ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd19p10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein 1310 0.0
2gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intr... 813 0.0
3gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 581 e-162
4gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nippon... 581 e-162
5dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 581 e-162
6dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, com... 581 e-162
7dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clon... 581 e-162
8dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clon... 581 e-162
9dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clon... 581 e-162
10gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, c... 579 e-162
11gb|BT016300.1| Zea mays clone Contig133 mRNA sequence 571 e-159
12ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predic... 563 e-157
13gb|AY104464.1| Zea mays PCO114899 mRNA sequence 563 e-157
14gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmT... 563 e-157
15dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clon... 474 e-130
16dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clon... 434 e-118
17emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative... 424 e-115
18gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast int... 256 9e-65
19gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral prot... 246 8e-62
20dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clon... 234 3e-58
21ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predic... 220 5e-54
22dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 220 5e-54
23dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 220 5e-54
24dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D... 220 5e-54
25dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic D... 220 5e-54
26dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic D... 220 5e-54
27dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clon... 220 5e-54
28dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clon... 220 5e-54
29dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mR... 220 5e-54
30dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clon... 220 5e-54
31dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 220 5e-54
32dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 220 5e-54
33dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clon... 220 5e-54
34dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clon... 220 5e-54
35dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clon... 220 5e-54
36dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 220 5e-54
37dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clon... 212 1e-51
38gb|AY112388.1| Zea mays CL24208_1 mRNA sequence 212 1e-51
39gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic prote... 202 1e-48
40gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic prote... 202 1e-48
41gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic prote... 202 1e-48
42gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral prot... 198 2e-47
43gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds 186 7e-44
44gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral prot... 186 7e-44
45gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intr... 186 7e-44
46gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRN... 186 7e-44
47gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral prot... 182 1e-42
48gb|AY105015.1| Zea mays PCO137646 mRNA sequence 182 1e-42
49gb|AY106931.1| Zea mays PCO140073 mRNA sequence 178 2e-41
50gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic prote... 159 1e-35
51ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA 155 2e-34
52dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 155 2e-34
53dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic D... 155 2e-34
54dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic D... 155 2e-34
55dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mR... 155 2e-34
56dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clon... 155 2e-34
57emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro... 155 2e-34
58ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predic... 119 1e-23
59emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4,... 119 1e-23
60dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 119 1e-23
61gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast int... 119 1e-23
62emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein 107 5e-20
63emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Co... 103 8e-19
64emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative to... 100 1e-17
65dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence 98 5e-17
66ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC ... 96 2e-16
67gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, comp... 96 2e-16
68gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mR... 96 2e-16
69gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mR... 96 2e-16
70gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced ... 96 2e-16
71emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Co... 96 2e-16
72emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Co... 96 2e-16
73emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Co... 96 2e-16
74emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Co... 96 2e-16
75emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Co... 96 2e-16
76emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Co... 96 2e-16
77emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Co... 96 2e-16
78dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 96 2e-16
79gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protei... 96 2e-16
80ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa822... 92 3e-15
81gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral prot... 92 3e-15
82dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic D... 92 3e-15
83dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clon... 92 3e-15
84dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsi... 90 1e-14
85emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for put... 88 5e-14
86dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds 88 5e-14
87dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast ... 86 2e-13
88gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral prot... 84 7e-13
89ref|XM_473251.1| Oryza sativa (japonica cultivar-group), predic... 82 3e-12
90emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4,... 82 3e-12
91gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds 82 3e-12
92emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic... 80 1e-11
93gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast i... 80 1e-11
94emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Co... 80 1e-11
95emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Co... 80 1e-11
96dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intri... 78 4e-11
97dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 4e-11
98dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds 76 2e-10
99gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence 74 7e-10
100emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Co... 74 7e-10
101emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Co... 74 7e-10
102emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Co... 72 3e-09
103gb|AF057137.1|AF057137 Arabidopsis thaliana gamma tonoplast intr... 72 3e-09
104emb|AJ133748.1|PAB133748 Picea abies mRNA for major intrinsic pr... 70 1e-08
105gb|AF326506.1|AF326506 Zea mays tonoplast membrane integral prot... 68 4e-08
106emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Co... 68 4e-08
107dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds 68 4e-08
108gb|DQ237285.1| Panax ginseng tonoplast intrinsic protein (TIP1) ... 66 2e-07
109gb|AF271662.1|AF271662 Vitis berlandieri x Vitis rupestris putat... 64 7e-07
110gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic p... 64 7e-07
111ref|NM_188626.1| Oryza sativa (japonica cultivar-group), Ozsa822... 62 3e-06
112ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative... 62 3e-06
113ref|NM_189871.1| Oryza sativa (japonica cultivar-group), mRNA 62 3e-06
114gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 geno... 62 3e-06
115dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 62 3e-06
116dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 62 3e-06
117gb|AF275315.1|AF275315 Lotus japonicus water-selective transport... 62 3e-06
118dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic D... 62 3e-06
119dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 3e-06
120dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mR... 62 3e-06
121dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 3e-06
122dbj|AK099190.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 3e-06
123dbj|AK069592.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 3e-06
124gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 62 3e-06
125dbj|AP004479.1| Lotus japonicus genomic DNA, chromosome 1, clone... 62 3e-06
126dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, compl... 60 1e-05
127ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT... 58 4e-05
128ref|NM_188505.1| Oryza sativa (japonica cultivar-group), Ozsa817... 58 4e-05
129gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds 58 4e-05
130gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds 58 4e-05
131gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP)... 58 4e-05
132dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic D... 58 4e-05
133gb|AF133531.1|AF133531 Mesembryanthemum crystallinum water chann... 58 4e-05
134dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 58 4e-05
135emb|BX823560.1|CNS0A7QS Arabidopsis thaliana Full-length cDNA Co... 56 2e-04
136gb|BT016509.1| Zea mays clone Contig342 mRNA sequence 54 6e-04
137emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic pr... 54 6e-04
138emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquapo... 54 6e-04
139gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putat... 54 6e-04
140gb|AY130971.1| Brassica oleracea var. botrytis tonoplast intrins... 52 0.002
141gb|U92652.2|BOU92652 Brassica oleracea var. botrytis tonoplast i... 52 0.002
142dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds 52 0.002
143gb|AF367456.1| Prunus persica clone gTip1 gamma-tonoplast intrin... 50 0.010
144dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds 50 0.010
145dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds 50 0.010
146ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel A... 48 0.039
147ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron... 48 0.039
148emb|X95952.1|HAAP H.annuus mRNA for aquaporin 48 0.039
149gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic pr... 48 0.039
150gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic pr... 48 0.039
151gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral prot... 48 0.039
152emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Co... 48 0.039
153emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Co... 48 0.039
154emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Co... 48 0.039
155gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete s... 48 0.039
156dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 48 0.039
157gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 48 0.039
158gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integr... 48 0.039
159emb|X53040.1|RNNIP26 R.norvegicus MIP-26 mRNA 46 0.15
160gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA,... 46 0.15
161emb|X53052.1|RRMIP Rat partial mRNA for main intrinsic protein 46 0.15
162emb|X12514.1|RNMIP26R Rat mRNA fragment for main intrinsic prote... 46 0.15
163emb|AJ251652.1|MTR251652 Medicago truncatula mRNA for aquaporin ... 46 0.15
164emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonopla... 46 0.15
165gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome 46 0.15
166emb|BX822968.1|CNS0A5UC Arabidopsis thaliana Full-length cDNA Co... 46 0.15
167gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, com... 46 0.15
168ref|XM_343137.2| PREDICTED: Rattus norvegicus major intrinsic pr... 46 0.15
169gb|AY207429.1| Homo sapiens interleukin 11 (IL11) gene, complete... 46 0.15
170emb|AJ605573.1| Ricinus communis mRNA for aquaporin (Tip1-1 gene... 46 0.15
171gb|AY112625.1| Zea mays CL46210_1 mRNA sequence 46 0.15
172gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integr... 46 0.15
173gb|AF000143.1|HSAF000143 Human putative alternative lens membran... 46 0.15
174gb|M81890.1|HUMIL11A Human interleukin 11 (IL11) gene, complete ... 46 0.15
175ref|XM_476227.1| Oryza sativa (japonica cultivar-group), predic... 44 0.61
176gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome... 44 0.61
177emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete ch... 44 0.61
178ref|XM_851400.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.61
179ref|XM_536333.2| PREDICTED: Canis familiaris similar to actinin,... 44 0.61
180ref|XM_851314.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.61
181ref|XM_851274.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.61
182ref|XM_851189.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.61
183ref|XM_851152.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.61
184ref|XM_851023.1| PREDICTED: Canis familiaris similar to actinin,... 44 0.61
185dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.61
186dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.61
187ref|XM_343420.2| PREDICTED: Rattus norvegicus similar to RIKEN c... 44 0.61
188gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water chann... 44 0.61
189dbj|AK072531.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.61
190emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 44 0.61
191dbj|AK060193.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.61
192gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.61
193emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa... 44 0.61
194gb|AY839872.1| Vitis vinifera aquaporin (TIP1;1) mRNA, complete cds 42 2.4
195ref|XM_482690.1| Oryza sativa (japonica cultivar-group), mRNA 42 2.4
196ref|XM_480293.1| Oryza sativa (japonica cultivar-group), mRNA 42 2.4
197gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chr... 42 2.4
198gb|AC154709.2| Mus musculus BAC clone RP24-357I4 from chromosome... 42 2.4
199gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome 42 2.4
200ref|XM_593064.2| PREDICTED: Bos taurus similar to tumor protein ... 42 2.4
201gb|AY581827.1| Cynodon dactylon NOD26-like membrane integral pro... 42 2.4
202ref|NM_002457.1| Homo sapiens mucin 2, oligomeric mucus/gel-form... 42 2.4
203gb|AF183913.1| Azospirillum brasilense major outer membrane prot... 42 2.4
204ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquapori... 42 2.4
205ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquapori... 42 2.4
206emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chr... 42 2.4
207ref|XM_567655.1| Cryptococcus neoformans var. neoformans JEC21 h... 42 2.4
208gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, compl... 42 2.4
209gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complet... 42 2.4
210gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complet... 42 2.4
211gb|BC012214.1| Mus musculus Rab geranylgeranyl transferase, a su... 42 2.4
212gb|AY258323.1| Rubella virus strain BRD-II, complete genome 42 2.4
213ref|XM_503667.1| Yarrowia lipolytica CLIB122, YALI0E07557g predi... 42 2.4
214ref|NM_019519.1| Mus musculus Rab geranylgeranyl transferase, a ... 42 2.4
215ref|XM_961391.1| PREDICTED: Tribolium castaneum similar to CG310... 42 2.4
216gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 42 2.4
217emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete ... 42 2.4
218emb|BX640430.1| Bordetella parapertussis strain 12822, complete ... 42 2.4
219emb|AL390091.1|NCB12F1 Neurospora crassa DNA linkage group II BA... 42 2.4
220emb|AJ489613.1|CAR489613 Cicer arietinum partial mRNA for tonopl... 42 2.4
221gb|AC139749.4| Homo sapiens chromosome 11, clone RP13-870H17, co... 42 2.4
222emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 i... 42 2.4
223gb|AC183494.1| Brassica oleracea Contig C, complete sequence 42 2.4
224dbj|AK146917.1| Mus musculus 17 days embryo kidney cDNA, RIKEN f... 42 2.4
225gb|AF271660.1|AF271660 Vitis berlandieri x Vitis rupestris putat... 42 2.4
226ref|XM_926004.1| PREDICTED: Homo sapiens similar to Mucin-2 prec... 42 2.4
227gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsi... 42 2.4
228dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
229gb|AF342810.1|AF342810 Zea mays NOD26-like membrane integral pro... 42 2.4
230gb|AF326507.1|AF326507 Zea mays tonoplast membrane integral prot... 42 2.4
231gb|AF326485.1|AF326485 Zea mays NOD26-like membrane integral pro... 42 2.4
232emb|BX822791.1|CNS0A7SC Arabidopsis thaliana Full-length cDNA Co... 42 2.4
233gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome... 42 2.4
234ref|NM_214226.1| Sus scrofa inositol(1,3,4,5)tetrakisphosphate r... 42 2.4
235gb|AE004658.1| Pseudomonas aeruginosa PAO1, section 219 of 529 o... 42 2.4
236dbj|AP005606.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
237gb|AF127662.1|AF127662 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 2.4
238gb|AF127661.1|AF127661 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 2.4
239gb|AF127660.1|AF127660 Mus musculus strain C57BL/6J RAB geranylg... 42 2.4
240gb|AF127659.1|AF127659 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 2.4
241gb|AF127658.1|AF127658 Mus musculus strain C57BL/6J RAB geranylg... 42 2.4
242gb|AF127657.1|AF127657 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 2.4
243gb|AF127656.1|AF127656 Mus musculus strain C57BL/6J RAB geranylg... 42 2.4
244gb|AF127655.1|AF127655 Mus musculus strain C57BL/6J-gm/gm RAB ge... 42 2.4
245gb|AF127654.1|AF127654 Mus musculus strain C57BL/6J RAB geranylg... 42 2.4
246dbj|AP004558.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
247dbj|AP003798.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
248dbj|AP005501.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.4
249dbj|AK071278.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.4
250gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... 42 2.4
251emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 42 2.4
252gb|AF466200.2| Sorghum bicolor putative protein kinase gene, par... 42 2.4
253emb|AL845372.6| Zebrafish DNA sequence from clone DKEYP-113C1 in... 42 2.4
254gb|AY109651.1| Zea mays CL6730_1 mRNA sequence 42 2.4
255gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP... 42 2.4
256emb|CR381567.9| Zebrafish DNA sequence from clone DKEY-115O4 in ... 42 2.4
257gb|AF026470.1|AF026470 Pseudomonas aeruginosa gluconate represso... 42 2.4
258gb|AC159324.2| Mus musculus BAC clone RP23-9D1 from chromosome 1... 42 2.4
259gb|CP000085.1| Burkholderia thailandensis E264 chromosome II, co... 42 2.4
260emb|CR974568.14| Mouse DNA sequence from clone RP23-39N20 on chr... 42 2.4
261emb|CR388420.19| Zebrafish DNA sequence from clone DKEY-37H18 in... 42 2.4
262gb|L21998.1|HUMMUC2X Homo sapiens intestinal mucin (MUC2) mRNA, ... 42 2.4
263emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 42 2.4
264gb|U88368.1|SSU88368 Sus scrofa inositol(1,3,4,5)tetrakisphospha... 42 2.4
265gb|M94132.1|HUMIMUCB Human mucin 2 (MUC2) mRNA sequence 42 2.4
266gb|L07320.1|HS5E1A Murine cytomegalovirus e1 protein gene, compl... 42 2.4
267ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel A... 40 9.5
268gb|AC164878.2| Mus musculus BAC clone RP23-364G24 from chromosom... 40 9.5
269gb|AC162034.6| Mus musculus chromosome 7, clone RP23-285B12, com... 40 9.5
270gb|CP000096.1| Pelodictyon luteolum DSM 273, complete genome 40 9.5
271gb|DQ215783.1| Taeniopygia guttata clone 0058P0012B09 proteasome... 40 9.5
272ref|XM_465012.1| Oryza sativa (japonica cultivar-group), mRNA 40 9.5
273gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence 40 9.5
274ref|XM_472326.1| Oryza sativa (japonica cultivar-group), predic... 40 9.5
275gb|AF474373.1| Hordeum vulgare subsp. vulgare BAC 259I16, comple... 40 9.5
276ref|NM_001025266.1| Homo sapiens hypothetical gene supported by ... 40 9.5
277gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 40 9.5
278gb|AC145321.3| Oryza sativa (japonica cultivar-group) chromosome... 40 9.5
279gb|CP000010.1| Burkholderia mallei ATCC 23344 chromosome 1, comp... 40 9.5
280ref|XM_366929.1| Magnaporthe grisea 70-15 chromosome VII hypothe... 40 9.5
281ref|XM_414866.1| PREDICTED: Gallus gallus similar to Aquaporin 8... 40 9.5
282ref|XM_426181.1| PREDICTED: Gallus gallus similar to Brix domain... 40 9.5
283gb|CP000285.1| Chromohalobacter salexigens DSM 3043, complete ge... 40 9.5
284gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, com... 40 9.5
285gb|DQ356948.1| Crocodilepox virus, complete genome 40 9.5
286ref|NM_014755.1| Homo sapiens SERTA domain containing 2 (SERTAD2... 40 9.5
287gb|AY502065.1| Streptomyces mobaraensis transglutaminase gene, c... 40 9.5
288gb|AF531437.1| Streptomyces mobaraensis IFO13819 transglutaminas... 40 9.5
289emb|AL591789.1|SME591789 Sinorhizobium meliloti 1021 complete ch... 40 9.5
290ref|XM_855673.1| PREDICTED: Canis familiaris similar to Ankyrin ... 40 9.5
291ref|XM_548420.2| PREDICTED: Canis familiaris similar to Ankyrin ... 40 9.5
292emb|CR847515.10| Zebrafish DNA sequence from clone DKEYP-60A7 in... 40 9.5
293gb|AC012596.4| Homo sapiens BAC clone CTD-2523K17 from 7, comple... 40 9.5
294gb|AY225468.1| Mus musculus interleukin 11 gene, promoter region... 40 9.5
295gb|AC123519.2| Oryza sativa (japonica cultivar-group) chromosome... 40 9.5
296emb|AL161740.16| Human DNA sequence from clone RP6-239D12 on chr... 40 9.5
297gb|AC123518.2| Oryza sativa (japonica cultivar-group) chromosome... 40 9.5
298emb|X63277.1|ZMYPTM1 Z.mays yptm1 cDNA 40 9.5
299emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic p... 40 9.5
300gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g3683... 40 9.5
301gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic... 40 9.5
302gb|AF486513.1| Hordeum vulgare cultivar Yon M Kei GBSSI gene, pr... 40 9.5
303gb|AF486512.1| Hordeum vulgare cultivar CDC Alamo GBSSI gene, pr... 40 9.5
304gb|AF486508.1| Hordeum vulgare cultivar Oderbrucker GBSSI gene, ... 40 9.5
305emb|BX571965.1| Burkholderia pseudomallei strain K96243, chromos... 40 9.5
306emb|AL606611.3|OSJN00044 Oryza sativa genomic DNA, chromosome 4,... 40 9.5
307emb|AL117431.1|HSM800940 Homo sapiens genomic DNA; cDNA DKFZp434... 40 9.5
308emb|BX897736.7| Zebrafish DNA sequence from clone CH211-181B15 i... 40 9.5
309emb|CR857936.1| Pongo pygmaeus mRNA; cDNA DKFZp469G0211 (from cl... 40 9.5
310gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 9.5
311gb|AE005901.1| Caulobacter crescentus CB15 section 227 of 359 of... 40 9.5
312gb|AC023310.4| Homo sapiens chromosome 15, clone RP11-336L20, co... 40 9.5
313dbj|AK091454.1| Homo sapiens cDNA FLJ34135 fis, clone FCBBF3010695 40 9.5
314tpg|BK001890.1| TPA: TPA_inf: Drosophila melanogaster HDC08154 (... 40 9.5
315gb|AE012138.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 9.5
316gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 9.5
317gb|CP000136.1| Rhizobium etli CFN 42 plasmid p42c, complete sequ... 40 9.5
318dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 40 9.5
319gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map ... 40 9.5
320dbj|AB118808.1| Hordeum vulgare subsp. spontaneum GBSSI gene for... 40 9.5
321dbj|AB089162.1| Hordeum vulgare subsp. vulgare GBSSI gene for gr... 40 9.5
322dbj|AB088761.1| Hordeum vulgare subsp. vulgare GBSSI gene for gr... 40 9.5
323gb|AC100757.2| Homo sapiens chromosome 15, clone RP11-566K19, co... 40 9.5
324gb|AC107487.1| Drosophila melanogaster 3L BAC RP98-10D20 (Roswel... 40 9.5
325gb|DQ317109.1| Drosophila pseudoobscura Dscam gene, exons 3 thro... 40 9.5
326emb|BX548249.13| Zebrafish DNA sequence from clone CH211-93A2 in... 40 9.5
327emb|BX119977.10| Zebrafish DNA sequence from clone CH211-198A3 i... 40 9.5
328gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 40 9.5
329gb|AC018843.4|AC018843 Homo sapiens chromosome 3 clone RP11-900O... 40 9.5
330dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.5
331dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.5
332gb|AF326504.1|AF326504 Zea mays tonoplast membrane integral prot... 40 9.5
333emb|AL662997.3|OSJN00205 Oryza sativa genomic DNA, chromosome 4,... 40 9.5
334emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Co... 40 9.5
335emb|BX819122.1|CNS0AA8S Arabidopsis thaliana Full-length cDNA Co... 40 9.5
336emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Co... 40 9.5
337emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Co... 40 9.5
338emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Co... 40 9.5
339emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Co... 40 9.5
340emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Co... 40 9.5
341emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Co... 40 9.5
342emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Co... 40 9.5
343emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Co... 40 9.5
344gb|AY779624.1| Myxococcus xanthus strain DK1622 rod locus, compl... 40 9.5
345gb|AC007365.3| Homo sapiens BAC clone RP11-451M22 from 2, comple... 40 9.5
346gb|AC009496.3| Homo sapiens BAC clone RP11-500G18 from 2, comple... 40 9.5
347gb|AE004695.1| Pseudomonas aeruginosa PAO1, section 256 of 529 o... 40 9.5
348gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete s... 40 9.5
349gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome 40 9.5
350gb|AC136687.6| Homo sapiens chromosome 15, clone RP11-439M15, co... 40 9.5
351gb|AC134393.6| Homo sapiens chromosome 15, clone CTC-803A3, comp... 40 9.5
352gb|AC131280.9| Homo sapiens chromosome 15, clone RP11-467L19, co... 40 9.5
353dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 9.5
354dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 9.5
355dbj|AP006149.2| Oryza sativa (japonica cultivar-group) genomic D... 40 9.5
356dbj|AP003712.4| Oryza sativa (japonica cultivar-group) genomic D... 40 9.5
357gb|AC011599.8|AC011599 Homo sapiens 3 BAC RP11-606C6 (Roswell Pa... 40 9.5
358dbj|AB154356.1| Hordeum vulgare subsp. spontaneum GBSSI gene for... 40 9.5
359dbj|AP004168.3| Oryza sativa (japonica cultivar-group) genomic D... 40 9.5
360dbj|AB118809.1| Hordeum vulgare subsp. spontaneum GBSSI gene for... 40 9.5
361dbj|D50917.1| Homo sapiens mRNA for KIAA0127 gene, partial cds 40 9.5
362dbj|AK112006.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.5
363dbj|AK111927.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.5
364emb|X07932.1|HVWAXYR Barley mRNA pcwx27 for waxy locus 40 9.5
365emb|X07931.1|HVWAXYG Barley DNA for waxy locus encoding starch s... 40 9.5
366dbj|AK109762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.5
367gb|AC007934.7|AC007934 Homo sapiens, clone RP11-29A1, complete s... 40 9.5
368dbj|AK100873.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.5
369dbj|AK069688.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.5
370emb|AL929340.4| Zebrafish DNA sequence from clone CH211-248N16 i... 40 9.5
371emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 40 9.5
372gb|AC006947.2|AC006947 Homo sapiens chromosome 17, clone hRPK.11... 40 9.5
373gb|AE003476.3| Drosophila melanogaster chromosome 3L, section 10... 40 9.5
374gb|U68299.1|MCU68299 Mouse cytomegalovirus 1 complete genomic se... 40 9.5
375emb|CR388150.14| Zebrafish DNA sequence from clone DKEY-115A2 in... 40 9.5
376gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 9.5
377gb|AY885250.2| Dermacentor variabilis vitellogenin (Vg) mRNA, co... 40 9.5
378emb|AL929067.8| Mouse DNA sequence from clone RP24-69A20 on chro... 40 9.5
379gb|DQ202710.1| Olea europaea tonoplast intrinsic protein (tip) m... 40 9.5
380gb|AC034198.7| Homo sapiens chromosome 3 clone RP11-767C1 map 3p... 40 9.5
381gb|AC018836.5| Homo sapiens chromosome 3 clone RP11-588P9 map 3p... 40 9.5
382gb|AF317103.1| Dumontia alaskana specimen-voucher GWS000917 (UNB... 40 9.5
383gb|AF317102.1| Dumontia alaskana specimen-voucher GWS000916 (UNB... 40 9.5
384gb|AF317101.1| Dumontia alaskana specimen-voucher G0221 (UNB) sm... 40 9.5
385gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic pro... 40 9.5
386dbj|AB054056.1| Hordeum vulgare waxy gene, partial sequence, cul... 40 9.5
387dbj|AB054055.2| Hordeum vulgare waxy gene, partial sequence, cul... 40 9.5
388emb|AL772162.4| Mouse DNA sequence from clone RP23-175J8 on chro... 40 9.5

