Clone Name	rbasd19k19
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AF271362.1|AF271362 Lolium perenne nucleoside diphosphate kin...	603	e-169
2	ref|NM_197769.1| Oryza sativa (japonica cultivar-group) putative...	442	e-121
3	dbj|AK072751.1| Oryza sativa (japonica cultivar-group) cDNA clon...	442	e-121
4	gb|AY103833.1| Zea mays PCO135636 mRNA sequence	321	1e-84
5	gb|U55019.1|SOU55019 Saccharum officinarum nucleoside diphosphat...	305	7e-80
6	gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 geno...	262	1e-66
7	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	262	1e-66
8	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	262	1e-66
9	ref|XM_478187.1| Oryza sativa (japonica cultivar-group), mRNA	143	6e-31
10	dbj|D16292.1|RICNDKR Oryza sativa mRNA for nucleoside diphosphat...	143	6e-31
11	dbj|AK121796.1| Oryza sativa (japonica cultivar-group) cDNA clon...	143	6e-31
12	gb|AY649743.1| Oryza sativa (japonica cultivar-group) nucleoside...	135	2e-28
13	gb|DQ097723.1| Arachis hypogaea nucleoside diphosphate kinase I ...	119	9e-24
14	gb|AF480463.1| Musa acuminata nucleoside diphosphate kinase mRNA...	117	4e-23
15	gb|AY104578.1| Zea mays PCO113042 mRNA sequence	101	2e-18
16	dbj|D10659.1|SPINDPKINI Spinach mRNA for nucleoside diphosphate ...	100	9e-18
17	gb|BT013034.1| Lycopersicon esculentum clone 114282R, mRNA sequence	98	3e-17
18	emb|X75324.1|LERNADNK L.esculentum (Ailsa Craig) mRNA for nucleo...	98	3e-17
19	ref|XM_323541.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE ...	84	5e-13
20	ref|XM_956069.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE ...	84	5e-13
21	ref|XM_676393.1| Aspergillus nidulans FGSC A4 nucleoside diphosp...	84	5e-13
22	gb|AY057453.1| Emericella nidulans nucleoside diphosphate kinase...	84	5e-13
23	gb|AF072289.1|AF072289 Mesembryanthemum crystallinum nucleoside ...	80	8e-12
24	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	78	3e-11
25	dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic D...	78	3e-11
26	dbj|AP004266.3| Oryza sativa (japonica cultivar-group) genomic D...	78	3e-11
27	ref|XM_742902.1| Aspergillus fumigatus Af293 nucleoside diphosph...	70	8e-09
28	emb|AL807368.1|NC62D11 Neurospora crassa DNA linkage group V cos...	70	8e-09
29	emb|AL807373.1|NC21D9 Neurospora crassa DNA linkage group V cosm...	70	8e-09
30	dbj|D88148.1| Neurospora crassa mRNA for nucleoside diphosphate ...	70	8e-09
31	gb|AY324230.1| Aspergillus fumigatus nucleoside diphosphate kina...	68	3e-08
32	gb|U72142.1|HAU72142 Helianthus annuus nucleoside diphosphate ki...	68	3e-08
33	gb|AF108881.1|AF108881 Capsicum annuum nucleoside diphosphate ki...	66	1e-07
34	gb|DQ157699.1| Solanum chacoense cytosolic nucleoside diphosphat...	62	2e-06
35	emb|BX072516.1|CNS09S48 Single read from an extremity of a full-...	62	2e-06
36	emb|BX072515.1|CNS09S47 Single read from an extremity of a full-...	62	2e-06
37	emb|BX063953.1|CNS09LID Single read from an extremity of a full-...	62	2e-06
38	emb|BX051771.1|CNS09C3Z Single read from an extremity of a full-...	62	2e-06
39	emb|BX050874.1|CNS09BF2 Single read from an extremity of a full-...	62	2e-06
40	emb|BX048701.1|CNS099QP Single read from an extremity of a full-...	62	2e-06
41	emb|BX044675.1|CNS096MV Single read from an extremity of a full-...	62	2e-06
42	emb|BX039425.1|CNS092L1 Single read from an extremity of a full-...	62	2e-06
43	emb|BX038905.1|CNS0926L Single read from an extremity of a full-...	62	2e-06
44	emb|BX038259.1|CNS091ON Single read from an extremity of a full-...	62	2e-06
45	emb|BX038258.1|CNS091OM Single read from an extremity of a full-...	62	2e-06
46	emb|BX038115.1|CNS091KN Single read from an extremity of a full-...	62	2e-06
47	emb|BX037581.1|CNS0915T Single read from an extremity of a full-...	62	2e-06
48	emb|BX037580.1|CNS0915S Single read from an extremity of a full-...	62	2e-06
49	emb|BX036658.1|CNS090G6 Single read from an extremity of a full-...	62	2e-06
50	emb|BX032742.1|CNS08XFE Single read from an extremity of a full-...	62	2e-06
51	emb|BX031659.1|CNS08WLB Single read from an extremity of a full-...	62	2e-06
52	emb|BX031658.1|CNS08WLA Single read from an extremity of a full-...	62	2e-06
53	emb|BX025663.1|CNS08RYR Single read from an extremity of a full-...	62	2e-06
54	emb|BX025662.1|CNS08RYQ Single read from an extremity of a full-...	62	2e-06
55	emb|BX025230.1|CNS08RMQ Single read from an extremity of a full-...	62	2e-06
56	emb|BX024508.1|CNS08R2O Single read from an extremity of a full-...	62	2e-06
57	emb|BX024507.1|CNS08R2N Single read from an extremity of a full-...	62	2e-06
58	emb|BX023654.1|CNS08QEY Single read from an extremity of a full-...	62	2e-06
59	emb|BX022916.1|CNS08PUG Single read from an extremity of a full-...	62	2e-06
60	emb|BX022915.1|CNS08PUF Single read from an extremity of a full-...	62	2e-06
61	emb|BX021481.1|CNS08OQL Single read from an extremity of a full-...	62	2e-06
62	emb|BX021480.1|CNS08OQK Single read from an extremity of a full-...	62	2e-06
63	emb|BX021192.1|CNS08OIK Single read from an extremity of a full-...	62	2e-06
64	emb|BX021174.1|CNS08OI2 Single read from an extremity of a full-...	62	2e-06
65	emb|BX018153.1|CNS08M65 Single read from an extremity of a full-...	62	2e-06
66	emb|BX018054.1|CNS08M3E Single read from an extremity of a full-...	62	2e-06
67	emb|BX017467.1|CNS08LN3 Single read from an extremity of a full-...	62	2e-06
68	emb|BX017466.1|CNS08LN2 Single read from an extremity of a full-...	62	2e-06
69	emb|BX017206.1|CNS08LFU Single read from an extremity of a full-...	62	2e-06
70	emb|BX016645.1|CNS08L09 Single read from an extremity of a full-...	62	2e-06
71	emb|BX014282.1|CNS08J6M Single read from an extremity of a full-...	62	2e-06
72	emb|BX009575.1|CNS08FJV Single read from an extremity of a full-...	62	2e-06
73	emb|BX009569.1|CNS08FJP Single read from an extremity of a full-...	62	2e-06
74	emb|BX009487.1|CNS08FHF Single read from an extremity of a full-...	62	2e-06
75	emb|BX007945.1|CNS08EAL Single read from an extremity of a full-...	62	2e-06
76	emb|BX007944.1|CNS08EAK Single read from an extremity of a full-...	62	2e-06
77	emb|BX006734.1|CNS08DCY Single read from an extremity of a full-...	62	2e-06
78	emb|BX006733.1|CNS08DCX Single read from an extremity of a full-...	62	2e-06
79	emb|BX006020.1|CNS08CT4 Single read from an extremity of a full-...	62	2e-06
80	dbj|AB226030.1| Aspergillus oryzae cDNA, contig sequence: AoEST2886	62	2e-06
81	dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102	62	2e-06
82	ref|XM_308641.2| Anopheles gambiae str. PEST ENSANGP00000011253 ...	62	2e-06
83	ref|XM_570963.1| Cryptococcus neoformans var. neoformans JEC21 n...	60	7e-06
84	emb|BX025692.1|CNS08RZK Single read from an extremity of a full-...	60	7e-06
85	dbj|AK065933.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	7e-06
86	ref|XM_363038.1| Magnaporthe grisea 70-15 hypothetical protein (...	58	3e-05
87	gb|AY194364.1| Vitis vinifera nucleoside-diphosphate kinase (Ndp...	58	3e-05
88	ref|XM_780291.1| PREDICTED: Strongylocentrotus purpuratus simila...	58	3e-05
89	gb|AY157740.1| Glycine max nucleoside diphosphate kinase mRNA, c...	58	3e-05
90	gb|AY389630.1| Hyacinthus orientalis nucleoside diphosphate kina...	56	1e-04
91	emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segmen...	56	1e-04
92	gb|AY157739.1| Glycine max nucleoside diphosphate kinase mRNA, c...	56	1e-04
93	gb|U50150.1|GMU50150 Glycine max nucleoside diphosphate kinase m...	56	1e-04
94	ref|XM_386148.1| Gibberella zeae PH-1 chromosome 3 hypothetical ...	54	5e-04
95	emb|BX062211.1|CNS09K5Z Single read from an extremity of a full-...	54	5e-04
96	emb|BX017207.1|CNS08LFV Single read from an extremity of a full-...	54	5e-04
97	emb|X71388.1|PSNDKP1 P.sativum ndk-p1 mRNA for nucleoside diphos...	52	0.002
98	gb|AY130398.1| Petromyzon marinus nucleoside diphosphate kinase ...	52	0.002
99	dbj|D86052.1|PEAPNDKN1 Pisum sativum mRNA for PNDKN1, complete cds	52	0.002
100	ref|XM_753830.1| Ustilago maydis 521 hypothetical protein (UM027...	50	0.007
101	dbj|AB126060.1| Codonopsis lanceolata NDPK 1 mRNA for nucloeside...	50	0.007
102	gb|U10283.1|FBU10283 Flaveria bidentis clone pNDK-b nucleoside d...	50	0.007
103	gb|U10282.1|FBU10282 Flaveria bidentis clone pNDK-a nucleoside d...	50	0.007
104	gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr...	48	0.028
105	emb|BX038906.1|CNS0926M Single read from an extremity of a full-...	48	0.028
106	emb|BX038116.1|CNS091KO Single read from an extremity of a full-...	48	0.028
107	emb|BX021303.1|CNS08OLN Single read from an extremity of a full-...	48	0.028
108	emb|BX021302.1|CNS08OLM Single read from an extremity of a full-...	48	0.028
109	emb|BX021175.1|CNS08OI3 Single read from an extremity of a full-...	48	0.028
110	emb|BX013424.1|CNS08IIS Single read from an extremity of a full-...	48	0.028
111	emb|BX009576.1|CNS08FJW Single read from an extremity of a full-...	48	0.028
112	ref|NM_117000.2| Arabidopsis thaliana NDPK1; ATP binding / nucle...	46	0.11
113	gb|AY231961.1| Drosophila yakuba clone yak-em_awd mRNA sequence	46	0.11
114	emb|X69376.1|ATNDK13 A.thaliana gene for nucleoside diphosphate ...	46	0.11
115	emb|X69373.1|ATNDK A.thaliana mRNA for nucleoside diphosphate ki...	46	0.11
116	emb|AL161514.2|ATCHRIV26 Arabidopsis thaliana DNA chromosome 4, ...	46	0.11
117	emb|AL117386.1|ATT30A10 Arabidopsis thaliana DNA chromosome 4, B...	46	0.11
118	gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome	46	0.11
119	gb|AY072518.1| Arabidopsis thaliana unknown protein mRNA, comple...	46	0.11
120	dbj|AB071599.1| Brassica rapa Bc-NDPK1 mRNA for nucleoside dipho...	46	0.11
121	emb|AL116259.1|CNS01D1N Botrytis cinerea strain T4 cDNA library	46	0.11
122	emb|AL116136.1|CNS01CY8 Botrytis cinerea strain T4 cDNA library	46	0.11
123	emb|AL115859.1|CNS01CQJ Botrytis cinerea strain T4 cDNA library	46	0.11
124	emb|AL115323.1|CNS01CBN Botrytis cinerea strain T4 cDNA library	46	0.11
125	emb|AL114869.1|CNS01BZ1 Botrytis cinerea strain T4 cDNA library	46	0.11
126	emb|AL114309.1|CNS01BJH Botrytis cinerea strain T4 cDNA library	46	0.11
127	emb|AL111481.1|CNS019CX Botrytis cinerea strain T4 cDNA library	46	0.11
128	gb|AF370529.1|AF370529 Arabidopsis thaliana Unknown protein mRNA...	46	0.11
129	emb|BX827107.1|CNS0A38G Arabidopsis thaliana Full-length cDNA Co...	46	0.11
130	emb|BX829087.1|CNS0A2O7 Arabidopsis thaliana Full-length cDNA Co...	46	0.11
131	gb|AY962601.1| Nicotiana tabacum nucleoside diphosphate kinase m...	46	0.11
132	dbj|AB121070.1| Natronomonas pharaonis ndk gene for nucleoside d...	46	0.11
133	emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome	46	0.11
134	gb|AF069544.1|AF069544 Mycobacterium smegmatis nucleoside diphos...	46	0.11
135	gb|AF017641.1|AF017641 Arabidopsis thaliana nucleoside diphospha...	46	0.11
136	dbj|AB072238.1| Brassica rapa mRNA for NDPK I, complete cds	46	0.11
137	gb|BT019474.1| Synthetic construct Homo sapiens non-metastatic c...	44	0.44
138	gb|BT019438.1| Homo sapiens non-metastatic cells 4, protein expr...	44	0.44
139	gb|BT019437.1| Synthetic construct Homo sapiens non-metastatic c...	44	0.44
140	gb|BT019436.1| Synthetic construct Homo sapiens non-metastatic c...	44	0.44
141	gb|BT019435.1| Synthetic construct Homo sapiens non-metastatic c...	44	0.44
142	gb|BC004880.2| Homo sapiens non-metastatic cells 4, protein expr...	44	0.44
143	ref|NM_005009.2| Homo sapiens non-metastatic cells 4, protein ex...	44	0.44
144	ref|XM_824577.1| Trypanosoma brucei TREU927 nucleoside diphospha...	44	0.44
145	ref|XM_809769.1| Trypanosoma cruzi strain CL Brener hypothetical...	44	0.44
146	ref|XM_814613.1| Trypanosoma cruzi strain CL Brener hypothetical...	44	0.44
147	emb|BX049071.1|CNS09A0Z Single read from an extremity of a full-...	44	0.44
148	emb|CR857184.1| Pongo pygmaeus mRNA; cDNA DKFZp468E0516 (from cl...	44	0.44
149	emb|CR621504.1| full-length cDNA clone CS0DC014YN11 of Neuroblas...	44	0.44
150	emb|CR613066.1| full-length cDNA clone CS0DF035YK02 of Fetal bra...	44	0.44
151	dbj|AK094439.1| Homo sapiens cDNA FLJ37120 fis, clone BRACE20223...	44	0.44
152	emb|CR597313.1| full-length cDNA clone CS0DC018YA06 of Neuroblas...	44	0.44
153	emb|CR595773.1| full-length cDNA clone CS0DC003YM19 of Neuroblas...	44	0.44
154	emb|CR592051.1| full-length cDNA clone CS0DF021YM10 of Fetal bra...	44	0.44
155	gb|AF295650.1| Beta vulgaris nucleotide diphosphate kinase (ndk)...	44	0.44
156	ref|NR_001577.1| Homo sapiens non-metastatic cells 2, protein (N...	44	0.44
157	gb|DQ066341.1| Ixodes scapularis isolate IS-6-12-J-cluster-432 n...	44	0.44
158	gb|AY335611.1| Synthetic construct Homo sapiens non-metastatic c...	44	0.44
159	dbj|AB232529.1| Haloarcula quadrata ndk gene for nucleoside diph...	44	0.44
160	dbj|AB232528.1| Haloarcula sinaiiensis ndk gene for nucleoside d...	44	0.44
161	gb|U85976.1|HSU85976 Human nucleoside diphosphate kinase (NDK) p...	44	0.44
162	gb|AF164200.1|AF164200 Trypanosoma brucei putative DNA replicati...	44	0.44
163	gb|AY888350.1| Synthetic construct Homo sapiens clone FLH008002....	44	0.44
164	gb|AY888349.1| Synthetic construct Homo sapiens clone FLH008001....	44	0.44
165	gb|AY890948.1| Synthetic construct Homo sapiens clone FLH008000....	44	0.44
166	gb|AY890947.1| Synthetic construct Homo sapiens clone FLH007999....	44	0.44
167	gb|AY890946.1| Synthetic construct Homo sapiens clone FLH007998....	44	0.44
168	gb|AY890945.1| Synthetic construct Homo sapiens clone FLH007997....	44	0.44
169	dbj|AB126343.1| Haloarcula sinaiiensis ndk gene for nucleoside d...	44	0.44
170	dbj|AB126342.1| Haloarcula quadrata ndk gene for nucleoside diph...	44	0.44
171	dbj|AB126339.1| Haloarcula californiae ndk gene for nucleoside d...	44	0.44
172	dbj|AB121064.1| Haloarcula sinaiiensis ndk gene for nucleoside d...	44	0.44
173	gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c...	44	0.44
174	gb|AC004263.1|AC004263 Homo sapiens PAC clone 278C19 from 12q, c...	44	0.44
175	gb|AF086133.1|HUMZA87H07 Homo sapiens full length insert cDNA cl...	44	0.44
176	gb|BC017067.1| Homo sapiens non-metastatic cells 4, protein expr...	44	0.44
177	emb|CT033698.1| Platynereis dumerilii EST IB0AAA15DD08EM1	44	0.44
178	emb|CT032612.1| Platynereis dumerilii EST IB0AAA35BD04EM1	44	0.44
179	emb|CT032450.1| Platynereis dumerilii EST IB0AAA38AD09EM1	44	0.44
180	emb|Y07604.1|HSNM23H4 H.sapiens mRNA for nucleoside-diphosphate ...	44	0.44
181	gb|AC119951.12| Mus musculus chromosome 9, clone RP24-448C4, com...	42	1.7
182	gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete...	42	1.7
183	gb|AC120386.12| Mus musculus chromosome 9, clone RP24-294A16, co...	42	1.7
184	emb|AL583826.16| Human DNA sequence from clone RP11-434B7 on chr...	42	1.7
185	emb|AL355483.14| Human DNA sequence from clone RP4-784A16 on chr...	42	1.7
186	ref|XM_780229.1| PREDICTED: Strongylocentrotus purpuratus simila...	42	1.7
187	emb|X13107.1|DMAWDR Drosophila melanogaster awd mRNA ( abnormal ...	42	1.7
188	gb|AY113576.1| Drosophila melanogaster RH27794 full insert cDNA	42	1.7
189	ref|NM_057413.3| Drosophila melanogaster abnormal wing discs CG2...	42	1.7
190	gb|AY585937.1| Paxillus involutus strain ATCC 200175 nucleoside ...	42	1.7
191	gb|AC007469.7|AC007469 Drosophila melanogaster, chromosome 3R, r...	42	1.7
192	gb|AE003779.2| Drosophila melanogaster chromosome 3R, section 11...	42	1.7
193	emb|AL845442.7| Mouse DNA sequence from clone RP23-392D9 on chro...	42	1.7
194	gb|J05207.1|MXANDK M.xanthus nucleoside 5'-diphosphate phosphotr...	42	1.7
195	gb|CP000097.1| Synechococcus sp. CC9902, complete genome	40	6.8
196	gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome	40	6.8
197	gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome	40	6.8
198	gb|AC126023.3| Mus musculus BAC clone RP24-422I18 from chromosom...	40	6.8
199	gb|AC130843.3| Mus musculus BAC clone RP24-501N9 from chromosome...	40	6.8
200	ref|XM_753334.1| Ustilago maydis 521 hypothetical protein (UM022...	40	6.8
201	emb|CT025688.6| Mouse DNA sequence from clone RP24-310A8 on chro...	40	6.8
202	gb|AC122026.3| Mus musculus BAC clone RP24-390D21 from chromosom...	40	6.8
203	gb|AC113272.11| Mus musculus chromosome 1, clone RP23-379C24, co...	40	6.8
204	emb|BX248409.5| Human DNA sequence from clone RP11-360D2 on chro...	40	6.8
205	gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome	40	6.8
206	emb|AL109921.21|HSDJ383J4 Human DNA sequence from clone RP3-383J...	40	6.8
207	emb|AL110114.1|HSJ868P24 Human DNA sequence from clone RP5-868P2...	40	6.8
208	emb|BX033272.1|CNS08XU4 Single read from an extremity of a full-...	40	6.8
209	emb|BX018154.1|CNS08M66 Single read from an extremity of a full-...	40	6.8
210	emb|CR555306.1| Azoarcus sp. EbN1 complete genome	40	6.8
211	emb|BX323072.9| Zebrafish DNA sequence from clone CH211-271G18, ...	40	6.8
212	emb|BX537282.9| Zebrafish DNA sequence from clone DKEY-90A24 in ...	40	6.8
213	gb|AC161475.6| Pan troglodytes BAC clone CH251-252J1 from chromo...	40	6.8
214	gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome	40	6.8
215	dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ...	40	6.8
216	gb|AY107446.1| Zea mays PCO061918 mRNA sequence	40	6.8
217	dbj|AP001891.4| Homo sapiens genomic DNA, chromosome 11q, clone:...	40	6.8
218	gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete...	40	6.8
219	gb|AC004663.1|AC004663 Homo sapiens chromosome 19, cosmid R29783...	40	6.8
220	gb|AF058895.1|HSNTCH15 Homo sapiens Notch3 (NOTCH3) gene, exons ...	40	6.8
221	gb|U97669.1|HSU97669 Homo sapiens Notch3 (NOTCH3) mRNA, complete...	40	6.8
222	gb|AC139244.4| Mus musculus BAC clone RP23-324J8 from 16, comple...	40	6.8
223	ref|NM_000435.1| Homo sapiens Notch homolog 3 (Drosophila) (NOTC...	40	6.8

