ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd19k02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_189916.1| Oryza sativa (japonica cultivar-group), predic... 178 1e-41
2dbj|AK071735.1| Oryza sativa (japonica cultivar-group) cDNA clon... 178 1e-41
3gb|AY110722.1| Zea mays CL6595_1 mRNA sequence 121 2e-24
4dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 88 3e-14
5dbj|AP003436.2| Oryza sativa (japonica cultivar-group) genomic D... 88 3e-14
6gb|AY105154.1| Zea mays PCO134624 mRNA sequence 48 0.025
7ref|XM_467497.1| Oryza sativa (japonica cultivar-group), mRNA 46 0.100
8gb|AY288198.2| Oryza sativa (japonica cultivar-group) Rac GDP-di... 46 0.100
9dbj|AK073093.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.100
10ref|NM_127306.2| Arabidopsis thaliana IRE1A; kinase AT2G17520 (I... 42 1.6
11gb|AC007584.4| Arabidopsis thaliana chromosome 2 clone MJB20 map... 42 1.6
12emb|BX511223.6| Zebrafish DNA sequence from clone DKEYP-96B6 in ... 42 1.6
13gb|AF308596.1|AF308596 Arabidopsis thaliana endoribonuclease/pro... 42 1.6
14dbj|AK222006.1| Arabidopsis thaliana mRNA for endoribonuclease/p... 42 1.6
15emb|BX819767.1|CNS0A8F2 Arabidopsis thaliana Full-length cDNA Co... 42 1.6
16emb|BX818884.1|CNS0A7ZK Arabidopsis thaliana Full-length cDNA Co... 42 1.6
17emb|AL928805.18| Mouse DNA sequence from clone RP23-291H20 on ch... 42 1.6
18dbj|AB049937.1| Arabidopsis thaliana mRNA for Ire1 homolog-2, co... 42 1.6
19emb|AL772308.4| Mouse DNA sequence from clone RP23-451I21 on chr... 42 1.6
20gb|AC133004.4| Oryza sativa (japonica cultivar-group) chromosome... 40 6.1
21ref|XM_958361.1| Neurospora crassa OR74A hypothetical protein ( ... 40 6.1
22ref|XM_325317.1| Neurospora crassa OR74A hypothetical protein ( ... 40 6.1
23gb|AY590560.1| Treponema pallidum subsp. endemicum isolate Iraq ... 40 6.1
24gb|AY532698.1| Treponema pallidum subsp. pallidum isolate Sea 81... 40 6.1
25gb|AY532697.1| Treponema pallidum subsp. pallidum isolate Mexico... 40 6.1
26gb|AY532696.1| Treponema pallidum subsp. pallidum isolate Sea 81... 40 6.1
27gb|AY532695.1| Treponema pallidum subsp. pallidum isolate Chicag... 40 6.1
28gb|AY532694.1| Treponema pallidum subsp. pallidum isolate Bal-7 ... 40 6.1
29gb|AY532693.1| Treponema pallidum subsp. pallidum isolate Bal-3 ... 40 6.1
30gb|AY550205.1| Treponema pallidum subsp. pallidum isolate Bal 73... 40 6.1
31gb|AY550204.1| Treponema pallidum subsp. pallidum isolate Bal-3 ... 40 6.1
32gb|AY550206.1| Treponema pallidum subsp. pertenue isolate Gauthi... 40 6.1
33gb|AY542157.1| Treponema pallidum subsp. pallidum isolate Sea 81... 40 6.1
34gb|AY542156.1| Treponema pallidum subsp. pallidum isolate Bal 73... 40 6.1
35gb|AY542155.1| Treponema pallidum subsp. pallidum isolate Chicag... 40 6.1
36gb|AY542154.1| Treponema pallidum subsp. pallidum isolate Mexico... 40 6.1
37gb|AY542153.1| Treponema pallidum subsp. pallidum isolate Sea 81... 40 6.1
38gb|AY536646.1| Treponema pallidum subsp. pallidum isolate Bal-7 ... 40 6.1
39gb|AY536645.1| Treponema pallidum subsp. pallidum isolate Bal 73... 40 6.1
40gb|AY533515.1| Treponema pallidum subsp. pallidum isolate Chicag... 40 6.1
41gb|AY533514.1| Treponema pallidum subsp. pallidum isolate Mexico... 40 6.1