>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein
          Length = 1020

 Score = 1310 bits (661), Expect = 0.0
 Identities = 672/675 (99%), Gaps = 1/675 (0%)
 Strand = Plus / Minus

                                                                        
Query: 19   gaattnacaggttttacacaagcaaattgacagggtcgatcgtcacaggtttcacagcac 78
            ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1020 gaattcacaggttttacacaagcaaattgacagggtcgatcgtcacaggtttcacagcac 961

                                                                        
Query: 79   cacaaactgatggaccgatcgaccctgggaatgggatggattcattcattcaaagcaaac 138
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 960  cacaaactgatggaccgatcgaccctgggaatgggatggattcattcattcaaagcaaac 901

                                                                        
Query: 139  ttaaacgactcatgactggaagcaaggggagacgcgatcgaccacacggacggacgggcg 198
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 900  ttaaacgactcatgactggaagcaaggggagacgcgatcgaccacacggacggacgggcg 841

                                                                        
Query: 199  ggcggggggcaggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcg 258
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 840  ggcggggggcaggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcg 781

                                                                        
Query: 259  ggagatgaagagcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgac 318
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 780  ggagatgaagagcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgac 721

                                                                        
Query: 319  ccagtacacccactggtacccccactcccagctgacgagggcggggccgaaggagacggc 378
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 720  ccagtacacccactggtacccccactcccagctgacgagggcggggccgaaggagacggc 661

                                                                        
Query: 379  ggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaa 438
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 660  ggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaa 601

                                                                        
Query: 439  gccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggc 498
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 600  gccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggc 541

                                                                        
Query: 499  gtacaccgtgtacaccagcccgaaggtcatgacgatctccaggaccaccgcctcccacgc 558
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 540  gtacaccgtgtacaccagcccgaaggtcatgacgatctccaggaccaccgcctcccacgc 481

                                                                        
Query: 559  gccgatgccggtgagcccgaaggtgccggtggggagcccgccggtggagaagcggaggag 618
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 480  gccgatgccggtgagcccgaaggtgccggtggggagcccgccggtggagaagcggaggag 421

                                                                        
Query: 619  gaagcaggcggcggtggagcccagcagctgcgccacccagtagagcaggccgcggaagan 678
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 420  gaagcaggcggcggtggagcccagcagctgcgccacccagtagagcaggccgcggaagag 361

                           
Query: 679  ggttgatgttgccgc 693
            || ||||||||||||
Sbjct: 360  gg-tgatgttgccgc 347



to top

>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1133

 Score =  813 bits (410), Expect = 0.0
 Identities = 455/469 (97%), Gaps = 1/469 (0%)
 Strand = Plus / Minus

                                                                       
Query: 225 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 284
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 845 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 786

                                                                       
Query: 285 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 344
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 785 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 726

                                                                       
Query: 345 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 404
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 725 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 666

                                                                       
Query: 405 cgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgc 464
           ||||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 665 cgccgcccaccaggatgttggcgcccacgatgaagccgatggcgatgggcgcgatggtgc 606

                                                                       
Query: 465 ccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaagg 524
           |||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||
Sbjct: 605 ccaggctgcccttcttggggtccacggccgtggcgtacaccgtgtacaccagcccgaagg 546

                                                                       
Query: 525 tcatgacgatctccaggaccaccgcctcccacgcgccgatgccggtgagcccgaaggtgc 584
           |||| ||||||||||| ||||||||||||||||||||||||||  | |||||||||||||
Sbjct: 545 tcatcacgatctccagcaccaccgcctcccacgcgccgatgccactcagcccgaaggtgc 486

                                                                       
Query: 585 cggtggggagcccgccggtggagaagcggaggaggaagcaggcggcggtggagcccagca 644
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 485 cggtggggagcccgccggtggagaagcggaggaggaagcaggcggcggtggagcccagca 426

                                                            
Query: 645 gctgcgccacccagtagagcaggccgcggaaganggttgatgttgccgc 693
           ||||||| | ||||||||||||||||||||||| || ||||||||||||
Sbjct: 425 gctgcgcgatccagtagagcaggccgcggaagaggg-tgatgttgccgc 378



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 131 aagcaaacttaaacgactcatg 152
           ||||||||||||||||||||||
Sbjct: 977 aagcaaacttaaacgactcatg 956



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 29   gttttacacaagcaaattgacagggtcg 56
            |||||||| |||||||||||||| ||||
Sbjct: 1054 gttttacagaagcaaattgacagtgtcg 1027



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  581 bits (293), Expect = e-162
 Identities = 437/484 (90%), Gaps = 1/484 (0%)
 Strand = Plus / Plus

                                                                           
Query: 210     ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 269
               ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 2544716 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544775

                                                                           
Query: 270     gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 329
               | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 2544776 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544835

                                                                           
Query: 330     actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 389
               ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 2544836 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 2544895

                                                                           
Query: 390     acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 449
               | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 2544896 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 2544955

                                                                           
Query: 450     tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 509
               |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 2544956 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 2545015

                                                                           
Query: 510     acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccgg 569
               | || || ||||||||||||||||||||||| ||||  ||||||||| ||  || |||||
Sbjct: 2545016 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 2545075

                                                                           
Query: 570     tgagcccgaaggtgccggtggggagcccgccggtggagaagcggaggaggaagcaggcgg 629
               | || |||||||||||||||| ||||||||||||||||||||||||||||||||| ||  
Sbjct: 2545076 tcaggccgaaggtgccggtggcgagcccgccggtggagaagcggaggaggaagcacgcca 2545135

                                                                           
Query: 630     cggtggagcccagcagctgcgccacccagtagagcaggccgcggaaganggttgatgttg 689
               ||||||||||||| ||||| || | ||||||||| ||||||||||| | || ||||||||
Sbjct: 2545136 cggtggagcccaggagctgggcgatccagtagaggaggccgcggaacaggg-tgatgttg 2545194

                   
Query: 690     ccgc 693
               ||||
Sbjct: 2545195 ccgc 2545198



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 184     acggacggacgggcgggcggg 204
               |||||||||||||||||||||
Sbjct: 8319519 acggacggacgggcgggcggg 8319499



to top

>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0067N01, from chromosome 3, complete sequence
          Length = 159636

 Score =  581 bits (293), Expect = e-162
 Identities = 437/484 (90%), Gaps = 1/484 (0%)
 Strand = Plus / Minus

                                                                          
Query: 210    ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 269
              ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 125378 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 125319

                                                                          
Query: 270    gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 329
              | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 125318 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 125259

                                                                          
Query: 330    actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 389
              ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 125258 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 125199

                                                                          
Query: 390    acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 449
              | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 125198 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 125139

                                                                          
Query: 450    tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 509
              |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 125138 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 125079

                                                                          
Query: 510    acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccgg 569
              | || || ||||||||||||||||||||||| ||||  ||||||||| ||  || |||||
Sbjct: 125078 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 125019

                                                                          
Query: 570    tgagcccgaaggtgccggtggggagcccgccggtggagaagcggaggaggaagcaggcgg 629
              | || |||||||||||||||| ||||||||||||||||||||||||||||||||| ||  
Sbjct: 125018 tcaggccgaaggtgccggtggcgagcccgccggtggagaagcggaggaggaagcacgcca 124959

                                                                          
Query: 630    cggtggagcccagcagctgcgccacccagtagagcaggccgcggaaganggttgatgttg 689
              ||||||||||||| ||||| || | ||||||||| ||||||||||| | || ||||||||
Sbjct: 124958 cggtggagcccaggagctgggcgatccagtagaggaggccgcggaacaggg-tgatgttg 124900

                  
Query: 690    ccgc 693
              ||||
Sbjct: 124899 ccgc 124896



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  581 bits (293), Expect = e-162
 Identities = 437/484 (90%), Gaps = 1/484 (0%)
 Strand = Plus / Plus

                                                                           
Query: 210     ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 269
               ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 2544826 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 2544885

                                                                           
Query: 270     gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 329
               | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 2544886 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 2544945

                                                                           
Query: 330     actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 389
               ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 2544946 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 2545005

                                                                           
Query: 390     acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 449
               | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 2545006 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 2545065

                                                                           
Query: 450     tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 509
               |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 2545066 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 2545125

                                                                           
Query: 510     acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccgg 569
               | || || ||||||||||||||||||||||| ||||  ||||||||| ||  || |||||
Sbjct: 2545126 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 2545185

                                                                           
Query: 570     tgagcccgaaggtgccggtggggagcccgccggtggagaagcggaggaggaagcaggcgg 629
               | || |||||||||||||||| ||||||||||||||||||||||||||||||||| ||  
Sbjct: 2545186 tcaggccgaaggtgccggtggcgagcccgccggtggagaagcggaggaggaagcacgcca 2545245

                                                                           
Query: 630     cggtggagcccagcagctgcgccacccagtagagcaggccgcggaaganggttgatgttg 689
               ||||||||||||| ||||| || | ||||||||| ||||||||||| | || ||||||||
Sbjct: 2545246 cggtggagcccaggagctgggcgatccagtagaggaggccgcggaacaggg-tgatgttg 2545304

                   
Query: 690     ccgc 693
               ||||
Sbjct: 2545305 ccgc 2545308



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 184     acggacggacgggcgggcggg 204
               |||||||||||||||||||||
Sbjct: 8317354 acggacggacgggcgggcggg 8317334



to top

>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds
          Length = 1080

 Score =  581 bits (293), Expect = e-162
 Identities = 437/484 (90%), Gaps = 1/484 (0%)
 Strand = Plus / Minus

                                                                       
Query: 210 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 269
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 844 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 785

                                                                       
Query: 270 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 329
           | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 784 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 725

                                                                       
Query: 330 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 389
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 724 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 665

                                                                       
Query: 390 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 449
           | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 664 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 605

                                                                       
Query: 450 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 509
           |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 604 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 545

                                                                       
Query: 510 acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccgg 569
           | || || ||||||||||||||||||||||| ||||  ||||||||| ||  || |||||
Sbjct: 544 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 485

                                                                       
Query: 570 tgagcccgaaggtgccggtggggagcccgccggtggagaagcggaggaggaagcaggcgg 629
           | || |||||||||||||||| ||||||||||||||||||||||||||||||||| ||  
Sbjct: 484 tcaggccgaaggtgccggtggcgagcccgccggtggagaagcggaggaggaagcacgcca 425

                                                                       
Query: 630 cggtggagcccagcagctgcgccacccagtagagcaggccgcggaaganggttgatgttg 689
           ||||||||||||| ||||| || | ||||||||| ||||||||||| | || ||||||||
Sbjct: 424 cggtggagcccaggagctgggcgatccagtagaggaggccgcggaacaggg-tgatgttg 366

               
Query: 690 ccgc 693
           ||||
Sbjct: 365 ccgc 362



to top

>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full
           insert sequence
          Length = 1034

 Score =  581 bits (293), Expect = e-162
 Identities = 437/484 (90%), Gaps = 1/484 (0%)
 Strand = Plus / Minus

                                                                       
Query: 210 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 269
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 853 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 794

                                                                       
Query: 270 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 329
           | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 793 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 734

                                                                       
Query: 330 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 389
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 733 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 674

                                                                       
Query: 390 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 449
           | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 673 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 614

                                                                       
Query: 450 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 509
           |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 613 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 554

                                                                       
Query: 510 acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccgg 569
           | || || ||||||||||||||||||||||| ||||  ||||||||| ||  || |||||
Sbjct: 553 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 494

                                                                       
Query: 570 tgagcccgaaggtgccggtggggagcccgccggtggagaagcggaggaggaagcaggcgg 629
           | || |||||||||||||||| ||||||||||||||||||||||||||||||||| ||  
Sbjct: 493 tcaggccgaaggtgccggtggcgagcccgccggtggagaagcggaggaggaagcacgcca 434

                                                                       
Query: 630 cggtggagcccagcagctgcgccacccagtagagcaggccgcggaaganggttgatgttg 689
           ||||||||||||| ||||| || | ||||||||| ||||||||||| | || ||||||||
Sbjct: 433 cggtggagcccaggagctgggcgatccagtagaggaggccgcggaacaggg-tgatgttg 375

               
Query: 690 ccgc 693
           ||||
Sbjct: 374 ccgc 371



to top

>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full
           insert sequence
          Length = 1082

 Score =  581 bits (293), Expect = e-162
 Identities = 437/484 (90%), Gaps = 1/484 (0%)
 Strand = Plus / Minus

                                                                       
Query: 210 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 269
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 855 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 796

                                                                       
Query: 270 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 329
           | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 795 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 736

                                                                       
Query: 330 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 389
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 735 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 676

                                                                       
Query: 390 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 449
           | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 675 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 616

                                                                       
Query: 450 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 509
           |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 615 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 556

                                                                       
Query: 510 acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccgg 569
           | || || ||||||||||||||||||||||| ||||  ||||||||| ||  || |||||
Sbjct: 555 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 496

                                                                       
Query: 570 tgagcccgaaggtgccggtggggagcccgccggtggagaagcggaggaggaagcaggcgg 629
           | || |||||||||||||||| ||||||||||||||||||||||||||||||||| ||  
Sbjct: 495 tcaggccgaaggtgccggtggcgagcccgccggtggagaagcggaggaggaagcacgcca 436

                                                                       
Query: 630 cggtggagcccagcagctgcgccacccagtagagcaggccgcggaaganggttgatgttg 689
           ||||||||||||| ||||| || | ||||||||| ||||||||||| | || ||||||||
Sbjct: 435 cggtggagcccaggagctgggcgatccagtagaggaggccgcggaacaggg-tgatgttg 377

               
Query: 690 ccgc 693
           ||||
Sbjct: 376 ccgc 373



to top

>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full
           insert sequence
          Length = 1055

 Score =  581 bits (293), Expect = e-162
 Identities = 437/484 (90%), Gaps = 1/484 (0%)
 Strand = Plus / Minus

                                                                       
Query: 210 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 269
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 851 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 792

                                                                       
Query: 270 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 329
           | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 791 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 732

                                                                       
Query: 330 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 389
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 731 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 672

                                                                       
Query: 390 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 449
           | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 671 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 612

                                                                       
Query: 450 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 509
           |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 611 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 552

                                                                       
Query: 510 acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccgg 569
           | || || ||||||||||||||||||||||| ||||  ||||||||| ||  || |||||
Sbjct: 551 agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 492

                                                                       
Query: 570 tgagcccgaaggtgccggtggggagcccgccggtggagaagcggaggaggaagcaggcgg 629
           | || |||||||||||||||| ||||||||||||||||||||||||||||||||| ||  
Sbjct: 491 tcaggccgaaggtgccggtggcgagcccgccggtggagaagcggaggaggaagcacgcca 432

                                                                       
Query: 630 cggtggagcccagcagctgcgccacccagtagagcaggccgcggaaganggttgatgttg 689
           ||||||||||||| ||||| || | ||||||||| ||||||||||| | || ||||||||
Sbjct: 431 cggtggagcccaggagctgggcgatccagtagaggaggccgcggaacaggg-tgatgttg 373

               
Query: 690 ccgc 693
           ||||
Sbjct: 372 ccgc 369



to top

>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds
          Length = 1039

 Score =  579 bits (292), Expect = e-162
 Identities = 427/471 (90%), Gaps = 1/471 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 282
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 754 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 695

                                                                       
Query: 283 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 342
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 694 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 635

                                                                       
Query: 343 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 402
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||  |||
Sbjct: 634 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 575

                                                                       
Query: 403 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
           ||||||||| || ||||||||||| || ||||||||||||||||||||||| ||||||||
Sbjct: 574 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcgatgggggcgatggt 515

                                                                       
Query: 463 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 522
           |||||||||||||||||| ||||| || || |||||||||||||||||||||||||||||
Sbjct: 514 gcccaggctgcccttcttcgggtccaccgccgtggcgtacaccgtgtacaccagcccgaa 455

                                                                       
Query: 523 ggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccggtgagcccgaaggt 582
           |||||| ||||||||||| |||| |||||||||| |    | ||| || |||||||||||
Sbjct: 454 ggtcatcacgatctccagcaccagcgcctcccacaccgacacgcccgtcagcccgaaggt 395

                                                                       
Query: 583 gccggtggggagcccgccggtggagaagcggaggaggaagcaggcggcggtggagcccag 642
           ||| ||||   ||||||| || ||||||||||| |||||||| ||  ||||||| |||||
Sbjct: 394 gcccgtggcctgcccgcccgtcgagaagcggagcaggaagcacgccacggtggaccccag 335

                                                              
Query: 643 cagctgcgccacccagtagagcaggccgcggaaganggttgatgttgccgc 693
           |||||||||||||||||| || || || ||||| | || ||||||||||||
Sbjct: 334 cagctgcgccacccagtacaggagcccccggaacaggg-tgatgttgccgc 285



to top

>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence
          Length = 1112

 Score =  571 bits (288), Expect = e-159
 Identities = 426/471 (90%), Gaps = 1/471 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 282
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 850 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 791

                                                                       
Query: 283 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 342
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 790 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 731

                                                                       
Query: 343 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 402
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||  |||
Sbjct: 730 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 671

                                                                       
Query: 403 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
           ||||||||| || |||||||||||||| ||||||||||||||||||||||| ||||||||
Sbjct: 670 ggcgccgcccaccaggatgttggcgcccacgatgaagccgatggcgatgggggcgatggt 611

                                                                       
Query: 463 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 522
           |||||||||||||||||| ||||| || || || ||||||||||||||||||||||||||
Sbjct: 610 gcccaggctgcccttcttcgggtccaccgccgtcgcgtacaccgtgtacaccagcccgaa 551

                                                                       
Query: 523 ggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccggtgagcccgaaggt 582
           |||||| ||||||||||| |||| |||||||||| |    | ||| || |||||||||||
Sbjct: 550 ggtcatcacgatctccagcaccagcgcctcccacaccgacacgcccgtcagcccgaaggt 491

                                                                       
Query: 583 gccggtggggagcccgccggtggagaagcggaggaggaagcaggcggcggtggagcccag 642
           ||| ||||   ||||||| || ||||||||||| |||||||| ||  ||||||| |||||
Sbjct: 490 gcccgtggcctgcccgcccgtcgagaagcggagcaggaagcacgccacggtggaccccag 431

                                                              
Query: 643 cagctgcgccacccagtagagcaggccgcggaaganggttgatgttgccgc 693
           |||||||||||||||||| || || || ||||| | || ||||||||||||
Sbjct: 430 cagctgcgccacccagtacaggagcccccggaacaggg-tgatgttgccgc 381



to top

>ref|XM_470213.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score =  563 bits (284), Expect = e-157
 Identities = 425/471 (90%), Gaps = 1/471 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 282
           |||||||||||||||||||||||||||||||||| ||||||||||||| | |||||||||
Sbjct: 753 ttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaagaggacctcgtagat 694

                                                                       
Query: 283 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 342
           ||||||||||||||| ||||||||||| ||||| |||||||||||||||||| || ||||
Sbjct: 693 gacgccggcgaggccaccgccgatgagtgggccaacccagtacacccactgggactccca 634

                                                                       
Query: 343 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 402
              ||||||||||||||| ||||||||||||||||| ||||||||||| ||||||  |||
Sbjct: 633 ggaccagctgacgagggccgggccgaaggagacggccgggttcatggaggcgccgtcgaa 574