---

>gb|AF271362.1|AF271362 Lolium perenne nucleoside diphosphate kinase (NDPK) mRNA, complete
           cds
          Length = 720

 Score =  603 bits (304), Expect = e-169
 Identities = 376/400 (94%)
 Strand = Plus / Minus

                                                                       
Query: 106 gcctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccag 165
           ||||| |||||||||||||||||||||||  ||||| | || || |||||||||||||| 
Sbjct: 515 gcctcgtagatccagttgtgctggctgctggtccacccggcgagaccctcagggaaccac 456

                                                                       
Query: 166 agggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccg 225
           ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 455 agggcaatctccttcctggcattctcaactgagtcgcttccatggatgacgttcctgccg 396

                                                                       
Query: 226 atgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggcg 285
           ||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 395 atgtcaacggcgaagtcaccacggatggtgccaggctcagaggccagggggttggtggcg 336

                                                                       
Query: 286 ccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgacgacc 345
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 335 ccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatggcgacgacg 276

                                                                       
Query: 346 gggccggagacgatgtactccacgagcccagcgaagaagggtttggaggacagatcggcg 405
           |||||||||||||||||||||||||||||  |||||||||| ||||||||||||||||||
Sbjct: 275 gggccggagacgatgtactccacgagcccgccgaagaagggcttggaggacagatcggcg 216

                                                                       
Query: 406 tagtgctgctcggcgaacgacttctccacgttctggagcttcatgcctttaaggtagaag 465
           ||||||||||| ||||||||||||||||||||||||||||| | ||| || |||||||||
Sbjct: 215 tagtgctgctcagcgaacgacttctccacgttctggagcttgaggcccttgaggtagaag 156

                                                   
Query: 466 cccttcttctcgaagcggctgatgacctcgccgatgaggc 505
           ||||||||||||||||||||||||| ||||||||||||||
Sbjct: 155 cccttcttctcgaagcggctgatgatctcgccgatgaggc 116

---

>ref|NM_197769.1| Oryza sativa (japonica cultivar-group) putative nucleoside
           diphosphate kinase (OSJNBa0027P10.4), mRNA
          Length = 800

 Score =  442 bits (223), Expect = e-121
 Identities = 355/399 (88%)
 Strand = Plus / Minus

                                                                       
Query: 107 cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 166
           |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 520 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 461

                                                                       
Query: 167 gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccga 226
           | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||| |
Sbjct: 460 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgccaa 401

                                                                       
Query: 227 tgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggcgc 286
           ||||||| |||||||| |||||||||||||| ||||| | |||||||||||||||||| |
Sbjct: 400 tgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggttggtggccc 341

                                                                       
Query: 287 caatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgacgaccg 346
           | | || |||||| || |||| ||||||   |||||||||||||||||| |||||||| |
Sbjct: 340 cgacgagcttgcggccggtggagacgacctgcttgccctcccagaccatggcgacgacgg 281

                                                                       
Query: 347 ggccggagacgatgtactccacgagcccagcgaagaagggtttggaggacagatcggcgt 406
           ||||||||||||||||||||||||||||  |||||||||| |||||||||||||||||||
Sbjct: 280 ggccggagacgatgtactccacgagccctccgaagaagggcttggaggacagatcggcgt 221

                                                                       
Query: 407 agtgctgctcggcgaacgacttctccacgttctggagcttcatgcctttaaggtagaagc 466
           |||||| ||||||||||||||||||||||||   |||||||||| |||| |||||||| |
Sbjct: 220 agtgcttctcggcgaacgacttctccacgttgatgagcttcatggctttgaggtagaatc 161

                                                  
Query: 467 ccttcttctcgaagcggctgatgacctcgccgatgaggc 505
           |||||||||||||||||| |||||||||||| |||||||
Sbjct: 160 ccttcttctcgaagcggccgatgacctcgccaatgaggc 122

---

>dbj|AK072751.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023136C24, full
           insert sequence
          Length = 734

 Score =  442 bits (223), Expect = e-121
 Identities = 355/399 (88%)
 Strand = Plus / Minus

                                                                       
Query: 107 cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 166
           |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 532 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 473

                                                                       
Query: 167 gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccga 226
           | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||| |
Sbjct: 472 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgccaa 413

                                                                       
Query: 227 tgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggcgc 286
           ||||||| |||||||| |||||||||||||| ||||| | |||||||||||||||||| |
Sbjct: 412 tgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggttggtggccc 353

                                                                       
Query: 287 caatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgacgaccg 346
           | | || |||||| || |||| ||||||   |||||||||||||||||| |||||||| |
Sbjct: 352 cgacgagcttgcggccggtggagacgacctgcttgccctcccagaccatggcgacgacgg 293

                                                                       
Query: 347 ggccggagacgatgtactccacgagcccagcgaagaagggtttggaggacagatcggcgt 406
           ||||||||||||||||||||||||||||  |||||||||| |||||||||||||||||||
Sbjct: 292 ggccggagacgatgtactccacgagccctccgaagaagggcttggaggacagatcggcgt 233

                                                                       
Query: 407 agtgctgctcggcgaacgacttctccacgttctggagcttcatgcctttaaggtagaagc 466
           |||||| ||||||||||||||||||||||||   |||||||||| |||| |||||||| |
Sbjct: 232 agtgcttctcggcgaacgacttctccacgttgatgagcttcatggctttgaggtagaatc 173

                                                  
Query: 467 ccttcttctcgaagcggctgatgacctcgccgatgaggc 505
           |||||||||||||||||| |||||||||||| |||||||
Sbjct: 172 ccttcttctcgaagcggccgatgacctcgccaatgaggc 134

---

>gb|AY103833.1| Zea mays PCO135636 mRNA sequence
          Length = 929

 Score =  321 bits (162), Expect = 1e-84
 Identities = 336/394 (85%)
 Strand = Plus / Minus

                                                                       
Query: 112 tagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccagagggcg 171
           |||||||||  |||||||||||||  ||| |||||| ||||||| |||||||| ||||| 
Sbjct: 709 tagatccaggggtgctggctgctctgccaatcagcagggccctcggggaaccacagggca 650

                                                                       
Query: 172 atctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccgatgtcg 231
           ||||||||  | ||| ||||||    ||| |||||||| |||||||||||||| ||||||
Sbjct: 649 atctccttattagcactctcaatgctgtcacttccatgaatgacattcctgccaatgtcg 590

                                                                       
Query: 232 acggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggcgccaatg 291
           || || ||||| |||||||||||||||||||| || ||||||||||||||||||||||||
Sbjct: 589 acagcaaagtcgccacggatggtgccgggctcagaagccagggggttggtggcgccaatg 530

                                                                       
Query: 292 atcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccg 351
           |||||||| ||||| | ||||||||||||||||||||||||||| || || || ||||| 
Sbjct: 529 atcttgcggccagttgtgacgacgctcttgccctcccagaccatggccaccacagggcca 470