42gb|AY533513.1| Treponema pallidum subsp. pallidum isolate Sea 81... 40 6.1
43gb|AY533512.1| Treponema pallidum subsp. pallidum isolate Sea 81... 40 6.1
44gb|AY533511.1| Treponema pallidum subsp. pallidum isolate Chicag... 40 6.1
45gb|AY533510.1| Treponema pallidum subsp. pallidum isolate Bal 73... 40 6.1
46gb|AY533509.1| Treponema pallidum subsp. pallidum isolate Bal-7 ... 40 6.1
47gb|AY533508.1| Treponema pallidum subsp. pallidum isolate Bal-3 ... 40 6.1
48ref|XM_824433.1| Trypanosoma brucei TREU927 phosphatidylinositol... 40 6.1
49ref|XM_765080.1| Giardia lamblia ATCC 50803 hypothetical protein... 40 6.1
50gb|AY364312.1| Oryza sativa (japonica cultivar-group) Rho GDP di... 40 6.1
51gb|AY158568.1| Treponema pallidum clone 5C-J TprJ (tprJ) gene, p... 40 6.1
52gb|AY158567.1| Treponema pallidum clone 5B-J TprJ (tprJ) gene, p... 40 6.1
53gb|AY158566.1| Treponema pallidum clone 5A-J TprJ (tprJ) gene, p... 40 6.1
54gb|AY158565.1| Treponema pallidum clone 11C-J TprJ (tprJ) gene, ... 40 6.1
55gb|AY158564.1| Treponema pallidum clone 11B-J TprJ (tprJ) gene, ... 40 6.1
56gb|AY158563.1| Treponema pallidum clone 11A-J TprJ (tprJ) gene, ... 40 6.1
57gb|AY158562.1| Treponema pallidum clone 8C-J TprJ (tprJ) gene, p... 40 6.1
58gb|AY158561.1| Treponema pallidum clone 8B-J TprJ (tprJ) gene, p... 40 6.1
59gb|AY158560.1| Treponema pallidum clone 8A-J TprJ (tprJ) gene, p... 40 6.1
60gb|AY158559.1| Treponema pallidum clone 7C-J TprJ (tprJ) gene, p... 40 6.1
61gb|AY158558.1| Treponema pallidum clone 7B-J TprJ (tprJ) gene, p... 40 6.1
62gb|AY158557.1| Treponema pallidum clone 7A-J TprJ (tprJ) gene, p... 40 6.1
63gb|AY158556.1| Treponema pallidum clone 4C-J TprJ (tprJ) gene, p... 40 6.1
64gb|AY158555.1| Treponema pallidum clone 4B-J TprJ (tprJ) gene, p... 40 6.1
65gb|AY158554.1| Treponema pallidum clone 4A-J TprJ (tprJ) gene, p... 40 6.1
66gb|AY158553.1| Treponema pallidum clone 2C-J TprJ (tprJ) gene, p... 40 6.1
67gb|AY158552.1| Treponema pallidum clone 2B-J TprJ (tprJ) gene, p... 40 6.1
68gb|AY158551.1| Treponema pallidum clone 2A-J TprJ (tprJ) gene, p... 40 6.1
69gb|AY158550.1| Treponema pallidum clone 10B-J TprJ (tprJ) gene, ... 40 6.1
70gb|AY158549.1| Treponema pallidum clone 10A-J TprJ (tprJ) gene, ... 40 6.1
71gb|AY158548.1| Treponema pallidum clone 10C-J TprJ (tprJ) gene, ... 40 6.1
72gb|AY158547.1| Treponema pallidum clone 9B-J TprJ (tprJ) gene, p... 40 6.1
73gb|AY158546.1| Treponema pallidum clone 9A-J TprJ (tprJ) gene, p... 40 6.1
74gb|AY158545.1| Treponema pallidum clone 9C-J TprJ (tprJ) gene, p... 40 6.1
75gb|AY158544.1| Treponema pallidum clone 6C-J TprJ (tprJ) gene, p... 40 6.1
76gb|AY158543.1| Treponema pallidum clone 6B-J TprJ (tprJ) gene, p... 40 6.1
77gb|AY158541.1| Treponema pallidum clone 3C-J TprJ (tprJ) gene, p... 40 6.1
78gb|AY158540.1| Treponema pallidum clone 3B-J TprJ (tprJ) gene, p... 40 6.1
79gb|AY158539.1| Treponema pallidum clone 3A-J TprJ (tprJ) gene, p... 40 6.1
80gb|AY158538.1| Treponema pallidum clone 1C-J TprJ (tprJ) gene, p... 40 6.1
81gb|AY158537.1| Treponema pallidum clone 1B-J TprJ (tprJ) gene, p... 40 6.1
82gb|AY158536.1| Treponema pallidum clone 1A-J TprJ (tprJ) gene, p... 40 6.1
83emb|CR387929.4| Zebrafish DNA sequence from clone DKEY-172H18 in... 40 6.1
84gb|AF334830.1| Homo sapiens cartilage-hair hypoplasia region gen... 40 6.1
