DNA sequence from clone RP23-9C19 on chromosome 13, complete
              sequence
          Length = 201341

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 237    tagacgatagatggatggatggataa 262
              |||| |||||||||||||||||||||
Sbjct: 199864 tagatgatagatggatggatggataa 199839

to top

>emb|CR388128.18| Zebrafish DNA sequence from clone CH211-127B17 in linkage group 18,
              complete sequence
          Length = 180022

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 239    gacgatagatggatggatggat 260
              ||||||||||||||||||||||
Sbjct: 172508 gacgatagatggatggatggat 172529

to top

>emb|BX927218.17| Zebrafish DNA sequence from clone DKEY-14O18 in linkage group 19,
             complete sequence
          Length = 208809

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 242   gatagatggatggatggataactggg 267
             ||||||||||||||||||||| ||||
Sbjct: 27277 gatagatggatggatggataagtggg 27252

to top

>emb|AL606705.23| Zebrafish DNA sequence from clone BUSM1-175P5 in linkage group 15,
             complete sequence
          Length = 92464

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 242   gatagatggatggatggataactggg 267
             ||||||||||||||||||||| ||||
Sbjct: 41302 gatagatggatggatggataagtggg 41277

to top

>gb|AC109256.11| Mus musculus chromosome 8, clone RP23-11D11, complete sequence
          Length = 242101

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 242    gatagatggatggatggataac 263
              ||||||||||||||||||||||
Sbjct: 221215 gatagatggatggatggataac 221236

to top

>gb|AC107689.7| Mus musculus chromosome 3, clone RP24-283F19, complete sequence
          Length = 168704

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 235    ggtagacgatagatggatggatggat 260
              |||||| |||||||||||||||||||
Sbjct: 108644 ggtagatgatagatggatggatggat 108619

to top

>dbj|AP001751.1| Homo sapiens genomic DNA, chromosome 21q, section 95/105
          Length = 340000

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 242   gatagatggatggatggataactggg 267
             ||||||||||||||||||||| ||||
Sbjct: 17105 gatagatggatggatggataaatggg 17080



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   atagatggatggatggataa 262
             ||||||||||||||||||||
Sbjct: 17016 atagatggatggatggataa 16997

to top

>gb|AC008734.7| Homo sapiens chromosome 19 clone CTD-2529P6, complete sequence
          Length = 183137

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 242   gatagatggatggatggataactggg 267
             ||||||||||||||||||||| ||||
Sbjct: 90690 gatagatggatggatggataaatggg 90665

to top

>emb|CT030166.8| Mouse DNA sequence from clone RP23-320I11 on chromosome 13, complete
              sequence
          Length = 222942

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 237    tagacgatagatggatggatggataa 262
              |||| |||||||||||||||||||||
Sbjct: 112299 tagatgatagatggatggatggataa 112274

to top

>emb|CR848667.23| Zebrafish DNA sequence from clone CH211-257P13 in linkage group 15,
              complete sequence
          Length = 157566

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 242    gatagatggatggatggataac 263
              ||||||||||||||||||||||
Sbjct: 148350 gatagatggatggatggataac 148329

to top

>emb|AL935289.4| Zebrafish DNA sequence from clone CH211-232C12, complete sequence
          Length = 154174

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 239   gacgatagatggatggatggat 260
             ||||||||||||||||||||||
Sbjct: 51754 gacgatagatggatggatggat 51733

to top

>emb|AL773564.8| Zebrafish DNA sequence from clone CH211-204C7, complete sequence
          Length = 159763

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 235   ggtagacgatagatggatggatggat 260
             |||||| |||||||||||||||||||
Sbjct: 38406 ggtagatgatagatggatggatggat 38381



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 242  gatagatggatggatggata 261
            ||||||||||||||||||||
Sbjct: 7251 gatagatggatggatggata 7270

to top

>gb|AC171970.3| Mus musculus  BAC RP23-116G8 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 193415

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 240   acgatagatggatggatggata 261
             ||||||||||||||||||||||
Sbjct: 53674 acgatagatggatggatggata 53695

to top

>emb|AL603843.15| Mouse DNA sequence from clone RP23-412D17 on chromosome 15, complete
             sequence
          Length = 203649

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 242   gatagatggatggatggataac 263
             ||||||||||||||||||||||
Sbjct: 39097 gatagatggatggatggataac 39118

to top

>dbj|AP001046.1| Homo sapiens genomic DNA, chromosome 21, clone:KB43F12, MX1-D21S171
             region, complete sequence
          Length = 158063

 Score = 44.1 bits (22), Expect = 0.28
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 242   gatagatggatggatggataactggg 267
             ||||||||||||||||||||| ||||
Sbjct: 17105 gatagatggatggatggataaatggg 17080



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   atagatggatggatggataa 262
             ||||||||||||||||||||
Sbjct: 17016 atagatggatggatggataa 16997

to top

>gb|AC102381.12| Mus musculus chromosome 8, clone RP24-180I19, complete sequence
          Length = 190298

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 176038 gatagatggatggatggataa 176058



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 175792 gatagatggatggatggataa 175812

to top

>gb|AC152076.4| Mus musculus BAC clone RP23-326O10 from chromosome 18, complete sequence
          Length = 215816

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 206804 gatagatggatggatggataa 206824



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 206836 gatagatggatggatggata 206855

to top

>gb|AC161528.14| Mus musculus chromosome 8, clone RP23-369H18, complete sequence
          Length = 206302

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 109446 gatagatggatggatggataa 109426



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 109200 gatagatggatggatggataa 109180

to top

>gb|AC164398.8| Mus musculus chromosome 7, clone RP23-307M24, complete sequence
          Length = 196756

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 46071 tagatgatagatggatggatggata 46095

to top

>gb|AC119252.10| Mus musculus chromosome 8, clone RP24-279M13, complete sequence
          Length = 176594

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 28232 gatagatggatggatggataa 28252

to top

>gb|AC093353.11| Mus musculus chromosome 10, clone RP23-19C22, complete sequence
          Length = 188921

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 133399 tagatgatagatggatggatggata 133375

to top

>gb|AC150916.3| Bos taurus  BAC CH240-309L24 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 158580

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 80308 gatagatggatggatggataa 80288

to top

>gb|AC149679.2| Bos taurus  BAC CH240-27A8 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 196187

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 12697 gatagatggatggatggataa 12717

to top

>gb|AF241735.2| Homo sapiens chromosome X clone CTD-2324A24 map p11.4, complete
            sequence
          Length = 39877

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 242  gatagatggatggatggataa 262
            |||||||||||||||||||||
Sbjct: 6223 gatagatggatggatggataa 6243

to top

>gb|AF241734.2| Homo sapiens chromosome X clone RP1-34M10 map p11.4, complete sequence
          Length = 119916

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 113830 gatagatggatggatggataa 113850

to top

>gb|AC091810.4| Homo sapiens chromosome X clone CTD-2324A24 map p11.4, complete
            sequence
          Length = 100442