                                                                       
Query: 352 gagacgatgtactccacgagcccagcgaagaagggtttggaggacagatcggcgtagtgc 411
           |||| |||||| |||||||| ||   ||||||||| |||||||  |||||||||||||||
Sbjct: 469 gagatgatgtagtccacgaggccctggaagaagggcttggaggcgagatcggcgtagtgc 410

                                                                       
Query: 412 tgctcggcgaacgacttctccacgttctggagcttcatgcctttaaggtagaagcccttc 471
           | ||| || |||||| |||||||||||   ||||||| | | || |||||||||||||||
Sbjct: 409 ttctcagcaaacgacctctccacgttcacaagcttcaaggccttgaggtagaagcccttc 350

                                             
Query: 472 ttctcgaagcggctgatgacctcgccgatgaggc 505
           ||||| || |||||||||| ||| || |||||||
Sbjct: 349 ttctcaaaacggctgatgatctcaccaatgaggc 316

---

>gb|U55019.1|SOU55019 Saccharum officinarum nucleoside diphosphate kinase (SoNDPK1) mRNA,
           complete cds
          Length = 742

 Score =  305 bits (154), Expect = 7e-80
 Identities = 334/394 (84%)
 Strand = Plus / Minus

                                                                       
Query: 112 tagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccagagggcg 171
           |||||||||  |||||||||||||  ||| ||||| |||||||| |||||||| || || 
Sbjct: 498 tagatccaggggtgctggctgctctgccaatcagcgaggccctcggggaaccacagagca 439

                                                                       
Query: 172 atctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccgatgtcg 231
           ||||||||  | ||| ||||||    ||| |||||||||||||||||||| || ||||||
Sbjct: 438 atctccttgttagcactctcaatgctgtcacttccatggatgacattccttccaatgtcg 379

                                                                       
Query: 232 acggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggcgccaatg 291
           || || ||||| ||||||||||| |||||||| ||  ||||||||||||||||||| |||
Sbjct: 378 acagcaaagtcgccacggatggttccgggctcagaaaccagggggttggtggcgccgatg 319

                                                                       
Query: 292 atcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccg 351
           |||||||| ||||| | ||||||||||||||||||||||||||| || || || ||||| 
Sbjct: 318 atcttgcggccagttgtgacgacgctcttgccctcccagaccatggccaccacagggcca 259

                                                                       
Query: 352 gagacgatgtactccacgagcccagcgaagaagggtttggaggacagatcggcgtagtgc 411
           |||| |||||| |||||||| ||   ||||||||| |||||||| ||||| |||||||||
Sbjct: 258 gagatgatgtagtccacgaggccctggaagaagggcttggaggatagatcagcgtagtgc 199

                                                                       
Query: 412 tgctcggcgaacgacttctccacgttctggagcttcatgcctttaaggtagaagcccttc 471
           | ||||||||||||| |||||||||||   ||||||| | | || |||||||||||||||
Sbjct: 198 ttctcggcgaacgacctctccacgttcacaagcttcaaggccttgaggtagaagcccttc 139

                                             
Query: 472 ttctcgaagcggctgatgacctcgccgatgaggc 505
           |||||||| ||||| |||| ||| || |||||||
Sbjct: 138 ttctcgaaacggctaatgatctcaccaatgaggc 105

---

>gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 genomic sequence, complete
             sequence
          Length = 141307

 Score =  262 bits (132), Expect = 1e-66
 Identities = 207/232 (89%)
 Strand = Plus / Plus

                                                                         
Query: 219   cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 278
             |||||| |||||||| |||||||| |||||||||||||| ||||| | ||||||||||||
Sbjct: 54738 cctgccaatgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggtt 54797

                                                                         
Query: 279   ggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagc 338
             |||||| || | || |||||| || |||| ||||||   |||||||||||||||||| ||
Sbjct: 54798 ggtggccccgacgagcttgcggccggtggagacgacctgcttgccctcccagaccatggc 54857

                                                                         
Query: 339   gacgaccgggccggagacgatgtactccacgagcccagcgaagaagggtttggaggacag 398
             |||||| |||||||||||||||||||||||||||||  |||||||||| |||||||||||
Sbjct: 54858 gacgacggggccggagacgatgtactccacgagccctccgaagaagggcttggaggacag 54917

                                                                 
Query: 399   atcggcgtagtgctgctcggcgaacgacttctccacgttctggagcttcatg 450
             |||||||||||||| ||||||||||||||||||||||||   ||||||||||
Sbjct: 54918 atcggcgtagtgcttctcggcgaacgacttctccacgttgatgagcttcatg 54969



 Score =  121 bits (61), Expect = 2e-24
 Identities = 103/117 (88%)
 Strand = Plus / Plus

                                                                         
Query: 107   cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 166
             |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 53331 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 53390

                                                                      
Query: 167   gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgc 223
             | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||
Sbjct: 53391 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgc 53447



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                            
Query: 451   cctttaaggtagaagcccttcttctcgaagcggctgatgacctcgcc 497
             ||||| |||||||| ||||||||||||||||||| ||||||||||||
Sbjct: 55264 cctttgaggtagaatcccttcttctcgaagcggccgatgacctcgcc 55310

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  262 bits (132), Expect = 1e-66
 Identities = 207/232 (89%)
 Strand = Plus / Plus

                                                                            
Query: 219      cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 278
                |||||| |||||||| |||||||| |||||||||||||| ||||| | ||||||||||||
Sbjct: 21740055 cctgccaatgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggtt 21740114

                                                                            
Query: 279      ggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagc 338
                |||||| || | || |||||| || |||| ||||||   |||||||||||||||||| ||
Sbjct: 21740115 ggtggccccgacgagcttgcggccggtggagacgacctgcttgccctcccagaccatggc 21740174

                                                                            
Query: 339      gacgaccgggccggagacgatgtactccacgagcccagcgaagaagggtttggaggacag 398
                |||||| |||||||||||||||||||||||||||||  |||||||||| |||||||||||
Sbjct: 21740175 gacgacggggccggagacgatgtactccacgagccctccgaagaagggcttggaggacag 21740234

                                                                    
Query: 399      atcggcgtagtgctgctcggcgaacgacttctccacgttctggagcttcatg 450
                |||||||||||||| ||||||||||||||||||||||||   ||||||||||
Sbjct: 21740235 atcggcgtagtgcttctcggcgaacgacttctccacgttgatgagcttcatg 21740286



 Score =  121 bits (61), Expect = 2e-24
 Identities = 103/117 (88%)
 Strand = Plus / Plus

                                                                            
Query: 107      cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 166
                |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 21738648 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 21738707

                                                                         
Query: 167      gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgc 223
                | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||
Sbjct: 21738708 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgc 21738764



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                               
Query: 451      cctttaaggtagaagcccttcttctcgaagcggctgatgacctcgcc 497
                ||||| |||||||| ||||||||||||||||||| ||||||||||||
Sbjct: 21740581 cctttgaggtagaatcccttcttctcgaagcggccgatgacctcgcc 21740627

---

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  262 bits (132), Expect = 1e-66
 Identities = 207/232 (89%)
 Strand = Plus / Plus

                                                                            
Query: 219      cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 278
                |||||| |||||||| |||||||| |||||||||||||| ||||| | ||||||||||||
Sbjct: 21751718 cctgccaatgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggtt 21751777

                                                                            
Query: 279      ggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagc 338
                |||||| || | || |||||| || |||| ||||||   |||||||||||||||||| ||
Sbjct: 21751778 ggtggccccgacgagcttgcggccggtggagacgacctgcttgccctcccagaccatggc 21751837

                                                                            
Query: 339      gacgaccgggccggagacgatgtactccacgagcccagcgaagaagggtttggaggacag 398
                |||||| |||||||||||||||||||||||||||||  |||||||||| |||||||||||
Sbjct: 21751838 gacgacggggccggagacgatgtactccacgagccctccgaagaagggcttggaggacag 21751897

                                                                    
Query: 399      atcggcgtagtgctgctcggcgaacgacttctccacgttctggagcttcatg 450
                |||||||||||||| ||||||||||||||||||||||||   ||||||||||
Sbjct: 21751898 atcggcgtagtgcttctcggcgaacgacttctccacgttgatgagcttcatg 21751949



 Score =  121 bits (61), Expect = 2e-24
 Identities = 103/117 (88%)
 Strand = Plus / Plus

                                                                            
Query: 107      cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 166
                |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 21750311 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 21750370

                                                                         
Query: 167      gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgc 223
                | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||
Sbjct: 21750371 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgc 21750427



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                               
Query: 451      cctttaaggtagaagcccttcttctcgaagcggctgatgacctcgcc 497
                ||||| |||||||| ||||||||||||||||||| ||||||||||||
Sbjct: 21752244 cctttgaggtagaatcccttcttctcgaagcggccgatgacctcgcc 21752290

---

>ref|XM_478187.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 450

 Score =  143 bits (72), Expect = 6e-31
 Identities = 288/360 (80%)
 Strand = Plus / Minus

                                                                       
Query: 131 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 190
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 421 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 362

                                                                       
Query: 191 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 250
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 361 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 302

                                                                       
Query: 251 tggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtccagtggcga 310
           ||||||||||  | |   ||  |||  ||||||| ||||||||| |||| |||||||| |
Sbjct: 301 tggtgccgggggctgcctcccagggcctggtggccccaatgatcctgcggccagtggcaa 242

                                                                       
Query: 311 cgacgctcttgccctcccagaccatagcgacgaccgggccggagacgatgtactccacga 370
           | ||   ||| || ||||| ||||| || ||||| ||||| |||| |||||||||||| |
Sbjct: 241 caacatccttcccttcccaaaccatcgcaacgacggggccagagatgatgtactccacca 182

                                                                       
Query: 371 gcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcggcgaacgacttct 430
            ||||| ||||||||| |||  ||| || ||||| ||||||||||  || || ||| |||
Sbjct: 181 acccagggaagaagggcttgtcggaaaggtcggcatagtgctgctgtgcaaaggacctct 122

                                                                       
Query: 431 ccacgttctggagcttcatgcctttaaggtagaagcccttcttctcgaagcggctgatga 490
           |||| |||  || |||||| ||  | |||||||| || ||||||||||| | ||||||||
Sbjct: 121 ccacattcatgaacttcatccccctcaggtagaatcctttcttctcgaacctgctgatga 62

---

>dbj|D16292.1|RICNDKR Oryza sativa mRNA for nucleoside diphosphate kinase, complete cds
          Length = 683

 Score =  143 bits (72), Expect = 6e-31
 Identities = 288/360 (80%)
 Strand = Plus / Minus

                                                                       
Query: 131 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 190
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 442 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 383

                                                                       
Query: 191 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 250
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 382 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 323

                                                                       
Query: 251 tggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtccagtggcga 310
           ||||||||||  | |   ||  |||  ||||||| ||||||||| |||| |||||||| |
Sbjct: 322 tggtgccgggggctgcctcccagggcctggtggccccaatgatcctgcggccagtggcaa 263

                                                                       
Query: 311 cgacgctcttgccctcccagaccatagcgacgaccgggccggagacgatgtactccacga 370
           | ||   ||| || ||||| ||||| || ||||| ||||| |||| |||||||||||| |
Sbjct: 262 caacatccttcccttcccaaaccatcgcaacgacggggccagagatgatgtactccacca 203

                                                                       
Query: 371 gcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcggcgaacgacttct 430
            ||||| ||||||||| |||  ||| || ||||| ||||||||||  || || ||| |||
Sbjct: 202 acccagggaagaagggcttgtcggaaaggtcggcatagtgctgctgtgcaaaggacctct 143

                                                                       
Query: 431 ccacgttctggagcttcatgcctttaaggtagaagcccttcttctcgaagcggctgatga 490
           |||| |||  || |||||| ||  | |||||||| || ||||||||||| | ||||||||
Sbjct: 142 ccacattcatgaacttcatccccctcaggtagaatcctttcttctcgaacctgctgatga 83

---

>dbj|AK121796.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033095O19, full
           insert sequence
          Length = 866

 Score =  143 bits (72), Expect = 6e-31
 Identities = 288/360 (80%)
 Strand = Plus / Minus

                                                                       
Query: 131 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 190
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 540 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 481

                                                                       
Query: 191 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 250
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 480 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 421

                                                                       
Query: 251 tggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtccagtggcga 310
           ||||||||||  | |   ||  |||  ||||||| ||||||||| |||| |||||||| |
Sbjct: 420 tggtgccgggggctgcctcccagggcctggtggccccaatgatcctgcggccagtggcaa 361

                                                                       
Query: 311 cgacgctcttgccctcccagaccatagcgacgaccgggccggagacgatgtactccacga 370
           | ||   ||| || ||||| ||||| || ||||| ||||| |||| |||||||||||| |
Sbjct: 360 caacatccttcccttcccaaaccatcgcaacgacggggccagagatgatgtactccacca 301

                                                                       
Query: 371 gcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcggcgaacgacttct 430
            ||||| ||||||||| |||  ||| || ||||| ||||||||||  || || ||| |||
Sbjct: 300 acccagggaagaagggcttgtcggaaaggtcggcatagtgctgctgtgcaaaggacctct 241

                                                                       
Query: 431 ccacgttctggagcttcatgcctttaaggtagaagcccttcttctcgaagcggctgatga 490
           |||| |||  || |||||| ||  | |||||||| || ||||||||||| | ||||||||
Sbjct: 240 ccacattcatgaacttcatccccctcaggtagaatcctttcttctcgaacctgctgatga 181

---

>gb|AY649743.1| Oryza sativa (japonica cultivar-group) nucleoside diphosphate
           kinase 1 mRNA, complete cds
          Length = 683

 Score =  135 bits (68), Expect = 2e-28
 Identities = 287/360 (79%)
 Strand = Plus / Minus

                                                                       
Query: 131 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 190
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 421 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 362

                                                                       
Query: 191 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 250
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 361 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 302

                                                                       
Query: 251 tggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtccagtggcga 310
           ||||||||||  | |   ||  |||  ||||||| ||||||||| |||| |||||||| |
Sbjct: 301 tggtgccgggggctgcctcccagggcctggtggccccaatgatcctgcggccagtggcaa 242

                                                                       
Query: 311 cgacgctcttgccctcccagaccatagcgacgaccgggccggagacgatgtactccacga 370
           | ||   ||| || ||||| ||||| || ||||| ||||| |||| |||||||||||| |
Sbjct: 241 caacatccttcccttcccaaaccatcgcaacgacggggccagagatgatgtactccacca 182