85emb|BX511101.3| Zebrafish DNA sequence from clone DKEYP-92F1 in ... 40 6.1
86dbj|AK040321.1| Mus musculus 0 day neonate thymus cDNA, RIKEN fu... 40 6.1
87emb|AL928617.13| Mouse DNA sequence from clone RP23-326E21 on ch... 40 6.1
88dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.1
89dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 6.1
90gb|AF261077.1|AF261077 Treponema pallidum strain SS14 clone 3 Tp... 40 6.1
91gb|AF261075.1|AF261075 Treponema pallidum strain SS14 clone 1 Tp... 40 6.1
92gb|AC112187.2| Homo sapiens chromosome 5 clone RP11-269M20, comp... 40 6.1
93gb|AF217541.1|AF217541 Treponema pallidum subsp. pallidum strain... 40 6.1
94gb|AF217540.1|AF217540 Treponema pallidum subsp. pallidum strain... 40 6.1
95gb|AF217539.1|AF217539 Treponema pallidum subsp. pallidum strain... 40 6.1
96gb|AF217538.1|AF217538 Treponema pallidum subsp. pertenue TprD3 ... 40 6.1
97gb|AF217537.1|AF217537 Treponema pallidum subsp. pallidum strain... 40 6.1
98gb|AF187953.1|AF187953 Treponema pallidum subsp. pallidum isolat... 40 6.1
99gb|AF187952.1|AF187952 Treponema pallidum subsp. pallidum isolat... 40 6.1
100dbj|AP003543.3| Oryza sativa (japonica cultivar-group) genomic D... 40 6.1
101dbj|AP003507.2| Oryza sativa (japonica cultivar-group) genomic D... 40 6.1
102dbj|AK065671.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.1
103dbj|AK060873.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 6.1
104emb|CR790363.24| Zebrafish DNA sequence from clone DKEY-175D9 in... 40 6.1
105emb|CT573072.1| Kuenenia stuttgartiensis genome fragment KUST_D ... 40 6.1
106gb|AC154388.4| Mus musculus BAC clone RP23-14P7 from chromosome ... 40 6.1
107emb|AL389899.1|NCB7J19 Neurospora crassa DNA linkage group II BA... 40 6.1
108gb|AY685240.1| Treponema paraluiscuniculi nonfunctional TprG2 ge... 40 6.1
109gb|AY685239.1| Treponema paraluiscuniculi nonfunctional TprG1 ge... 40 6.1
110gb|AY685238.1| Treponema paraluiscuniculi nonfunctional TprG and... 40 6.1
111gb|AY685237.1| Treponema paraluiscuniculi nonfunctional TprD gen... 40 6.1
112gb|AY685236.1| Treponema paraluiscuniculi nonfunctional TprC gen... 40 6.1
113emb|CT030647.17| Mouse DNA sequence from clone RP23-379I9 on chr... 40 6.1
114gb|AF073527.1|AF073527 Treponema pallidum subsp. pertenue tprJ g... 40 6.1
115gb|U88957.1|TPU88957 Treponema pallidum major outer sheath prote... 40 6.1
116gb|AE000520.1| Treponema pallidum subsp. pallidum str. Nichols c... 40 6.1
117emb|AL832752.1|HSM804063 Homo sapiens mRNA; cDNA DKFZp686A0127 (... 40 6.1
118gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 6.1
119emb|AL133410.32| Human DNA sequence from clone RP11-112J3 on chr... 40 6.1
120gb|AC132945.3| Mus musculus BAC clone RP24-321A15 from 8, comple... 40 6.1
121gb|AF045437.1| Treponema pallidum clone 5 putative outer membran... 40 6.1
122gb|AF045436.1| Treponema pallidum clone 7 putative outer membran... 40 6.1
123gb|AF045435.1| Treponema pallidum clones 2, 3 and 8 putative out... 40 6.1
124gb|AF045434.1| Treponema pallidum clones 6 and 16 putative outer... 40 6.1
125gb|AF045433.1| Treponema pallidum clones 1, 2, 4, 5 and 7 putati... 40 6.1
126emb|AL831770.3| Human DNA sequence from clone RP13-297M11 on chr... 40 6.1