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 242  gatagatggatggatggataa 262
            |||||||||||||||||||||
Sbjct: 7254 gatagatggatggatggataa 7274

to top

>gb|AC150412.2| Branchiostoma floridae clone CH302-60C21, complete sequence
          Length = 169780

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 157365 gatagatggatggatggataa 157345

to top

>gb|AC147337.3| Pan troglodytes BAC clone CH251-104M9 from Y, complete sequence
          Length = 168027

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 126509 gatagatggatggatggataa 126529

to top

>gb|AC147977.2| Pan troglodytes BAC clone CH251-486H24 from 7, complete sequence
          Length = 213806

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 242   gatagatggatggatggataactgg 266
             ||||||||||||||||||| |||||
Sbjct: 93998 gatagatggatggatggatgactgg 93974

to top

>gb|AC145999.3| Pan troglodytes BAC clone RP43-138L12 from 7, complete sequence
          Length = 182926

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 242   gatagatggatggatggataactgg 266
             ||||||||||||||||||| |||||
Sbjct: 58145 gatagatggatggatggatgactgg 58169

to top

>gb|AC102545.9| Mus musculus chromosome 9, clone RP23-118J13, complete sequence
          Length = 241789

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 246   gatggatggatggataactgg 266
             |||||||||||||||||||||
Sbjct: 61184 gatggatggatggataactgg 61204

to top

>gb|AC159238.2| Mus musculus BAC clone RP24-477O8 from chromosome 12, complete sequence
          Length = 176407

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 123236 tagatgatagatggatggatggata 123212



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 123189 tagatgatagatggatggatggata 123165

to top

>gb|AC122935.3| Mus musculus BAC clone RP23-20E4 from chromosome 3, complete sequence
          Length = 191153

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 133586 gatagatggatggatggataa 133606

to top

>gb|AC124449.3| Mus musculus BAC clone RP24-212N10 from chromosome 15, complete sequence
          Length = 165858

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 140797 gatagatggatggatggataa 140777

to top

>emb|BX248397.8| Zebrafish DNA sequence from clone CH211-233H19 in linkage group 18,
             complete sequence
          Length = 160938

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 240   acgatagatggatggatggat 260
             |||||||||||||||||||||
Sbjct: 96158 acgatagatggatggatggat 96178



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 96026 gatagatggatggatggataa 96046



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 242  gatagatggatggatggataa 262
            |||||||||||||||||||||
Sbjct: 5832 gatagatggatggatggataa 5852

to top

>gb|AC146215.2| Pan troglodytes BAC clone CH251-299B14 from Y, complete sequence
          Length = 163780

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 51311 gatagatggatggatggataa 51331

to top

>gb|AC134559.5| Mus musculus BAC clone RP24-332C4 from chromosome 8, complete sequence
          Length = 180692

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 91786 tagatgatagatggatggatggata 91762

to top

>gb|AC127554.4| Mus musculus BAC clone RP24-323K23 from chromosome 8, complete sequence
          Length = 178416

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 82269 gatagatggatggatggataa 82249

to top

>gb|AC134441.4| Mus musculus BAC clone RP24-544J6 from chromosome 5, complete sequence
          Length = 177565

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 62875 gatagatggatggatggataa 62895

to top

>gb|AC133100.5| Mus musculus BAC clone RP23-98O11 from chromosome 19, complete sequence
          Length = 204855

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 64997 gatagatggatggatggataa 65017

to top

>emb|CR536619.20| Zebrafish DNA sequence from clone CH211-194H19 in linkage group 16,
              complete sequence
          Length = 179375

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 175782 gatagatggatggatggataa 175802



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 175718 gatagatggatggatggataa 175738

to top

>gb|AC124381.4| Mus musculus BAC clone RP24-406E24 from chromosome 15, complete sequence
          Length = 176561

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 161179 gatagatggatggatggataa 161199

to top

>gb|AC124415.4| Mus musculus BAC clone RP24-298J2 from chromosome 10, complete sequence
          Length = 160137

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 49702 tagatgatagatggatggatggata 49678

to top

>emb|CR854834.11| Zebrafish DNA sequence from clone DKEYP-92B10 in linkage group 11,
             complete sequence
          Length = 140484

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 93245 gatagatggatggatggataa 93225

to top

>gb|AC124578.4| Mus musculus BAC clone RP23-166C2 from 18, complete sequence
          Length = 213229

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 187002 gatagatggatggatggataa 186982



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 186970 gatagatggatggatggata 186951

to top

>gb|AC123061.4| Mus musculus BAC clone RP23-216H22 from 14, complete sequence
          Length = 193093

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 76069 tagatgatagatggatggatggata 76045

to top

>gb|AC122830.4| Mus musculus BAC clone RP23-224I23 from 8, complete sequence
          Length = 257003

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 141365 tagatgatagatggatggatggata 141341

to top

>emb|CR759824.9| Zebrafish DNA sequence from clone DKEY-81E3 in linkage group 13, complete
              sequence
          Length = 174086

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 111818 gatagatggatggatggataa 111798



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 82364 gatagatggatggatggata 82383

to top

>emb|CR407547.14| Zebrafish DNA sequence from clone DKEY-62A12 in linkage group 9, complete
              sequence
          Length = 204067

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 131812 gatagatggatggatggataa 131792

to top

>gb|AC117185.2| Mus musculus BAC clone RP23-37M7 from 8, complete sequence
          Length = 188791

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 181765 tagatgatagatggatggatggata 181741

to top

>gb|AC005019.1| Homo sapiens BAC clone GS1-250A16 from 7, complete sequence
          Length = 188362

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 242   gatagatggatggatggataactgg 266
             ||||||||||||||||||| |||||
Sbjct: 40772 gatagatggatggatggatgactgg 40748

to top

>emb|CR700058.2|CNS0G346 Tetraodon nigroviridis full-length cDNA
          Length = 759

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 242 gatagatggatggatggataa 262
           |||||||||||||||||||||
Sbjct: 754 gatagatggatggatggataa 734



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 682 gatagatggatggatggata 663



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 550 gatagatggatggatggata 531



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 534 gatagatggatggatggata 515

to top

>emb|CR693293.2|CNS0FXW9 Tetraodon nigroviridis full-length cDNA
          Length = 876

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 242 gatagatggatggatggataa 262
           |||||||||||||||||||||
Sbjct: 733 gatagatggatggatggataa 713



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 241 cgatagatggatggatggat 260
           ||||||||||||||||||||
Sbjct: 806 cgatagatggatggatggat 787



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 681 gatagatggatggatggata 662



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 633 gatagatggatggatggata 614

to top

>emb|CR685962.2|CNS0FS8M Tetraodon nigroviridis full-length cDNA
          Length = 761

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 242 gatagatggatggatggataa 262
           |||||||||||||||||||||
Sbjct: 743 gatagatggatggatggataa 723



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 671 gatagatggatggatggata 652