                                                                       
Query: 403 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
            |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||
Sbjct: 573 cgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcgatgggggcgatggt 514

                                                                       
Query: 463 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 522
           ||| |||||||||||||||||||| ||||||||||||||||| ||||| || || |||||
Sbjct: 513 gccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgtagacgaggccgaa 454

                                                                       
Query: 523 ggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccggtgagcccgaaggt 582
           |||||||||||||||||| ||||  ||||||||| ||  || |||||| || ||||||||
Sbjct: 453 ggtcatgacgatctccagcaccagggcctcccacacggagacgccggtcaggccgaaggt 394

                                                                       
Query: 583 gccggtggggagcccgccggtggagaagcggaggaggaagcaggcggcggtggagcccag 642
           |||||||| ||||||||||||||||||||||||||||||||| ||  |||||||||||||
Sbjct: 393 gccggtggcgagcccgccggtggagaagcggaggaggaagcacgccacggtggagcccag 334

                                                              
Query: 643 cagctgcgccacccagtagagcaggccgcggaaganggttgatgttgccgc 693
            ||||| || | ||||||||| ||||||||||| | || ||||||||||||
Sbjct: 333 gagctgggcgatccagtagaggaggccgcggaacaggg-tgatgttgccgc 284



to top

>gb|AY104464.1| Zea mays PCO114899 mRNA sequence
          Length = 1167

 Score =  563 bits (284), Expect = e-157
 Identities = 425/471 (90%), Gaps = 1/471 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 282
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 849 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 790

                                                                       
Query: 283 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 342
           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 789 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtagcccca 730

                                                                       
Query: 343 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 402
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||  |||
Sbjct: 729 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 670

                                                                       
Query: 403 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
           ||||||||| || ||||||||||| || ||||||||||||||||| ||||| ||||||||
Sbjct: 669 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggt 610

                                                                       
Query: 463 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 522
           |||||||||||||||||| ||||| || || || ||||||||||||||||||||||||||
Sbjct: 609 gcccaggctgcccttcttcgggtccaccgccgtcgcgtacaccgtgtacaccagcccgaa 550

                                                                       
Query: 523 ggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccggtgagcccgaaggt 582
           |||||| ||||||||||| |||| |||||||||| |    | ||| || |||||||||||
Sbjct: 549 ggtcatcacgatctccagcaccagcgcctcccacaccgacacgcccgtcagcccgaaggt 490

                                                                       
Query: 583 gccggtggggagcccgccggtggagaagcggaggaggaagcaggcggcggtggagcccag 642
           ||| ||||   ||||||| || ||||||||||| |||||||| ||  ||||||| |||||
Sbjct: 489 gcccgtggcctgcccgcccgtcgagaagcggagcaggaagcacgccacggtggaccccag 430

                                                              
Query: 643 cagctgcgccacccagtagagcaggccgcggaaganggttgatgttgccgc 693
           |||||||||||||||||| || || || ||||| | || ||||||||||||
Sbjct: 429 cagctgcgccacccagtacaggagccctcggaacaggg-tgatgttgccgc 380



to top

>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds
          Length = 1097

 Score =  563 bits (284), Expect = e-157
 Identities = 425/471 (90%), Gaps = 1/471 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 282
           |||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 846 ttagtagtcggtggaggggagctgctcgtgggtgtgggagatgaagagcagctcgtagat 787

                                                                       
Query: 283 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtaccccca 342
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 786 gacgccggcgaggccgccgccgatgaggggcccgacccagtacacccactggtagcccca 727

                                                                       
Query: 343 ctcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaa 402
           |||||||||||||||||||||||||||||| ||||||||||||||||||||||||  |||
Sbjct: 726 ctcccagctgacgagggcggggccgaaggacacggcggggttcatggacgcgccgtcgaa 667

                                                                       
Query: 403 ggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
           ||||||||| || ||||||||||| || ||||||||||||||||| ||||| ||||||||
Sbjct: 666 ggcgccgcccaccaggatgttggcccccacgatgaagccgatggcaatgggggcgatggt 607

                                                                       
Query: 463 gcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaa 522
           |||||||||||||||||| ||||| || || |||||||||||||||||||||||||||||
Sbjct: 606 gcccaggctgcccttcttcgggtccaccgccgtggcgtacaccgtgtacaccagcccgaa 547

                                                                       
Query: 523 ggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccggtgagcccgaaggt 582
           |||||| ||||||||||| |||| |||||||||| |    | ||| || |||||||||||
Sbjct: 546 ggtcatcacgatctccagcaccagcgcctcccacaccgacacgcccgtcagcccgaaggt 487

                                                                       
Query: 583 gccggtggggagcccgccggtggagaagcggaggaggaagcaggcggcggtggagcccag 642
           ||| ||||   ||||||| || ||||||||||| |||||||| ||  ||||||| |||||
Sbjct: 486 gcccgtggcctgcccgcccgtcgagaagcggagcaggaagcacgccacggtggaccccag 427

                                                              
Query: 643 cagctgcgccacccagtagagcaggccgcggaaganggttgatgttgccgc 693
           |||||||||||||||||| || || || ||||| | || ||||||||||||
Sbjct: 426 cagctgcgccacccagtacaggagcccccggaacaggg-tgatgttgccgc 377



to top

>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full
           insert sequence
          Length = 551

 Score =  474 bits (239), Expect = e-130
 Identities = 344/379 (90%)
 Strand = Plus / Minus

                                                                       
Query: 210 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 269
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 379 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 320

                                                                       
Query: 270 gcagctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccc 329
           | | |||||||||||||||||||||||| ||||||||||| ||||| |||||||||||||
Sbjct: 319 ggacctcgtagatgacgccggcgaggccaccgccgatgagtgggccaacccagtacaccc 260

                                                                       
Query: 330 actggtacccccactcccagctgacgagggcggggccgaaggagacggcggggttcatgg 389
           ||||| || ||||   ||||||||||||||| ||||||||||||||||| ||||||||||
Sbjct: 259 actgggactcccaggaccagctgacgagggccgggccgaaggagacggccgggttcatgg 200

                                                                       
Query: 390 acgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcga 449
           | ||||||  ||| |||||||||||||||||||| |||||||||||||||||||||||||
Sbjct: 199 aggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaagccgatggcga 140

                                                                       
Query: 450 tgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgt 509
           |||| ||||||||||| |||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 139 tgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcgtacacggtgt 80

                                                                       
Query: 510 acaccagcccgaaggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccgg 569
           | || || ||||||||||||||||||||||| ||||  ||||||||| ||  || |||||
Sbjct: 79  agacgaggccgaaggtcatgacgatctccagcaccagggcctcccacacggagacgccgg 20

                              
Query: 570 tgagcccgaaggtgccggt 588
           | || ||||||||||||||
Sbjct: 19  tcaggccgaaggtgccggt 1



to top

>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full
           insert sequence
          Length = 1024

 Score =  434 bits (219), Expect = e-118
 Identities = 348/390 (89%), Gaps = 1/390 (0%)
 Strand = Plus / Plus

                                                                       
Query: 304 gatgagggggccgacccagtacacccactggtacccccactcccagctgacgagggcggg 363
           |||||| ||||| |||||||||||||||||| || ||||   ||||||||||||||| ||
Sbjct: 219 gatgagtgggccaacccagtacacccactgggactcccaggaccagctgacgagggccgg 278

                                                                       
Query: 364 gccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgtt 423
           ||||||||||||||| ||||||||||| ||||||  ||| ||||||||||||||||||||
Sbjct: 279 gccgaaggagacggccgggttcatggaggcgccgtcgaacgcgccgccgacgaggatgtt 338

                                                                       
Query: 424 ggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggg 483
            ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||
Sbjct: 339 cgcgccgacgatgaagccgatggcgatgggggcgatggtgccgaggctgcccttcttggg 398

                                                                       
Query: 484 gtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctccaggac 543
           ||| ||||||||||||||||| ||||| || || ||||||||||||||||||||||| ||
Sbjct: 399 gtcaacggcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatctccagcac 458

                                                                       
Query: 544 caccgcctcccacgcgccgatgccggtgagcccgaaggtgccggtggggagcccgccggt 603
           ||  ||||||||| ||  || |||||| || |||||||||||||||| ||||||||||||
Sbjct: 459 cagggcctcccacacggagacgccggtcaggccgaaggtgccggtggcgagcccgccggt 518

                                                                       
Query: 604 ggagaagcggaggaggaagcaggcggcggtggagcccagcagctgcgccacccagtagag 663
           ||||||||||||||||||||| ||  ||||||||||||| ||||| || | |||||||||
Sbjct: 519 ggagaagcggaggaggaagcacgccacggtggagcccaggagctgggcgatccagtagag 578

                                         
Query: 664 caggccgcggaaganggttgatgttgccgc 693
            ||||||||||| | || ||||||||||||
Sbjct: 579 gaggccgcggaacaggg-tgatgttgccgc 607



 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 55/57 (96%)
 Strand = Plus / Plus

                                                                    
Query: 210 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatga 266
           ||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 167 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatga 223



to top

>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic
           protein (TIP)
          Length = 1146

 Score =  424 bits (214), Expect = e-115
 Identities = 412/476 (86%), Gaps = 4/476 (0%)
 Strand = Plus / Minus

                                                                       
Query: 221 gcttagtagtcggtggtggggagctgctcgtgggtgcgggag---atgaagagcagctcg 277
           |||||||||||||||||||||||||||||||||||| |||||   ||||||||||  |||
Sbjct: 837 gcttagtagtcggtggtggggagctgctcgtgggtgtgggaggagatgaagagcatgtcg 778

                                                                       
Query: 278 tagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtac 337
           || || |   | |||||  |  | |||||||  |||||||||||||||||||| ||||  
Sbjct: 777 tatataagtgcagcgagtgcagcaccgatgaacgggccgacccagtacacccagtggttg 718

                                                                       
Query: 338 ccccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccg 397
             |||   |||||||||||| | |||||||||||| ||||||||||||||||||||||||
Sbjct: 717 ttccaggaccagctgacgagcgaggggccgaaggacacggcggggttcatggacgcgccg 658

                                                                       
Query: 398 gagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcg 457
             |||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||
Sbjct: 657 tcgaaggcgccgccgacgaggatgttggcgcccacgatgaagccgatggcgatgggggcg 598

                                                                       
Query: 458 atggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagc 517
           |||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| 
Sbjct: 597 atggtgcccaggctgcccttcttggggtcgaccgcggtggcgtacacagtgtacaccaga 538

                                                                       
Query: 518 ccgaaggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccggtgagcccg 577
           ||||||||||| |||||||| || ||||  ||||||||| ||  ||||||||| || |||
Sbjct: 537 ccgaaggtcatcacgatctcgagcaccagggcctcccacacggagatgccggtcaggccg 478

                                                                       
Query: 578 aaggtgccggtggggagcccgccggtggagaagcggaggaggaagcaggcggcggtggag 637
           |||||||||||||||||||||||||||  |||||||||||||| ||| ||  || | |||
Sbjct: 477 aaggtgccggtggggagcccgccggtgacgaagcggaggaggaggcacgccacgatcgag 418

                                                                   
Query: 638 cccagcagctgcgccacccagtagagcaggccgcggaaganggttgatgttgccgc 693
           |||||||||||||| | |||||| || | || |||||| | || ||||||||||||
Sbjct: 417 cccagcagctgcgcgatccagtacaggatgctgcggaaca-ggctgatgttgccgc 363



to top

>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein
           (TIP1) mRNA, partial cds
          Length = 662

 Score =  256 bits (129), Expect = 9e-65
 Identities = 299/354 (84%), Gaps = 4/354 (1%)
 Strand = Plus / Minus

                                                                       
Query: 340 ccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccgga 399
           |||||||||||| || || |  || |||||||| || || |||||||| ||||| |||  
Sbjct: 632 ccactcccagctcaccagcggcggcccgaaggacaccgccgggttcatcgacgccccgtc 573

                                                                       
Query: 400 gaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgat 459
           |||||| |||||| | ||||||||||| || |||||||||||||| ||||||||||||||
Sbjct: 572 gaaggccccgccggccaggatgttggcccccacgatgaagccgatcgcgatgggcgcgat 513

                                                                       
Query: 460 ggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagccc 519
            || |||||||| |||||||| ||||| | ||||||||||||||| ||||| || |||||
Sbjct: 512 cgtccccaggctccccttcttcgggtcaatggcggtggcgtacacggtgtagacgagccc 453

                                                                       
Query: 520 gaaggtcatgacgatctccaggaccaccgcctcccacgcgccgatgccggtgagcccgaa 579
           |||||||||||||||||| ||||||| ||| | |||  ||| ||  |||| |||||||||
Sbjct: 452 gaaggtcatgacgatctcgaggaccagcgcgttccagacgctgaccccggagagcccgaa 393

                                                                       
Query: 580 ggtgccggtggggagcccgccggtggagaagcggaggaggaagcaggcggcggtggagcc 639
           | |||||||      | |||| |||||||| |||||||||| ||| ||||||||||||||
Sbjct: 392 gctgccggt---ctcctcgccagtggagaaccggaggaggaggcacgcggcggtggagcc 336

                                                                 
Query: 640 cagcagctgcgccacccagtagagcaggccgcggaaganggttgatgttgccgc 693
           ||| |||||||||||||||||||| |||||||||||||  | ||||||||||||
Sbjct: 335 caggagctgcgccacccagtagaggaggccgcggaagagcg-tgatgttgccgc 283



to top

>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA,
           complete cds
          Length = 1021

 Score =  246 bits (124), Expect = 8e-62
 Identities = 208/236 (88%)
 Strand = Plus / Minus

                                                                       
Query: 311 gggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaag 370
           |||||||||||||||||||| |||| | ||||  | | | |||||| ||| |||||||||
Sbjct: 682 gggccgacccagtacacccagtggttctcccagacgccggtgacgacggccgggccgaag 623

                                                                       
Query: 371 gagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccg 430
           |||||||||||||||||||| ||||||  ||||||||| ||  | |||||||||||||||
Sbjct: 622 gagacggcggggttcatggaggcgccgtcgaaggcgccccccgccaggatgttggcgccg 563

                                                                       
Query: 431 acgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacg 490
           ||||||||||||||||||||||||||||||  ||| |||  ||||||||||||||| |||
Sbjct: 562 acgatgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttcttggggtccacg 503

                                                                   
Query: 491 gcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctccaggaccac 546
           || |||||||||||||||||||| || |||||||||||||| |||||||| |||||
Sbjct: 502 gccgtggcgtacaccgtgtacacgaggccgaaggtcatgaccatctccagcaccac 447



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                  
Query: 613 gaggaggaagcaggcggcggtggagcccagcagctgcgccacccagtagagcagg 667
           |||||||| ||||||| ||  ||||||||| ||||| ||||||||||||| ||||
Sbjct: 377 gaggaggaggcaggcgacgacggagcccaggagctgggccacccagtagaccagg 323



to top

>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full
           insert sequence
          Length = 870

 Score =  234 bits (118), Expect = 3e-58
 Identities = 199/225 (88%), Gaps = 1/225 (0%)
 Strand = Plus / Minus

                                                                       
Query: 469 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 528
           |||||||||||||||||| ||||||||||||||||| ||||| || || |||||||||||
Sbjct: 592 gctgcccttcttggggtcaacggcggtggcgtacacggtgtagacgaggccgaaggtcat 533

                                                                       
Query: 529 gacgatctccaggaccaccgcctcccacgcgccgatgccggtgagcccgaaggtgccggt 588
           |||||||||||| ||||  ||||||||| ||  || |||||| || ||||||||||||||
Sbjct: 532 gacgatctccagcaccagggcctcccacacggagacgccggtcaggccgaaggtgccggt 473

                                                                       
Query: 589 ggggagcccgccggtggagaagcggaggaggaagcaggcggcggtggagcccagcagctg 648
           || ||||||||||||||||||||||||||||||||| ||  ||||||||||||| |||||
Sbjct: 472 ggcgagcccgccggtggagaagcggaggaggaagcacgccacggtggagcccaggagctg 413

                                                        
Query: 649 cgccacccagtagagcaggccgcggaaganggttgatgttgccgc 693
            || | ||||||||| ||||||||||| | || ||||||||||||
Sbjct: 412 ggcgatccagtagaggaggccgcggaacaggg-tgatgttgccgc 369



 Score =  155 bits (78), Expect = 2e-34
 Identities = 93/98 (94%)
 Strand = Plus / Minus

                                                                       
Query: 210 ggcggcggtgagcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaaga 269
           ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 689 ggcggcgatgagcttagtagtcggtggtggggagctgctcgtgggtgtgggagatgaaga 630

                                                 
Query: 270 gcagctcgtagatgacgccggcgaggccgccgccgatg 307
           | | |||||||||||||||||||||||| |||||||||
Sbjct: 629 ggacctcgtagatgacgccggcgaggccaccgccgatg 592



to top

>ref|NM_189497.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score =  220 bits (111), Expect = 5e-54
 Identities = 168/187 (89%)
 Strand = Plus / Minus

                                                                       
Query: 351 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 410
           |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 628 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 569

                                                                       
Query: 411 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 470
           || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 568 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 509

                                                                       
Query: 471 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 530
            |||||||||||| || || |||||||||||||| ||||| || || |||||||||||||
Sbjct: 508 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 449

                  
Query: 531 cgatctc 537
           |||||||
Sbjct: 448 cgatctc 442



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 638 cccagcagctgcgccacccagta 660
           |||||||||||||||||||||||
Sbjct: 338 cccagcagctgcgccacccagta 316



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  220 bits (111), Expect = 5e-54
 Identities = 171/191 (89%)
 Strand = Plus / Minus

                                                                            
Query: 349      gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 408
                |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 13251010 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 13250951

                                                                            
Query: 409      gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 468
                | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 13250950 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 13250891

                                                                            
Query: 469      gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 528
                    ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 13250890 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 13250831

                           
Query: 529      gacgatctcca 539
                || ||||||||
Sbjct: 13250830 gatgatctcca 13250820



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                                
Query: 277      gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 324
                ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 13251082 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 13251035



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 427      gccgacgatgaagccgatggcgat 450
                ||||| ||||||||||||||||||
Sbjct: 26574317 gccgaggatgaagccgatggcgat 26574294



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  220 bits (111), Expect = 5e-54
 Identities = 168/187 (89%)
 Strand = Plus / Plus

                                                                            
Query: 351      tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 410
                |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 43108799 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 43108858

                                                                            
Query: 411      cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 470
                || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 43108859 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 43108918

                                                                            
Query: 471      tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 530
                 |||||||||||| || || |||||||||||||| ||||| || || |||||||||||||
Sbjct: 43108919 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 43108978

                       
Query: 531      cgatctc 537
                |||||||
Sbjct: 43108979 cgatctc 43108985



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 79/90 (87%)
 Strand = Plus / Minus

                                                                           
Query: 354     cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 413
               ||||||| ||||||||||||  ||| ||||||||||| ||||||||| |||  |||||| 
Sbjct: 7297479 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 7297420

                                             
Query: 414     cgaggatgttggcgccgacgatgaagccga 443
               ||||||||||||||||||||| || |||||
Sbjct: 7297419 cgaggatgttggcgccgacgacgaggccga 7297390



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                      
Query: 380     gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 434
               ||||||||||||||||||| ||  ||||||||| ||| | |||||||||||||||
Sbjct: 7302352 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 7302298



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                                
Query: 287     ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 335
               |||||||||||| ||||||||| ||| |||| |||||||||||| ||||
Sbjct: 6644922 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 6644970



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 638      cccagcagctgcgccacccagta 660
                |||||||||||||||||||||||
Sbjct: 43109089 cccagcagctgcgccacccagta 43109111



to top

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0459B04
          Length = 142475

 Score =  220 bits (111), Expect = 5e-54
 Identities = 168/187 (89%)
 Strand = Plus / Plus

                                                                          
Query: 351    tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 410
              |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 105828 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 105887

                                                                          
Query: 411    cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 470
              || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 105888 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 105947

                                                                          
Query: 471    tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 530
               |||||||||||| || || |||||||||||||| ||||| || || |||||||||||||
Sbjct: 105948 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 106007

                     
Query: 531    cgatctc 537
              |||||||
Sbjct: 106008 cgatctc 106014



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 638    cccagcagctgcgccacccagta 660
              |||||||||||||||||||||||
Sbjct: 106118 cccagcagctgcgccacccagta 106140



to top

>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0427E01
          Length = 146395

 Score =  220 bits (111), Expect = 5e-54
 Identities = 171/191 (89%)
 Strand = Plus / Minus

                                                                         
Query: 349   gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 408
             |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 12820 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 12761

                                                                         
Query: 409   gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 468
             | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 12760 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 12701

                                                                         
Query: 469   gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 528
                 ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 12700 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 12641

                        
Query: 529   gacgatctcca 539
             || ||||||||
Sbjct: 12640 gatgatctcca 12630



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                             
Query: 277   gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 324
             ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 12892 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 12845



to top

>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0012F14
          Length = 168629

 Score =  220 bits (111), Expect = 5e-54
 Identities = 171/191 (89%)
 Strand = Plus / Minus

                                                                          
Query: 349    gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 408
              |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 168198 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 168139

                                                                          
Query: 409    gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 468
              | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 168138 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 168079

                                                                          
Query: 469    gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 528
                  ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 168078 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 168019

                         
Query: 529    gacgatctcca 539
              || ||||||||
Sbjct: 168018 gatgatctcca 168008



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                              
Query: 277    gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 324
              ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 168270 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 168223



to top

>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full
           insert sequence
          Length = 1346

 Score =  220 bits (111), Expect = 5e-54
 Identities = 168/187 (89%)
 Strand = Plus / Minus

                                                                       
Query: 351 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 410
           |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 652 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 593

                                                                       
Query: 411 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 470
           || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 592 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 533

                                                                       
Query: 471 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 530
            |||||||||||| || || |||||||||||||| ||||| || || |||||||||||||
Sbjct: 532 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 473

                  
Query: 531 cgatctc 537
           |||||||
Sbjct: 472 cgatctc 466



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 638 cccagcagctgcgccacccagta 660
           |||||||||||||||||||||||
Sbjct: 362 cccagcagctgcgccacccagta 340



to top

>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full
           insert sequence
          Length = 1149