>ref|NM_189916.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 654

 Score =  178 bits (90), Expect = 1e-41
 Identities = 236/282 (83%), Gaps = 2/282 (0%)
 Strand = Plus / Minus

                                                                       
Query: 172 ggccagtccttcctgatctcaaagctgtacctcatgtccaggtacaccttcccatcatca 231
           ||||| |||||||| |||||||||  ||| ||||| |||| |||    || |||||||||
Sbjct: 641 ggccactccttcctaatctcaaagtagtaactcatctccaagtagcatttgccatcatca 582

                                                                       
Query: 232 tccacaaactttaatctagcagaataggagcccctcgcaaagatgcc-gctcggggtgct 290
           || |||||||||| | ||||||||||||| || || || || ||||| ||| |||||| |
Sbjct: 581 tcaacaaactttagtttagcagaataggaacctcttgcgaacatgccagct-ggggtggt 523

                                                                       
Query: 291 atcttcttcggccttgtacgtgtagggctcctgctgagggctgaatgtccccagcatcac 350
            || |||||  |||  || |||||||||||  |||| || ||||||||||||||||||||
Sbjct: 522 ctcctcttcaccctcatatgtgtagggctctagctggggactgaatgtccccagcatcac 463

                                                                       
Query: 351 cttctggttctccactcttactccggtcttccagacggtgtgcgagtacttgagaccgga 410
           |||||||||||| ||||||||||| ||||||||||| ||||  | ||||||||| || ||
Sbjct: 462 cttctggttctcaactcttactccagtcttccagacagtgttggtgtacttgaggcctga 403

                                                     
Query: 411 cacgatgttgttggagacggcgaaggagaagcggaagctgta 452
           |||||||||||||||||||  ||||  |||||||||||||||
Sbjct: 402 cacgatgttgttggagacgatgaagctgaagcggaagctgta 361



to top

>dbj|AK071735.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023112G04, full
           insert sequence
          Length = 1085

 Score =  178 bits (90), Expect = 1e-41
 Identities = 236/282 (83%), Gaps = 2/282 (0%)
 Strand = Plus / Minus

                                                                       
Query: 172 ggccagtccttcctgatctcaaagctgtacctcatgtccaggtacaccttcccatcatca 231
           ||||| |||||||| |||||||||  ||| ||||| |||| |||    || |||||||||
Sbjct: 732 ggccactccttcctaatctcaaagtagtaactcatctccaagtagcatttgccatcatca 673

                                                                       
Query: 232 tccacaaactttaatctagcagaataggagcccctcgcaaagatgcc-gctcggggtgct 290
           || |||||||||| | ||||||||||||| || || || || ||||| ||| |||||| |
Sbjct: 672 tcaacaaactttagtttagcagaataggaacctcttgcgaacatgccagct-ggggtggt 614

                                                                       
Query: 291 atcttcttcggccttgtacgtgtagggctcctgctgagggctgaatgtccccagcatcac 350
            || |||||  |||  || |||||||||||  |||| || ||||||||||||||||||||
Sbjct: 613 ctcctcttcaccctcatatgtgtagggctctagctggggactgaatgtccccagcatcac 554

                                                                       
Query: 351 cttctggttctccactcttactccggtcttccagacggtgtgcgagtacttgagaccgga 410
           |||||||||||| ||||||||||| ||||||||||| ||||  | ||||||||| || ||
Sbjct: 553 cttctggttctcaactcttactccagtcttccagacagtgttggtgtacttgaggcctga 494