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 603 gatagatggatggatggata 584



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 547 gatagatggatggatggata 528



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 531 gatagatggatggatggata 512

to top

>emb|CR690080.2|CNS0FVF0 Tetraodon nigroviridis full-length cDNA
          Length = 768

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 242 gatagatggatggatggataa 262
           |||||||||||||||||||||
Sbjct: 750 gatagatggatggatggataa 730



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 610 gatagatggatggatggata 591



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 554 gatagatggatggatggata 535



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 538 gatagatggatggatggata 519

to top

>emb|CR687426.2|CNS0FTDA Tetraodon nigroviridis full-length cDNA
          Length = 776

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 242 gatagatggatggatggataa 262
           |||||||||||||||||||||
Sbjct: 694 gatagatggatggatggataa 674



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 622 gatagatggatggatggata 603



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 566 gatagatggatggatggata 547



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 550 gatagatggatggatggata 531

to top

>gb|AC069285.8| Homo sapiens BAC clone RP11-196D18 from 7, complete sequence
          Length = 175952

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 16232 gatagatggatggatggataa 16212

to top

>gb|AC159140.10| Mus musculus chromosome 7, clone RP24-84I4, complete sequence
          Length = 202318

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 93236 tagatgatagatggatggatggata 93212

to top

>gb|AC145925.2| Pan troglodytes BAC clone RP43-40L5 from 7, complete sequence
          Length = 156109

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 242   gatagatggatggatggataactgg 266
             ||||||||||||||||||| |||||
Sbjct: 41732 gatagatggatggatggatgactgg 41708

to top

>emb|AL163280.2|HS21C080 Homo sapiens chromosome 21 segment HS21C080
          Length = 340000

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 242  gatagatggatggatggataa 262
            |||||||||||||||||||||
Sbjct: 3023 gatagatggatggatggataa 3003

to top

>emb|CR855321.8| Zebrafish DNA sequence from clone CH211-87E10 in linkage group 5,
             complete sequence
          Length = 53654

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 239   gacgatagatggatggatgga 259
             |||||||||||||||||||||
Sbjct: 18419 gacgatagatggatggatgga 18439

to top

>emb|Z68323.2|HSN13G6 Human DNA sequence from clone LL22NC03-13G6 on chromosome 22, complete
             sequence
          Length = 31004

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 21271 tagatgatagatggatggatggata 21247

to top

>emb|Z82202.1|HS34P24 Human DNA sequence from clone RP1-34P24 on chromosome 22, complete
             sequence
          Length = 105357

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 74648 gatagatggatggatggataa 74668

to top

>emb|BX649443.16| Human DNA sequence from clone CTD-2589D3 on chromosome X Contains part
             of the DHRSX gene for dehydrogenase/reductase (SDR family)
             X-linked and a novel gene, complete sequence
          Length = 79564

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 31255 gatagatggatggatggataa 31275

to top

>emb|AL355591.13| Human DNA sequence from clone RP11-300B7 on chromosome 10 Contains a
             CpG island, complete sequence
          Length = 129839

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 89363 gatagatggatggatggataa 89343

to top

>emb|AL355809.11| Human DNA sequence from clone RP4-650K8 on chromosome 1 Contains part
             of the gene for a novel protein, complete sequence
          Length = 120340

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 69417 gatagatggatggatggataa 69397

to top

>gb|AF235104.5| Homo sapiens chromosome 8 clone GS1-251I7 map p21-p11, complete sequence
          Length = 175380

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 112403 gatagatggatggatggataa 112383

to top

>emb|AL109828.22|HSJ586J11 Human DNA sequence from clone RP4-586J11 on chromosome 20 Contains
             ESTs, complete sequence
          Length = 91350

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 39313 gatagatggatggatggataa 39293

to top

>emb|BX890581.13| Zebrafish DNA sequence from clone CH211-222O19 in linkage group 21,
             complete sequence
          Length = 205143

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 52432 tagatgatagatggatggatggata 52456

to top

>emb|BX323824.17| Zebrafish DNA sequence from clone DKEY-37F18 in linkage group 25,
             complete sequence
          Length = 168743

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 51354 gatagatggatggatggataa 51334

to top

>gb|AC175363.2| Pan troglodytes chromosome X clone CH251-7A1 map human ortholog p11.4,
              complete sequence
          Length = 221738

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 155569 gatagatggatggatggataa 155589

to top

>gb|AC118283.5| Homo sapiens BAC clone RP11-1398P2 from 4, complete sequence
          Length = 130805

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 242  gatagatggatggatggataa 262
            |||||||||||||||||||||
Sbjct: 1718 gatagatggatggatggataa 1738



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 235  ggtagacgatagatggatggatggataa 262
            |||||| ||| |||||||||||||||||
Sbjct: 1424 ggtagaggatggatggatggatggataa 1451

to top

>emb|AL596215.7| Mouse DNA sequence from clone RP23-278I21 on chromosome 11, complete
             sequence
          Length = 203117

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 37398 gatagatggatggatggataa 37418

to top

>gb|AC153146.5| Mus musculus BAC clone RP23-217F11 from chromosome 8, complete sequence
          Length = 212278

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 204254 tagatgatagatggatggatggata 204230

to top

>emb|AL845512.9| Zebrafish DNA sequence from clone CH211-286M4 in linkage group 4
             Contains the gene for a novel protein similar to mouse and
             human F-box protein 7  (FBXO7), the gene for a novel
             protein similar to human exportin tRNA (nuclear export
             receptor for tRNAs) (XPOT), the gene for a novel protein
             similar to parathyroid hormone-like hormone (PTHLH), the
             3' end of a novel gene, a novel gene and two CpG islands,
             complete sequence
          Length = 192940

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 79048 gatagatggatggatggataa 79028

to top

>gb|AC103758.14| Homo sapiens chromosome 8, clone CTD-3135A9, complete sequence
          Length = 235357

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 53313 gatagatggatggatggataa 53333

to top

>gb|AC136964.2| Sus scrofa domestica clone RP44-154L9, complete sequence
          Length = 164640

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 109398 gatagatggatggatggataa 109418

to top

>emb|BX927303.11| Zebrafish DNA sequence from clone CH211-67L13 in linkage group 6,
              complete sequence
          Length = 163380

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 240    acgatagatggatggatggat 260
              |||||||||||||||||||||
Sbjct: 106490 acgatagatggatggatggat 106510

to top

>emb|BX571701.10| Zebrafish DNA sequence from clone CH211-233M11 in linkage group 13,
             complete sequence
          Length = 154641

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 240   acgatagatggatggatggat 260
             |||||||||||||||||||||
Sbjct: 90592 acgatagatggatggatggat 90612



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 240   acgatagatggatggatggat 260
             |||||||||||||||||||||
Sbjct: 90472 acgatagatggatggatggat 90492



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 90226 gatagatggatggatggata 90245

to top

>emb|CR385074.10| Zebrafish DNA sequence from clone CH211-258K6 in linkage group 23,
              complete sequence
          Length = 163114