 Score =  220 bits (111), Expect = 5e-54
 Identities = 168/187 (89%)
 Strand = Plus / Minus

                                                                       
Query: 351 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 410
           |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 701 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 642

                                                                       
Query: 411 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 470
           || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 641 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 582

                                                                       
Query: 471 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 530
            |||||||||||| || || |||||||||||||| ||||| || || |||||||||||||
Sbjct: 581 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 522

                  
Query: 531 cgatctc 537
           |||||||
Sbjct: 521 cgatctc 515



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 638 cccagcagctgcgccacccagta 660
           |||||||||||||||||||||||
Sbjct: 411 cccagcagctgcgccacccagta 389



to top

>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 970

 Score =  220 bits (111), Expect = 5e-54
 Identities = 168/187 (89%)
 Strand = Plus / Minus

                                                                       
Query: 351 tgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgc 410
           |||||| ||||||||||||||||||||||||||||||||| ||||||  |||||||||||
Sbjct: 638 tgacgacggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgc 579

                                                                       
Query: 411 cgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggc 470
           || |||||||||||||||||||||||||||||||||||||||| ||||||   || ||| 
Sbjct: 578 cggcgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggt 519

                                                                       
Query: 471 tgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatga 530
            |||||||||||| || || |||||||||||||| ||||| || || |||||||||||||
Sbjct: 518 cgcccttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatga 459

                  
Query: 531 cgatctc 537
           |||||||
Sbjct: 458 cgatctc 452



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 638 cccagcagctgcgccacccagta 660
           |||||||||||||||||||||||
Sbjct: 348 cccagcagctgcgccacccagta 326



to top

>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full
           insert sequence
          Length = 1194

 Score =  220 bits (111), Expect = 5e-54
 Identities = 171/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 349 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 408
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 710 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 651

                                                                       
Query: 409 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 468
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 650 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 591

                                                                       
Query: 469 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 528
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 590 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 531

                      
Query: 529 gacgatctcca 539
           || ||||||||
Sbjct: 530 gatgatctcca 520



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 277 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 324
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 782 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 735



to top

>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full
           insert sequence
          Length = 1214

 Score =  220 bits (111), Expect = 5e-54
 Identities = 171/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 349 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 408
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 712 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653

                                                                       
Query: 409 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 468
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 593

                                                                       
Query: 469 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 528
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 592 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 533

                      
Query: 529 gacgatctcca 539
           || ||||||||
Sbjct: 532 gatgatctcca 522



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 277 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 324
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 784 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 737



to top

>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full
           insert sequence
          Length = 1074

 Score =  220 bits (111), Expect = 5e-54
 Identities = 171/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 349 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 408
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 590 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 531

                                                                       
Query: 409 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 468
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 530 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 471

                                                                       
Query: 469 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 528
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 470 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 411

                      
Query: 529 gacgatctcca 539
           || ||||||||
Sbjct: 410 gatgatctcca 400



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 277 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 324
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 662 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 615



to top

>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full
           insert sequence
          Length = 1197

 Score =  220 bits (111), Expect = 5e-54
 Identities = 171/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 349 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 408
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 713 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654

                                                                       
Query: 409 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 468
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 594

                                                                       
Query: 469 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 528
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 593 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 534

                      
Query: 529 gacgatctcca 539
           || ||||||||
Sbjct: 533 gatgatctcca 523



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 277 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 324
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 785 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 738



to top

>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full
           insert sequence
          Length = 1195

 Score =  220 bits (111), Expect = 5e-54
 Identities = 171/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 349 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 408
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 711 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652

                                                                       
Query: 409 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 468
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 592

                                                                       
Query: 469 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 528
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 591 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 532

                      
Query: 529 gacgatctcca 539
           || ||||||||
Sbjct: 531 gatgatctcca 521



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 277 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 324
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 783 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 736



to top

>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full
           insert sequence
          Length = 1202

 Score =  220 bits (111), Expect = 5e-54
 Identities = 171/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 349 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 408
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 713 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 654

                                                                       
Query: 409 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 468
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 653 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 594

                                                                       
Query: 469 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 528
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 593 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 534

                      
Query: 529 gacgatctcca 539
           || ||||||||
Sbjct: 533 gatgatctcca 523



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 277 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 324
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 785 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 738



to top

>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full
           insert sequence
          Length = 1220

 Score =  220 bits (111), Expect = 5e-54
 Identities = 171/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 349 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 408
           |||| ||| ||||||||||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 711 gctggcgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 652

                                                                       
Query: 409 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 468
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 651 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 592

                                                                       
Query: 469 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 528
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 591 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 532

                      
Query: 529 gacgatctcca 539
           || ||||||||
Sbjct: 531 gatgatctcca 521



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 277 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 324
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 783 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 736



to top

>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full
           insert sequence
          Length = 1196

 Score =  212 bits (107), Expect = 1e-51
 Identities = 170/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 349 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgcc 408
           |||| ||| |||||| |||||||||   || |||||||||||  |||||||||||| |||
Sbjct: 712 gctggcgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggcc 653

                                                                       
Query: 409 gccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccag 468
           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 652 ggcgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgag 593

                                                                       
Query: 469 gctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcat 528
               ||||||||||||||| |||||||||||||||| |||||||||||||||||||| | 
Sbjct: 592 cgaccccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgac 533

                      
Query: 529 gacgatctcca 539
           || ||||||||
Sbjct: 532 gatgatctcca 522



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 45/48 (93%)
 Strand = Plus / Minus

                                                           
Query: 277 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 324
           ||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 784 gtagacgaggccggcgaggccgccgccgacgagggggccgacccagta 737



to top

>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence
          Length = 833

 Score =  212 bits (107), Expect = 1e-51
 Identities = 202/236 (85%)
 Strand = Plus / Plus

                                                                       
Query: 311 gggccgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaag 370
           |||||||||||||||||||| |||| | ||||  | | | ||||||  || |||||||||
Sbjct: 329 gggccgacccagtacacccagtggttctcccagacgccggtgacgacagccgggccgaag 388

                                                                       
Query: 371 gagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccg 430
           |||||||||| ||||||||| ||||||  |||||||       | |||||||||||||||
Sbjct: 389 gagacggcggngttcatggaggcgccgtcgaaggcgnnnnnngccaggatgttggcgccg 448

                                                                       
Query: 431 acgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacg 490
           ||||||||||||||||||||||||||||||  ||| |||  ||||||||||||||| |||
Sbjct: 449 acgatgaagccgatggcgatgggcgcgatgacgccgaggtcgcccttcttggggtccacg 508

                                                                   
Query: 491 gcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctccaggaccac 546
           || |||||||||||||||||||| || |||||||||||||| |||||||| |||||
Sbjct: 509 gccgtggcgtacaccgtgtacacgaggccgaaggtcatgaccatctccagcaccac 564



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                  
Query: 613 gaggaggaagcaggcggcggtggagcccagcagctgcgccacccagtagagcagg 667
           |||||||| ||||||| ||  ||||||||| ||||| |||| |||||||||||||
Sbjct: 634 gaggaggaggcaggcgacgacggagcccaggagctgggccagccagtagagcagg 688



to top

>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA,
           complete cds
          Length = 829

 Score =  202 bits (102), Expect = 1e-48
 Identities = 162/182 (89%)
 Strand = Plus / Minus

                                                                       
Query: 358 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
           ||||||||||||||||   || |||||||||||| |||||||||||| |||| |||||||
Sbjct: 663 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggcgacgag 604

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           ||||||||||||||||||||||||||||||||| || ||||||||||| |||   |||||
Sbjct: 603 gatgttggcgccgacgatgaagccgatggcgattggagcgatggtgccgagggacccctt 544

                                                                       
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||||| |||||||||||||||| ||||| || ||||||||||| | || ||||||
Sbjct: 543 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 484

             
Query: 538 ca 539
           ||
Sbjct: 483 ca 482



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 277 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 324
           ||||| ||||||||||||||| ||||||||||| |||||| |||||||
Sbjct: 744 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagta 697



to top

>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA,
           complete cds
          Length = 853

 Score =  202 bits (102), Expect = 1e-48
 Identities = 162/182 (89%)
 Strand = Plus / Minus

                                                                       
Query: 358 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
           ||||||||||||||||   || |||||||||||| |||||||||||| |||| | |||||
Sbjct: 666 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggcaacgag 607

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           |||||||||||||||||||||||||||||||||||| ||||||||||| |||   |||||
Sbjct: 606 gatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgccgagggaaccctt 547

                                                                       
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||||| |||||||||||||||| ||||| || ||||||||||| | || ||||||
Sbjct: 546 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 487

             
Query: 538 ca 539
           ||
Sbjct: 486 ca 485



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 277 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 324
           ||||| ||||||||||||||| ||||||||||| |||||| |||||||
Sbjct: 747 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagta 700



to top

>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA,
           complete cds
          Length = 817

 Score =  202 bits (102), Expect = 1e-48
 Identities = 162/182 (89%)
 Strand = Plus / Minus

                                                                       
Query: 358 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
           ||||||||||||||||   || |||||||||||| |||||||||||| |||| | |||||
Sbjct: 667 ggcggggccgaaggagcgtgcagggttcatggacccgccggagaaggggccggccacgag 608

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           |||||||||||||||||||||||||||||||||||| ||||||||||| |||   |||||
Sbjct: 607 gatgttggcgccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 548

                                                                       
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||||| |||||||||||||||| ||||| || ||||||||||| | || ||||||
Sbjct: 547 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 488

             
Query: 538 ca 539
           ||
Sbjct: 487 ca 486



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 277 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
           ||||| ||||||||||||||| ||||||||||| |||||| ||||||| |||||
Sbjct: 748 gtagacgacgccggcgaggccaccgccgatgagcgggccggcccagtagaccca 695



to top

>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA,
           complete cds
          Length = 1073

 Score =  198 bits (100), Expect = 2e-47
 Identities = 160/180 (88%)
 Strand = Plus / Minus

                                                                       
Query: 358 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
           ||||||||||||||||  |||||||||||||||  |||||  |||||  ||  || ||||
Sbjct: 682 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 623

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           |||||||||||||||||||||||||||||||||||||||||||||||| |||  ||||||
Sbjct: 622 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagggagccctt 563

                                                                       
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||||| |||||||||||||||| ||||| || ||| ||||||| |||||||||||
Sbjct: 562 cttggggtcggcggcggtggcgtacacggtgtagacgagcgcgaaggtgatgacgatctc 503



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 276 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
           |||||| || ||| ||||| |||||||||||||| |||||||||||||| |||||
Sbjct: 764 cgtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagaccca 710



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 637 gcccagcagctgcgccacccagtaga 662
           |||||||||||| |||||||||||||
Sbjct: 400 gcccagcagctgggccacccagtaga 375



to top

>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds
          Length = 968

 Score =  186 bits (94), Expect = 7e-44
 Identities = 160/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 358 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
           ||||||||||||||||  ||| |||||||||||  |||||  ||||| |||| || | ||
Sbjct: 615 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 556

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           |||||||||||||||||||||||||||||| |||||||||||||||||||||   |||||
Sbjct: 555 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 496

                                                                       
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           ||| |||||| | |||||||||||||| |||||||||||| ||||||| || ||||||||
Sbjct: 495 cttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacgatctc 436

             
Query: 538 ca 539
           ||
Sbjct: 435 ca 434



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 293 aggccgccgccgatgagggggccgacccagtacaccca 330
           ||||| ||||||| ||||||||||||||||||||||||
Sbjct: 680 aggccaccgccgacgagggggccgacccagtacaccca 643



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 358 ggcggggccgaaggagacggcggggttca 386
           |||| ||||||||| ||||||||||||||
Sbjct: 276 ggcgaggccgaaggtgacggcggggttca 248



to top

>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA,
           complete cds
          Length = 1042

 Score =  186 bits (94), Expect = 7e-44
 Identities = 160/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 358 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
           ||||||||||||||||  ||| |||||||||||  |||||  ||||| |||| || | ||
Sbjct: 683 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 624

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           |||||||||||||||||||||||||||||| |||||||||||||||||||||   |||||
Sbjct: 623 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 564

                                                                       
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           ||| |||||| | |||||||||||||| |||||||||||| ||||||| || ||||||||
Sbjct: 563 cttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacgatctc 504

             
Query: 538 ca 539
           ||
Sbjct: 503 ca 502



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 293 aggccgccgccgatgagggggccgacccagtacaccca 330
           ||||| ||||||| ||||||||||||||||||||||||
Sbjct: 748 aggccaccgccgacgagggggccgacccagtacaccca 711



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 358 ggcggggccgaaggagacggcggggttca 386
           |||| ||||||||| ||||||||||||||
Sbjct: 344 ggcgaggccgaaggtgacggcggggttca 316



to top

>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1067

 Score =  186 bits (94), Expect = 7e-44
 Identities = 160/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 358 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
           ||||||||||||||||   || |||||||||||| ||||||| |||| |||| | |||||
Sbjct: 669 ggcggggccgaaggagcgtgcagggttcatggacccgccggaaaaggggccggccacgag 610

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           ||||||||||||||| |||||||||||||||||||| ||||||||||| |||   |||||
Sbjct: 609 gatgttggcgccgacaatgaagccgatggcgatgggggcgatggtgccgagggatccctt 550

                                                                       
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||||| |||||||||||||||| ||||| || ||||||||||| | || ||||||
Sbjct: 549 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 490

             
Query: 538 ca 539
           ||
Sbjct: 489 ca 488



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 44/48 (91%)
 Strand = Plus / Minus

                                                           
Query: 283 gacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
           ||||||||||||||| ||||||||||| |||||| ||||||| |||||
Sbjct: 744 gacgccggcgaggccaccgccgatgagcgggccggcccagtaaaccca 697



to top

>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds
          Length = 1060

 Score =  186 bits (94), Expect = 7e-44
 Identities = 160/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 358 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
           ||||||||||||||||  ||| |||||||||||  |||||  ||||| |||| || | ||
Sbjct: 674 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 615

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           |||||||||||||||||||||||||||||| |||||||||||||||||||||   |||||
Sbjct: 614 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 555

                                                                       
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           ||| |||||| | |||||||||||||| |||||||||||| ||||||| || ||||||||
Sbjct: 554 cttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacgatctc 495

             
Query: 538 ca 539
           ||
Sbjct: 494 ca 493



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 293 aggccgccgccgatgagggggccgacccagtacaccca 330
           ||||| ||||||| ||||||||||||||||||||||||
Sbjct: 739 aggccaccgccgacgagggggccgacccagtacaccca 702



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 358 ggcggggccgaaggagacggcggggttca 386
           |||| ||||||||| ||||||||||||||
Sbjct: 335 ggcgaggccgaaggtgacggcggggttca 307



to top

>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA,
           complete cds
          Length = 1110

 Score =  182 bits (92), Expect = 1e-42
 Identities = 155/176 (88%)
 Strand = Plus / Minus

                                                                       
Query: 358 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
           ||||||||||||||||  |||||||||||||||  |||||  |||||  ||  || ||||
Sbjct: 839 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 780

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           |||||||||||||||||||||||||||||||||||||||||||||||| ||   ||||||
Sbjct: 779 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagccctt 720

                                                                   
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 533
           |||||||||| |||||||||||||||| ||||| || ||| ||||||| |||||||
Sbjct: 719 cttggggtcggcggcggtggcgtacacggtgtagacgagcgcgaaggtgatgacga 664



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 276 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
           |||||| || ||| |||||||||||||||| ||| |||||||||||||| |||||
Sbjct: 921 cgtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagaccca 867



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 630 cggtggagcccagcagctgcgccacccagtaga 662
           |||||| |||||||||||| |||||||||||||
Sbjct: 567 cggtggcgcccagcagctgggccacccagtaga 535



to top

>gb|AY105015.1| Zea mays PCO137646 mRNA sequence
          Length = 1238

 Score =  182 bits (92), Expect = 1e-42
 Identities = 155/176 (88%)
 Strand = Plus / Minus

                                                                       
Query: 358 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
           ||||||||||||||||  |||||||||||||||  |||||  |||||  ||  || ||||
Sbjct: 838 ggcggggccgaaggagcgggcggggttcatggagccgccgctgaagggccccgcggcgag 779

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           |||||||||||||||||||||||||||||||||||||||||||||||| ||   ||||||
Sbjct: 778 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgagccctt 719

                                                                   
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 533
           |||||||||| |||||||||||||||| ||||| || ||| ||||||| |||||||
Sbjct: 718 cttggggtcggcggcggtggcgtacacggtgtagacgagcgcgaaggtgatgacga 663



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 276 cgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
           |||||| || ||| |||||||||||||||| ||| |||||||||||||| |||||
Sbjct: 920 cgtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagaccca 866



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 630 cggtggagcccagcagctgcgccacccagtaga 662
           |||||| |||||||||||| |||||||||||||
Sbjct: 566 cggtggcgcccagcagctgggccacccagtaga 534



to top

>gb|AY106931.1| Zea mays PCO140073 mRNA sequence
          Length = 1069

 Score =  178 bits (90), Expect = 2e-41
 Identities = 159/182 (87%)
 Strand = Plus / Minus

                                                                       
Query: 358 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
           ||||||||||||||||  ||| |||||||||||  |||||  ||||| |||| || | ||
Sbjct: 692 ggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcggccag 633

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           |||||||||||||||||||||||||||||| |||||||||||||||||||||   |||||
Sbjct: 632 gatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggacccctt 573

                                                                       
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           ||| |||||| | |||||||||||||| |||||||||||  ||||||| || ||||||||
Sbjct: 572 cttcgggtcggccgcggtggcgtacacggtgtacaccagagcgaaggtgatcacgatctc 513

             
Query: 538 ca 539
           ||
Sbjct: 512 ca 511



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 293 aggccgccgccgatgagggggccgacccagtacaccca 330
           ||||| ||||||| ||||||||||||||||||||||||
Sbjct: 757 aggccaccgccgacgagggggccgacccagtacaccca 720



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 358 ggcggggccgaaggagacggcggggttca 386
           |||| ||||||||| ||||||||||||||
Sbjct: 353 ggcgaggccgaaggtgacggcggggttca 325



to top

>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast
             intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes,
             complete cds
          Length = 65979

 Score =  159 bits (80), Expect = 1e-35
 Identities = 140/160 (87%)
 Strand = Plus / Minus

                                                                         
Query: 380   gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 439
             |||||||||||  |||||  |||||  ||| || ||||||||||||||||||||||||||
Sbjct: 44819 gggttcatggagccgccgctgaagggcccggcggcgaggatgttggcgccgacgatgaag 44760

                                                                         
Query: 440   ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 499
             ||||| || ||||||||||||||||| |||  |||||||||||||||| | || || |||
Sbjct: 44759 ccgatcgccatgggcgcgatggtgccgagggagcccttcttggggtcggccgccgtcgcg 44700

                                                     
Query: 500   tacaccgtgtacaccagcccgaaggtcatgacgatctcca 539
             |||||||||||||||||| ||||||| || ||||||||||
Sbjct: 44699 tacaccgtgtacaccagcgcgaaggtgatcacgatctcca 44660



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 287   ccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
             |||||||||||||| || ||||| || |||||||||||||||||
Sbjct: 44912 ccggcgaggccgccaccaatgagtggcccgacccagtacaccca 44869



to top

>ref|XM_467137.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 747

 Score =  155 bits (78), Expect = 2e-34
 Identities = 156/182 (85%)
 Strand = Plus / Minus

                                                                       
Query: 358 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
           ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || ||||
Sbjct: 612 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 553

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           ||||||||||||||||||||||||||| |||||||||||||||||||| ||    |||||
Sbjct: 552 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 493

                                                                       
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           ||| |||||  | || |||||||||||||||||||||||| |||| || |||||||||||
Sbjct: 492 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 433

             
Query: 538 ca 539
           ||
Sbjct: 432 ca 431



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 287 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
           |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 640



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  155 bits (78), Expect = 2e-34
 Identities = 156/182 (85%)
 Strand = Plus / Plus

                                                                            
Query: 358      ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
                ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || ||||
Sbjct: 26627254 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 26627313

                                                                            
Query: 418      gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
                ||||||||||||||||||||||||||| |||||||||||||||||||| ||    |||||
Sbjct: 26627314 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 26627373

                                                                            
Query: 478      cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
                ||| |||||  | || |||||||||||||||||||||||| |||| || |||||||||||
Sbjct: 26627374 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 26627433

                  
Query: 538      ca 539
                ||
Sbjct: 26627434 ca 26627435



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                            
Query: 287      ccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
                |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 26627226



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 616      gaggaagcaggcggcggtgg 635
                ||||||||||||||||||||
Sbjct: 10918389 gaggaagcaggcggcggtgg 10918370



to top

>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0519E06
          Length = 170634

 Score =  155 bits (78), Expect = 2e-34
 Identities = 156/182 (85%)
 Strand = Plus / Plus

                                                                          
Query: 358    ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
              ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || ||||
Sbjct: 169635 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 169694

                                                                          
Query: 418    gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
              ||||||||||||||||||||||||||| |||||||||||||||||||| ||    |||||
Sbjct: 169695 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 169754

                                                                          
Query: 478    cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
              ||| |||||  | || |||||||||||||||||||||||| |||| || |||||||||||
Sbjct: 169755 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 169814

                
Query: 538    ca 539
              ||
Sbjct: 169815 ca 169816



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                          
Query: 287    ccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
              |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 169607



to top

>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1112_F09
          Length = 139371

 Score =  155 bits (78), Expect = 2e-34
 Identities = 156/182 (85%)
 Strand = Plus / Plus

                                                                         
Query: 358   ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
             ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || ||||
Sbjct: 61415 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 61474

                                                                         
Query: 418   gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
             ||||||||||||||||||||||||||| |||||||||||||||||||| ||    |||||
Sbjct: 61475 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 61534

                                                                         
Query: 478   cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
             ||| |||||  | || |||||||||||||||||||||||| |||| || |||||||||||
Sbjct: 61535 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 61594

