>gb|AC123040.4| Mus musculus BAC clone RP24-532L16 from chromosome 8, complete sequence
          Length = 171193

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 19    agaaacaacctaatcagatgcaa 41
             |||||||||||| ||||||||||
Sbjct: 50983 agaaacaacctattcagatgcaa 51005

>gb|AC018360.16| Homo sapiens 3 BAC RP11-67D16 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 179993

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 35    gatgcaaagtattattctt 53
             |||||||||||||||||||
Sbjct: 19605 gatgcaaagtattattctt 19587

>emb|AL732637.1| Human DNA sequence from clone RP11-537J24 on chromosome X, complete
             sequence
          Length = 39922

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 35    gatgcaaagtattattctt 53
             |||||||||||||||||||
Sbjct: 32796 gatgcaaagtattattctt 32778

>emb|AL713873.11| Human DNA sequence from clone RP11-10L1 on chromosome 1 Contains the 5'
             end of a novel gene, complete sequence
          Length = 101283

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 35    gatgcaaagtattattctt 53
             |||||||||||||||||||
Sbjct: 10621 gatgcaaagtattattctt 10639

>emb|AL009031.1|HS467D16 Human DNA sequence from clone RP3-467D16 on chromosome 6p22.3-24.1
             Contains the 5' end of the SCA1 gene for spinocerebellar
             ataxia 1 (olivopontocerebellar ataxia 1, autosomal
             dominant, ataxin 1) with a poly-glutamine (CAG repeat)
             polymorphism and the 3' part of the GMPR gene for GMP
             reductase, Guanosine 5'-monophosphate oxidoreductase,
             complete sequence
          Length = 143583

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 35    gatgcaaagtattattctt 53
             |||||||||||||||||||
Sbjct: 55540 gatgcaaagtattattctt 55522

>gb|AC090811.5| Homo sapiens chromosome 8, clone RP11-55J5, complete sequence
          Length = 176418

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 35   gatgcaaagtattattctt 53
            |||||||||||||||||||
Sbjct: 6924 gatgcaaagtattattctt 6942

>gb|AC024941.30|AC024941 Homo sapiens 12 BAC RP11-900F13 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 172246

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 37    tgcaaagtattattcttcc 55
             |||||||||||||||||||
Sbjct: 60021 tgcaaagtattattcttcc 60003

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 38      gcaaagtattattcttcct 56
               |||||||||||||||||||
Sbjct: 5939461 gcaaagtattattcttcct 5939479

>gb|AC097110.1| Homo sapiens BAC clone RP11-51P8 from 4, complete sequence
          Length = 153480

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 32    tcagatgcaaagtattatt 50
             |||||||||||||||||||
Sbjct: 68279 tcagatgcaaagtattatt 68261

>gb|AC098852.2| Homo sapiens BAC clone RP11-123E11 from 4, complete sequence
          Length = 193927

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 40    aaagtattattcttcctct 58
             |||||||||||||||||||
Sbjct: 36642 aaagtattattcttcctct 36660

>gb|AC104339.10| Homo sapiens chromosome 8, clone RP11-777J24, complete sequence
          Length = 194212

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 35     gatgcaaagtattattctt 53
              |||||||||||||||||||
Sbjct: 125767 gatgcaaagtattattctt 125785

>dbj|AP005915.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBb0056C19
          Length = 147739

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 38     gcaaagtattattcttcct 56
              |||||||||||||||||||
Sbjct: 117682 gcaaagtattattcttcct 117700

>dbj|AP005008.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0544H11
          Length = 178376

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 38     gcaaagtattattcttcct 56
              |||||||||||||||||||
Sbjct: 169263 gcaaagtattattcttcct 169281

>dbj|AP006278.1| Homo sapiens genomic DNA, chromosome 8q22.1, clone: KB1573B4, complete
              sequence
          Length = 157927

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 35     gatgcaaagtattattctt 53
              |||||||||||||||||||
Sbjct: 154541 gatgcaaagtattattctt 154523

>gb|AC002326.1|AC002326 Genomic sequence from Human 6, complete sequence
          Length = 148750

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 35    gatgcaaagtattattctt 53
             |||||||||||||||||||
Sbjct: 66341 gatgcaaagtattattctt 66323

>dbj|AP003112.1| Homo sapiens genomic DNA, chromosome 8q23, clone:KB1288E10
          Length = 144703

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 35    gatgcaaagtattattctt 53
             |||||||||||||||||||
Sbjct: 29614 gatgcaaagtattattctt 29596


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 564,074
Number of Sequences: 3902068
Number of extensions: 564074
Number of successful extensions: 35414
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35379
Number of HSP's gapped (non-prelim): 35
length of query: 132
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 111
effective length of database: 17,151,101,840
effective search space: 1903772304240
effective search space used: 1903772304240
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)