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 116041 tagatgatagatggatggatggata 116017

to top

>gb|AC157561.10| Mus musculus chromosome 7, clone RP23-356A20, complete sequence
          Length = 232927

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 240    acgatagatggatggatggat 260
              |||||||||||||||||||||
Sbjct: 228804 acgatagatggatggatggat 228824

to top

>emb|BX571949.19| Zebrafish DNA sequence from clone DKEY-25F1 in linkage group 11, complete
              sequence
          Length = 149012

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 137725 gatagatggatggatggataa 137705

to top

>emb|BX901978.14| Zebrafish DNA sequence from clone DKEY-155M6 in linkage group 18,
             complete sequence
          Length = 168101

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 240   acgatagatggatggatggat 260
             |||||||||||||||||||||
Sbjct: 28790 acgatagatggatggatggat 28770

to top

>emb|AL929566.30| Zebrafish DNA sequence from clone CH211-159C13 in linkage group 8,
             complete sequence
          Length = 137166

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 63845 gatagatggatggatggataa 63865

to top

>emb|BX469920.6| Zebrafish DNA sequence from clone DKEY-237J21 in linkage group 24,
             complete sequence
          Length = 123617

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 17256 gatagatggatggatggataa 17236

to top

>emb|BX510999.11| Zebrafish DNA sequence from clone CH211-157P22 in linkage group 5,
              complete sequence
          Length = 160405

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 124281 gatagatggatggatggataa 124261

to top

>emb|CR382344.9| Zebrafish DNA sequence from clone DKEY-150D12 in linkage group 8,
              complete sequence
          Length = 182390

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 242    gatagatggatggatggataactgg 266
              ||||||||| |||||||||||||||
Sbjct: 131143 gatagatgggtggatggataactgg 131167

to top

>dbj|BS000598.1| Pan troglodytes chromosome Y clone:PTB-224I01, complete sequences
          Length = 153754

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 79982 gatagatggatggatggataa 80002

to top

>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence
          Length = 23952694

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 242      gatagatggatggatggataa 262
                |||||||||||||||||||||
Sbjct: 22256675 gatagatggatggatggataa 22256655

to top

>gb|AC011499.5| Homo sapiens chromosome 19 clone CTB-54O9, complete sequence
          Length = 199776

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 136184 gatagatggatggatggataa 136204

to top

>emb|BX470133.27| Zebrafish DNA sequence from clone DKEY-169N7 in linkage group 9, complete
              sequence
          Length = 178929

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 149276 gatagatggatggatggataa 149256

to top

>gb|AC021553.14| Homo sapiens chromosome 15, clone RP11-709B3, complete sequence
          Length = 185596

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 120383 gatagatggatggatggataa 120403

to top

>gb|AC158604.5| Mus musculus 10 BAC RP23-130B2 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 190024

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 81100 tagatgatagatggatggatggata 81124

to top

>gb|AC091988.3| Homo sapiens chromosome 5 clone RP11-73G8, complete sequence
          Length = 148263

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 91685 tagatgatagatggatggatggata 91709

to top

>gb|AC013643.10| Homo sapiens chromosome 8, clone RP11-16P20, complete sequence
          Length = 157324

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 108909 gatagatggatggatggataa 108889

to top

>gb|AC022832.13| Homo sapiens chromosome 8, clone RP11-145O15, complete sequence
          Length = 166236

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 85175 gatagatggatggatggataa 85195

to top

>emb|BX324129.11| Zebrafish DNA sequence from clone CH211-221D5 in linkage group 2,
             complete sequence
          Length = 111186

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 89134 gatagatggatggatggataa 89154

to top

>gb|AC182231.2| Mus musculus BAC clone RP23-356C18 from chromosome 8, complete sequence
          Length = 206310

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 45921 gatagatggatggatggataa 45901

to top

>gb|AC157511.2| Mus musculus BAC clone RP24-456J10 from chromosome 9, complete sequence
          Length = 167921

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 33783 tagatgatagatggatggatggata 33807

to top

>gb|AC101979.13| Mus musculus chromosome 3, clone RP24-338A7, complete sequence
          Length = 161025

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 237  tagacgatagatggatggatggata 261
            |||| ||||||||||||||||||||
Sbjct: 8423 tagatgatagatggatggatggata 8447

to top

>gb|AC096627.28| Mus musculus strain C57BL/6J clone rp23-77b23 map 11, complete sequence
          Length = 264908

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 39299 gatagatggatggatggataa 39279

to top

>gb|AC153579.10| Mus musculus 6 BAC RP23-21F2 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 228481

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 242    gatagatggatggatggataactgg 266
              ||||||||||||||||||| |||||
Sbjct: 118358 gatagatggatggatggatgactgg 118382

to top

>dbj|AK086407.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched
            library, clone:D930026C10 product:hypothetical protein,
            full insert sequence
          Length = 2041

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 242  gatagatggatggatggataa 262
            |||||||||||||||||||||
Sbjct: 1144 gatagatggatggatggataa 1124

to top

>dbj|AK037455.1| Mus musculus 16 days neonate thymus cDNA, RIKEN full-length enriched
            library, clone:A130019P07 product:unclassifiable, full
            insert sequence
          Length = 2745

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 237  tagacgatagatggatggatggata 261
            |||| ||||||||||||||||||||
Sbjct: 1609 tagatgatagatggatggatggata 1633

to top

>emb|BX323039.6| Zebrafish DNA sequence from clone CH211-145A11 in linkage group 10,
              complete sequence
          Length = 150772

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 103987 gatagatggatggatggataa 104007



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 241    cgatagatggatggatggata 261
              |||||||||||||||||||||
Sbjct: 103508 cgatagatggatggatggata 103528

to top

>gb|AC090386.13| Homo sapiens chromosome 18, clone RP11-797E24, complete sequence
          Length = 185563

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 26234 gatagatggatggatggataa 26254



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 26017 gatagatggatggatggataa 26037

to top

>gb|AC107739.9| Mus musculus chromosome 7, clone RP23-345M1, complete sequence
          Length = 205227

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 155630 tagatgatagatggatggatggata 155654

to top

>gb|AC154876.7| Mus musculus chromosome 3, clone RP23-190D19, complete sequence
          Length = 196840

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 188468 tagatgatagatggatggatggata 188492

to top

>gb|AC147067.4| Homo sapiens BAC clone RP13-1016M1 from 4, complete sequence
          Length = 167744

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 242  gatagatggatggatggataa 262
            |||||||||||||||||||||
Sbjct: 4115 gatagatggatggatggataa 4135



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 235  ggtagacgatagatggatggatggataa 262
            |||||| ||| |||||||||||||||||
Sbjct: 3821 ggtagaggatggatggatggatggataa 3848

to top

>gb|AC007879.4| Homo sapiens BAC clone RP11-309L6 from 2, complete sequence
          Length = 158841