               
Query: 538   ca 539
             ||
Sbjct: 61595 ca 61596



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                         
Query: 287   ccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
             |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 61387



to top

>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1013

 Score =  155 bits (78), Expect = 2e-34
 Identities = 156/182 (85%)
 Strand = Plus / Minus

                                                                       
Query: 358 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
           ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || ||||
Sbjct: 685 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 626

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           ||||||||||||||||||||||||||| |||||||||||||||||||| ||    |||||
Sbjct: 625 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 566

                                                                       
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           ||| |||||  | || |||||||||||||||||||||||| |||| || |||||||||||
Sbjct: 565 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 506

             
Query: 538 ca 539
           ||
Sbjct: 505 ca 504



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 287 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
           |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 713



to top

>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full
           insert sequence
          Length = 873

 Score =  155 bits (78), Expect = 2e-34
 Identities = 156/182 (85%)
 Strand = Plus / Minus

                                                                       
Query: 358 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
           ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || ||||
Sbjct: 487 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 428

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           ||||||||||||||||||||||||||| |||||||||||||||||||| ||    |||||
Sbjct: 427 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 368

                                                                       
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           ||| |||||  | || |||||||||||||||||||||||| |||| || |||||||||||
Sbjct: 367 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 308

             
Query: 538 ca 539
           ||
Sbjct: 307 ca 306



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 287 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
           |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 515



to top

>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2
          Length = 339972

 Score =  155 bits (78), Expect = 2e-34
 Identities = 156/182 (85%)
 Strand = Plus / Minus

                                                                          
Query: 358    ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
              ||||||||||||||||   || |||||||||||  |||||  ||| | |||| || ||||
Sbjct: 250580 ggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacgggccggcggcgag 250521

                                                                          
Query: 418    gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
              ||||||||||||||||||||||||||| |||||||||||||||||||| ||    |||||
Sbjct: 250520 gatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatccctt 250461

                                                                          
Query: 478    cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
              ||| |||||  | || |||||||||||||||||||||||| |||| || |||||||||||
Sbjct: 250460 cttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacgatctc 250401

                
Query: 538    ca 539
              ||
Sbjct: 250400 ca 250399



 Score =  139 bits (70), Expect = 1e-29
 Identities = 112/126 (88%)
 Strand = Plus / Plus

                                                                          
Query: 414    cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 473
              ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||    |
Sbjct: 332124 cgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccgagcgatc 332183

                                                                          
Query: 474    ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 533
              ||||||| |||||  | || |||||||||||||||||||||||| |||| || |||||||
Sbjct: 332184 ccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatgacga 332243

                    
Query: 534    tctcca 539
              ||||||
Sbjct: 332244 tctcca 332249



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                          
Query: 287    ccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
              |||||||||||||||||||| || |||||||||||||| |||||
Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagaccca 250608



to top

>ref|XM_473424.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2307

 Score =  119 bits (60), Expect = 1e-23
 Identities = 108/124 (87%)
 Strand = Plus / Minus

                                                                       
Query: 416 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 475
           ||||||||||| |||||||||||||||||||| |||||||||| |||||| |||   |||
Sbjct: 557 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 498

                                                                       
Query: 476 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatc 535
           ||||| |||||| | || |||||||||||||||||||||||| |||| || || || |||
Sbjct: 497 ttcttcgggtcggccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatcacaatc 438

               
Query: 536 tcca 539
           ||||
Sbjct: 437 tcca 434



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 287 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
           ||||| ||||| || ||||| || ||||||||||||||||||||
Sbjct: 686 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 643



to top

>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17,
             complete sequence
          Length = 127259

 Score =  119 bits (60), Expect = 1e-23
 Identities = 108/124 (87%)
 Strand = Plus / Plus

                                                                         
Query: 416   aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 475
             ||||||||||| |||||||||||||||||||| |||||||||| |||||| |||   |||
Sbjct: 92622 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 92681

                                                                         
Query: 476   ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatc 535
             ||||| |||||| | || |||||||||||||||||||||||| |||| || || || |||
Sbjct: 92682 ttcttcgggtcggccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatcacaatc 92741

                 
Query: 536   tcca 539
             ||||
Sbjct: 92742 tcca 92745



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                         
Query: 287   ccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
             ||||| ||||| || ||||| || ||||||||||||||||||||
Sbjct: 92493 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 92536



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  119 bits (60), Expect = 1e-23
 Identities = 108/124 (87%)
 Strand = Plus / Plus

                                                                            
Query: 416      aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccc 475
                ||||||||||| |||||||||||||||||||| |||||||||| |||||| |||   |||
Sbjct: 27568646 aggatgttggcaccgacgatgaagccgatggccatgggcgcgacggtgccgagggaaccc 27568705

                                                                            
Query: 476      ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatc 535
                ||||| |||||| | || |||||||||||||||||||||||| |||| || || || |||
Sbjct: 27568706 ttcttcgggtcggccgccgtggcgtacaccgtgtacaccagcgcgaacgtgatcacaatc 27568765

                    
Query: 536      tcca 539
                ||||
Sbjct: 27568766 tcca 27568769



 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 189/235 (80%), Gaps = 5/235 (2%)
 Strand = Plus / Minus

                                                                            
Query: 300      cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 359
                |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| |||||| |
Sbjct: 26354830 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 26354771

                                                                            
Query: 360      cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 419
                | |||||||| | |   || |||||||||| |||||||  ||| | ||| ||| ||||||
Sbjct: 26354770 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 26354711

                                                                            
Query: 420      tgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcc-cttc 478
                |||| |||||  |||  ||||||||||||| |||||| |||  |||   || ||| ||||
Sbjct: 26354710 tgttcgcgcccgcgaccaagccgatggcgaggggcgcaatgtcgcc---gccgccgcttc 26354654

                                                                       
Query: 479      ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 533
                |  || |||||||||||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 26354653 tccgg-tcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 26354600



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                            
Query: 287      ccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
                ||||| ||||| || ||||| || ||||||||||||||||||||
Sbjct: 27568517 ccggccaggccaccaccgatcagtgggccgacccagtacaccca 27568560



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 283      gacgccggcgaggccgccgccgatgagg 310
                ||||||| ||||||||||||||| ||||
Sbjct: 19492802 gacgccgacgaggccgccgccgaggagg 19492775



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 602     gtggagaagcggaggaggaa 621
               ||||||||||||||||||||
Sbjct: 9345783 gtggagaagcggaggaggaa 9345764



to top

>gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast intrinsic protein (TIP)
           mRNA, complete cds
          Length = 1235

 Score =  119 bits (60), Expect = 1e-23
 Identities = 210/260 (80%)
 Strand = Plus / Minus

                                                                       
Query: 278 tagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtac 337
           |||||||| |||||||| || || |||||||| |||||||||||||| ||||| ||||  
Sbjct: 752 tagatgactccggcgagccctcctccgatgagtgggccgacccagtagacccagtggttg 693

                                                                       
Query: 338 ccccactcccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccg 397
             |||   ||| ||||| ||||| || ||||| || ||||| ||||||||||| || |||
Sbjct: 692 ttccaggtccaactgactagggctggaccgaatgacacggccgggttcatggatgcaccg 633

                                                                       
Query: 398 gagaaggcgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcg 457
           | |||||| || ||||| | ||||||||| || |||||||| || ||||| || || || 
Sbjct: 632 gtgaaggctcctccgaccaagatgttggctccaacgatgaaaccaatggcaattggggca 573

                                                                       
Query: 458 atggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagc 517
           ||| | || ||| ||||  ||||| |||||| ||| ||||||||||| ||||| ||||| 
Sbjct: 572 atgattccgaggttgcctctcttgtggtcgatggccgtggcgtacacggtgtagaccagg 513

                               
Query: 518 ccgaaggtcatgacgatctc 537
           ||||||||||| || |||||
Sbjct: 512 ccgaaggtcatcacaatctc 493



to top

>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein
          Length = 1007

 Score =  107 bits (54), Expect = 5e-20
 Identities = 144/174 (82%)
 Strand = Plus / Minus

                                                                       
Query: 366 cgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttgg 425
           ||||||||  |||||||||||||||  |||| ||||||| |||  || | | ||||||||
Sbjct: 684 cgaaggagcgggcggggttcatggagccgccagagaaggggcccgcggccaagatgttgg 625

                                                                       
Query: 426 cgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggt 485
           |||| ||||||||||| || || ||||| |||||||||||||||  ||||||||| ||||
Sbjct: 624 cgcccacgatgaagccaatagcaatgggagcgatggtgcccaggtcgcccttcttcgggt 565

                                                                 
Query: 486 cgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctcca 539
           || | ||||||||||| || ||||| |  ||| |||| || || ||||||||||
Sbjct: 564 cggctgcggtggcgtagacggtgtagatgagcgcgaatgtgataacgatctcca 511



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                       
Query: 287 ccggcgaggccgccgccgatgagggggccgacccagtacaccca 330
           ||||| |||||||| |||||||||||||||||||||||||||||
Sbjct: 763 ccggcaaggccgcctccgatgagggggccgacccagtacaccca 720



to top

>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 887

 Score =  103 bits (52), Expect = 8e-19
 Identities = 136/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| ||||||  ||| || || ||| |||||||||| || || |||
Sbjct: 488 acggctgggttcatggaagcgccgctgaaagctccaccggcgaggatgttcgctccaacg 429

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| || |||||||| || ||||| || || ||  |||| ||||||||||| ||||| 
Sbjct: 428 atgaaacctatggcgattggtgcgattgttccgagagtgccgttcttggggtcaacggct 369

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 368 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 325



to top

>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein
           (tip1 gene)
          Length = 1112

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 250/314 (79%), Gaps = 2/314 (0%)
 Strand = Plus / Minus

                                                                       
Query: 225 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 284
           ||||||| ||||| |||||||| || |||||| ||  |||||| | ||||| ||||| ||
Sbjct: 830 agtagtcagtggttgggagctgttcatgggtgtggttgatgaataacagctggtagacga 771

                                                                       
Query: 285 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 344
            |||||||| | |  | ||||  || |||||||||||||| | ||| ||||   |||| |
Sbjct: 770 tgccggcgatggctgcaccgactagtgggccgacccagtagatccagtggttaacccagt 711

                                                                       
Query: 345 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 404
            |||||| || | ||| || || ||||  ||||| ||||||||||| || |||| |||| 
Sbjct: 710 tccagctcaccaaggcaggtccaaaggccacggcagggttcatggatgcaccggtgaaga 651

                                                                       
Query: 405 cgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgc 464
           | || ||||||| |||||||||  | || || | ||||||||||| ||| ||||| ||||
Sbjct: 650 ctcctccgacgaagatgttggcagcaacaataaggccgatggcgaggggagcgatagtgc 591

                                                                       
Query: 465 cca-ggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaag 523
           | | |||| || ||||||||||||| |||||||||||| || ||||| || || ||||||
Sbjct: 590 cgatggct-cctttcttggggtcgatggcggtggcgtagacggtgtagactagtccgaag 532

                         
Query: 524 gtcatgacgatctc 537
           ||||| ||||||||
Sbjct: 531 gtcatcacgatctc 518



to top

>dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence
          Length = 1054

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 136/165 (82%)
 Strand = Plus / Minus

                                                                       
Query: 373 gacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgac 432
           |||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || ||
Sbjct: 679 gacggctgggttcatggaggctccgctgaaagctccaccggcgaggatgttagctccaac 620

                                                                       
Query: 433 gatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggc 492
           |||||| || ||||| || || ||||| || || || || || |||||||||||||||||
Sbjct: 619 gatgaaacctatggcaattggtgcgattgttccgagactaccgttcttggggtcgacggc 560

                                                        
Query: 493 ggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
            |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 559 tgtggcgtaaacggtgtagacgagcccgaaggtcatcacgatctc 515



to top

>ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC PROTEIN 2); water
           channel AT3G26520 (TIP2) mRNA, complete cds
          Length = 1201

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 135/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 720 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 661

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 660 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 601

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 600 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 557



to top

>gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 762

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 135/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 608 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 549

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 548 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 489

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 488 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 445



to top

>gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 1061

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 135/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 670 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 611

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 610 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 551

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 550 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 507



to top

>gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds
          Length = 1066

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 135/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 675 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 616

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 615 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 556

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 555 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 512



to top

>gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced tonoplast intrinsic
           protein mRNA, complete cds
          Length = 1072

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 135/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 682 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 623

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 622 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 563

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 562 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 519



to top

>emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB65ZD08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1010

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 135/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 658 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 599

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 598 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 539

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 538 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 495



to top

>emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB53ZH08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1020

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 135/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 536 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493



to top

>emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH1ZE06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1008

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 135/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 536 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493



to top

>emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB78ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1054

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 135/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 647 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 588

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 587 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 528

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 527 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 484



to top

>emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH38ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 995

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 135/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 665 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 606

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 605 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 546

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 545 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 502



to top

>emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZE05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 960

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 135/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 479 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 420

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 419 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 360

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 359 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 316



to top

>emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS56ZB09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1012

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 135/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 656 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 597

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 596 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 537

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 536 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 493



to top

>dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16
          Length = 82646

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 135/164 (82%)
 Strand = Plus / Plus

                                                                         
Query: 374   acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
             ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 15518 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 15577

                                                                         
Query: 434   atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
             ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 15578 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 15637

                                                         
Query: 494   gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
             |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 15638 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 15681



to top

>gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protein (gamma-TIP2) mRNA,
           complete cds
          Length = 1020

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 135/164 (82%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 617 acggctgggttcatggaggctccgctgaaagctccaccggcgaggatgttagctccaacg 558

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| || |||||||| || ||||| || || || || || ||||||||||| ||||| 
Sbjct: 557 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggct 498

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 497 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 454



to top

>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA
          Length = 756

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 79/90 (87%)
 Strand = Plus / Minus

                                                                       
Query: 354 cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 413
           ||||||| ||||||||||||  ||| ||||||||||| ||||||||| |||  |||||| 
Sbjct: 616 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 557

                                         
Query: 414 cgaggatgttggcgccgacgatgaagccga 443
           ||||||||||||||||||||| || |||||
Sbjct: 556 cgaggatgttggcgccgacgacgaggccga 527



to top

>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA,
           complete cds
          Length = 955

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 73/82 (89%)
 Strand = Plus / Minus

                                                                       
Query: 353 acgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccg 412
           ||||| |||||||||||||||   ||||||||||||||||||||||||||||  ||||||
Sbjct: 714 acgagcgcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccg 655

                                 
Query: 413 acgaggatgttggcgccgacga 434
            |||| | ||||||||||||||
Sbjct: 654 gcgagcacgttggcgccgacga 633



to top

>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0431F01
          Length = 143209

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 79/90 (87%)
 Strand = Plus / Minus

                                                                         
Query: 354   cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 413
             ||||||| ||||||||||||  ||| ||||||||||| ||||||||| |||  |||||| 
Sbjct: 98909 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 98850

                                           
Query: 414   cgaggatgttggcgccgacgatgaagccga 443
             ||||||||||||||||||||| || |||||
Sbjct: 98849 cgaggatgttggcgccgacgacgaggccga 98820



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                     
Query: 380    gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 434
              ||||||||||||||||||| ||  ||||||||| ||| | |||||||||||||||
Sbjct: 103782 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 103728



to top

>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full
           insert sequence
          Length = 1112

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 79/90 (87%)
 Strand = Plus / Minus

                                                                       
Query: 354 cgagggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccga 413
           ||||||| ||||||||||||  ||| ||||||||||| ||||||||| |||  |||||| 
Sbjct: 619 cgagggccgggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccgg 560

                                         
Query: 414 cgaggatgttggcgccgacgatgaagccga 443
           ||||||||||||||||||||| || |||||
Sbjct: 559 cgaggatgttggcgccgacgacgaggccga 530



to top

>dbj|AB206104.1| Mimosa pudica tip1;1 mRNA for tonoplast intrinsic protein 1;1,
           complete cds
          Length = 1067

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 96/113 (84%)
 Strand = Plus / Minus

                                                                       
Query: 223 ttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagat 282
           |||||| ||||||||||||||||||||||||||| ||||||||||||  |  || |||||
Sbjct: 826 ttagtaatcggtggtggggagctgctcgtgggtgtgggagatgaagataacttcatagat 767

                                                                
Query: 283 gacgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 335
           ||| || || ||||| || || || || |||||||||||||| ||||| ||||
Sbjct: 766 gaccccagcaaggccacctccaataagtgggccgacccagtagacccagtggt 714



to top

>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene)
          Length = 428

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 181/224 (80%), Gaps = 2/224 (0%)
 Strand = Plus / Minus

                                                                       
Query: 315 cgacccagtacacccactggtacccccactcccagctgacgagggcggggccgaaggaga 374
           |||||||||| ||||||||||   |||| | |||||| || | ||| || || ||||  |
Sbjct: 428 cgacccagtaaacccactggttaacccagttccagctcaccaaggcaggtccaaaggcca 369

                                                                       
Query: 375 cggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 434
           |||| ||||||||||| || |||| |||| | || ||| ||| |||||||||  | || |
Sbjct: 368 cggcagggttcatggatgcaccggtgaagactcctccgtcgaagatgttggcagcaacaa 309

                                                                       
Query: 435 tgaagccgatggcgatgggcgcgatggtgccca-ggctgcccttcttggggtcgacggcg 493
           | | ||||||||||| ||| ||||| ||||| | |||| || ||||||||||||| ||||
Sbjct: 308 taaggccgatggcgaggggagcgatagtgccgatggct-cctttcttggggtcgatggcg 250

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || || ||||||||||| ||||||||
Sbjct: 249 gtggcgtagacggtgtagactagtccgaaggtcatcacgatctc 206



to top

>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds
          Length = 321

 Score = 87.7 bits (44), Expect = 5e-14
 Identities = 101/120 (84%)
 Strand = Plus / Minus

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           |||||||||||||||||| ||||||||||| || || || || || ||||| || |||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggcaattggtgcaattgttcccagacttccctt 262

                                                                       
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           ||||||||| |  ||||| ||||| || |||||||| |||||||| ||||| || |||||
Sbjct: 261 cttggggtcaattgcggttgcgtagactgtgtacacaagcccgaacgtcattacaatctc 202



to top

>dbj|AB048248.1| Pyrus communis Py-gTIP mRNA for gamma tonoplast intrinsic protein,
           complete cds
          Length = 1122

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 100/119 (84%)
 Strand = Plus / Minus

                                                                       
Query: 419 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttc 478
           ||||||||||| |||||||| || || |||||||||||||| || |||| ||| || |||
Sbjct: 631 atgttggcgccaacgatgaaaccaatcgcgatgggcgcgattgtccccacgctcccattc 572

                                                                      
Query: 479 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           || ||||| | ||| || ||||| |||||||| ||||| ||||| ||||| ||||||||
Sbjct: 571 ttcgggtcaatggcagtcgcgtagaccgtgtagaccagtccgaacgtcatcacgatctc 513



to top

>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA,
           complete cds
          Length = 1125

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 72/82 (87%)
 Strand = Plus / Minus

                                                                       
Query: 356 agggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacg 415
           ||||| ||||||||||||   || ||||||||||||||||||| ||||  ||||||| ||
Sbjct: 768 agggccgggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcg 709

                                 
Query: 416 aggatgttggcgccgacgatga 437
           ||| ||||||||||||||||||
Sbjct: 708 aggctgttggcgccgacgatga 687



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 607 gaagcggaggaggaagcaggcggcggtggagcccagcagctg 648
           |||||||||||||| ||||||||||| |||| ||||||||||
Sbjct: 517 gaagcggaggaggacgcaggcggcggaggaggccagcagctg 476



to top

>ref|XM_473251.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 189/235 (80%), Gaps = 5/235 (2%)
 Strand = Plus / Minus

                                                                       
Query: 300 cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 359
           |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| |||||| |
Sbjct: 697 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 638

                                                                       
Query: 360 cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 419
           | |||||||| | |   || |||||||||| |||||||  ||| | ||| ||| ||||||
Sbjct: 637 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 578

                                                                       
Query: 420 tgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcc-cttc 478
           |||| |||||  |||  ||||||||||||| |||||| |||  |||   || ||| ||||
Sbjct: 577 tgttcgcgcccgcgaccaagccgatggcgaggggcgcaatgtcgcc---gccgccgcttc 521

                                                                  
Query: 479 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 533
           |  || |||||||||||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 520 tccgg-tcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 467



to top

>emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0038O10,
              complete sequence
          Length = 141545

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 189/235 (80%), Gaps = 5/235 (2%)
 Strand = Plus / Minus

                                                                          
Query: 300    cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 359
              |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| |||||| |
Sbjct: 131407 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 131348

                                                                          
Query: 360    cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 419
              | |||||||| | |   || |||||||||| |||||||  ||| | ||| ||| ||||||
Sbjct: 131347 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 131288

                                                                          
Query: 420    tgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcc-cttc 478
              |||| |||||  |||  ||||||||||||| |||||| |||  |||   || ||| ||||
Sbjct: 131287 tgttcgcgcccgcgaccaagccgatggcgaggggcgcaatgtcgcc---gccgccgcttc 131231

                                                                     
Query: 479    ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 533
              |  || |||||||||||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 131230 tccgg-tcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 131177



to top

>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds
          Length = 1047

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 101/121 (83%)
 Strand = Plus / Minus

                                                                       
Query: 419 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttc 478
           ||||| ||||| || ||||| || ||||||||||| || ||  | ||||   ||||||||
Sbjct: 665 atgttagcgccaacaatgaaaccaatggcgatgggagcaataattcccaaattgcccttc 606

                                                                       
Query: 479 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctcc 538
           |||||||| ||||| |||||||| || ||||||||||  ||||||||||| |||||||||
Sbjct: 605 ttggggtcaacggcagtggcgtagactgtgtacaccaaaccgaaggtcatcacgatctcc 546

            
Query: 539 a 539
           |
Sbjct: 545 a 545



to top

>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein
          Length = 992

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 133/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 376 ggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgat 435
           |||||||||||| ||||| |||| ||| || || || || || |||||||| ||||||||
Sbjct: 623 ggcggggttcatcgacgcaccggtgaacgccccaccaaccagaatgttggcaccgacgat 564