                                                                       
Query: 371 gcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcggcgaacgacttct 430
            ||||| ||||||||| |||  ||| || ||||| ||||||||||  || || ||| |||
Sbjct: 181 acccagggaagaagggcttgtcggaaaggtcggcatagtgctgctgtgcaaaggacctct 122

                                                                       
Query: 431 ccacgttctggagcttcatgcctttaaggtagaagcccttcttctcgaagcggctgatga 490
           |||| |||  || |||||| ||  | ||| |||| || ||||||||||| | ||||||||
Sbjct: 121 ccacattcatgaacttcatccccctcaggaagaatcctttcttctcgaacctgctgatga 62

---

>gb|DQ097723.1| Arachis hypogaea nucleoside diphosphate kinase I mRNA, complete cds
          Length = 573

 Score =  119 bits (60), Expect = 9e-24
 Identities = 159/192 (82%)
 Strand = Plus / Minus

                                                                       
Query: 144 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 203
           |||| |||||||||||||||| |  ||||| |||||  ||||| ||||||| ||||||||
Sbjct: 503 agcagggccctcagggaaccacaatgcgatttccttggtggcactctcaacagagtcgct 444

                                                                       
Query: 204 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctc 263
           ||| ||||| |||||||| || ||||| | |||||||||||||||||| || || |||||
Sbjct: 443 tccgtggatcacattccttccaatgtcaatggcgaagtcaccacggatagttccaggctc 384

                                                                       
Query: 264 ggaggccagggggttggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgcc 323
            || |||| |||||| || || ||||| | ||| || ||||| ||||| || |  |||||
Sbjct: 383 agatgccaaggggtttgttgctccaatcaactttcggccagtagcgacaacacctttgcc 324

                       
Query: 324 ctcccagaccat 335
           ||||||||||||
Sbjct: 323 ctcccagaccat 312

---

>gb|AF480463.1| Musa acuminata nucleoside diphosphate kinase mRNA, partial cds
          Length = 595

 Score =  117 bits (59), Expect = 4e-23
 Identities = 185/227 (81%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtg 255
           |||||||||||||| ||||||||||||||||| ||||  || | ||| || |||||||||
Sbjct: 267 gagtcgcttccatgaatgacattcctgccgatctcgatcgcaaggtccccgcggatggtg 208

                                                                       
Query: 256 ccgggctcggaggccagggggttggtggcgccaatgatcttgcgtccagtggcgacgacg 315
           |||||  ||||| |    |||||||||||||| ||||||||||| |||||| | || |||
Sbjct: 207 ccgggggcggagtcagccgggttggtggcgccgatgatcttgcgaccagtgacaaccacg 148

                                                                       
Query: 316 ctcttgccctcccagaccatagcgacgaccgggccggagacgatgtactccacgagccca 375
            |||| ||| |||| ||||| ||||| || || || |||| |||||||||||| || || 
Sbjct: 147 ttcttccccgcccacaccatcgcgaccacgggacccgagatgatgtactccaccagtccc 88

                                                          
Query: 376 gcgaagaagggtttggaggacagatcggcgtagtgctgctcggcgaa 422
           || ||||| || || |  || || ||||||||||||| |||||||||
Sbjct: 87  gcaaagaaaggcttcgcagagaggtcggcgtagtgcttctcggcgaa 41

---

>gb|AY104578.1| Zea mays PCO113042 mRNA sequence
          Length = 943

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 154 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 213
           |||||||||||||| |||||||||||| |  | ||||| || ||||||||||||||||||
Sbjct: 575 tcagggaaccagagagcgatctccttcttcccgttctccacggagtcgcttccatggatg 516

                                                          
Query: 214 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccggg 260
           |||||||||||||  || |||||| |||| ||||| ||||| |||||
Sbjct: 515 acattcctgccgacttccacggcgtagtccccacgaatggtaccggg 469



 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 172/213 (80%)
 Strand = Plus / Minus

                                                                       
Query: 278 tggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatag 337
           ||||||| ||||||||| |||| |||||    ||||||  ||| |||||||| ||||| |
Sbjct: 451 tggtggccccaatgatcctgcggccagtcaacacgacgtccttcccctcccacaccatcg 392

                                                                       
Query: 338 cgacgaccgggccggagacgatgtactccacgagcccagcgaagaagggtttggaggaca 397
           | || || |||||||| | |||||||||||| | ||| | |||||| || |||  ||| |
Sbjct: 391 ccaccacggggccggaaatgatgtactccaccaacccggggaagaaaggcttgtcggaaa 332

                                                                       
Query: 398 gatcggcgtagtgctgctcggcgaacgacttctccacgttctggagcttcatgcctttaa 457
           | || |||||||||||||  ||||| ||| |||||||||||  || |||||| || || |
Sbjct: 331 ggtcagcgtagtgctgctgcgcgaaggacctctccacgttcatgaacttcatccccttga 272

                                            
Query: 458 ggtagaagcccttcttctcgaagcggctgatga 490
           ||||||| || |||||||||||||| |||||||
Sbjct: 271 ggtagaaccctttcttctcgaagcgactgatga 239

---

>dbj|D10659.1|SPINDPKINI Spinach mRNA for nucleoside diphosphate kinase I, complete cds
          Length = 828

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 113/134 (84%)
 Strand = Plus / Minus

                                                                       
Query: 205 ccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcg 264
           |||||||||||||| ||||| ||||||| |||||| |||||||||||||| || ||||| 
Sbjct: 380 ccatggatgacatttctgccaatgtcgatggcgaaatcaccacggatggttcctggctct 321

                                                                       
Query: 265 gaggccagggggttggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccc 324
           || || || ||||||||||| ||||||| ||| | ||| || || || || | ||| |||
Sbjct: 320 gaagcaagagggttggtggctccaatgagcttccttccggtagcaacaactcccttaccc 261

                         
Query: 325 tcccagaccatagc 338
           ||||||||||||||
Sbjct: 260 tcccagaccatagc 247

---

>gb|BT013034.1| Lycopersicon esculentum clone 114282R, mRNA sequence
          Length = 727

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 151/185 (81%)
 Strand = Plus / Minus

                                                                       
Query: 154 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 213
           ||||||||||| || |||||||||||||| ||| ||||||| |  || ||||||||||||
Sbjct: 451 tcagggaaccaaagagcgatctccttcctagcactctcaacagcatcacttccatggatg 392

                                                                       
Query: 214 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 273
           ||||||||||| ||||| |  || || ||||||||||| || || |   | ||  ||| |
Sbjct: 391 acattcctgccaatgtcaatagcaaaatcaccacggatagttccagcagcagactccaag 332

                                                                       
Query: 274 gggttggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagacc 333
           |||||||| || ||||||||||| |  |||||||| || || | ||| ||||||||||||
Sbjct: 331 gggttggttgctccaatgatcttcctgccagtggcaactacacccttaccctcccagacc 272

                
Query: 334 atagc 338
           |||||
Sbjct: 271 atagc 267

---

>emb|X75324.1|LERNADNK L.esculentum (Ailsa Craig) mRNA for nucleoside diphosphate kinase
          Length = 590

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 151/185 (81%)
 Strand = Plus / Minus

                                                                       
Query: 154 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 213
           ||||||||||| || |||||||||||||| ||| ||||||| |  || ||||||||||||
Sbjct: 388 tcagggaaccaaagagcgatctccttcctagcactctcaacagcatcacttccatggatg 329

                                                                       
Query: 214 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 273
           ||||||||||| ||||| |  || || ||||||||||| || || |   | ||  ||| |
Sbjct: 328 acattcctgccaatgtcaatagcaaaatcaccacggatagttccagcagcagactccaag 269

                                                                       
Query: 274 gggttggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagacc 333
           |||||||| || ||||||||||| |  |||||||| || || | ||| ||||||||||||
Sbjct: 268 gggttggttgctccaatgatcttcctgccagtggcaactacacccttaccctcccagacc 209

                
Query: 334 atagc 338
           |||||
Sbjct: 208 atagc 204

---

>ref|XM_323541.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE KINASE (NDK) (NDP
           KINASE) (NCU04202.1) partial mRNA
          Length = 459

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 159 gaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatgacatt 218
           |||||||||||| ||||||||| |||| ||||| || ||||||   || |||  ||| ||
Sbjct: 402 gaaccagagggcaatctccttcttggcgttctcgacggagtcggagccgtggcagacgtt 343

                                                                       
Query: 219 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 278
            | ||| |||||||  || |||||||||||||||||||||||  ||||||| ||||||||
Sbjct: 342 gcggcccatgtcgagagcaaagtcaccacggatggtgccgggagcggaggcgagggggtt 283

                 
Query: 279 ggtggc 284
           ||||||
Sbjct: 282 ggtggc 277

---

>ref|XM_956069.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE KINASE (NDK) (NDP
           KINASE) (NCU04202.1) partial mRNA
          Length = 459

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 159 gaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatgacatt 218
           |||||||||||| ||||||||| |||| ||||| || ||||||   || |||  ||| ||
Sbjct: 402 gaaccagagggcaatctccttcttggcgttctcgacggagtcggagccgtggcagacgtt 343

                                                                       
Query: 219 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 278
            | ||| |||||||  || |||||||||||||||||||||||  ||||||| ||||||||
Sbjct: 342 gcggcccatgtcgagagcaaagtcaccacggatggtgccgggagcggaggcgagggggtt 283

                 
Query: 279 ggtggc 284
           ||||||
Sbjct: 282 ggtggc 277

---

>ref|XM_676393.1| Aspergillus nidulans FGSC A4 nucleoside diphosphate kinase
           (AN8216.2), mRNA
          Length = 486

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 222 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggt 281
           ||||| |||||  ||||||||||||||||||||||||||  ||||||| |||||||||||
Sbjct: 360 gccgacgtcgatagcgaagtcaccacggatggtgccgggggcggaggcaagggggttggt 301

                                                                       
Query: 282 ggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgac 341
           ||| || | |||  |||| || ||   |||||||  ||| |||||||||||||| |||||
Sbjct: 300 ggcaccgaggatggtgcggccggtcttgacgacgtccttaccctcccagaccatggcgac 241

             
Query: 342 ga 343
           ||
Sbjct: 240 ga 239

---

>gb|AY057453.1| Emericella nidulans nucleoside diphosphate kinase (swoH) gene,
           complete cds
          Length = 776

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 222 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggt 281
           ||||| |||||  ||||||||||||||||||||||||||  ||||||| |||||||||||
Sbjct: 650 gccgacgtcgatagcgaagtcaccacggatggtgccgggggcggaggcaagggggttggt 591

                                                                       
Query: 282 ggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgac 341
           ||| || | |||  |||| || ||   |||||||  ||| |||||||||||||| |||||
Sbjct: 590 ggcaccgaggatggtgcggccggtcttgacgacgtccttaccctcccagaccatggcgac 531

             
Query: 342 ga 343
           ||
Sbjct: 530 ga 529

---

>gb|AF072289.1|AF072289 Mesembryanthemum crystallinum nucleoside diphosphate kinase I (NDK
           I) mRNA, complete cds
          Length = 724

 Score = 79.8 bits (40), Expect = 8e-12
 Identities = 151/188 (80%)
 Strand = Plus / Minus

                                                                       
Query: 151 ccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatgg 210
           |||||||||||||| ||||| ||||| ||  | ||| | ||||| |  |||||||| |||
Sbjct: 432 ccctcagggaaccacagggcaatctcttttgttgcactttcaacagcatcgcttccgtgg 373

                                                                       
Query: 211 atgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggcc 270
           || || || ||||| ||||||| ||| || || ||||||||||| || ||||| || || 
Sbjct: 372 ataacgtttctgccaatgtcgatggcaaaatctccacggatggtaccaggctctgaagct 313

                                                                       
Query: 271 agggggttggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccag 330
           || ||||||||||| ||||||||||| |  |||||    || || | |||||||||||||
Sbjct: 312 agagggttggtggctccaatgatctttctaccagtaagaacaacacccttgccctcccag 253

                   
Query: 331 accatagc 338
           ||||||||
Sbjct: 252 accatagc 245

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                            
Query: 131      tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 190
                |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 18281744 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 18281803

                                               
Query: 191      caactgagtcgcttccatggatgacattcct 221
                | || |||||||| |||||||||||||||||
Sbjct: 18281804 ccacggagtcgctcccatggatgacattcct 18281834



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 113/138 (81%)
 Strand = Plus / Plus

                                                                            
Query: 278      tggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatag 337
                ||||||| ||||||||| |||| |||||||| || ||   ||| || ||||| ||||| |
Sbjct: 18282332 tggtggccccaatgatcctgcggccagtggcaacaacatccttcccttcccaaaccatcg 18282391

                                                                            
Query: 338      cgacgaccgggccggagacgatgtactccacgagcccagcgaagaagggtttggaggaca 397
                | ||||| ||||| |||| |||||||||||| | ||||| ||||||||| |||  ||| |
Sbjct: 18282392 caacgacggggccagagatgatgtactccaccaacccagggaagaagggcttgtcggaaa 18282451

                                  
Query: 398      gatcggcgtagtgctgct 415
                | ||||| ||||||||||
Sbjct: 18282452 ggtcggcatagtgctgct 18282469

---

>dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1218_C12
          Length = 105861

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                         
Query: 131   tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 190
             |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 84987 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 85046

                                            
Query: 191   caactgagtcgcttccatggatgacattcct 221
             | || |||||||| |||||||||||||||||
Sbjct: 85047 ccacggagtcgctcccatggatgacattcct 85077



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 113/138 (81%)
 Strand = Plus / Plus

                                                                         
Query: 278   tggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatag 337
             ||||||| ||||||||| |||| |||||||| || ||   ||| || ||||| ||||| |
Sbjct: 85575 tggtggccccaatgatcctgcggccagtggcaacaacatccttcccttcccaaaccatcg 85634

                                                                         
Query: 338   cgacgaccgggccggagacgatgtactccacgagcccagcgaagaagggtttggaggaca 397
             | ||||| ||||| |||| |||||||||||| | ||||| ||||||||| |||  ||| |
Sbjct: 85635 caacgacggggccagagatgatgtactccaccaacccagggaagaagggcttgtcggaaa 85694

                               
Query: 398   gatcggcgtagtgctgct 415
             | ||||| ||||||||||
Sbjct: 85695 ggtcggcatagtgctgct 85712

---

>dbj|AP004266.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0038F10
          Length = 153929

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                         
Query: 131   tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 190
             |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 11239 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 11298