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 69248 tagatgatagatggatggatggata 69224

to top

>gb|AC015974.10| Homo sapiens BAC clone RP11-467A18 from 2, complete sequence
          Length = 196544

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 64779 gatagatggatggatggataa 64799

to top

>gb|AC005479.2|AC005479 Homo sapiens PAC clone RP3-449M8 from 14q24.3, complete sequence
          Length = 140425

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 68582 gatagatggatggatggataa 68562

to top

>gb|AC087557.20| Mus musculus strain C57BL/6J chromosome 9 clone rp23-184f1, complete
              sequence
          Length = 186745

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 246    gatggatggatggataactgg 266
              |||||||||||||||||||||
Sbjct: 148344 gatggatggatggataactgg 148364

to top

>gb|AF456419.1| Takifugu rubripes PDGFRalpha (PDGFRalpha) gene, complete cds,
            alternatively spliced; and kinase receptor c-kit (c-kit)
            gene, complete cds
          Length = 54735

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 240  acgatagatggatggatggat 260
            |||||||||||||||||||||
Sbjct: 5030 acgatagatggatggatggat 5050

to top

>gb|AC096678.4| Pan troglodytes clone RP43-140G16, complete sequence
          Length = 95528

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 246   gatggatggatggataactgg 266
             |||||||||||||||||||||
Sbjct: 50978 gatggatggatggataactgg 50998

to top

>gb|AC084064.6| Homo sapiens chromosome 16 clone RP11-467I17, complete sequence
          Length = 189897

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 48512 gatagatggatggatggataa 48532

to top

>gb|AC093332.10| Homo sapiens chromosome 18, clone RP11-802O5, complete sequence
          Length = 112270

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 33623 gatagatggatggatggataa 33603



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 33392 gatagatggatggatggataa 33372

to top

>emb|BX088528.7| Zebrafish DNA sequence from clone CH211-226D23 in linkage group 1,
             complete sequence
          Length = 171618

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 240   acgatagatggatggatggat 260
             |||||||||||||||||||||
Sbjct: 46179 acgatagatggatggatggat 46199

to top

>emb|BX276091.6| Zebrafish DNA sequence from clone CH211-267P9 in linkage group 5,
             complete sequence
          Length = 134612

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 42097 gatagatggatggatggataa 42117

to top

>emb|BX248393.5| Zebrafish DNA sequence from clone CH211-233O13, complete sequence
          Length = 166286

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 39726 gatagatggatggatggataa 39706

to top

>emb|BX537113.8| Zebrafish DNA sequence from clone CH211-207G17 in linkage group 16,
             complete sequence
          Length = 218597

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 19730 tagatgatagatggatggatggata 19706



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 237   tagacgatagatggatggatggat 260
             |||| |||||||||||||||||||
Sbjct: 19251 tagatgatagatggatggatggat 19228



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 237   tagacgatagatggatggatggat 260
             |||| |||||||||||||||||||
Sbjct: 19005 tagatgatagatggatggatggat 18982

to top

>gb|AC153382.1| Mus musculus 10 BAC RP23-9F3 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 206125

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 25102 tagatgatagatggatggatggata 25126

to top

>emb|BX296535.7| Zebrafish DNA sequence from clone CH211-234I2, complete sequence
          Length = 163120

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 34008 gatagatggatggatggataa 34028



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 244   tagatggatggatggataactggg 267
             ||||||||||||||||||| ||||
Sbjct: 26852 tagatggatggatggataaatggg 26875

to top

>gb|AC117735.8| Mus musculus chromosome 5, clone RP24-132L16, complete sequence
          Length = 183861

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 242   gatagatggatggatggataactgg 266
             ||||||||||||||||||| |||||
Sbjct: 54747 gatagatggatggatggatgactgg 54723

to top

>emb|CT025582.12| Zebrafish DNA sequence from clone DKEY-220G3 in linkage group 2,
             complete sequence
          Length = 164685

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 79478 gatagatggatggatggataa 79498

to top

>emb|CR931778.23| Zebrafish DNA sequence from clone DKEY-265O4 in linkage group 4,
             complete sequence
          Length = 64016

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 10959 gatagatggatggatggataa 10939

to top

>emb|CR790375.9| Zebrafish DNA sequence from clone CH211-251O16 in linkage group 4,
             complete sequence
          Length = 153499

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 69530 gatagatggatggatggataa 69510



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 240   acgatagatggatggatggat 260
             |||||||||||||||||||||
Sbjct: 54055 acgatagatggatggatggat 54075

to top

>emb|CR846099.7| Zebrafish DNA sequence from clone DKEY-182M23 in linkage group 12,
            complete sequence
          Length = 140422

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 242  gatagatggatggatggataa 262
            |||||||||||||||||||||
Sbjct: 4227 gatagatggatggatggataa 4247

to top

>emb|CR751229.6| Zebrafish DNA sequence from clone CH211-116I17 in linkage group 4,
             complete sequence
          Length = 58988

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 23533 gatagatggatggatggataa 23513

to top

>emb|BX927361.31| Zebrafish DNA sequence from clone CH211-121K8 in linkage group 9,
             complete sequence
          Length = 177986

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 47636 gatagatggatggatggataa 47616

to top

>emb|CR387935.16| Zebrafish DNA sequence from clone CH211-212O1 in linkage group 18,
            complete sequence
          Length = 152685

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 240  acgatagatggatggatggat 260
            |||||||||||||||||||||
Sbjct: 8188 acgatagatggatggatggat 8208

to top

>emb|CR382286.9| Zebrafish DNA sequence from clone CH211-12J10 in linkage group 19,
             complete sequence
          Length = 149742

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 47370 gatagatggatggatggataa 47390

to top

>emb|BX649350.9| Zebrafish DNA sequence from clone CH211-161F1 in linkage group 4,
             complete sequence
          Length = 115188

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 85758 gatagatggatggatggataa 85738



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 243   atagatggatggatggataa 262
             ||||||||||||||||||||
Sbjct: 33167 atagatggatggatggataa 33148

to top

>emb|CR318592.7| Zebrafish DNA sequence from clone CH211-51F17 in linkage group 19,
             complete sequence
          Length = 124310

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 26294 gatagatggatggatggataa 26274

to top

>emb|BX890545.7| Zebrafish DNA sequence from clone CH211-253N4 in linkage group 4,
           complete sequence
          Length = 186267

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 246 gatggatggatggataactgg 266
           |||||||||||||||||||||
Sbjct: 469 gatggatggatggataactgg 449

to top

>emb|BX901967.4| Zebrafish DNA sequence from clone CH211-195J16 in linkage group 4,
            complete sequence
          Length = 5182

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 246  gatggatggatggataactgg 266
            |||||||||||||||||||||
Sbjct: 3651 gatggatggatggataactgg 3631

to top

>emb|BX247873.15| Zebrafish DNA sequence from clone CH211-198O12 in linkage group 8,
             complete sequence
          Length = 139803