                                                                       
Query: 436 gaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggt 495
           ||| ||||| || ||||| |||||||| || |     ||||||||||| ||||| || ||
Sbjct: 563 gaatccgatcgcaatgggagcgatggttccaatatcccccttcttgggatcgacagcagt 504

                                                       
Query: 496 ggcgtacaccgtgtacaccagcccgaaggtcatgacgatctcca 539
            |||||||| ||||| || |||||| | ||||| ||||||||||
Sbjct: 503 agcgtacacagtgtagacgagcccgcacgtcatcacgatctcca 460



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 299 ccgccgatgagggggccgacccagtacaccca 330
           ||||||||||| ||||| ||||||||||||||
Sbjct: 703 ccgccgatgagcgggccaacccagtacaccca 672



to top

>gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast intrinsic protein
           bobTIP26-1 mRNA, complete cds
          Length = 942

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 100/120 (83%)
 Strand = Plus / Minus

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           ||||||||| || || ||||| ||||| |||||||| || || || || || || || ||
Sbjct: 597 gatgttggcaccaacaatgaaaccgatagcgatgggagctattgttccaagacttccgtt 538

                                                                       
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||| || |||||||||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 537 cttgggatcaacggcggtggcgtagactgtgtaaactagcccgaaggtcatcacgatctc 478



 Score = 48.1 bits (24), Expect = 0.039
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 225 agtagtcggtggtggggagctgctcgtgggtg 256
           ||||||||| |||||||||||| |||||||||
Sbjct: 790 agtagtcggcggtggggagctgttcgtgggtg 759



to top

>emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB27ZF06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 628

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                       
Query: 414 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 473
           |||||||||| || || |||||||| || |||||||| || ||||| || || || || |
Sbjct: 182 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 123

                                                                       
Query: 474 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 533
           | ||||||||||| ||||  |||||||| || ||||| || |||||||||||||| ||||
Sbjct: 122 cgttcttggggtctacggttgtggcgtagacggtgtagacgagcccgaaggtcattacga 63

               
Query: 534 tctc 537
           ||||
Sbjct: 62  tctc 59



to top

>emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH92ZF07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 931

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 133/164 (81%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| |||||   ||| || || ||| |||||||||| || || |||
Sbjct: 644 acggctgggttcatggaagcgcccctgaacgctccaccggcgaggatgttcgctccaacg 585

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| |  |||||||| || |||||  |||| ||  | || ||||||||||| ||||| 
Sbjct: 584 atgaaacttatggcgattggtgcgattttgccgagaataccgttcttggggtcaacggct 525

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 524 gtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 481



to top

>dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein,
           complete cds
          Length = 1143

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 99/119 (83%)
 Strand = Plus / Minus

                                                                       
Query: 419 atgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttc 478
           ||||| ||||| || | ||| ||||| ||||| |||||||| || |||| ||||||  ||
Sbjct: 660 atgttcgcgccaactacgaaaccgatcgcgatcggcgcgattgttcccacgctgcctctc 601

                                                                      
Query: 479 ttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           || ||||| | ||| |||||||||||||||||||||| ||| || ||||| ||||||||
Sbjct: 600 ttcgggtcaatggctgtggcgtacaccgtgtacaccaacccaaacgtcatcacgatctc 542



to top

>dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C05, full
           insert sequence
          Length = 912

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 48/51 (94%)
 Strand = Plus / Minus

                                                              
Query: 483 ggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 533
           |||||||||||||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 583 ggtcgacggcggtggcgtacacggtgtacacgagcccgaacgtcatgacga 533



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 125/157 (79%)
 Strand = Plus / Minus

                                                                       
Query: 300 cgccgatgagggggccgacccagtacacccactggtacccccactcccagctgacgaggg 359
           |||||||||| || |||| |||||| ||||| ||||  | ||| | ||||| |||||| |
Sbjct: 763 cgccgatgagcggcccgagccagtaaacccagtggtggcgccagttccagccgacgagcg 704

                                                                       
Query: 360 cggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgagga 419
           | |||||||| | |   || |||||||||| |||||||  ||| | ||| ||| ||||||
Sbjct: 703 ccgggccgaacgcgcgcgccgggttcatggccgcgccgtcgaacgggcccccggcgagga 644

                                                
Query: 420 tgttggcgccgacgatgaagccgatggcgatgggcgc 456
           |||| |||||  |||  ||||||||||||| ||||||
Sbjct: 643 tgttcgcgcccgcgaccaagccgatggcgaggggcgc 607



to top

>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds
          Length = 321

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           |||||||||||||||||||||||||||||| |||||||| || || |||| |   |||||
Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatgggcgcaattgtccccacgtcaccctt 262

                                                 
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacacca 515
           ||| |||||    |||||| ||||||| ||||||||||
Sbjct: 261 ctttgggtcacatgcggtgccgtacactgtgtacacca 224



to top

>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence
          Length = 980

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 244/313 (77%)
 Strand = Plus / Minus

                                                                       
Query: 225 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 284
           ||||||||||||| |||||||| |||||||||  |   |||||||  | |||||||||||
Sbjct: 767 agtagtcggtggttgggagctgttcgtgggtggtgttaatgaagaaaacctcgtagatga 708

                                                                       
Query: 285 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccact 344
             |||||||  || ||||||| ||| || ||| ||||||| ||||| ||||    |||| 
Sbjct: 707 gtccggcgattccaccgccgacgagaggtccggcccagtagacccagtggttggtccacg 648

                                                                       
Query: 345 cccagctgacgagggcggggccgaaggagacggcggggttcatggacgcgccggagaagg 404
            |||||| || |  || || ||||| |  |||||||| |||||||| || |||||||| |
Sbjct: 647 tccagctcacaaccgctggtccgaaagccacggcgggattcatggaggctccggagaatg 588

                                                                       
Query: 405 cgccgccgacgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgc 464
           | || ||  | |  |||||||| ||||| ||||| || || ||||| || ||||| || |
Sbjct: 587 ctcctccagctaatatgttggctccgactatgaaaccaatagcgattggagcgattgttc 528

                                                                       
Query: 465 ccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaagg 524
           | || || || || |||||||| | |||||||||||| || ||||| || |||||||| |
Sbjct: 527 cgagactcccgtttttggggtcaatggcggtggcgtagacagtgtaaacaagcccgaatg 468

                        
Query: 525 tcatgacgatctc 537
           |||| ||||||||
Sbjct: 467 tcatcacgatctc 455



to top

>emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL65ZH05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 1014

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 88/105 (83%)
 Strand = Plus / Minus

                                                                       
Query: 433 gatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggc 492
           |||||| || |||||||| || ||||| || || || || || ||||||||||| |||||
Sbjct: 589 gatgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacggc 530

                                                        
Query: 493 ggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
            |||||||| || ||||| || |||||||||||||| ||||||||
Sbjct: 529 tgtggcgtagacggtgtagacgagcccgaaggtcatcacgatctc 485



to top

>emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS54ZD02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1062

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 100/121 (82%)
 Strand = Plus / Minus

                                                                       
Query: 417 ggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccct 476
           ||||||| || || |||||||| || |||||||| || ||||| || || || || || |
Sbjct: 613 ggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactaccgt 554

                                                                       
Query: 477 tcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatct 536
           |||||||||| ||||| |||||||| || ||| | || |||||||||||||| |||||||
Sbjct: 553 tcttggggtcaacggctgtggcgtagacggtgcagacgagcccgaaggtcatcacgatct 494

            
Query: 537 c 537
           |
Sbjct: 493 c 493



to top

>emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH74ZE01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 921

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 103/124 (83%), Gaps = 1/124 (0%)
 Strand = Plus / Minus

                                                                       
Query: 414 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 473
           |||||||||| || || |||||||| || |||||||| |  ||||| || || || || |
Sbjct: 615 cgaggatgttagctccaacgatgaaacctatggcgattgt-gcgattgttccgagactac 557

                                                                       
Query: 474 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 533
           | ||||||||||| ||||| |||||||| || ||||| || |||||||||||||| ||||
Sbjct: 556 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacga 497

               
Query: 534 tctc 537
           ||||
Sbjct: 496 tctc 493



to top

>gb|AF057137.1|AF057137 Arabidopsis thaliana gamma tonoplast intrinsic protein 2 (TIP2)
           mRNA, complete cds
          Length = 1035

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 102/124 (82%)
 Strand = Plus / Minus

                                                                       
Query: 414 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 473
           |||||||||| || || |||||||| || |||||||| || ||||| || || || ||  
Sbjct: 621 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactag 562

                                                                       
Query: 474 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 533
           | |||||||| || ||||| |||||||| || ||||| || |||||||||||||| ||||
Sbjct: 561 cgttcttgggatcaacggctgtggcgtagacggtgtagacgagcccgaaggtcatcacga 502

               
Query: 534 tctc 537
           ||||
Sbjct: 501 tctc 498



to top

>emb|AJ133748.1|PAB133748 Picea abies mRNA for major intrinsic protein
          Length = 1168

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 134/167 (80%)
 Strand = Plus / Minus

                                                                       
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 439
           ||||||||||| || |||  |||||| |||||| | || || ||||| || || ||||| 
Sbjct: 708 gggttcatggaagccccgtcgaaggcaccgccggccagaatattggcacccactatgaaa 649

                                                                       
Query: 440 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 499
           ||||| || | ||| || ||||| |||||||| ||| | || |  |||| ||| ||||||
Sbjct: 648 ccgatcgcaaggggggctatggttcccaggctcccccttttagcatcgatggccgtggcg 589

                                                          
Query: 500 tacaccgtgtacaccagcccgaaggtcatgacgatctccaggaccac 546
           || || ||||| ||||||||||| ||||| ||||||||||| |||||
Sbjct: 588 tatacagtgtaaaccagcccgaacgtcatcacgatctccagcaccac 542



to top

>gb|AF326506.1|AF326506 Zea mays tonoplast membrane integral protein ZmTIP4-2 mRNA,
           complete cds
          Length = 1255

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                     
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 437
           ||||||||||||||||||| ||||  ||||||| ||||| ||||||||||||| ||||
Sbjct: 743 gggttcatggacgcgccggtgaagttgccgccggcgaggctgttggcgccgactatga 686



to top

>emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS71ZE09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 573

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 135/166 (81%), Gaps = 2/166 (1%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 183 acggctgggttcatggaagctccgctgaaagctccaccggcgaggatgttagctccaacg 124

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgac-ggc 492
           ||||| || |||||||| || ||||| || || || || || ||||||||||| || |||
Sbjct: 123 atgaaacctatggcgattggtgcgattgttccgagactaccgttcttggggtcaacgggc 64

                                                         
Query: 493 ggtggcgtacac-cgtgtacaccagcccgaaggtcatgacgatctc 537
            |||||||| ||  ||||| || |||||||||||||| ||||||||
Sbjct: 63  tgtggcgtagacgggtgtagacgagcccgaaggtcatcacgatctc 18



to top

>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds
          Length = 321

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 82/98 (83%)
 Strand = Plus / Minus

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           |||||||||||||||||| |||||||||||||| || || || |||||||     |||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggcgatcggtgcaattgtgcccaatgcaccctt 262

                                                 
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacacca 515
           |||||||||    ||||||||||| || ||||||||||
Sbjct: 261 cttggggtcacatgcggtggcgtaaacggtgtacacca 224



to top

>gb|DQ237285.1| Panax ginseng tonoplast intrinsic protein (TIP1) mRNA, complete cds
          Length = 940

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 473 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 532
           |||||||| ||||||| |||||| ||||| || ||||| |||||||| ||||||||||| 
Sbjct: 561 cccttctttgggtcgatggcggttgcgtaaacggtgtaaaccagcccaaaggtcatgaca 502

                
Query: 533 atctc 537
           |||||
Sbjct: 501 atctc 497



to top

>gb|AF271662.1|AF271662 Vitis berlandieri x Vitis rupestris putative aquaporin TIP2 (TIP2)
           mRNA, partial cds
          Length = 304

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 98/120 (81%)
 Strand = Plus / Minus

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           ||||||||| || |||||||| || || || ||||| || ||| |||| | | |||||||
Sbjct: 274 gatgttggcacccacgatgaaaccaattgcaatgggtgcaatgatgccgatgttgccctt 215

                                                                       
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           ||| ||||| | ||| || ||||| || ||||| ||||| |||||||||||||| |||||
Sbjct: 214 cttcgggtcaatggctgttgcgtatacagtgtaaaccaggccgaaggtcatgacaatctc 155



to top

>gb|AY821911.1| Gossypium hirsutum putative tonoplast intrinsic protein mRNA,
           partial cds
          Length = 529

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 221 gcttagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtag 280
           ||||| || |||||||| ||||||||||||||||||  |  ||||||||  | |||||||
Sbjct: 417 gcttaataatcggtggttgggagctgctcgtgggtgttgctgatgaagatgaactcgtag 358

                                                       
Query: 281 atgacgccggcgaggccgccgccgatgagggggccgacccagta 324
           ||||  || ||||| || || ||||| ||||| |||||||||||
Sbjct: 357 atgagaccagcgagcccaccaccgataaggggtccgacccagta 314



 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 455 gcgatggtgcccaggctgcccttcttggggtcgacggcggtggcgtacaccgtgtacacc 514
           ||||| || |||| ||| ||||| ||||| || ||||| ||||||||||| |||||||||
Sbjct: 183 gcgattgttcccaagcttccctttttgggatcaacggctgtggcgtacactgtgtacacc 124

                               
Query: 515 agcccgaaggtcatgacgat 534
           |  ||||||||||| |||||
Sbjct: 123 aatccgaaggtcatcacgat 104



to top

>ref|NM_188626.1| Oryza sativa (japonica cultivar-group), Ozsa8229 predicted mRNA
          Length = 756

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 434
           ||||||||||||||||||| ||  ||||||||| ||| | |||||||||||||||
Sbjct: 590 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 536



to top

>ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative beta-tonoplast
           intrinsic protein (OSJNBa0051D19.19), mRNA
          Length = 1186

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 287 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 346
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 855 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 796

                                  
Query: 347 cagctgacgagggcggggccgaa 369
           |||| |||||| || ||||||||
Sbjct: 795 cagccgacgagcgccgggccgaa 773



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 414 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
           |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 728 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 680



to top

>ref|NM_189871.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 576

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 287 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 346
           |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | |
Sbjct: 512 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 453

                      
Query: 347 cagctgacgag 357
           |||| ||||||
Sbjct: 452 cagccgacgag 442



to top

>gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 genomic sequence, complete
             sequence
          Length = 131984

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                         
Query: 287   ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 346
             |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 26108 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 26167

                                    
Query: 347   cagctgacgagggcggggccgaa 369
             |||| |||||| || ||||||||
Sbjct: 26168 cagccgacgagcgccgggccgaa 26190



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                              
Query: 414   cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
             |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 26235 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 26283



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                            
Query: 287      ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 346
                |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 18187020 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 18186961

                                       
Query: 347      cagctgacgagggcggggccgaa 369
                |||| |||||| || ||||||||
Sbjct: 18186960 cagccgacgagcgccgggccgaa 18186938



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                                 
Query: 414      cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
                |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 18186893 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 18186845



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                            
Query: 287      ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 346
                |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | |
Sbjct: 25641777 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 25641836

                           
Query: 347      cagctgacgag 357
                |||| ||||||
Sbjct: 25641837 cagccgacgag 25641847



to top

>gb|AF275315.1|AF275315 Lotus japonicus water-selective transport intrinsic membrane
           protein 1 mRNA, complete cds
          Length = 1162

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 473 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 532
           ||||||||||| || ||||| |||||||| || ||||||||||  || |||||||| |||
Sbjct: 562 cccttcttgggatcaacggctgtggcgtaaactgtgtacaccaatccaaaggtcatcacg 503

                  
Query: 533 atctcca 539
           |||||||
Sbjct: 502 atctcca 496



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 346 ccagctgacgagggcggggccgaaggagacggcggggttcatgga 390
           |||||| |||| ||| || ||||| || |||||||||||||||||
Sbjct: 689 ccagctcacgacggctggtccgaatgacacggcggggttcatgga 645



to top

>dbj|AP004380.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0594D10
          Length = 143200

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                         
Query: 287   ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 346
             |||||||||||| | ||||||| |||||||| |||||||||||| |||| || ||| | |
Sbjct: 95750 ccggcgaggccggcaccgatgaaggggccgagccagtacacccagtggtgcctccagtgc 95809

                        
Query: 347   cagctgacgag 357
             |||| ||||||
Sbjct: 95810 cagccgacgag 95820



to top

>dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-C03, full
           insert sequence
          Length = 1200

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 287 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 346
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 864 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 805

                                  
Query: 347 cagctgacgagggcggggccgaa 369
           |||| |||||| || ||||||||
Sbjct: 804 cagccgacgagcgccgggccgaa 782



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 414 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
           |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 737 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 689



to top

>dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1178

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 287 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 346
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 847 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 788

                                  
Query: 347 cagctgacgagggcggggccgaa 369
           |||| |||||| || ||||||||
Sbjct: 787 cagccgacgagcgccgggccgaa 765



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 414 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
           |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 720 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 672



to top

>dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-E03, full
           insert sequence
          Length = 1787

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                       
Query: 287 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 346
           |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 139 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 198

                                  
Query: 347 cagctgacgagggcggggccgaa 369
           |||| |||||| || ||||||||
Sbjct: 199 cagccgacgagcgccgggccgaa 221



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Plus

                                                            
Query: 414 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
           |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 266 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 314



to top

>dbj|AK099190.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023108H12, full
           insert sequence
          Length = 1055

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 434
           ||||||||||||||||||| ||  ||||||||| ||| | |||||||||||||||
Sbjct: 636 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 582



to top

>dbj|AK069592.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023019I12, full
           insert sequence
          Length = 1059

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                  
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacga 434
           ||||||||||||||||||| ||  ||||||||| ||| | |||||||||||||||
Sbjct: 639 gggttcatggacgcgccggtgagcgcgccgccggcgacggtgttggcgccgacga 585



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                            
Query: 287      ccggcgaggccgccgccgatgagggggccgacccagtacacccactggtacccccactcc 346
                |||||||||||| |||||| || |||||||| |||||||||||| |||| || |||   |
Sbjct: 18196273 ccggcgaggccggcgccgacgaaggggccgagccagtacacccagtggtgcctccagcgc 18196214

                                       
Query: 347      cagctgacgagggcggggccgaa 369
                |||| |||||| || ||||||||
Sbjct: 18196213 cagccgacgagcgccgggccgaa 18196191



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                                 
Query: 414      cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
                |||| ||||||||||||| || |||||||| |||||  |||||||||||
Sbjct: 18196146 cgagcatgttggcgccgaggaggaagccgacggcgagcggcgcgatggt 18196098



to top

>dbj|AP004479.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT03H13, TM0012b,
             complete sequence
          Length = 41820

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                         
Query: 473   cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 532
             ||||||||||| || ||||| |||||||| || ||||||||||  || |||||||| |||
Sbjct: 10234 cccttcttgggatcaacggctgtggcgtaaactgtgtacaccaatccaaaggtcatcacg 10293

                    
Query: 533   atctcca 539
             |||||||
Sbjct: 10294 atctcca 10300



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                          
Query: 346   ccagctgacgagggcggggccgaaggagacggcggggttcatgga 390
             |||||| |||| ||| || ||||| || |||||||||||||||||
Sbjct: 10107 ccagctcacgacggctggtccgaatgacacggcggggttcatgga 10151



to top

>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds
          Length = 911

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                         
Query: 617 aggaagcaggcggcggtggagcccagcagctgcgccacccagtaga 662
           |||||||| |||||||||||||| || ||||| |||||||||||||
Sbjct: 394 aggaagcaagcggcggtggagccgagaagctgagccacccagtaga 349



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 416 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
           ||||||||||| ||||||||||  || ||||||| ||| ||||||||
Sbjct: 598 aggatgttggcaccgacgatgagaccaatggcgaggggagcgatggt 552



to top

>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3)
           mRNA, complete cds
          Length = 1051

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 414 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
           ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 597 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 549



to top

>ref|NM_188505.1| Oryza sativa (japonica cultivar-group), Ozsa8174 predicted mRNA
          Length = 969

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 287 ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 335
           |||||||||||| ||||||||| ||| |||| |||||||||||| ||||
Sbjct: 881 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 833



to top

>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds
          Length = 753

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 414 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
           ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 559 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 511



to top

>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds
          Length = 853

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                            
Query: 414 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
           ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 587 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 539



to top

>gb|AF521135.1| Kandelia candel tonoplast intrinsic protein (TIP) mRNA, complete
           cds
          Length = 1099

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                
Query: 221 gcttagtagtcggtggtggggagctgctcgtgggtgc 257
           ||||||||||| | |||||||||||||||||||||||
Sbjct: 859 gcttagtagtcagcggtggggagctgctcgtgggtgc 823



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 86/104 (82%), Gaps = 1/104 (0%)
 Strand = Plus / Minus

                                                                       
Query: 434 atgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcg 493
           ||||| ||||||||||||| |||||| |||||||   | ||||||||||| || |  || 
Sbjct: 642 atgaaaccgatggcgatgg-cgcgattgtgcccaaatttcccttcttgggatcaatagcc 584

                                                       
Query: 494 gtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 537
           || ||||| || |||||||| || |||||||||||||| |||||
Sbjct: 583 gtcgcgtagactgtgtacacgaggccgaaggtcatgactatctc 540



to top

>dbj|AP002094.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0483F08
          Length = 148985

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                               
Query: 287    ccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 335
              |||||||||||| ||||||||| ||| |||| |||||||||||| ||||
Sbjct: 125093 ccggcgaggccggcgccgatgaagggaccgagccagtacacccagtggt 125141



to top

>gb|AF133531.1|AF133531 Mesembryanthemum crystallinum water channel protein MipI (MipI)
           mRNA, complete cds
          Length = 1035

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 473 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 532
           |||||||||||||| || || |||||||| || ||||| || |||||||||||||| || 
Sbjct: 576 cccttcttggggtcaacagcagtggcgtagacggtgtagacaagcccgaaggtcatcaca 517

                
Query: 533 atctc 537
           |||||
Sbjct: 516 atctc 512



to top

>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7
          Length = 80117

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 44/49 (89%)
 Strand = Plus / Plus