                                            
Query: 191   caactgagtcgcttccatggatgacattcct 221
             | || |||||||| |||||||||||||||||
Sbjct: 11299 ccacggagtcgctcccatggatgacattcct 11329



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 113/138 (81%)
 Strand = Plus / Plus

                                                                         
Query: 278   tggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatag 337
             ||||||| ||||||||| |||| |||||||| || ||   ||| || ||||| ||||| |
Sbjct: 11827 tggtggccccaatgatcctgcggccagtggcaacaacatccttcccttcccaaaccatcg 11886

                                                                         
Query: 338   cgacgaccgggccggagacgatgtactccacgagcccagcgaagaagggtttggaggaca 397
             | ||||| ||||| |||| |||||||||||| | ||||| ||||||||| |||  ||| |
Sbjct: 11887 caacgacggggccagagatgatgtactccaccaacccagggaagaagggcttgtcggaaa 11946

                               
Query: 398   gatcggcgtagtgctgct 415
             | ||||| ||||||||||
Sbjct: 11947 ggtcggcatagtgctgct 11964

---

>ref|XM_742902.1| Aspergillus fumigatus Af293 nucleoside diphosphate kinase
           (Afu5g03490) partial mRNA
          Length = 462

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 222 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggt 281
           ||||| |||||  ||||||||||||||||||||||||||  ||||||| || ||||||||
Sbjct: 336 gccgacgtcgatagcgaagtcaccacggatggtgccgggagcggaggcaagagggttggt 277

              
Query: 282 ggc 284
           |||
Sbjct: 276 ggc 274

---

>emb|AL807368.1|NC62D11 Neurospora crassa DNA linkage group V cosmid contig 62D11
          Length = 102165

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                            
Query: 238   aagtcaccacggatggtgccgggctcggaggccagggggttggtggc 284
             |||||||||||||||||||||||  ||||||| ||||||||||||||
Sbjct: 14775 aagtcaccacggatggtgccgggagcggaggcgagggggttggtggc 14821



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                        
Query: 159   gaaccagagggcgatctccttcctggcattctcaactgagtcg 201
             |||||||||||| ||||||||| |||| ||||| || ||||||
Sbjct: 14630 gaaccagagggcaatctccttcttggcgttctcgacggagtcg 14672

---

>emb|AL807373.1|NC21D9 Neurospora crassa DNA linkage group V cosmid contig 21D9
          Length = 55380

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                           
Query: 238  aagtcaccacggatggtgccgggctcggaggccagggggttggtggc 284
            |||||||||||||||||||||||  ||||||| ||||||||||||||
Sbjct: 4628 aagtcaccacggatggtgccgggagcggaggcgagggggttggtggc 4582



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 159  gaaccagagggcgatctccttcctggcattctcaactgagtcg 201
            |||||||||||| ||||||||| |||| ||||| || ||||||
Sbjct: 4773 gaaccagagggcaatctccttcttggcgttctcgacggagtcg 4731

---

>dbj|D88148.1| Neurospora crassa mRNA for nucleoside diphosphate kinase, complete
            cds
          Length = 4240

 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                           
Query: 238  aagtcaccacggatggtgccgggctcggaggccagggggttggtggc 284
            |||||||||||||||||||||||  ||||||| ||||||||||||||
Sbjct: 3268 aagtcaccacggatggtgccgggagcggaggcgagggggttggtggc 3222



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 159  gaaccagagggcgatctccttcctggcattctcaactgagtcg 201
            |||||||||||| ||||||||| |||| ||||| || ||||||
Sbjct: 3413 gaaccagagggcaatctccttcttggcgttctcgacggagtcg 3371

---

>gb|AY324230.1| Aspergillus fumigatus nucleoside diphosphate kinase (NDK) gene,
           complete cds
          Length = 928

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 235 gcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 284
           ||||||||||||||||||||||||||  ||||||| || |||||||||||
Sbjct: 737 gcgaagtcaccacggatggtgccgggagcggaggcaagagggttggtggc 688



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 159 gaaccagagggcgatctccttcctggcattctc 191
           |||||||||||| ||||||||| |||| |||||
Sbjct: 865 gaaccagagggcaatctccttcttggcgttctc 833

---

>gb|U72142.1|HAU72142 Helianthus annuus nucleoside diphosphate kinase mRNA, complete cds
          Length = 653

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 174/217 (80%), Gaps = 4/217 (1%)
 Strand = Plus / Minus

                                                                       
Query: 151 ccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatgg 210
           |||||||||||||| ||  | ||||||||| | ||| | ||||| |  || |||||||| 
Sbjct: 428 ccctcagggaaccacagaccaatctccttctttgcactttcaacagcatcacttccatga 369

                                                                       
Query: 211 atgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggc- 269
           || ||||| ||||| |||||||  || || ||||||||||||||||| ||   |||| | 
Sbjct: 368 atcacatttctgccaatgtcgattgcaaaatcaccacggatggtgccagga--ggagact 311

                                                                       
Query: 270 cagg-gggttggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctccc 328
           |||  ||||| ||||| ||||||||||||||||| ||||  || ||  ||||||| ||||
Sbjct: 310 cagcagggtttgtggcaccaatgatcttgcgtccggtggtaaccacattcttgccttccc 251

                                                
Query: 329 agaccatagcgacgaccgggccggagacgatgtactc 365
           | ||||| || ||||| || ||||||| |||||||||
Sbjct: 250 aaaccatggcaacgacgggtccggagatgatgtactc 214

---

>gb|AF108881.1|AF108881 Capsicum annuum nucleoside diphosphate kinase mRNA, complete cds
          Length = 755

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 135/169 (79%)
 Strand = Plus / Minus

                                                                       
Query: 128 ggctgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcat 187
           ||||||||  |||||| ||||  || || |||||||| || || ||||||||||| ||| 
Sbjct: 470 ggctgctctgccactctgcaactccttcggggaaccaaagagcaatctccttccttgcac 411

                                                                       
Query: 188 tctcaactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccac 247
           ||||||| |  || |||||||| |||||||||||||| ||||| |  ||  | |||||||
Sbjct: 410 tctcaacagcatcacttccatgaatgacattcctgccaatgtcaatagcataatcaccac 351

                                                            
Query: 248 ggatggtgccgggctcggaggccagggggttggtggcgccaatgatctt 296
           ||||||| || ||  | ||  ||| ||||||||| || |||||||||||
Sbjct: 350 ggatggtaccaggagcagattccaaggggttggttgctccaatgatctt 302

---

>gb|DQ157699.1| Solanum chacoense cytosolic nucleoside diphosphate kinase mRNA,
           complete cds
          Length = 753

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 166/211 (78%)
 Strand = Plus / Minus

                                                                       
Query: 128 ggctgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcat 187
           ||||||||  |||||| ||||  || || |||||||| || || ||||||||||| ||| 
Sbjct: 480 ggctgctctgccactctgcaattccttcggggaaccaaagagcaatctccttcctagcac 421

                                                                       
Query: 188 tctcaactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccac 247
           ||||||| |  || |||||||| || ||||||||||| || || |  || || |||||||
Sbjct: 420 tctcaacagcatcacttccatgaataacattcctgccaatatcaatagcaaaatcaccac 361

                                                                       
Query: 248 ggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtccagtgg 307
           ||||||| || |   | ||  ||| ||||||||| || ||||||||||| |  |||||||
Sbjct: 360 ggatggtaccagcagccgactccaaggggttggttgctccaatgatcttcctgccagtgg 301

                                          
Query: 308 cgacgacgctcttgccctcccagaccatagc 338
           | || || | ||| || ||||||||||||||
Sbjct: 300 caactacacccttaccttcccagaccatagc 270

---

>emb|BX072516.1|CNS09S48 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 605

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 442 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 501

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 502 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 552

---

>emb|BX072515.1|CNS09S47 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1BH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 662

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 372 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 313

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 312 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 262

---

>emb|BX063953.1|CNS09LID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 433 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 492

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 493 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 543

---

>emb|BX051771.1|CNS09C3Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 372 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 313

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 312 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 262

---

>emb|BX050874.1|CNS09BF2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 408

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 340 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 281

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 280 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 230

---

>emb|BX048701.1|CNS099QP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 197 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 138

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 137 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 87

---

>emb|BX044675.1|CNS096MV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 793

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 341 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 282

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 281 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 231

---

>emb|BX039425.1|CNS092L1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 349 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 290

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 289 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 239

---

>emb|BX038905.1|CNS0926L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 748

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 402 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 343

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 342 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 292

---

>emb|BX038259.1|CNS091ON Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 422 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 481

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 482 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 532

---

>emb|BX038258.1|CNS091OM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 715

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 361 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 302

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 301 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 251

---

>emb|BX038115.1|CNS091KN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 737

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 372 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 313

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 312 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 262

---

>emb|BX037581.1|CNS0915T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 429 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 488

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 489 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 539

---

>emb|BX037580.1|CNS0915S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 718

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 372 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 313

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 312 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 262

---

>emb|BX036658.1|CNS090G6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 313 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 254

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 253 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 203

---

>emb|BX032742.1|CNS08XFE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 203

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 202 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 152

---

>emb|BX031659.1|CNS08WLB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 805

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 400 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 459

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 460 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 510

---

>emb|BX031658.1|CNS08WLA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 346 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 287

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 286 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 236

---

>emb|BX025663.1|CNS08RYR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 669

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 425 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 484

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 485 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 535

---

>emb|BX025662.1|CNS08RYQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 581

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 363 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 304

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 303 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 253

---

>emb|BX025230.1|CNS08RMQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 532

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 203

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 202 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 152

---

>emb|BX024508.1|CNS08R2O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 419 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 478

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 479 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 529

---

>emb|BX024507.1|CNS08R2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 365 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 306

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 305 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 255

---

>emb|BX023654.1|CNS08QEY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 418 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 477

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 478 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 528

---

>emb|BX022916.1|CNS08PUG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 344 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 403

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 404 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 454

---

>emb|BX022915.1|CNS08PUF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 585

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 379 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 320

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 319 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 269

---

>emb|BX021481.1|CNS08OQL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 845

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 410 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 469

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 470 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 520

---

>emb|BX021480.1|CNS08OQK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 659

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 390 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 331

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 330 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 280

---

>emb|BX021192.1|CNS08OIK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 787

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 339 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 280

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 279 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 229

---

>emb|BX021174.1|CNS08OI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 203

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 202 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 152

---

>emb|BX018153.1|CNS08M65 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 347 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 288

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 287 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 237

---

>emb|BX018054.1|CNS08M3E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 652

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 203

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 202 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 152

---

>emb|BX017467.1|CNS08LN3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 691

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 405 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 464

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 465 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 515

---

>emb|BX017466.1|CNS08LN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 735

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 360 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 301

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 300 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 250

---

>emb|BX017206.1|CNS08LFU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 354 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 295

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 294 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 244

---

>emb|BX016645.1|CNS08L09 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 409 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 468

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 469 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 519

---

>emb|BX014282.1|CNS08J6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 347 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 288

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 287 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 237

---

>emb|BX009575.1|CNS08FJV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 387 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 328

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 327 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 277

---

>emb|BX009569.1|CNS08FJP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 605

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 203

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 202 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 152

---

>emb|BX009487.1|CNS08FHF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 357 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 298

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 297 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 247

---

>emb|BX007945.1|CNS08EAL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 407 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 466

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 467 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 517

---

>emb|BX007944.1|CNS08EAK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 730

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 203

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 202 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 152

---

>emb|BX006734.1|CNS08DCY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 394 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 453

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 454 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 504

---

>emb|BX006733.1|CNS08DCX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 348 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 289

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 288 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 238

---

>emb|BX006020.1|CNS08CT4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 203

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 202 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 152

---

>dbj|AB226030.1| Aspergillus oryzae cDNA, contig sequence: AoEST2886
          Length = 635

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 234 ggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 284
           |||||||||||||||||||||||| ||  ||||||| || |||||||||||
Sbjct: 361 ggcgaagtcaccacggatggtgccaggggcggaggcaagagggttggtggc 311

---

>dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102
          Length = 1779707

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                                  
Query: 234     ggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 284
               |||||||||||||||||||||||| ||  ||||||| || |||||||||||
Sbjct: 1532690 ggcgaagtcaccacggatggtgccaggggcggaggcaagagggttggtggc 1532740



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 159     gaaccagagggcgatctccttcctggcattctc 191
               |||||||||||| ||||||||| |||| |||||
Sbjct: 1532554 gaaccagagggcaatctccttcttggcgttctc 1532586

---

>ref|XM_308641.2| Anopheles gambiae str. PEST ENSANGP00000011253
           (ENSANGG00000008764), mRNA
          Length = 873

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 467 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 408

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 407 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 357

---

>ref|XM_570963.1| Cryptococcus neoformans var. neoformans JEC21
           nucleoside-diphosphate kinase (CNE02610) partial mRNA
          Length = 530

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                         
Query: 151 ccctcagggaaccagagggcgatctccttc 180
           ||||||||||||||||||||||||||||||
Sbjct: 425 ccctcagggaaccagagggcgatctccttc 396

---

>emb|BX025692.1|CNS08RZK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 508

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 245 cacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtccag 304
           ||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || |
Sbjct: 369 cacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccgg 310

                                                             
Query: 305 tggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           |   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 309 tcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 260

---

>dbj|AK065933.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013043K17, full
            insert sequence
          Length = 2012

 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 131  tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttc 180
            |||||||||||||||| |  || |||||||||||||| ||||||||||||
Sbjct: 1752 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttc 1703

---

>ref|XM_363038.1| Magnaporthe grisea 70-15 hypothetical protein (MG08622.4) partial
           cds
          Length = 726

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 228 gtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 284
           ||||| |||| ||||||||||||||||||| ||  | ||||| ||||||||||||||
Sbjct: 594 gtcgatggcgtagtcaccacggatggtgccaggggccgaggcaagggggttggtggc 538



 Score = 44.1 bits (22), Expect = 0.44
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 360 gtactccacgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 417
           |||||| ||||| |||||||||||||| |||     ||| ||||||||||||||||||
Sbjct: 450 gtactcaacgaggccagcgaagaagggcttgtccttcaggtcggcgtagtgctgctcg 393

---

>gb|AY194364.1| Vitis vinifera nucleoside-diphosphate kinase (Ndpk) mRNA, partial
           cds
          Length = 178

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 95/117 (81%)
 Strand = Plus / Minus