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 240   acgatagatggatggatggat 260
             |||||||||||||||||||||
Sbjct: 20751 acgatagatggatggatggat 20731

to top

>emb|AL953910.14| Zebrafish DNA sequence from clone DKEY-31E10 in linkage group 1,
             complete sequence
          Length = 190793

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 240   acgatagatggatggatggat 260
             |||||||||||||||||||||
Sbjct: 71656 acgatagatggatggatggat 71676



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 71571 gatagatggatggatggata 71590

to top

>emb|AL935282.14| Zebrafish DNA sequence from clone CH211-281O21 in linkage group 2,
             complete sequence
          Length = 173134

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 240   acgatagatggatggatggat 260
             |||||||||||||||||||||
Sbjct: 72247 acgatagatggatggatggat 72227



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 246  gatggatggatggataactgg 266
            |||||||||||||||||||||
Sbjct: 6717 gatggatggatggataactgg 6737



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 246  gatggatggatggataactgg 266
            |||||||||||||||||||||
Sbjct: 6661 gatggatggatggataactgg 6681



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 72285 gatagatggatggatggata 72266

to top

>emb|BX469898.9| Zebrafish DNA sequence from clone DKEY-180H12 in linkage group 18,
            complete sequence
          Length = 185729

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 242  gatagatggatggatggataa 262
            |||||||||||||||||||||
Sbjct: 3863 gatagatggatggatggataa 3883

to top

>emb|AL845365.9| Zebrafish DNA sequence from clone DKEY-150H13 in linkage group 20,
              complete sequence
          Length = 212942

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 116314 gatagatggatggatggataa 116334

to top

>emb|BX470240.8| Zebrafish DNA sequence from clone CH211-92L17 in linkage group 4,
             complete sequence
          Length = 100845

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 92491 gatagatggatggatggataa 92511

to top

>emb|BX511140.4| Zebrafish DNA sequence from clone DKEY-264G21 in linkage group 20,
             complete sequence
          Length = 166153

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 59403 gatagatggatggatggataa 59423

to top

>emb|AL590148.8| Zebrafish DNA sequence from clone RP71-30I22 in linkage group 8
             Contains part of a novel gene for a protein similar to
             human FLJ12550, the pim1 gene for pim-1 oncogene (proviral
             integration site 1), part of a novel gene for a protein
             similar to vertebrate UDP-galactose transporters, a novel
             gene for a protein similar to vertebrate caldesmon 1
             (CALD1) and a CpG island, complete sequence
          Length = 140984

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 240   acgatagatggatggatggat 260
             |||||||||||||||||||||
Sbjct: 16651 acgatagatggatggatggat 16631

to top

>emb|CR848722.7| Zebrafish DNA sequence from clone CH211-253H1 in linkage group 15,
             complete sequence
          Length = 45585

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 27105 gatagatggatggatggataa 27085

to top

>emb|BX927333.11| Zebrafish DNA sequence from clone CH211-69C15 in linkage group 10,
              complete sequence
          Length = 146168

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 111291 gatagatggatggatggataa 111271



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 110930 gatagatggatggatggataa 110910

to top

>gb|AC158127.3| Mus musculus chromosome 19, clone RP23-135N12, complete sequence
          Length = 217544

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 14878 tagatgatagatggatggatggata 14854



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 14777 tagatgatagatggatggatggata 14753



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 14427 tagatgatagatggatggatggata 14403



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 14396 tagatgatagatggatggatggata 14372



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 14304 tagatgatagatggatggatggata 14280



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 237   tagacgatagatggatggatggat 260
             |||| |||||||||||||||||||
Sbjct: 15199 tagatgatagatggatggatggat 15176



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 237   tagacgatagatggatggatggat 260
             |||| |||||||||||||||||||
Sbjct: 14843 tagatgatagatggatggatggat 14820



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 237   tagacgatagatggatggatggat 260
             |||| |||||||||||||||||||
Sbjct: 14661 tagatgatagatggatggatggat 14638



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 237   tagacgatagatggatggatggat 260
             |||| |||||||||||||||||||
Sbjct: 14521 tagatgatagatggatggatggat 14498



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 14445 gatagatggatggatggata 14426

to top

>emb|AL352976.3|CNS05TBV Human chromosome 14 DNA sequence BAC R-487K10 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 180460

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 92910 gatagatggatggatggataa 92890

to top

>emb|BX629356.1|CNS09SBW Tetraodon nigroviridis BAC sequence
          Length = 101385

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 49359 gatagatggatggatggataa 49379

to top

>emb|BX296559.14| Zebrafish DNA sequence from clone CH211-285F17 in linkage group 24,
             complete sequence
          Length = 171695

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 82673 gatagatggatggatggataa 82653

to top

>emb|CR548632.13| Zebrafish DNA sequence from clone DKEY-175H17 in linkage group 24,
              complete sequence
          Length = 178393

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 154141 gatagatggatggatggataa 154161

to top

>emb|AL928856.5| Mouse DNA sequence from clone RP23-413G24 on chromosome 2, complete
             sequence
          Length = 108193

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 17031 tagatgatagatggatggatggata 17007

to top

>gb|AC005796.1|AC005796 Homo sapiens chromosome 19, cosmid R31408, complete sequence
          Length = 43843

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 242  gatagatggatggatggataa 262
            |||||||||||||||||||||
Sbjct: 8634 gatagatggatggatggataa 8614

to top

>emb|AL954327.12| Zebrafish DNA sequence from clone DKEY-18H14 in linkage group 16,
             complete sequence
          Length = 237124

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 240   acgatagatggatggatggat 260
             |||||||||||||||||||||
Sbjct: 11274 acgatagatggatggatggat 11254

to top

>emb|CR854829.14| Zebrafish DNA sequence from clone DKEY-285B23 in linkage group 15,
             complete sequence
          Length = 166918

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 85518 gatagatggatggatggataa 85538

to top

>emb|AL807828.14| Mouse DNA sequence from clone RP23-184N11 on chromosome 4, complete
              sequence
          Length = 174593

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 122629 gatagatggatggatggataa 122649

to top

>emb|AL935202.7| Zebrafish DNA sequence from clone CH211-197E11, complete sequence
          Length = 189096

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 68271 gatagatggatggatggataa 68251

to top

>emb|AL732611.21| Mouse DNA sequence from clone RP23-135A21 on chromosome 4, complete
              sequence
          Length = 143036

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 112536 gatagatggatggatggataa 112556

to top

>emb|CR456684.10| Zebrafish DNA sequence from clone DKEY-46I8 in linkage group 12,
             complete sequence
          Length = 262809

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 87235 gatagatggatggatggataa 87255

to top

>gb|AC159826.1| Gallus gallus BAC clone CH261-57J20 from chromosome unknown, complete
             sequence
          Length = 207137

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 98    agataagacatgttgtttcttcctc 122
             |||||| ||||||||||||||||||
Sbjct: 89287 agataatacatgttgtttcttcctc 89263

to top

>emb|AL929124.13| Zebrafish DNA sequence from clone CH211-128D23, complete sequence
          Length = 165243