                                                             
Query: 414  cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
            ||||||||||||| || || ||||||||||||||||| || ||||||||
Sbjct: 8647 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggt 8695



to top

>emb|BX823560.1|CNS0A7QS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS51ZB01 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 676

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 100/124 (80%)
 Strand = Plus / Minus

                                                                       
Query: 414 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgc 473
           |||||||||| || || |||||||| || | |||||| || ||||| || || || |  |
Sbjct: 237 cgaggatgttcgctccaacgatgaaacccaaggcgattggtgcgattgttccgagacgac 178

                                                                       
Query: 474 ccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacga 533
           | ||||||||||| ||||| |||||||  || ||||| || ||||||| |||||| ||||
Sbjct: 177 cgttcttggggtcaacggctgtggcgtcgacggtgtagacgagcccgagggtcatcacga 118

               
Query: 534 tctc 537
           ||||
Sbjct: 117 tctc 114



to top

>gb|BT016509.1| Zea mays clone Contig342 mRNA sequence
          Length = 1237

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 273 gctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccact 332
           ||||||||| |||||||| ||||||| ||||||  | ||| || |||||||||||||| |
Sbjct: 880 gctcgtagacgacgccggagaggccggcgccgaccatgggccccacccagtacacccatt 821

              
Query: 333 ggt 335
           |||
Sbjct: 820 ggt 818



to top

>emb|X72581.1|ATGTIPMR A.thaliana mRNA for tonoplast intrinsic protein gamma (gamma-TIP)
          Length = 933

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 225 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 284
           ||||||||||||| |||||||||||||| |||  |  ||||||||  |  ||||||||||
Sbjct: 787 agtagtcggtggttgggagctgctcgtgtgtggtgttgatgaagaaaacttcgtagatga 728

                                                              
Query: 285 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 335
             || ||||  || ||||||| ||| || ||| ||||||||||||| ||||
Sbjct: 727 gtccagcgattccaccgccgacgagaggtccggcccagtacacccagtggt 677



to top

>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene)
          Length = 1017

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 349 gctgacgagggcggggccgaaggagacggcggggttcat 387
           |||||||| ||||||||||||||||  ||||||||||||
Sbjct: 624 gctgacgacggcggggccgaaggagcgggcggggttcat 586



to top

>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1)
           mRNA, complete cds
          Length = 1057

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 349 gctgacgagggcggggccgaaggagacggcggggttcat 387
           |||||||| ||||||||||||||||  ||||||||||||
Sbjct: 666 gctgacgacggcggggccgaaggagcgggcggggttcat 628



to top

>gb|AY130971.1| Brassica oleracea var. botrytis tonoplast intrinsic protein
           bobTIP26-2 gene, complete cds
          Length = 1442

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 476 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatc 535
           |||||||| || |||||||||||||| || ||||| || ||||| || ||||| ||||||
Sbjct: 996 ttcttgggatcaacggcggtggcgtagactgtgtaaactagcccaaatgtcattacgatc 937

             
Query: 536 tc 537
           ||
Sbjct: 936 tc 935



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 89/111 (80%)
 Strand = Plus / Minus

                                                                        
Query: 225  agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 284
            |||||||||||||||||||||| || || |||  |  ||||||||  | |||||||||||
Sbjct: 1247 agtagtcggtggtggggagctgttcatgtgtggtgttgatgaagaaaacctcgtagatga 1188

                                                               
Query: 285  cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 335
              |||||||  || |||||||| || || ||  ||||||| ||||| ||||
Sbjct: 1187 gtccggcgactccaccgccgataagaggtccagcccagtagacccagtggt 1137



to top

>gb|U92652.2|BOU92652 Brassica oleracea var. botrytis tonoplast intrinsic protein
           bobTIP26-2 mRNA, partial cds
          Length = 599

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 476 ttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatc 535
           |||||||| || |||||||||||||| || ||||| || ||||| || ||||| ||||||
Sbjct: 275 ttcttgggatcaacggcggtggcgtagactgtgtaaactagcccaaatgtcattacgatc 216

             
Query: 536 tc 537
           ||
Sbjct: 215 tc 214



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 89/111 (80%)
 Strand = Plus / Minus

                                                                       
Query: 225 agtagtcggtggtggggagctgctcgtgggtgcgggagatgaagagcagctcgtagatga 284
           |||||||||||||||||||||| || || |||  |  ||||||||  | |||||||||||
Sbjct: 526 agtagtcggtggtggggagctgttcatgtgtggtgttgatgaagaaaacctcgtagatga 467

                                                              
Query: 285 cgccggcgaggccgccgccgatgagggggccgacccagtacacccactggt 335
             |||||||  || |||||||| || || ||  ||||||| ||||| ||||
Sbjct: 466 gtccggcgactccaccgccgataagaggtccagcccagtagacccagtggt 416



to top

>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds
          Length = 321

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 418 gatgttggcgccgacgatgaagccgatggc 447
           |||||||||||||||||| |||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292



to top

>gb|AF367456.1| Prunus persica clone gTip1 gamma-tonoplast intrinsic protein mRNA,
           partial cds
          Length = 408

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 346 ccagctgacgagggcggggccgaaggagacggcggggttcatgga 390
           |||||||||||  ||||| ||||||||||| || |||||||||||
Sbjct: 393 ccagctgacgacagcgggtccgaaggagactgccgggttcatgga 349



to top

>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds
          Length = 321

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 425 gcgccgacgatgaagccgatggcga 449
           |||||||||||||||||||||||||
Sbjct: 314 gcgccgacgatgaagccgatggcga 290



to top

>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds
          Length = 321

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 422 ttggcgccgacgatgaagccgatggcgat 450
           |||||||||||||| ||||||||||||||
Sbjct: 317 ttggcgccgacgataaagccgatggcgat 289



to top

>ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel AT3G16240 (DELTA-TIP)
           mRNA, complete cds
          Length = 1125

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 126/160 (78%)
 Strand = Plus / Minus

                                                                       
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 439
           |||||||||||  | |||||||| |  ||| || ||||||||||||| || ||||| |  
Sbjct: 703 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 644

                                                                       
Query: 440 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 499
           || |||||||  || |||||||| || ||    ||||||||||| ||  |||||||||||
Sbjct: 643 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 584

                                                   
Query: 500 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 539
           || || ||||| ||||   ||||||| |||| ||||||||
Sbjct: 583 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 544



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 614 aggaggaagcaggcggcggtggagcccagcagctgcgccacccagtaga 662
           |||||||| || |||||||||||||| || ||||| || | ||||||||
Sbjct: 466 aggaggaaacaagcggcggtggagccgagaagctgagcgatccagtaga 418



to top

>ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron transporter/ iron ion
            binding AT3G16250 mRNA, complete cds
          Length = 1538

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 126/160 (78%)
 Strand = Plus / Plus

                                                                        
Query: 380  gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 439
            |||||||||||  | |||||||| |  ||| || ||||||||||||| || ||||| |  
Sbjct: 1172 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 1231

                                                                        
Query: 440  ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 499
            || |||||||  || |||||||| || ||    ||||||||||| ||  |||||||||||
Sbjct: 1232 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 1291

                                                    
Query: 500  tacaccgtgtacaccagcccgaaggtcatgacgatctcca 539
            || || ||||| ||||   ||||||| |||| ||||||||
Sbjct: 1292 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 1331



to top

>emb|X95952.1|HAAP H.annuus mRNA for aquaporin
          Length = 931

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 472 gcccttcttggggtcgacggcggtggcgtacaccgtgtacacca 515
           ||||||||||||||| || ||||||||||| ||  |||||||||
Sbjct: 553 gcccttcttggggtcaactgcggtggcgtaaacgttgtacacca 510



to top

>gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230)
           mRNA, complete cds
          Length = 853

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 126/160 (78%)
 Strand = Plus / Minus

                                                                       
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 439
           |||||||||||  | |||||||| |  ||| || ||||||||||||| || ||||| |  
Sbjct: 593 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 534

                                                                       
Query: 440 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 499
           || |||||||  || |||||||| || ||    ||||||||||| ||  |||||||||||
Sbjct: 533 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 474

                                                   
Query: 500 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 539
           || || ||||| ||||   ||||||| |||| ||||||||
Sbjct: 473 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 434



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 614 aggaggaagcaggcggcggtggagcccagcagctgcgccacccagtaga 662
           |||||||| || |||||||||||||| || ||||| || | ||||||||
Sbjct: 356 aggaggaaacaagcggcggtggagccgagaagctgagcgatccagtaga 308



to top

>gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230;
           MYA6.5) mRNA, complete cds
          Length = 929

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 126/160 (78%)
 Strand = Plus / Minus

                                                                       
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 439
           |||||||||||  | |||||||| |  ||| || ||||||||||||| || ||||| |  
Sbjct: 664 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 605

                                                                       
Query: 440 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 499
           || |||||||  || |||||||| || ||    ||||||||||| ||  |||||||||||
Sbjct: 604 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 545

                                                   
Query: 500 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 539
           || || ||||| ||||   ||||||| |||| ||||||||
Sbjct: 544 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 505



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 614 aggaggaagcaggcggcggtggagcccagcagctgcgccacccagtaga 662
           |||||||| || |||||||||||||| || ||||| || | ||||||||
Sbjct: 427 aggaggaaacaagcggcggtggagccgagaagctgagcgatccagtaga 379



to top

>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA,
           complete cds
          Length = 1021

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 349 gctgacgagggcggggccgaaggagacggcggggttcatggacgcgcc 396
           |||||||| ||| |||||||| |||  ||| |||||||||||||||||
Sbjct: 709 gctgacgacggccgggccgaacgagcgggccgggttcatggacgcgcc 662



to top

>emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZE06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 126/160 (78%)
 Strand = Plus / Minus

                                                                       
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 439
           |||||||||||  | |||||||| |  ||| || ||||||||||||| || ||||| |  
Sbjct: 641 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 582

                                                                       
Query: 440 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 499
           || |||||||  || |||||||| || ||    ||||||||||| ||  |||||||||||
Sbjct: 581 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 522

                                                   
Query: 500 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 539
           || || ||||| ||||   ||||||| |||| ||||||||
Sbjct: 521 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 482



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 614 aggaggaagcaggcggcggtggagcccagcagctgcgccacccagtaga 662
           |||||||| || |||||||||||||| || ||||| || | ||||||||
Sbjct: 404 aggaggaaacaagcggcggtggagccgagaagctgagcgatccagtaga 356



to top

>emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB88ZH07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 957

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 126/160 (78%)
 Strand = Plus / Minus

                                                                       
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 439
           |||||||||||  | |||||||| |  ||| || ||||||||||||| || ||||| |  
Sbjct: 646 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 587

                                                                       
Query: 440 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 499
           || |||||||  || |||||||| || ||    ||||||||||| ||  |||||||||||
Sbjct: 586 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 527

                                                   
Query: 500 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 539
           || || ||||| ||||   ||||||| |||| ||||||||
Sbjct: 526 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 487



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 614 aggaggaagcaggcggcggtggagcccagcagctgcgccacccagtaga 662
           |||||||| || |||||||||||||| || ||||| || | ||||||||
Sbjct: 409 aggaggaaacaagcggcggtggagccgagaagctgagcgatccagtaga 361



to top

>emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS72ZD10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 945

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 126/160 (78%)
 Strand = Plus / Minus

                                                                       
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 439
           |||||||||||  | |||||||| |  ||| || ||||||||||||| || ||||| |  
Sbjct: 643 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 584

                                                                       
Query: 440 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 499
           || |||||||  || |||||||| || ||    ||||||||||| ||  |||||||||||
Sbjct: 583 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 524

                                                   
Query: 500 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 539
           || || ||||| ||||   ||||||| |||| ||||||||
Sbjct: 523 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 484



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 614 aggaggaagcaggcggcggtggagcccagcagctgcgccacccagtaga 662
           |||||||| || |||||||||||||| || ||||| || | ||||||||
Sbjct: 406 aggaggaaacaagcggcggtggagccgagaagctgagcgatccagtaga 358



to top

>gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete sequence
          Length = 978

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 126/160 (78%)
 Strand = Plus / Minus

                                                                       
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 439
           |||||||||||  | |||||||| |  ||| || ||||||||||||| || ||||| |  
Sbjct: 665 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 606

                                                                       
Query: 440 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 499
           || |||||||  || |||||||| || ||    ||||||||||| ||  |||||||||||
Sbjct: 605 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 546

                                                   
Query: 500 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 539
           || || ||||| ||||   ||||||| |||| ||||||||
Sbjct: 545 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 506



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 614 aggaggaagcaggcggcggtggagcccagcagctgcgccacccagtaga 662
           |||||||| || |||||||||||||| || ||||| || | ||||||||
Sbjct: 428 aggaggaaacaagcggcggtggagccgagaagctgagcgatccagtaga 380



to top

>dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6
          Length = 75289

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 126/160 (78%)
 Strand = Plus / Minus

                                                                         
Query: 380   gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 439
             |||||||||||  | |||||||| |  ||| || ||||||||||||| || ||||| |  
Sbjct: 19492 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 19433

                                                                         
Query: 440   ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 499
             || |||||||  || |||||||| || ||    ||||||||||| ||  |||||||||||
Sbjct: 19432 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 19373

                                                     
Query: 500   tacaccgtgtacaccagcccgaaggtcatgacgatctcca 539
             || || ||||| ||||   ||||||| |||| ||||||||
Sbjct: 19372 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 19333



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                              
Query: 614   aggaggaagcaggcggcggtggagcccagcagctgcgccacccagtaga 662
             |||||||| || |||||||||||||| || ||||| || | ||||||||
Sbjct: 18856 aggaggaaacaagcggcggtggagccgagaagctgagcgatccagtaga 18808



to top

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                   
Query: 423     tggcgccgacgatgaagccgatggcgatgggcgcga 458
               |||||||||||||||||||| || ||||||| ||||
Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 425     gcgccgacgatgaagccgatg 445
               |||||||||||||||||||||
Sbjct: 3655270 gcgccgacgatgaagccgatg 3655250



to top

>gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integral protein mRNA,
           complete cds
          Length = 939

 Score = 48.1 bits (24), Expect = 0.039
 Identities = 126/160 (78%)
 Strand = Plus / Minus

                                                                       
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatgaag 439
           |||||||||||  | |||||||| |  ||| || ||||||||||||| || ||||| |  
Sbjct: 610 gggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacgataaga 551

                                                                       
Query: 440 ccgatggcgatgggcgcgatggtgcccaggctgcccttcttggggtcgacggcggtggcg 499
           || |||||||  || |||||||| || ||    ||||||||||| ||  |||||||||||
Sbjct: 550 ccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcggtggcg 491

                                                   
Query: 500 tacaccgtgtacaccagcccgaaggtcatgacgatctcca 539
           || || ||||| ||||   ||||||| |||| ||||||||
Sbjct: 490 tagacagtgtagaccaaagcgaaggtgatgatgatctcca 451



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 614 aggaggaagcaggcggcggtggagcccagcagctgcgccacccagtaga 662
           |||||||| || |||||||||||||| || ||||| || | ||||||||
Sbjct: 373 aggaggaaacaagcggcggtggagccgagaagctgagcgatccagtaga 325



to top

>emb|X53040.1|RNNIP26 R.norvegicus MIP-26 mRNA
          Length = 336

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 293 aggccgccgccgatgagggggccgacccagtacacccactggt 335
           ||||| ||||||||||  ||||| |||||||||||||| ||||
Sbjct: 301 aggcccccgccgatgattgggcccacccagtacacccagtggt 259



to top

>gb|AF521142.1| Kandelia candel tonoplast intrinsic protein mRNA, partial cds
          Length = 175

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 421 gttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccca 467
           |||||| || || ||||| ||||||||||| |||||||| |||||||
Sbjct: 62  gttggcacccacaatgaaaccgatggcgattggcgcgattgtgccca 16



to top

>emb|X53052.1|RRMIP Rat partial mRNA for main intrinsic protein
          Length = 936

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 293 aggccgccgccgatgagggggccgacccagtacacccactggt 335
           ||||| ||||||||||  ||||| |||||||||||||| ||||
Sbjct: 635 aggcccccgccgatgattgggcccacccagtacacccagtggt 593



to top

>emb|X12514.1|RNMIP26R Rat mRNA fragment for main intrinsic protein 26 (MIP26)
          Length = 543

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 293 aggccgccgccgatgagggggccgacccagtacacccactggt 335
           ||||| ||||||||||  ||||| |||||||||||||| ||||
Sbjct: 242 aggcccccgccgatgattgggcccacccagtacacccagtggt 200



to top

>emb|AJ251652.1|MTR251652 Medicago truncatula mRNA for aquaporin (aqp1 gene)
          Length = 1120

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 224 tagtagtcggtggtggggagctgctcgtgggtgcgggagatgaagag 270
           |||||||| || || ||||||||||||||||||| |  |||||||||
Sbjct: 837 tagtagtcagtagttgggagctgctcgtgggtgctgttgatgaagag 791



to top

>emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonoplast intrinsic protein (gene
           tip1-1)
          Length = 1104

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 137/175 (78%)
 Strand = Plus / Minus

                                                                       
Query: 365 ccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttg 424
           ||||| || ||||||||||||||||| || |||| |||||| || || || |  ||||| 
Sbjct: 686 ccgaatgacacggcggggttcatggatgctccggtgaaggctccaccaaccaaaatgtta 627

                                                                       
Query: 425 gcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgcccttcttgggg 484
           || || |||||||| || || || || || |||||  | || |   | |||||||| |||
Sbjct: 626 gcaccaacgatgaaaccaatagcaataggtgcgataattccaatattacccttctttggg 567

                                                                  
Query: 485 tcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctcca 539
           || ||||| || |||||||| ||||||||||  ||||| ||||| || |||||||
Sbjct: 566 tcaacggctgtagcgtacacagtgtacaccaaaccgaaagtcatcacaatctcca 512



to top

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 286     gccggcgaggccgccgccgatga 308
               |||||||||||||||||||||||
Sbjct: 3111631 gccggcgaggccgccgccgatga 3111609



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 285    cgccggcgaggccgccgccgatga 308
              ||||||||||||| ||||||||||
Sbjct: 505314 cgccggcgaggccaccgccgatga 505291



to top

>emb|BX822968.1|CNS0A5UC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB77ZF06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 945

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                       
Query: 473 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 532
           ||||||||||| ||  ||||||||||||| || ||||| ||||   ||||||| |||| |
Sbjct: 555 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 496

                  
Query: 533 atctcca 539
           |||||||
Sbjct: 495 atctcca 489



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 614 aggaggaagcaggcggcggtggagcccagcagctgcgccacccagtaga 662
           |||||||| || |||||||||||||| || ||||| || | ||||||||
Sbjct: 411 aggaggaaacaagcggcggtggagccgagaagctgagcgatccagtaga 363



to top

>gb|AC020922.9| Homo sapiens chromosome 19 clone CTD-2105E13, complete sequence
          Length = 134793

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 193   cgggcgggcggggggcaggcggc 215
             |||||||||||||||||||||||
Sbjct: 78789 cgggcgggcggggggcaggcggc 78811



to top

>ref|XM_343137.2| PREDICTED: Rattus norvegicus major intrinsic protein of eye lens
           fiber (Mip), mRNA
          Length = 2075

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 293 aggccgccgccgatgagggggccgacccagtacacccactggt 335
           ||||| ||||||||||  ||||| |||||||||||||| ||||
Sbjct: 685 aggcccccgccgatgattgggcccacccagtacacccagtggt 643



to top

>gb|AY207429.1| Homo sapiens interleukin 11 (IL11) gene, complete cds
          Length = 9803

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 193  cgggcgggcggggggcaggcggc 215
            |||||||||||||||||||||||
Sbjct: 1449 cgggcgggcggggggcaggcggc 1427



to top

>emb|AJ605573.1| Ricinus communis mRNA for aquaporin (Tip1-1 gene), clone pT4L
          Length = 1057

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 223 ttagtagtcggtggtggggagctgctcgtgggtgc 257
           ||||||||| ||||| ||||||||||| |||||||
Sbjct: 804 ttagtagtcagtggtagggagctgctcatgggtgc 770



to top

>gb|AY112625.1| Zea mays CL46210_1 mRNA sequence
          Length = 479

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 53/63 (84%)
 Strand = Plus / Plus

                                                                       
Query: 273 gctcgtagatgacgccggcgaggccgccgccgatgagggggccgacccagtacacccact 332
           ||||| ||| |||||||| ||||||| ||||||  | ||| || |||||||||||||| |
Sbjct: 279 gctcgaagacgacgccggagaggccggcgccgaccatgggccccacccagtacacccatt 338

              
Query: 333 ggt 335
           |||
Sbjct: 339 ggt 341



to top

>gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integral protein gene, partial
            cds
          Length = 2235

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 56/67 (83%)
 Strand = Plus / Minus

                                                                        
Query: 473  cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 532
            ||||||||||| ||  ||||||||||||| || ||||| ||||   ||||||| |||| |
Sbjct: 2150 cccttcttgggatcagcggcggtggcgtagacagtgtagaccaaagcgaaggtgatgatg 2091

                   
Query: 533  atctcca 539
            |||||||
Sbjct: 2090 atctcca 2084



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 614  aggaggaagcaggcggcggtggagcccagcagctgcgccacccagtaga 662
            |||||||| || |||||||||||||| || ||||| || | ||||||||
Sbjct: 1608 aggaggaaacaagcggcggtggagccgagaagctgagcgatccagtaga 1560



to top

>gb|AF000143.1|HSAF000143 Human putative alternative lens membrane intrinsic protein (PALM)
           mRNA, partial cds
          Length = 789

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 293 aggccgccgccgatgagggggccgacccagtacacccactggt 335
           ||||| ||||||||||  ||||| |||||||||||||| ||||
Sbjct: 641 aggcccccgccgatgattgggcccacccagtacacccagtggt 599



to top

>gb|M81890.1|HUMIL11A Human interleukin 11 (IL11) gene, complete mRNA
          Length = 6870