                                                                       
Query: 108 ctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccagag 167
           |||||||||||||| ||   ||||||| |||||  || || |||| || |||||||| ||
Sbjct: 119 ctcatagatccagtggttaaggctgctgctccaggcaacagggccttctgggaaccacag 60

                                                                    
Query: 168 ggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgcc 224
            || ||||||||||| ||| || | |||||||| || ||||| || |||||||||||
Sbjct: 59  tgctatctccttccttgcactccccactgagtcactcccatgaatcacattcctgcc 3

---

>ref|XM_780291.1| PREDICTED: Strongylocentrotus purpuratus similar to
           nucleoside-diphosphate kinase 1 isoform a (LOC580218),
           mRNA
          Length = 546

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 222 gccgatgtcgacggcgaagtcaccacggatggtgccgggct 262
           |||||||||||||| | ||||||||||||||||||| ||||
Sbjct: 420 gccgatgtcgacggagtagtcaccacggatggtgccaggct 380

---

>gb|AY157740.1| Glycine max nucleoside diphosphate kinase mRNA, complete cds
          Length = 661

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                       
Query: 144 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 203
           |||| |||||||||||||||| |  || || |||||  | ||| |||||||||| || ||
Sbjct: 430 agcagggccctcagggaaccacaatgcaatttccttgttagcactctcaactgaatcact 371

                                                        
Query: 204 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacg 248
           ||||||||| |||||||| || ||||| |  || |||||||||||
Sbjct: 370 tccatggataacattccttccaatgtcaatagcaaagtcaccacg 326

---

>gb|AY389630.1| Hyacinthus orientalis nucleoside diphosphate kinase mRNA, partial
           cds
          Length = 679

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 103/128 (80%)
 Strand = Plus / Minus

                                                                       
Query: 370 agcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcggcgaacgacttc 429
           |||||| ||||||||||||| |||||||| ||  | ||||||| |||||| || ||   |
Sbjct: 215 agcccaccgaagaagggttttgaggacaggtcctcatagtgcttctcggcaaaagagcgc 156

                                                                       
Query: 430 tccacgttctggagcttcatgcctttaaggtagaagcccttcttctcgaagcggctgatg 489
           |||||| |   |||||||||  |||| |||||||| ||||||||||| || || || |||
Sbjct: 155 tccacggtgatgagcttcattgctttcaggtagaaacccttcttctcaaatcgactaatg 96

                   
Query: 490 acctcgcc 497
           | ||||||
Sbjct: 95  atctcgcc 88



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 150 gccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatg 209
           |||||| |||||||| ||  | ||||||||||| ||| ||||||| | |||||| |||||
Sbjct: 435 gccctctgggaaccacagcccaatctccttcctcgcactctcaaccgcgtcgctcccatg 376

---

>emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segment 7/7
          Length = 344615

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                      
Query: 208    tggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctc 263
              |||||||| || | |||||||| |||||| |  |||||||||||||||||||||||
Sbjct: 172638 tggatgacgttgcggccgatgttgacggccagatcaccacggatggtgccgggctc 172693

---

>gb|AY157739.1| Glycine max nucleoside diphosphate kinase mRNA, complete cds
          Length = 655

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 88/108 (81%)
 Strand = Plus / Minus

                                                                       
Query: 144 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 203
           |||| |||||||||||||||| |  || || |||||  | ||| | |||||||  || ||
Sbjct: 436 agcagggccctcagggaaccacaatgcaatttccttgttagcactttcaactgcatcact 377

                                                           
Query: 204 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 251
           ||||||||| |||||||| || ||||| | ||| ||||||||||||||
Sbjct: 376 tccatggataacattccttccaatgtcaatggcaaagtcaccacggat 329

---

>gb|U50150.1|GMU50150 Glycine max nucleoside diphosphate kinase mRNA, complete cds
          Length = 771

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 88/108 (81%)
 Strand = Plus / Minus

                                                                       
Query: 144 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 203
           |||| |||||||||||||||| |  || || |||||  | ||| | |||||||  || ||
Sbjct: 445 agcagggccctcagggaaccacaatgcaatttccttgttagcactttcaactgcatcact 386

                                                           
Query: 204 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 251
           ||||||||| |||||||| || ||||| | ||| ||||||||||||||
Sbjct: 385 tccatggataacattccttccaatgtcaatggcaaagtcaccacggat 338

---

>ref|XM_386148.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05972.1)
           partial mRNA
          Length = 717

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 222 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggt 281
           ||||| ||||| |||| |||||||||||||||| |||||    ||||| |||||||||||
Sbjct: 591 gccgacgtcgatggcgtagtcaccacggatggtaccgggggaagaggcaagggggttggt 532

              
Query: 282 ggc 284
           |||
Sbjct: 531 ggc 529

---

>emb|BX062211.1|CNS09K5Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 250

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 225 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 166

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||    ||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 165 gtcttaacggcgttcaggccctcccagaccatcggcacgaccgggccggag 115

---

>emb|BX017207.1|CNS08LFV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 590

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 223 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 282

                                                              
Query: 304 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||   |||| || ||  ||||||||| ||||| |  |||||||||||||||
Sbjct: 283 gtcttgacggcgttcaggccctcccaaaccatcggcacgaccgggccggag 333

---

>emb|X71388.1|PSNDKP1 P.sativum ndk-p1 mRNA for nucleoside diphosphate kinase
          Length = 639

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 202 cttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 251
           |||||||| || ||||||||||| ||||| | ||| ||||||||||||||
Sbjct: 377 cttccatgaataacattcctgccaatgtcaatggcaaagtcaccacggat 328

---

>gb|AY130398.1| Petromyzon marinus nucleoside diphosphate kinase mRNA, partial cds
          Length = 355

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 196 gagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtg 255
           ||||||||||||||||| || || |  |||||||||| |  |||||| || |||||||||
Sbjct: 324 gagtcgcttccatggatcacgtttcgcccgatgtcgatgcagaagtccccgcggatggtg 265

                 
Query: 256 ccgggc 261
           ||||||
Sbjct: 264 ccgggc 259

---

>dbj|D86052.1|PEAPNDKN1 Pisum sativum mRNA for PNDKN1, complete cds
          Length = 629

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 202 cttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 251
           |||||||| || ||||||||||| ||||| | ||| ||||||||||||||
Sbjct: 365 cttccatgaataacattcctgccaatgtcaatggcaaagtcaccacggat 316

---

>ref|XM_753830.1| Ustilago maydis 521 hypothetical protein (UM02776.1) partial mRNA
          Length = 609

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtg 282
           |||| ||||| ||||||||| ||||||||||| |||||  | ||| | || |||||||||
Sbjct: 485 ccgacgtcgatggcgaagtcgccacggatggttccgggggcagagtcgagcgggttggtg 426

                
Query: 283 gcgcc 287
           |||||
Sbjct: 425 gcgcc 421

---

>dbj|AB126060.1| Codonopsis lanceolata NDPK 1 mRNA for nucloeside diphosphate kinase
           1, complete cds
          Length = 635

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 205 ccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgcc 257
           ||||| |||||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 417 ccatgaatgacattcctgccaatgtcaatagcaaaatcaccacggatggtgcc 365

---

>gb|U10283.1|FBU10283 Flaveria bidentis clone pNDK-b nucleoside diphosphate kinase mRNA,
           complete cds
          Length = 573

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 82/101 (81%)
 Strand = Plus / Minus

                                                                       
Query: 274 gggttggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagacc 333
           ||||| ||||| |||||||||||||| |||||||  || ||  ||||||| ||||| |||
Sbjct: 283 gggtttgtggcaccaatgatcttgcgcccagtggtaaccacattcttgccttcccaaacc 224

                                                    
Query: 334 atagcgacgaccgggccggagacgatgtactccacgagccc 374
           || || || || || || |||| ||||||||| || |||||
Sbjct: 223 atggcaacaacgggtccagagatgatgtactcaactagccc 183

---

>gb|U10282.1|FBU10282 Flaveria bidentis clone pNDK-a nucleoside diphosphate kinase mRNA,
           complete cds
          Length = 601

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 289 atgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgacgaccggg 348
           ||||||| ||| ||||||| ||| ||  ||||||||||||| ||||| || || || || 
Sbjct: 268 atgatctcgcggccagtggtgaccacattcttgccctcccaaaccatggcaacaacggga 209

                            
Query: 349 ccggagacgatgtactc 365
           || ||||||||||||||
Sbjct: 208 ccagagacgatgtactc 192



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 83/104 (79%)
 Strand = Plus / Minus

                                                                       
Query: 151 ccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatgg 210
           ||||| |||||||| ||  ||||| ||||||| ||  ||||||| |  || || ||||| 
Sbjct: 406 ccctcggggaaccacagaccgatcaccttcctcgcgctctcaaccgcatcactaccatga 347

                                                       
Query: 211 atgacattcctgccgatgtcgacggcgaagtcaccacggatggt 254
           || ||||| ||||| |||||||  || || ||||||||||||||
Sbjct: 346 atcacatttctgccaatgtcgattgcaaaatcaccacggatggt 303

---

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
              sequence
          Length = 1507550

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 157    gggaaccagagggcgatctccttc 180
              ||||||||||||||||||||||||
Sbjct: 701410 gggaaccagagggcgatctccttc 701433

---

>emb|BX038906.1|CNS0926M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 298

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 287
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 243 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 286

---

>emb|BX038116.1|CNS091KO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 345

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 75/92 (81%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 247 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 306

                                           
Query: 304 gtggcgacgacgctcttgccctcccagaccat 335
           ||   |||| || ||  |||||||||||||||
Sbjct: 307 gtcttgacggcgttcaggccctcccagaccat 338

---

>emb|BX021303.1|CNS08OLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 287
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 347 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 390

---

>emb|BX021302.1|CNS08OLM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 244 ccacggatggtgccgggctcggag 267
           ||||||||||||||||||||||||
Sbjct: 613 ccacggatggtgccgggctcggag 590

---

>emb|BX021175.1|CNS08OI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 149

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 287
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 103 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 146

---

>emb|BX013424.1|CNS08IIS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 798

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 287
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 350 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 307

---

>emb|BX009576.1|CNS08FJW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 91/112 (81%), Gaps = 1/112 (0%)
 Strand = Plus / Plus

                                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 303
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 396 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 455

                                                               
Query: 304 gtggc-gacgacgctcttgccctcccagaccatagcgacgaccgggccggag 354
           ||    |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 456 gtctttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 507

---

>ref|NM_117000.2| Arabidopsis thaliana NDPK1; ATP binding / nucleoside diphosphate
           kinase AT4G09320 (NDPK1) mRNA, complete cds
          Length = 700

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 154 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 213
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 482 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 423

                                                                       
Query: 214 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 273
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 422 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 363

                                  
Query: 274 gggttggtggcgccaatgatctt 296
           |||||||| || |||||||||||
Sbjct: 362 gggttggtagctccaatgatctt 340

---

>gb|AY231961.1| Drosophila yakuba clone yak-em_awd mRNA sequence
          Length = 450

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 237 gaagtcaccacggatggtgccgggctcggaggccagggggttggtggcgcc 287
           ||||||||| |||||||||||||||  |||| |   |||||||||||||||
Sbjct: 318 gaagtcaccgcggatggtgccgggcagggagtcggcggggttggtggcgcc 268



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 393 ggacagatcggcgtagtgct 412
           ||||||||||||||||||||
Sbjct: 162 ggacagatcggcgtagtgct 143

---

>emb|X69376.1|ATNDK13 A.thaliana gene for nucleoside diphosphate kinase, exons 1-3
          Length = 3132

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                        
Query: 154  tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 213
            ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 1191 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 1132

                                                                        
Query: 214  acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 273
            || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 1131 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 1072

                                   
Query: 274  gggttggtggcgccaatgatctt 296
            |||||||| || |||||||||||
Sbjct: 1071 gggttggtagctccaatgatctt 1049

---

>emb|X69373.1|ATNDK A.thaliana mRNA for nucleoside diphosphate kinase
          Length = 536

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 154 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 213
           ||||||||||| |  || |||||||| |||||| |||| || ||||| || || ||||| 
Sbjct: 392 tcagggaaccacaaagcaatctcctttctggcactctcgacagagtcactaccgtggatc 333

                                                                       
Query: 214 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 273
           |||||||| || ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 332 acattccttccaatgtcaatagcaaagtccccacggatagttcccggctcagaagctgct 273

                                  
Query: 274 gggttggtggcgccaatgatctt 296
           |||||||| || |||||||||||
Sbjct: 272 gggttggtagctccaatgatctt 250

---

>emb|AL161514.2|ATCHRIV26 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 26
          Length = 199754

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                          
Query: 154    tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 213
              ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 136684 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 136625

                                                                          
Query: 214    acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 273
              || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 136624 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 136565

                                     
Query: 274    gggttggtggcgccaatgatctt 296
              |||||||| || |||||||||||
Sbjct: 136564 gggttggtagctccaatgatctt 136542

---

>emb|AL117386.1|ATT30A10 Arabidopsis thaliana DNA chromosome 4, BAC clone T30A10 (ESSA project)
          Length = 83369

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                         
Query: 154   tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 213
             ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 69413 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 69354

                                                                         
Query: 214   acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 273
             || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 69353 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 69294

                                    
Query: 274   gggttggtggcgccaatgatctt 296
             |||||||| || |||||||||||
Sbjct: 69293 gggttggtagctccaatgatctt 69271

---

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 233     cggcgaagtcaccacggatggtgccgg 259
               ||||||||||| |||||||||||||||
Sbjct: 5713180 cggcgaagtcagcacggatggtgccgg 5713206

---

>gb|AY072518.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 475

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 154 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 213
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 380 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 321

                                                                       
Query: 214 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 273
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 320 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 261

                                  
Query: 274 gggttggtggcgccaatgatctt 296
           |||||||| || |||||||||||
Sbjct: 260 gggttggtagctccaatgatctt 238

---

>dbj|AB071599.1| Brassica rapa Bc-NDPK1 mRNA for nucleoside diphosphate kinase 1,
           complete cds
          Length = 640

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 188 tctcaactgagtcgcttccatggatgacattcctgccgatgtc 230
           |||| ||||||||||| |||||||| || |||||||| |||||
Sbjct: 388 tctccactgagtcgctcccatggatcacgttcctgccaatgtc 346

---

>emb|AL116259.1|CNS01D1N Botrytis cinerea strain T4 cDNA library
          Length = 650

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 367 acgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 417
           ||||| ||||||||||| || |||  ||| ||||| |||||||||||||||
Sbjct: 284 acgagaccagcgaagaatggcttgtcggagagatcagcgtagtgctgctcg 234