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 46085 gatagatggatggatggataa 46105

to top

>emb|AL953866.5| Zebrafish DNA sequence from clone DKEY-60I9 in linkage group 21, complete
              sequence
          Length = 198925

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 122998 gatagatggatggatggataa 123018

to top

>emb|AL807818.14| Zebrafish DNA sequence from clone CH211-225H24, complete sequence
          Length = 194425

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 149708 tagatgatagatggatggatggata 149732

to top

>emb|AL772300.10| Zebrafish DNA sequence from clone CH211-165G14, complete sequence
          Length = 155951

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 138353 gatagatggatggatggataa 138373



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 138337 gatagatggatggatggata 138356

to top

>gb|AC108836.23| Mus musculus chromosome 19, clone RP23-276L15, complete sequence
          Length = 196065

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 125438 tagatgatagatggatggatggata 125414



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 125337 tagatgatagatggatggatggata 125313



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 124987 tagatgatagatggatggatggata 124963



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 124956 tagatgatagatggatggatggata 124932



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 124864 tagatgatagatggatggatggata 124840



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 237    tagacgatagatggatggatggat 260
              |||| |||||||||||||||||||
Sbjct: 125759 tagatgatagatggatggatggat 125736



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 237    tagacgatagatggatggatggat 260
              |||| |||||||||||||||||||
Sbjct: 125403 tagatgatagatggatggatggat 125380



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 237    tagacgatagatggatggatggat 260
              |||| |||||||||||||||||||
Sbjct: 125221 tagatgatagatggatggatggat 125198



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 237    tagacgatagatggatggatggat 260
              |||| |||||||||||||||||||
Sbjct: 125081 tagatgatagatggatggatggat 125058



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 125005 gatagatggatggatggata 124986

to top

>emb|AL645547.14| Mouse DNA sequence from clone RP23-158M12 on chromosome X, complete
             sequence
          Length = 173477

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 242   gatagatggatggatggataactgg 266
             |||||||||||| ||||||||||||
Sbjct: 13844 gatagatggatgaatggataactgg 13820

to top

>emb|AL732590.7| Mouse DNA sequence from clone RP23-464C2 on chromosome 2, complete
              sequence
          Length = 199056

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 237    tagacgatagatggatggatggata 261
              |||| ||||||||||||||||||||
Sbjct: 135616 tagatgatagatggatggatggata 135592

to top

>emb|AJ279975.1|CFA279975 Canis familiaris microsatellite DNA, clone DTRcn.24
          Length = 776

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 242 gatagatggatggatggataa 262
           |||||||||||||||||||||
Sbjct: 451 gatagatggatggatggataa 471

to top

>gb|AC117789.17| Mus musculus chromosome 1, clone RP24-548D18, complete sequence
          Length = 180733

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 237   tagacgatagatggatggatggata 261
             |||| ||||||||||||||||||||
Sbjct: 86136 tagatgatagatggatggatggata 86112

to top

>gb|AF121897.4| Homo sapiens chromosome 21 clone RP1-160L9 map 21q22.2, complete
            sequence
          Length = 132088

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 242  gatagatggatggatggataa 262
            |||||||||||||||||||||
Sbjct: 6509 gatagatggatggatggataa 6489

to top

>dbj|AP003496.1| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1786D2
          Length = 150409

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 103247 gatagatggatggatggataa 103267

to top

>dbj|AP003494.1| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1700D9
          Length = 152142

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 37314 gatagatggatggatggataa 37334

to top

>emb|AL627342.15| Mouse DNA sequence from clone RP23-281G20 on chromosome 4, complete
             sequence
          Length = 84122

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 242   gatagatggatggatggataa 262
             |||||||||||||||||||||
Sbjct: 25474 gatagatggatggatggataa 25494



 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 25458 gatagatggatggatggata 25477

to top

>emb|AL645668.15| Mouse DNA sequence from clone RP23-32L21 on chromosome 4, complete
              sequence
          Length = 143213

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 242    gatagatggatggatggataa 262
              |||||||||||||||||||||
Sbjct: 139093 gatagatggatggatggataa 139113

to top

>gb|AC110244.10| Mus musculus chromosome 5, clone RP23-247E10, complete sequence
          Length = 214638

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 26652 gatagatggatggatggata 26633

to top

>gb|AC115947.8| Mus musculus chromosome 5, clone RP24-560A18, complete sequence
          Length = 202882

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 21208 gatagatggatggatggata 21189

to top

>gb|AC114663.8| Mus musculus chromosome 1, clone RP24-172O22, complete sequence
          Length = 167652

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 166961 gatagatggatggatggata 166980

to top

>gb|AC154262.1| Mus musculus chromosome 14 clone RP24-304G19, complete sequence
          Length = 162962

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 127220 gatagatggatggatggata 127239

to top

>gb|AC108429.11| Mus musculus chromosome 7, clone RP23-161B5, complete sequence
          Length = 186903

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 73116 gatagatggatggatggata 73135

to top

>gb|AC102892.9| Mus musculus chromosome 5, clone RP24-362B10, complete sequence
          Length = 158043

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 122917 gatagatggatggatggata 122936

to top

>gb|AC171406.3| Mus musculus  BAC RP24-475O6 (Roswell Park Cancer Institute (C57BL/6J
            Male) Mouse BAC Library) complete sequence
          Length = 192548

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 242  gatagatggatggatggata 261
            ||||||||||||||||||||
Sbjct: 5673 gatagatggatggatggata 5692

to top

>gb|AC129545.5| Mus musculus chromosome 1, clone RP23-264E23, complete sequence
          Length = 180431

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 172005 gatagatggatggatggata 172024

to top

>gb|AC131995.14| Mus musculus chromosome 1, clone RP24-338G10, complete sequence
          Length = 153731

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 122729 gatagatggatggatggata 122710

to top

>gb|AC165157.4| Mus musculus BAC clone RP23-267A24 from chromosome 12, complete sequence
          Length = 205444

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 135196 gatagatggatggatggata 135177

to top

>gb|AC131747.5| Mus musculus BAC clone RP23-36O24 from chromosome 14, complete sequence
          Length = 212930

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 167979 gatagatggatggatggata 167998

to top

>gb|AC102457.11| Mus musculus chromosome 19, clone RP24-312C18, complete sequence
          Length = 147128

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 237    tagacgatagatggatggatggat 260
              |||| |||||||||||||||||||
Sbjct: 131404 tagatgatagatggatggatggat 131381

to top

>gb|AC166991.5| Mus musculus BAC clone RP24-91J15 from chromosome 12, complete sequence
          Length = 199262

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 187336 gatagatggatggatggata 187317

to top

>gb|AC167972.3| Mus musculus BAC clone RP24-73H24 from chromosome 13, complete sequence
          Length = 224330