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 193 cgggcgggcggggggcaggcggc 215
           |||||||||||||||||||||||
Sbjct: 688 cgggcgggcggggggcaggcggc 666



to top

>ref|XM_476227.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 756

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 437
           |||||||| |||||||||||||||  ||| ||  ||| | ||||||| ||||||||||
Sbjct: 596 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 539



to top

>gb|AC145396.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0042F15, complete sequence
          Length = 162959

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                       
Query: 380   gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 437
             |||||||| |||||||||||||||  ||| ||  ||| | ||||||| ||||||||||
Sbjct: 86935 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 86878



to top

>emb|AL591787.1|SME591787 Sinorhizobium meliloti 1021 complete chromosome; segment 6/12
          Length = 329100

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 287    ccggcgaggccgccgccgatga 308
              ||||||||||||||||||||||
Sbjct: 213784 ccggcgaggccgccgccgatga 213805



to top

>ref|XM_851400.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 11 (LOC479191), mRNA
          Length = 4681

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 184 acggacggacgggcgggcggggggcaggcggcgg 217
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_536333.2| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 1 (LOC479191), mRNA
          Length = 4681

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 184 acggacggacgggcgggcggggggcaggcggcgg 217
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851314.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 10 (LOC479191), mRNA
          Length = 4663

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 184 acggacggacgggcgggcggggggcaggcggcgg 217
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851274.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 9 (LOC479191), mRNA
          Length = 4438

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 184 acggacggacgggcgggcggggggcaggcggcgg 217
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851189.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 7 (LOC479191), mRNA
          Length = 4777

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 184 acggacggacgggcgggcggggggcaggcggcgg 217
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851152.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 6 (LOC479191), mRNA
          Length = 4696

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 184 acggacggacgggcgggcggggggcaggcggcgg 217
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>ref|XM_851023.1| PREDICTED: Canis familiaris similar to actinin, alpha 2, transcript
           variant 3 (LOC479191), mRNA
          Length = 4681

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 184 acggacggacgggcgggcggggggcaggcggcgg 217
           |||||||||||||| ||||||| || ||||||||
Sbjct: 124 acggacggacgggccggcggggcgcgggcggcgg 91



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 358     ggcggggccgaaggagacggcg 379
               ||||||||||||||||||||||
Sbjct: 8473737 ggcggggccgaaggagacggcg 8473716



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 358     ggcggggccgaaggagacggcg 379
               ||||||||||||||||||||||
Sbjct: 8461221 ggcggggccgaaggagacggcg 8461200



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
               sequence
          Length = 29737217

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                         
Query: 380     gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 437
               |||||||| |||||||||||||||  ||| ||  ||| | ||||||| ||||||||||
Sbjct: 7902160 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 7902103



to top

>ref|XM_343420.2| PREDICTED: Rattus norvegicus similar to RIKEN cDNA B230380D07
           (predicted) (LOC363089), mRNA
          Length = 2497

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 621 agcaggcggcggtggagcccagcagc 646
           |||||||||||| |||||||||||||
Sbjct: 474 agcaggcggcggaggagcccagcagc 499



to top

>gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water channel protein MipK (MipK)
           mRNA, complete cds
          Length = 1076

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 79/98 (80%)
 Strand = Plus / Minus

                                                                       
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 477
           ||||||||| || || ||||| || || || ||||| || ||||||||||    |||| |
Sbjct: 637 gatgttggctccaacaatgaacccaatagcaatgggggcaatggtgcccactgagcccct 578

                                                 
Query: 478 cttggggtcgacggcggtggcgtacaccgtgtacacca 515
           ||||||||| || ||||||||||| || ||||| ||||
Sbjct: 577 cttggggtcaactgcggtggcgtagacggtgtagacca 540



to top

>dbj|AK072531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023131O04, full
           insert sequence
          Length = 1252

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 437
           |||||||| |||||||||||||||  ||| ||  ||| | ||||||| ||||||||||
Sbjct: 787 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 730



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 430     gacgatgaagccgatggcgatgggcg 455
               ||||||| ||||||||||||||||||
Sbjct: 1047164 gacgatgtagccgatggcgatgggcg 1047139



to top

>dbj|AK060193.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-001-E07, full
           insert sequence
          Length = 1100

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 380 gggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacgatga 437
           |||||||| |||||||||||||||  ||| ||  ||| | ||||||| ||||||||||
Sbjct: 786 gggttcattgacgcgccggagaagttgccaccagcgatggtgttggcaccgacgatga 729



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 358     ggcggggccgaaggagacggcg 379
               ||||||||||||||||||||||
Sbjct: 8473620 ggcggggccgaaggagacggcg 8473599



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 358     ggcggggccgaaggagacggcg 379
               ||||||||||||||||||||||
Sbjct: 8461104 ggcggggccgaaggagacggcg 8461083



to top

>emb|AL928775.2|CNS08CC5 Oryza sativa chromosome 12, . BAC OSJNBa0030N06 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 146444

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 358   ggcggggccgaaggagacggcg 379
             ||||||||||||||||||||||
Sbjct: 80400 ggcggggccgaaggagacggcg 80379



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 358   ggcggggccgaaggagacggcg 379
             ||||||||||||||||||||||
Sbjct: 67884 ggcggggccgaaggagacggcg 67863



to top

>gb|AY839872.1| Vitis vinifera aquaporin (TIP1;1) mRNA, complete cds
          Length = 993

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 473 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 532
           |||||||| || || || || ||||| ||||| ||||| ||||| ||||||||||| || 
Sbjct: 553 cccttctttggatccactgctgtggcatacactgtgtaaaccaggccgaaggtcatcaca 494

                
Query: 533 atctc 537
           |||||
Sbjct: 493 atctc 489



to top

>ref|XM_482690.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2139

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 601 ggtggagaagcggaggaggaagcaggcggcggt 633
           ||||| || |||||||||||||||| |||||||
Sbjct: 234 ggtggtgatgcggaggaggaagcagtcggcggt 202



to top

>ref|XM_480293.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1455

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 ggaggaagcaggcggcggtgg 635
           |||||||||||||||||||||
Sbjct: 100 ggaggaagcaggcggcggtgg 80



to top

>gb|AE017351.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 11, complete
              sequence
          Length = 1019846

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 330    actggtacccccactcccagc 350
              |||||||||||||||||||||
Sbjct: 290624 actggtacccccactcccagc 290604



to top

>gb|AC154709.2| Mus musculus BAC clone RP24-357I4 from chromosome 12, complete sequence
          Length = 136354

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 184   acggacggacgggcgggcggg 204
             |||||||||||||||||||||
Sbjct: 94084 acggacggacgggcgggcggg 94104



to top

>gb|AE017180.1| Geobacter sulfurreducens PCA, complete genome
          Length = 3814139

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 418     gatgttggcgccgacgatgaagccg 442
               ||||||| |||||||||||||||||
Sbjct: 2949085 gatgttgtcgccgacgatgaagccg 2949061



to top

>ref|XM_593064.2| PREDICTED: Bos taurus similar to tumor protein p73 (LOC515105),
           mRNA
          Length = 2606

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 295 gccgccgccgatgagggggcc 315
           |||||||||||||||||||||
Sbjct: 22  gccgccgccgatgagggggcc 42



to top

>gb|AY581827.1| Cynodon dactylon NOD26-like membrane integral protein-like mRNA,
           partial sequence
          Length = 555

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 373 gacggcggggttcatggacgcgccggaga 401
           ||||||||||||||||  |||||||||||
Sbjct: 425 gacggcggggttcatgtgcgcgccggaga 397



to top

>ref|NM_002457.1| Homo sapiens mucin 2, oligomeric mucus/gel-forming (MUC2), mRNA
          Length = 15720

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 579   aggtgccggtggggagcccgc 599
             |||||||||||||||||||||
Sbjct: 15523 aggtgccggtggggagcccgc 15503



to top

>gb|AF183913.1| Azospirillum brasilense major outer membrane protein OmaA precursor
           (omaA) gene, complete cds
          Length = 1435

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 287 ccggcgaggccgccgccgatg 307
           |||||||||||||||||||||
Sbjct: 698 ccggcgaggccgccgccgatg 678



to top

>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 2 (LOC607978), mRNA
          Length = 1082

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 358 ggcggggccgaaggagacggcggggttcatgga 390
           ||||||||||||||||  ||| |||||||||||
Sbjct: 588 ggcggggccgaaggagcgggccgggttcatgga 556



to top

>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 1 (LOC607978), mRNA
          Length = 1067

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 358 ggcggggccgaaggagacggcggggttcatgga 390
           ||||||||||||||||  ||| |||||||||||
Sbjct: 573 ggcggggccgaaggagcgggccgggttcatgga 541



to top

>emb|CT025679.5| Mouse DNA sequence from clone RP24-296K22 on chromosome 14, complete
              sequence
          Length = 160805

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 184    acggacggacgggcgggcggg 204
              |||||||||||||||||||||
Sbjct: 155955 acggacggacgggcgggcggg 155935



to top

>ref|XM_567655.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
            (CNK00920) partial mRNA
          Length = 2340

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 330  actggtacccccactcccagc 350
            |||||||||||||||||||||
Sbjct: 2133 actggtacccccactcccagc 2113



to top

>gb|AC123532.4| Mus musculus chromosome 14 clone RP23-84B6, complete sequence
          Length = 166421

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 184  acggacggacgggcgggcggg 204
            |||||||||||||||||||||
Sbjct: 7846 acggacggacgggcgggcggg 7826



to top

>gb|AC098877.3| Mus musculus BAC clone RP23-2C24 from 14, complete sequence
          Length = 240151

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 184   acggacggacgggcgggcggg 204
             |||||||||||||||||||||
Sbjct: 37973 acggacggacgggcgggcggg 37953



to top

>gb|AC104099.5| Mus musculus BAC clone RP24-372J8 from 3, complete sequence
          Length = 148259

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 184   acggacggacgggcgggcggg 204
             |||||||||||||||||||||
Sbjct: 37509 acggacggacgggcgggcggg 37489



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 181   cacacggacggacgggcgggcggg 204
             ||||||||||||||| ||||||||
Sbjct: 37516 cacacggacggacggacgggcggg 37493



to top

>gb|BC012214.1| Mus musculus Rab geranylgeranyl transferase, a subunit, mRNA (cDNA
           clone MGC:19255 IMAGE:3967218), complete cds
          Length = 2176

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 184 acggacggacgggcgggcggg 204
           |||||||||||||||||||||
Sbjct: 23  acggacggacgggcgggcggg 43



to top

>gb|AY258323.1| Rubella virus strain BRD-II, complete genome
          Length = 9778

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 193  cgggcgggcggggggcaggcggcgg 217
            ||||||||| |||||||||||||||
Sbjct: 2327 cgggcgggctgggggcaggcggcgg 2303



to top

>ref|XM_503667.1| Yarrowia lipolytica CLIB122, YALI0E07557g predicted mRNA
          Length = 2157

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 462  tgcccaggctgcccttcttgg 482
            |||||||||||||||||||||
Sbjct: 1060 tgcccaggctgcccttcttgg 1040



to top

>ref|NM_019519.1| Mus musculus Rab geranylgeranyl transferase, a subunit (Rabggta),
           mRNA
          Length = 2547

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 184 acggacggacgggcgggcggg 204
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>ref|XM_961391.1| PREDICTED: Tribolium castaneum similar to CG31000-PC, isoform C
            (LOC654951), mRNA
          Length = 3244

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 285  cgccggcgaggccgccgccga 305
            |||||||||||||||||||||
Sbjct: 1642 cgccggcgaggccgccgccga 1622



to top

>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 289     ggcgaggccgccgccgatgag 309
               |||||||||||||||||||||
Sbjct: 1201038 ggcgaggccgccgccgatgag 1201058



to top

>emb|BX640442.1| Bordetella bronchiseptica strain RB50, complete genome; segment 6/16
          Length = 349876

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 418    gatgttggcgccgacgatgaagccg 442
              ||||| |||||||||||||||||||
Sbjct: 151437 gatgtcggcgccgacgatgaagccg 151461



to top

>emb|BX640430.1| Bordetella parapertussis strain 12822, complete genome; segment 8/14
          Length = 348014

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 418   gatgttggcgccgacgatgaagccg 442
             ||||| |||||||||||||||||||
Sbjct: 62418 gatgtcggcgccgacgatgaagccg 62442



to top

>emb|AL390091.1|NCB12F1 Neurospora crassa DNA linkage group II BAC clone B12F1
          Length = 68478

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 184   acggacggacgggcgggcggg 204
             |||||||||||||||||||||
Sbjct: 42894 acggacggacgggcgggcggg 42914



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 181   cacacggacggacgggcgggcggg 204
             ||||||||||||||| ||||||||
Sbjct: 42887 cacacggacggacggacgggcggg 42910



to top

>emb|AJ489613.1|CAR489613 Cicer arietinum partial mRNA for tonoplast intrinsic protein (tip
           gene)
          Length = 716

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 224 tagtagtcggtggtggggagctgctcgtgggtg 256
           |||||||| ||||| ||||| ||||||||||||
Sbjct: 428 tagtagtcagtggtagggagttgctcgtgggtg 396



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 362 gggccgaaggagacggcggggttcatggacgcgccggagaaggc 405
           |||||||| || ||||| ||||||||||| || |||| ||||||
Sbjct: 290 gggccgaatgacacggctgggttcatggatgctccggtgaaggc 247



to top

>gb|AC139749.4| Homo sapiens chromosome 11, clone RP13-870H17, complete sequence
          Length = 131676

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 579   aggtgccggtggggagcccgc 599
             |||||||||||||||||||||
Sbjct: 40001 aggtgccggtggggagcccgc 40021



to top

>emb|BX470185.18| Zebrafish DNA sequence from clone CH211-222D3 in linkage group 3,
             complete sequence
          Length = 198900

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 184   acggacggacgggcgggcggg 204
             |||||||||||||||||||||
Sbjct: 27616 acggacggacgggcgggcggg 27596



to top

>gb|AC183494.1| Brassica oleracea Contig C, complete sequence
          Length = 285752

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                               
Query: 414    cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
              ||||||||||||| || |||||||| || || ||||| || ||||||||
Sbjct: 123743 cgaggatgttggcaccaacgatgaaaccaatagcgattggtgcgatggt 123695



to top

>dbj|AK146917.1| Mus musculus 17 days embryo kidney cDNA, RIKEN full-length enriched
           library, clone:I920074L06 product:Rab geranylgeranyl
           transferase, a subunit, full insert sequence
          Length = 2422

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 184 acggacggacgggcgggcggg 204
           |||||||||||||||||||||
Sbjct: 41  acggacggacgggcgggcggg 61



to top

>gb|AF271660.1|AF271660 Vitis berlandieri x Vitis rupestris putative aquaporin TIP3 (TIP3)
           mRNA, complete cds
          Length = 1133

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 473 cccttcttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacg 532
           |||||||| || || || || ||||| ||||| ||||| ||||| ||||||||||| || 
Sbjct: 573 cccttctttggatccactgctgtggcatacactgtgtaaaccaggccgaaggtcatcaca 514

                
Query: 533 atctc 537
           |||||
Sbjct: 513 atctc 509



to top

>ref|XM_926004.1| PREDICTED: Homo sapiens similar to Mucin-2 precursor (Intestinal
            mucin 2) (LOC642507), mRNA
          Length = 8604

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 579  aggtgccggtggggagcccgc 599
            |||||||||||||||||||||
Sbjct: 8410 aggtgccggtggggagcccgc 8390



to top

>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete
           cds
          Length = 997

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 418 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggt 462
           ||||||||| || || |||||||||||||| ||||| || |||||
Sbjct: 592 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggt 548



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                 
Query: 601      ggtggagaagcggaggaggaagcaggcggcggt 633
                ||||| || |||||||||||||||| |||||||
Sbjct: 21930666 ggtggtgatgcggaggaggaagcagtcggcggt 21930698



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 615     ggaggaagcaggcggcggtgg 635
               |||||||||||||||||||||
Sbjct: 4166018 ggaggaagcaggcggcggtgg 4165998



to top

>gb|AF342810.1|AF342810 Zea mays NOD26-like membrane integral protein ZmNIP2-3 mRNA,
           complete cds
          Length = 1300

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 373 gacggcggggttcatggacgcgccggaga 401
           ||||||||||||||||  |||||||||||
Sbjct: 442 gacggcggggttcatgtgcgcgccggaga 414



to top

>gb|AF326507.1|AF326507 Zea mays tonoplast membrane integral protein ZmTIP4-3 mRNA,
           complete cds
          Length = 1045

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 358 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 417
           |||||| ||||||||   ||| ||||||||||| |||||||| | |||| ||||| ||| 
Sbjct: 714 ggcgggcccgaaggacctggccgggttcatggaggcgccggacagggcggcgccggcgac 655

                            
Query: 418 gatgttggcgccgacga 434
           |  |||||| |||||||
Sbjct: 654 ggagttggccccgacga 638



to top

>gb|AF326485.1|AF326485 Zea mays NOD26-like membrane integral protein ZmNIP2-2 mRNA,
           complete cds
          Length = 1387

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 373 gacggcggggttcatggacgcgccggaga 401
           ||||||||||||||||  |||||||||||
Sbjct: 452 gacggcggggttcatgtgcgcgccggaga 424



to top

>emb|BX822791.1|CNS0A7SC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB64ZD05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 503

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 63/77 (81%)
 Strand = Plus / Minus

                                                                       
Query: 374 acggcggggttcatggacgcgccggagaaggcgccgccgacgaggatgttggcgccgacg 433
           ||||| ||||||||||| || |||  ||| || || ||| |||||||||| || || |||
Sbjct: 95  acggctgggttcatggaagcaccgctgaaagctccaccggcgaggatgttagctccaacg 36

                            
Query: 434 atgaagccgatggcgat 450
           ||||| || ||||||||
Sbjct: 35  atgaaacctatggcgat 19



to top

>gb|AC135495.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1664B11,
             complete sequence
          Length = 126040

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 184   acggacggacgggcgggcggg 204
             |||||||||||||||||||||
Sbjct: 56775 acggacggacgggcgggcggg 56755



to top

>ref|NM_214226.1| Sus scrofa inositol(1,3,4,5)tetrakisphosphate receptor (CENTA1),
           mRNA
          Length = 1544

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 185 cggacggacgggcgggcggggggca 209
           |||||||||||||||||||| ||||
Sbjct: 56  cggacggacgggcgggcgggcggca 80



to top

>gb|AE004658.1| Pseudomonas aeruginosa PAO1, section 219 of 529 of the complete
            genome
          Length = 11864

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 285  cgccggcgaggccgccgccga 305
            |||||||||||||||||||||
Sbjct: 2650 cgccggcgaggccgccgccga 2630



to top

>dbj|AP005606.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1590_E05
          Length = 148205

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 615   ggaggaagcaggcggcggtgg 635
             |||||||||||||||||||||
Sbjct: 65641 ggaggaagcaggcggcggtgg 65621



to top

>gb|AF127662.1|AF127662 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) mRNA, complete cds,
           alternatively spliced
          Length = 2466

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 184 acggacggacgggcgggcggg 204
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127661.1|AF127661 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) pseudogene, complete sequence
          Length = 2435

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 184 acggacggacgggcgggcggg 204
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127660.1|AF127660 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) mRNA, complete cds, alternatively
           spliced
          Length = 2492

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 184 acggacggacgggcgggcggg 204
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127659.1|AF127659 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) mRNA, complete cds,
           alternatively spliced
          Length = 2547

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 184 acggacggacgggcgggcggg 204
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127658.1|AF127658 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) mRNA, complete cds, alternatively
           spliced
          Length = 2547

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 184 acggacggacgggcgggcggg 204
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127657.1|AF127657 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) pseudogene, complete sequence
          Length = 2338

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 184 acggacggacgggcgggcggg 204
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127656.1|AF127656 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) mRNA, complete cds, alternatively
           spliced
          Length = 2395

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 184 acggacggacgggcgggcggg 204
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127655.1|AF127655 Mus musculus strain C57BL/6J-gm/gm RAB geranylgeranyl transferase
           alpha subunit (Rabggta) gene, complete cds,
           alternatively spliced
          Length = 2685

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 184 acggacggacgggcgggcggg 204
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>gb|AF127654.1|AF127654 Mus musculus strain C57BL/6J RAB geranylgeranyl transferase alpha
           subunit (Rabggta) gene, complete cds, alternatively
           spliced
          Length = 2685

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 184 acggacggacgggcgggcggg 204
           |||||||||||||||||||||
Sbjct: 18  acggacggacgggcgggcggg 38



to top

>dbj|AP004558.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0409A07
          Length = 146663

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 601    ggtggagaagcggaggaggaagcaggcggcggt 633
              ||||| || |||||||||||||||| |||||||
Sbjct: 131335 ggtggtgatgcggaggaggaagcagtcggcggt 131367



to top

>dbj|AP003798.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1005_H01
          Length = 128124

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 601   ggtggagaagcggaggaggaagcaggcggcggt 633
             ||||| || |||||||||||||||| |||||||
Sbjct: 16415 ggtggtgatgcggaggaggaagcagtcggcggt 16447



to top

>dbj|AP005501.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0458D06
          Length = 166038

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 615    ggaggaagcaggcggcggtgg 635
              |||||||||||||||||||||
Sbjct: 159131 ggaggaagcaggcggcggtgg 159111



to top

>dbj|AK071278.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023084C16, full
           insert sequence
          Length = 1455

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 ggaggaagcaggcggcggtgg 635
           |||||||||||||||||||||
Sbjct: 100 ggaggaagcaggcggcggtgg 80



to top

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 285     cgccggcgaggccgccgccga 305
               |||||||||||||||||||||
Sbjct: 2570348 cgccggcgaggccgccgccga 2570368



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 285     cgccggcgaggccgccgccgatga 308
               ||||||| ||||||||||||||||
Sbjct: 2369100 cgccggccaggccgccgccgatga 2369077


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,947,854
Number of Sequences: 3902068
Number of extensions: 5947854
Number of successful extensions: 149355
Number of sequences better than 10.0: 388
Number of HSP's better than 10.0 without gapping: 397
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 142531
Number of HSP's gapped (non-prelim): 6770
length of query: 693
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 670
effective length of database: 17,143,297,704
effective search space: 11486009461680
effective search space used: 11486009461680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top