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 229 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 284
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 422 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 367

---

>emb|AL116136.1|CNS01CY8 Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 367 acgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 417
           ||||| ||||||||||| || |||  ||| ||||| |||||||||||||||
Sbjct: 238 acgagaccagcgaagaatggcttgtcggagagatcagcgtagtgctgctcg 188



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 229 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 284
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 376 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 321

---

>emb|AL115859.1|CNS01CQJ Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 367 acgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 417
           ||||| ||||||||||| || |||  ||| ||||| |||||||||||||||
Sbjct: 226 acgagaccagcgaagaatggcttgtcggagagatcagcgtagtgctgctcg 176



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 229 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 284
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 364 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 309

---

>emb|AL115323.1|CNS01CBN Botrytis cinerea strain T4 cDNA library
          Length = 696

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 367 acgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 417
           ||||| ||||||||||| || |||  ||| ||||| |||||||||||||||
Sbjct: 252 acgagaccagcgaagaatggcttgtcggagagatcagcgtagtgctgctcg 202



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 229 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 284
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 390 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 335

---

>emb|AL114869.1|CNS01BZ1 Botrytis cinerea strain T4 cDNA library
          Length = 650

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 367 acgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 417
           ||||| ||||||||||| || |||  ||| ||||| |||||||||||||||
Sbjct: 270 acgagaccagcgaagaatggcttgtcggagagatcagcgtagtgctgctcg 220



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 229 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 284
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 408 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 353

---

>emb|AL114309.1|CNS01BJH Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 367 acgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 417
           ||||| ||||||||||| || |||  ||| ||||| |||||||||||||||
Sbjct: 256 acgagaccagcgaagaatggcttgtcggagagatcagcgtagtgctgctcg 206



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 229 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 284
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 394 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 339

---

>emb|AL111481.1|CNS019CX Botrytis cinerea strain T4 cDNA library
          Length = 576

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 367 acgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 417
           ||||| ||||||||||| || |||  ||| ||||| |||||||||||||||
Sbjct: 242 acgagaccagcgaagaatggcttgtcggagagatcagcgtagtgctgctcg 192



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 229 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 284
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 380 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 325

---

>gb|AF370529.1|AF370529 Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 528

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 154 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 213
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 391 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 332

                                                                       
Query: 214 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 273
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 331 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 272

                                  
Query: 274 gggttggtggcgccaatgatctt 296
           |||||||| || |||||||||||
Sbjct: 271 gggttggtagctccaatgatctt 249

---

>emb|BX827107.1|CNS0A38G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZE03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 518

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 154 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 213
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 393 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 334

                                                                       
Query: 214 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 273
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 333 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 274

                                  
Query: 274 gggttggtggcgccaatgatctt 296
           |||||||| || |||||||||||
Sbjct: 273 gggttggtagctccaatgatctt 251

---

>emb|BX829087.1|CNS0A2O7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL69ZH05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 593

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 154 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 213
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 393 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 334

                                                                       
Query: 214 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 273
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 333 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 274

                                  
Query: 274 gggttggtggcgccaatgatctt 296
           |||||||| || |||||||||||
Sbjct: 273 gggttggtagctccaatgatctt 251

---

>gb|AY962601.1| Nicotiana tabacum nucleoside diphosphate kinase mRNA, complete cds
          Length = 704

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 101/127 (79%)
 Strand = Plus / Minus

                                                                       
Query: 128 ggctgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcat 187
           ||||||||  |||||| ||||  || || |||||||| || || || |||||||| ||| 
Sbjct: 480 ggctgctctgccactctgcaactccttcggggaaccaaagagcaatttccttccttgcac 421

                                                                       
Query: 188 tctcaactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccac 247
           |||||||||  || |||||||| || || |||||||| ||||| |  ||  | |||||||
Sbjct: 420 tctcaactgcatcacttccatgaataacgttcctgccaatgtcaatagcataatcaccac 361

                  
Query: 248 ggatggt 254
           |||||||
Sbjct: 360 ggatggt 354

---

>dbj|AB121070.1| Natronomonas pharaonis ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 420

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 236 cgaagtcaccacggatggtgccgggctcgga 266
           |||||||||| ||||||||||||||| ||||
Sbjct: 313 cgaagtcaccgcggatggtgccgggcgcgga 283

---

>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome
          Length = 2595221

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 236     cgaagtcaccacggatggtgccgggctcgga 266
               |||||||||| ||||||||||||||| ||||
Sbjct: 1771041 cgaagtcaccgcggatggtgccgggcgcgga 1771011

---

>gb|AF069544.1|AF069544 Mycobacterium smegmatis nucleoside diphosphate kinase (ndk) gene,
           complete cds
          Length = 608

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 234 ggcgaagtcaccacggatggtgccggg 260
           |||||||||||| ||||||||||||||
Sbjct: 464 ggcgaagtcaccgcggatggtgccggg 438

---

>gb|AF017641.1|AF017641 Arabidopsis thaliana nucleoside diphosphate kinase type 1 (NDPK1)
           gene, complete cds
          Length = 450

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 154 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 213
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 398 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 339

                                                                       
Query: 214 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 273
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 338 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 279

                                  
Query: 274 gggttggtggcgccaatgatctt 296
           |||||||| || |||||||||||
Sbjct: 278 gggttggtagctccaatgatctt 256

---

>dbj|AB072238.1| Brassica rapa mRNA for NDPK I, complete cds
          Length = 628

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 188 tctcaactgagtcgcttccatggatgacattcctgccgatgtc 230
           |||| ||||||||||| |||||||| || |||||||| |||||
Sbjct: 394 tctccactgagtcgctcccatggatcacgttcctgccaatgtc 352

---

>gb|BT019474.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|BT019438.1| Homo sapiens non-metastatic cells 4, protein expressed in mRNA,
           complete cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|BT019437.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|BT019436.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|BT019435.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|BC004880.2| Homo sapiens non-metastatic cells 4, protein expressed in, mRNA
           (cDNA clone MGC:11088 IMAGE:3830205), complete cds
          Length = 1045

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 466 tggatgacattcctgctgatgtggacgctgaagtcacc 429

---

>ref|NM_005009.2| Homo sapiens non-metastatic cells 4, protein expressed in (NME4),
           mRNA
          Length = 1059

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 483 tggatgacattcctgctgatgtggacgctgaagtcacc 446

---

>ref|XM_824577.1| Trypanosoma brucei TREU927 nucleoside diphosphate kinase
           (Tb11.01.7800) partial mRNA
          Length = 462

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 232 acggcgaagtcaccacggatggtgcc 257
           ||||||||||||||||| ||||||||
Sbjct: 326 acggcgaagtcaccacgaatggtgcc 301

---

>ref|XM_809769.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053503697.100) partial mRNA
          Length = 5331

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 224  cgatgtcgacggcgaagtcacc 245
            ||||||||||||||||||||||
Sbjct: 3261 cgatgtcgacggcgaagtcacc 3240

---

>ref|XM_814613.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053504105.200) partial mRNA
          Length = 5334

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 224  cgatgtcgacggcgaagtcacc 245
            ||||||||||||||||||||||
Sbjct: 3261 cgatgtcgacggcgaagtcacc 3240

---

>emb|BX049071.1|CNS09A0Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 324

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 321 gccctcccagaccatagcgacgaccgggccggag 354
           ||||||||||||||| |  |||||||||||||||
Sbjct: 309 gccctcccagaccatcggcacgaccgggccggag 276

---

>emb|CR857184.1| Pongo pygmaeus mRNA; cDNA DKFZp468E0516 (from clone DKFZp468E0516)
          Length = 696

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 322 ccctcccagaccatagcgacgaccgggccggagacgatgtactccacgagcccagcgaag 381
           |||||||||||||| || |||||||| || |||   ||||||| ||| ||||||| ||||
Sbjct: 314 ccctcccagaccatggccacgaccggccctgagttcatgtacttcaccagcccagggaag 255

             
Query: 382 aa 383
           ||
Sbjct: 254 aa 253

---

>emb|CR621504.1| full-length cDNA clone CS0DC014YN11 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 600

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 182 tggatgacattcctgctgatgtggacgctgaagtcacc 145

---

>emb|CR613066.1| full-length cDNA clone CS0DF035YK02 of Fetal brain of Homo sapiens
           (human)
          Length = 873

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 353 tggatgacattcctgctgatgtggacgctgaagtcacc 316

---

>dbj|AK094439.1| Homo sapiens cDNA FLJ37120 fis, clone BRACE2022389, highly similar to
            NUCLEOSIDE DIPHOSPHATE KINASE, MITOCHONDRIAL PRECURSOR
            (EC 2.7.4.6)
          Length = 1861

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 208  tggatgacattcctgccgatgtcgacggcgaagtcacc 245
            |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 1342 tggatgacattcctgctgatgtggacgctgaagtcacc 1305

---

>emb|CR597313.1| full-length cDNA clone CS0DC018YA06 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 879

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 467 tggatgacattcctgctgatgtggacgctgaagtcacc 430

---

>emb|CR595773.1| full-length cDNA clone CS0DC003YM19 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1082

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 566 tggatgacattcctgctgatgtggacgctgaagtcacc 529

---

>emb|CR592051.1| full-length cDNA clone CS0DF021YM10 of Fetal brain of Homo sapiens
            (human)
          Length = 1652

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 208  tggatgacattcctgccgatgtcgacggcgaagtcacc 245
            |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 1249 tggatgacattcctgctgatgtggacgctgaagtcacc 1212

---

>gb|AF295650.1| Beta vulgaris nucleotide diphosphate kinase (ndk) gene, partial cds
          Length = 806

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 219 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 278
           |||||| ||||| | ||| || || ||||||||||| || ||||| || || || |||||
Sbjct: 126 cctgccaatgtcaatggcaaaatcgccacggatggtaccaggctcagaagcaagagggtt 67

                             
Query: 279 ggtggcgccaatgatctt 296
           |||||| || ||||||||
Sbjct: 66  ggtggctccgatgatctt 49

---

>ref|NR_001577.1| Homo sapiens non-metastatic cells 2, protein (NM23B) expressed in,
           pseudogene 1 (NME2P1) on chromosome 12
          Length = 693

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 322 ccctcccagaccatagcgacgaccgggccggagacgatgtactccacgagcccagcgaag 381
           |||||||||||||| || |||||||| || |||   ||||||| ||| ||||||| ||||
Sbjct: 360 ccctcccagaccatggccacgaccggccctgagttcatgtacttcaccagcccagggaag 301

             
Query: 382 aa 383
           ||
Sbjct: 300 aa 299

---

>gb|DQ066341.1| Ixodes scapularis isolate IS-6-12-J-cluster-432
           nucleoside-diphosphate kinase mRNA, partial cds
          Length = 513

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 462 gaagcccttcttctcgaagcggctga 487
           |||||| |||||||||||||||||||
Sbjct: 150 gaagccgttcttctcgaagcggctga 125

---

>gb|AY335611.1| Synthetic construct Homo sapiens non-metastatic cells
           nucleoside-diphosphate kinase 6 (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>dbj|AB232529.1| Haloarcula quadrata ndk gene for nucleoside diphosphate kinase,
           complete cds, strain:JCM 11048
          Length = 689

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 239 agtcaccacggatggtgccggg 260
           ||||||||||||||||||||||
Sbjct: 440 agtcaccacggatggtgccggg 419

---

>dbj|AB232528.1| Haloarcula sinaiiensis ndk gene for nucleoside diphosphate kinase,
           complete cds, strain:ATCC 33800
          Length = 689

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 239 agtcaccacggatggtgccggg 260
           ||||||||||||||||||||||
Sbjct: 440 agtcaccacggatggtgccggg 419

---

>gb|U85976.1|HSU85976 Human nucleoside diphosphate kinase (NDK) pseudogene, partial cds
          Length = 770

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 322 ccctcccagaccatagcgacgaccgggccggagacgatgtactccacgagcccagcgaag 381
           |||||||||||||| || |||||||| || |||   ||||||| ||| ||||||| ||||
Sbjct: 413 ccctcccagaccatggccacgaccggccctgagttcatgtacttcaccagcccagggaag 354

             
Query: 382 aa 383
           ||
Sbjct: 353 aa 352

---

>gb|AF164200.1|AF164200 Trypanosoma brucei putative DNA replication protein CDC47 (CDC47) and
            nucleoside diphosphate kinase (NDPK) genes, complete cds
          Length = 3852

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 232  acggcgaagtcaccacggatggtgcc 257
            ||||||||||||||||| ||||||||
Sbjct: 3427 acggcgaagtcaccacgaatggtgcc 3402

---

>gb|AY888350.1| Synthetic construct Homo sapiens clone FLH008002.01X non-metastatic
           cells 4 protein (NME4) mRNA, complete cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|AY888349.1| Synthetic construct Homo sapiens clone FLH008001.01X non-metastatic
           cells 4 protein (NME4) mRNA, complete cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|AY890948.1| Synthetic construct Homo sapiens clone FLH008000.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|AY890947.1| Synthetic construct Homo sapiens clone FLH007999.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|AY890946.1| Synthetic construct Homo sapiens clone FLH007998.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|AY890945.1| Synthetic construct Homo sapiens clone FLH007997.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>dbj|AB126343.1| Haloarcula sinaiiensis ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 591

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 239 agtcaccacggatggtgccggg 260
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289

---

>dbj|AB126342.1| Haloarcula quadrata ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 590

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 239 agtcaccacggatggtgccggg 260
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289

---

>dbj|AB126339.1| Haloarcula californiae ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 590

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 239 agtcaccacggatggtgccggg 260
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289

---

>dbj|AB121064.1| Haloarcula sinaiiensis ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 423

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 239 agtcaccacggatggtgccggg 260
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289

---

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 239   agtcaccacggatggtgccggg 260
             ||||||||||||||||||||||
Sbjct: 89088 agtcaccacggatggtgccggg 89067

---

>gb|AC004263.1|AC004263 Homo sapiens PAC clone 278C19 from 12q, complete sequence
          Length = 106921

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                         
Query: 322   ccctcccagaccatagcgacgaccgggccggagacgatgtactccacgagcccagcgaag 381
             |||||||||||||| || |||||||| || |||   ||||||| ||| ||||||| ||||
Sbjct: 90215 ccctcccagaccatggccacgaccggccctgagttcatgtacttcaccagcccagggaag 90156

               
Query: 382   aa 383
             ||
Sbjct: 90155 aa 90154

---

>gb|AF086133.1|HUMZA87H07 Homo sapiens full length insert cDNA clone ZA87H07
          Length = 714