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 178770 gatagatggatggatggata 178789

to top

>gb|AC166821.2| Mus musculus BAC clone RP24-68F22 from chromosome 17, complete sequence
          Length = 202649

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 185624 gatagatggatggatggata 185605

to top

>gb|AC166158.3| Mus musculus BAC clone RP24-244P14 from chromosome 1, complete sequence
          Length = 170234

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 47022 gatagatggatggatggata 47003

to top

>gb|AC139293.4| Mus musculus BAC clone RP24-381N4 from chromosome 8, complete
            sequence
          Length = 161248

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 242  gatagatggatggatggata 261
            ||||||||||||||||||||
Sbjct: 5651 gatagatggatggatggata 5632

to top

>gb|AC132617.4| Mus musculus BAC clone RP23-230A6 from chromosome 12, complete sequence
          Length = 239046

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 174695 gatagatggatggatggata 174676

to top

>gb|AC123952.5| Mus musculus BAC clone RP23-195B3 from chromosome 5, complete sequence
          Length = 191582

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 246   gatggatggatggataactg 265
             ||||||||||||||||||||
Sbjct: 30446 gatggatggatggataactg 30465

to top

>gb|AC167126.6| Mus musculus chromosome 1, clone RP24-104I19, complete sequence
          Length = 156900

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 148899 gatagatggatggatggata 148880

to top

>gb|AC158803.11| Mus musculus 10 BAC RP24-186E11 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 168941

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 46697 gatagatggatggatggata 46678

to top

>gb|AC163020.9| Mus musculus chromosome 7, clone RP23-36L11, complete sequence
          Length = 215384

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 31754 gatagatggatggatggata 31773

to top

>gb|AC119874.12| Mus musculus chromosome 8, clone RP24-289B21, complete sequence
          Length = 170702

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 237   tagacgatagatggatggatggat 260
             |||| |||||||||||||||||||
Sbjct: 87288 tagatgatagatggatggatggat 87311

to top

>gb|AC161516.9| Mus musculus chromosome 5, clone RP23-130C18, complete sequence
          Length = 226006

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 82373 gatagatggatggatggata 82392

to top

>gb|AC164410.5| Mus musculus chromosome 5, clone RP23-6J21, complete sequence
          Length = 245837

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 30734 gatagatggatggatggata 30715

to top

>gb|AC167232.5| Mus musculus  BAC RP24-496C19 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 174683

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 56353 gatagatggatggatggata 56334

to top

>gb|AC125267.18| Mus musculus chromosome 10, clone RP24-483E18, complete sequence
          Length = 203922

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 112081 gatagatggatggatggata 112100

to top

>gb|AC161412.10| Mus musculus chromosome 7, clone RP24-78I5, complete sequence
          Length = 172087

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 66691 gatagatggatggatggata 66710

to top

>gb|AC168273.3| Mus musculus  BAC RP23-184H4 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 202998

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 133350 gatagatggatggatggata 133331

to top

>gb|BT018915.1| Zea mays clone EL01T0403H03.d mRNA sequence
          Length = 1155

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 247  atggatggatggataactgg 266
            ||||||||||||||||||||
Sbjct: 1077 atggatggatggataactgg 1096

to top

>gb|AC113547.27| Mus musculus chromosome 12, clone RP23-263J2, complete sequence
          Length = 197242

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 23517 gatagatggatggatggata 23498

to top

>gb|AC115930.10| Mus musculus chromosome 3, clone RP24-534H10, complete sequence
          Length = 158041

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 129248 gatagatggatggatggata 129229

to top

>gb|AC137110.11| Mus musculus chromosome 7, clone RP23-399P8, complete sequence
          Length = 199827

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 27349 gatagatggatggatggata 27368

to top

>gb|AY591719.1| Mus musculus clone IgKVk4-58 immunoglobulin kappa-like gene, partial
            sequence
          Length = 4001

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 242  gatagatggatggatggata 261
            ||||||||||||||||||||
Sbjct: 3224 gatagatggatggatggata 3205

to top

>gb|AC162171.7| Mus musculus chromosome 5, clone RP23-143N11, complete sequence
          Length = 229553

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 192070 gatagatggatggatggata 192089

to top

>gb|AY368673.1| Triticum turgidum HMW-glutenin locus, complete sequence
          Length = 285506

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 195568 gatagatggatggatggata 195587

to top

>gb|AY225963.1| Lymnaea stagnalis microsatellite D5 sequence
          Length = 142

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 42  gatagatggatggatggata 23

to top

>gb|AY024069.1| Oryza sativa microsatellite MRG6394 containing (GATA)X20, genomic
           sequence
          Length = 280

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 177 gatagatggatggatggata 196

to top

>gb|AC138210.10| Mus musculus chromosome 1, clone RP23-346B12, complete sequence
          Length = 206044

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 130802 gatagatggatggatggata 130821

to top

>gb|AY258673.1| Xiphophorus maculatus microsatellite Msd027 sequence
          Length = 625

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 242 gatagatggatggatggata 261
           ||||||||||||||||||||
Sbjct: 395 gatagatggatggatggata 414

to top

>gb|AC093481.8| Mus musculus chromosome 18, clone RP23-62E19, complete sequence
          Length = 242587

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 241   cgatagatggatggatggat 260
             ||||||||||||||||||||
Sbjct: 82133 cgatagatggatggatggat 82114

to top

>gb|AC165170.2| Mus musculus BAC clone CH25-458O4 from chromosome 16, complete sequence
          Length = 105383

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 99063 gatagatggatggatggata 99082

to top

>gb|AC164622.3| Mus musculus BAC clone CH36-287E13 from chromosome 13, complete
             sequence
          Length = 174691

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 84505 gatagatggatggatggata 84486

to top

>gb|AC156576.3| Mus musculus BAC clone RP23-7C22 from chromosome 13, complete sequence
          Length = 205345

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 13067 gatagatggatggatggata 13048

to top

>gb|AC165091.3| Mus musculus BAC clone RP23-25M19 from chromosome 17, complete sequence
          Length = 198085

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 164828 gatagatggatggatggata 164847

to top

>gb|AC166357.3| Mus musculus BAC clone RP23-360N1 from chromosome 7, complete sequence
          Length = 220916

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 242    gatagatggatggatggata 261
              ||||||||||||||||||||
Sbjct: 206572 gatagatggatggatggata 206553

to top

>gb|AC164096.3| Mus musculus BAC clone RP23-356H17 from chromosome 8, complete sequence
          Length = 229851

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   gatagatggatggatggata 261
             ||||||||||||||||||||
Sbjct: 84773 gatagatggatggatggata 84792


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,912,991
Number of Sequences: 3902068
Number of extensions: 2912991
Number of successful extensions: 289838
Number of sequences better than 10.0: 975
Number of HSP's better than 10.0 without gapping: 976
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 266237
Number of HSP's gapped (non-prelim): 23461
length of query: 333
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 311
effective length of database: 17,147,199,772
effective search space: 5332779129092
effective search space used: 5332779129092
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result