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 181 tggatgacattcctgctgatgtggacgctgaagtcacc 144

---

>gb|BC017067.1| Homo sapiens non-metastatic cells 4, protein expressed in, mRNA
           (cDNA clone MGC:9630 IMAGE:3913604), complete cds
          Length = 973

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 483 tggatgacattcctgctgatgtggacgctgaagtcacc 446

---

>emb|CT033698.1| Platynereis dumerilii EST IB0AAA15DD08EM1
          Length = 831

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 159 gaaccagagggcgatctccttc 180
           ||||||||||||||||||||||
Sbjct: 483 gaaccagagggcgatctccttc 462

---

>emb|CT032612.1| Platynereis dumerilii EST IB0AAA35BD04EM1
          Length = 853

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 159 gaaccagagggcgatctccttc 180
           ||||||||||||||||||||||
Sbjct: 480 gaaccagagggcgatctccttc 459

---

>emb|CT032450.1| Platynereis dumerilii EST IB0AAA38AD09EM1
          Length = 851

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 159 gaaccagagggcgatctccttc 180
           ||||||||||||||||||||||
Sbjct: 470 gaaccagagggcgatctccttc 449

---

>emb|Y07604.1|HSNM23H4 H.sapiens mRNA for nucleoside-diphosphate kinase
          Length = 879

 Score = 44.1 bits (22), Expect = 0.44
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 208 tggatgacattcctgccgatgtcgacggcgaagtcacc 245
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 463 tggatgacattcctgctgatgtggacgctgaagtcacc 426

---

>gb|AC119951.12| Mus musculus chromosome 9, clone RP24-448C4, complete sequence
          Length = 215131

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 201    gcttccatggatgacattcct 221
              |||||||||||||||||||||
Sbjct: 175569 gcttccatggatgacattcct 175589

---

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 235     gcgaagtcaccacggatggtgccgg 259
               ||||||||| |||||||||||||||
Sbjct: 1400267 gcgaagtcagcacggatggtgccgg 1400243

---

>gb|AC120386.12| Mus musculus chromosome 9, clone RP24-294A16, complete sequence
          Length = 207310

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 201    gcttccatggatgacattcct 221
              |||||||||||||||||||||
Sbjct: 205795 gcttccatggatgacattcct 205775

---

>emb|AL583826.16| Human DNA sequence from clone RP11-434B7 on chromosome 1 Contains the
             3' end of the RPS6KC1 gene for ribosomal protein S6 kinase
             52kDa polypeptide 1, complete sequence
          Length = 122208

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 118   cagttgtgctggctgctcctc 138
             |||||||||||||||||||||
Sbjct: 42834 cagttgtgctggctgctcctc 42854

---

>emb|AL355483.14| Human DNA sequence from clone RP4-784A16 on chromosome 1 Contains the
             3' end of the LRP8 gene for low density lipoprotein
             receptor-related protein 8 apolipoprotein e receptor, five
             novel genes and a CpG island, complete sequence
          Length = 80255

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 375   agcgaagaagggtttggaggacaga 399
             |||||||| ||||||||||||||||
Sbjct: 49839 agcgaagatgggtttggaggacaga 49863

---

>ref|XM_780229.1| PREDICTED: Strongylocentrotus purpuratus similar to Nucleoside
           diphosphate kinase A (NDK A) (NDP kinase A) (Tumor
           metastatic process-associated protein) (Metastasis
           inhibition factor nm23) (nm23-H1) (Granzyme A-activated
           DNase) (GAAD) (LOC580157), mRNA
          Length = 537

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 225 gatgtcgacggcgaagtcaccacggatggtgcc 257
           ||||||||| | | |||||||||||||||||||
Sbjct: 408 gatgtcgacagagtagtcaccacggatggtgcc 376

---

>emb|X13107.1|DMAWDR Drosophila melanogaster awd mRNA ( abnormal wing disc )
          Length = 573

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 237 gaagtcaccacggatggtgccgggc 261
           ||||||||| |||||||||||||||
Sbjct: 352 gaagtcaccgcggatggtgccgggc 328

---

>gb|AY113576.1| Drosophila melanogaster RH27794 full insert cDNA
          Length = 650

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 237 gaagtcaccacggatggtgccgggc 261
           ||||||||| |||||||||||||||
Sbjct: 413 gaagtcaccgcggatggtgccgggc 389

---

>ref|NM_057413.3| Drosophila melanogaster abnormal wing discs CG2210-RA (awd), mRNA
          Length = 683

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 237 gaagtcaccacggatggtgccgggc 261
           ||||||||| |||||||||||||||
Sbjct: 462 gaagtcaccgcggatggtgccgggc 438

---

>gb|AY585937.1| Paxillus involutus strain ATCC 200175 nucleoside diphosphate kinase
           (ndkA) mRNA, complete cds
          Length = 591

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 157 gggaaccagagggcgatctccttcctggcattctcaactgagtcg 201
           |||||||| |||||||||||||||  ||| ||||| || ||||||
Sbjct: 455 gggaaccaaagggcgatctccttctcggcgttctcgacggagtcg 411

---

>gb|AC007469.7|AC007469 Drosophila melanogaster, chromosome 3R, region 100D1-100F2, BAC clone
              BACR48C22, complete sequence
          Length = 181446

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 237    gaagtcaccacggatggtgccgggc 261
              ||||||||| |||||||||||||||
Sbjct: 115598 gaagtcaccgcggatggtgccgggc 115622

---

>gb|AE003779.2| Drosophila melanogaster chromosome 3R, section 117 of 118 of the complete
              sequence
          Length = 232050

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 237    gaagtcaccacggatggtgccgggc 261
              ||||||||| |||||||||||||||
Sbjct: 154870 gaagtcaccgcggatggtgccgggc 154894

---

>emb|AL845442.7| Mouse DNA sequence from clone RP23-392D9 on chromosome 2, complete
             sequence
          Length = 192013

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 379   aagaagggtttggaggacaga 399
             |||||||||||||||||||||
Sbjct: 53685 aagaagggtttggaggacaga 53705

---

>gb|J05207.1|MXANDK M.xanthus nucleoside 5'-diphosphate phosphotransferase (ndk) gene,
           complete cds
          Length = 789

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 466 cccttcttctcgaagcggctgatga 490
           ||||||| |||||||||||||||||
Sbjct: 179 cccttctcctcgaagcggctgatga 155

---

>gb|CP000097.1| Synechococcus sp. CC9902, complete genome
          Length = 2234828

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 244     ccacggatggtgccgggctc 263
               ||||||||||||||||||||
Sbjct: 2073845 ccacggatggtgccgggctc 2073864

---

>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome
          Length = 2560265

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 482    ggctgatgacctcgccgatg 501
              ||||||||||||||||||||
Sbjct: 630613 ggctgatgacctcgccgatg 630632

---

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 337     gcgacgaccgggccggagac 356
               ||||||||||||||||||||
Sbjct: 4819297 gcgacgaccgggccggagac 4819278

---

>gb|AC126023.3| Mus musculus BAC clone RP24-422I18 from chromosome 16, complete
             sequence
          Length = 198296

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 128   ggctgctcctccactcagca 147
             ||||||||||||||||||||
Sbjct: 12027 ggctgctcctccactcagca 12008

---

>gb|AC130843.3| Mus musculus BAC clone RP24-501N9 from chromosome 1, complete sequence
          Length = 141921

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 19    aatacaaatctcaaaactgt 38
             ||||||||||||||||||||
Sbjct: 50683 aatacaaatctcaaaactgt 50702

---

>ref|XM_753334.1| Ustilago maydis 521 hypothetical protein (UM02280.1) partial mRNA
          Length = 2751

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 294  cttgcgtccagtggcgacgacgctcttg 321
            ||||||||||| ||||||| ||||||||
Sbjct: 1372 cttgcgtccaggggcgacgccgctcttg 1399

---

>emb|CT025688.6| Mouse DNA sequence from clone RP24-310A8 on chromosome 9, complete
              sequence
          Length = 233365

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 17     gaaatacaaatctcaaaactgtaa 40
              |||||||||||||||| |||||||
Sbjct: 161004 gaaatacaaatctcaatactgtaa 161027

---

>gb|AC122026.3| Mus musculus BAC clone RP24-390D21 from chromosome 1, complete sequence
          Length = 205642

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 206    catggatgacattcctgccgatgt 229
              |||||||||||||||||| |||||
Sbjct: 161801 catggatgacattcctgctgatgt 161778

---

>gb|AC113272.11| Mus musculus chromosome 1, clone RP23-379C24, complete sequence
          Length = 170622

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 19   aatacaaatctcaaaactgt 38
            ||||||||||||||||||||
Sbjct: 5137 aatacaaatctcaaaactgt 5118

---

>emb|BX248409.5| Human DNA sequence from clone RP11-360D2 on chromosome 1 Contains the 5'
              end of a novel gene (FLJ45235), a novel gene, the 5' end of
              the gene for Kelch motif containing protein, a ribosomal
              protein S27 (metallopanstimulin 1)  (RPS27) pseudogene and
              a CpG island, complete sequence
          Length = 127227

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 18     aaatacaaatctcaaaactgtaaa 41
              |||||||||||||||||| |||||
Sbjct: 118372 aaatacaaatctcaaaacagtaaa 118349

---

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 337     gcgacgaccgggccggagacgatg 360
               ||||||||| ||||||||||||||
Sbjct: 2890968 gcgacgacccggccggagacgatg 2890991

---

>emb|AL109921.21|HSDJ383J4 Human DNA sequence from clone RP3-383J4 on chromosome 1q24.1-24.3
             Contains two genes for novel proteins (FLJ10514) and two
             CpG islands, complete sequence
          Length = 133936

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 18    aaatacaaatctcaaaactgtaaa 41
             |||||||||||||||||| |||||
Sbjct: 24849 aaatacaaatctcaaaacagtaaa 24826

---

>emb|AL110114.1|HSJ868P24 Human DNA sequence from clone RP5-868P24 on chromosome 20 Contains STSs
             and GSSs, complete sequence
          Length = 78371

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 165   gagggcgatctccttcctggcatt 188
             |||| |||||||||||||||||||
Sbjct: 53754 gaggccgatctccttcctggcatt 53731

---

>emb|BX033272.1|CNS08XU4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 292

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 244 ccacggatggtgccgggctc 263
           ||||||||||||||||||||
Sbjct: 20  ccacggatggtgccgggctc 1

---

>emb|BX018154.1|CNS08M66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 213

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                       
Query: 244 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 287
           ||||||||||||||| |||||||| |    ||||||||||||||
Sbjct: 139 ccacggatggtgccgagctcggagtcggccgggttggtggcgcc 182

---

>emb|CR555306.1| Azoarcus sp. EbN1 complete genome
          Length = 4296230

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 337     gcgacgaccgggccggagacgatg 360
               ||||||||| ||||||||||||||
Sbjct: 4238765 gcgacgacccggccggagacgatg 4238788

---

>emb|BX323072.9| Zebrafish DNA sequence from clone CH211-271G18, complete sequence
          Length = 131030

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 129   gctgctcctccactcagcaa 148
             ||||||||||||||||||||
Sbjct: 81587 gctgctcctccactcagcaa 81568

---

>emb|BX537282.9| Zebrafish DNA sequence from clone DKEY-90A24 in linkage group 5,
             complete sequence
          Length = 124378

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 18    aaatacaaatctcaaaactg 37
             ||||||||||||||||||||
Sbjct: 23939 aaatacaaatctcaaaactg 23920

---

>gb|AC161475.6| Pan troglodytes BAC clone CH251-252J1 from chromosome unknown, complete
             sequence
          Length = 177925

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 385   ggtttggaggacagatcggc 404
             ||||||||||||||||||||
Sbjct: 55005 ggtttggaggacagatcggc 55024

---

>gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome
          Length = 3052398

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 400    tcggcgtagtgctgctcggc 419
              ||||||||||||||||||||
Sbjct: 799691 tcggcgtagtgctgctcggc 799710

---

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 223     ccgatgtcgacggcgaagtc 242
               ||||||||||||||||||||
Sbjct: 7419314 ccgatgtcgacggcgaagtc 7419295

---

>gb|AY107446.1| Zea mays PCO061918 mRNA sequence
          Length = 529

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 350 cggagacgatgtactccacg 369
           ||||||||||||||||||||
Sbjct: 427 cggagacgatgtactccacg 408

---

>dbj|AP001891.4| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-356E17, complete
             sequence
          Length = 210691

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 385   ggtttggaggacagatcggc 404
             ||||||||||||||||||||
Sbjct: 21518 ggtttggaggacagatcggc 21537

---

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 350     cggagacgatgtactccacg 369
               ||||||||||||||||||||
Sbjct: 2569365 cggagacgatgtactccacg 2569346

---

>gb|AC004663.1|AC004663 Homo sapiens chromosome 19, cosmid R29783, complete sequence
          Length = 41150

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 150   gccctcagggaaccagaggg 169
             ||||||||||||||||||||
Sbjct: 13565 gccctcagggaaccagaggg 13584

---

>gb|AF058895.1|HSNTCH15 Homo sapiens Notch3 (NOTCH3) gene, exons 26, 27, and 28
          Length = 840

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 150 gccctcagggaaccagaggg 169
           ||||||||||||||||||||
Sbjct: 468 gccctcagggaaccagaggg 449

---

>gb|U97669.1|HSU97669 Homo sapiens Notch3 (NOTCH3) mRNA, complete cds
          Length = 8091

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 150  gccctcagggaaccagaggg 169
            ||||||||||||||||||||
Sbjct: 5115 gccctcagggaaccagaggg 5096

---

>gb|AC139244.4| Mus musculus BAC clone RP23-324J8 from 16, complete sequence
          Length = 209201

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 128    ggctgctcctccactcagca 147
              ||||||||||||||||||||
Sbjct: 186624 ggctgctcctccactcagca 186605

---

>ref|NM_000435.1| Homo sapiens Notch homolog 3 (Drosophila) (NOTCH3), mRNA
          Length = 8091

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 150  gccctcagggaaccagaggg 169
            ||||||||||||||||||||
Sbjct: 5115 gccctcagggaaccagaggg 5096


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,479,715
Number of Sequences: 3902068
Number of extensions: 3479715
Number of successful extensions: 64064
Number of sequences better than 10.0: 224
Number of HSP's better than 10.0 without gapping: 221
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 62955
Number of HSP's gapped (non-prelim): 985
length of query: 505
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 483
effective length of database: 17,147,199,772
effective search space: 8282097489876
effective search space used: 8282097489876
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---