                                                     
Query: 411 cacgatgttgttggagacggcgaaggagaagcggaagctgta 452
           |||||||||||||||||||  ||||  |||||||||||||||
Sbjct: 493 cacgatgttgttggagacgatgaagctgaagcggaagctgta 452



to top

>gb|AY110722.1| Zea mays CL6595_1 mRNA sequence
          Length = 1130

 Score =  121 bits (61), Expect = 2e-24
 Identities = 100/113 (88%)
 Strand = Plus / Minus

                                                                       
Query: 340 cccagcatcaccttctggttctccactcttactccggtcttccagacggtgtgcgagtac 399
           |||||||||| |||| || |||||||| | || || ||||||||||| ||||  | ||||
Sbjct: 662 cccagcatcatcttcggggtctccactttgacgccagtcttccagacagtgttggtgtac 603

                                                                
Query: 400 ttgagaccggacacgatgttgttggagacggcgaaggagaagcggaagctgta 452
           ||||| |||||||||||||||||||||||| ||||||||||||||||||||||
Sbjct: 602 ttgaggccggacacgatgttgttggagacgacgaaggagaagcggaagctgta 550



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 74/92 (80%)
 Strand = Plus / Minus

                                                                       
Query: 172 ggccagtccttcctgatctcaaagctgtacctcatgtccaggtacaccttcccatcatca 231
           ||||| |||||||| |||||||||  ||| ||||| |||| | |   ||| |||||  ||
Sbjct: 830 ggccactccttcctaatctcaaaggagtagctcatctccaagaagcacttgccatcggca 771

                                           
Query: 232 tccacaaactttaatctagcagaataggagcc 263
           || |||||||||| | |||| |||||||||||
Sbjct: 770 tcaacaaactttagtttagcggaataggagcc 739



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 77/88 (87%)
 Strand = Plus / Plus

                                                                            
Query: 365      ctcttactccggtcttccagacggtgtgcgagtacttgagaccggacacgatgttgttgg 424
                |||||||||| ||||||||||| ||||  | ||||||||| || ||||||||||||||||
Sbjct: 39816278 ctcttactccagtcttccagacagtgttggtgtacttgaggcctgacacgatgttgttgg 39816337

                                            
Query: 425      agacggcgaaggagaagcggaagctgta 452
                |||||  ||||  |||||||||||||||
Sbjct: 39816338 agacgatgaagctgaagcggaagctgta 39816365



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                     
Query: 310      gtgtagggctcctgctgagggctgaatgtccccagcatcaccttctggttctc 362
                |||||||||||  |||| || ||||||||||||||||||||||||||||||||
Sbjct: 39815873 gtgtagggctctagctggggactgaatgtccccagcatcaccttctggttctc 39815925



to top

>dbj|AP003436.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0470A12
          Length = 185095

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 77/88 (87%)
 Strand = Plus / Plus

                                                                          
Query: 365    ctcttactccggtcttccagacggtgtgcgagtacttgagaccggacacgatgttgttgg 424
              |||||||||| ||||||||||| ||||  | ||||||||| || ||||||||||||||||
Sbjct: 167177 ctcttactccagtcttccagacagtgttggtgtacttgaggcctgacacgatgttgttgg 167236

                                          
Query: 425    agacggcgaaggagaagcggaagctgta 452
              |||||  ||||  |||||||||||||||
Sbjct: 167237 agacgatgaagctgaagcggaagctgta 167264



 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 49/53 (92%)
 Strand = Plus / Plus

                                                                   
Query: 310    gtgtagggctcctgctgagggctgaatgtccccagcatcaccttctggttctc 362
              |||||||||||  |||| || ||||||||||||||||||||||||||||||||
Sbjct: 166772 gtgtagggctctagctggggactgaatgtccccagcatcaccttctggttctc 166824



to top

>gb|AY105154.1| Zea mays PCO134624 mRNA sequence
          Length = 1194

 Score = 48.1 bits (24), Expect = 0.025
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 306 gtacgtgtagggctcctgctgagggctgaatgtccccagcatcacctt 353
           |||||||||||||||| |||| |||||||| || || |||||| ||||
Sbjct: 432 gtacgtgtagggctccagctgggggctgaacgtgccgagcatctcctt 385



to top

>ref|XM_467497.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1608

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                        
Query: 306  gtacgtgtagggctcctgctgagggctgaatgtccccagcatcaccttctggttctccac 365
            ||||||||| |||||| |||| |||||||| || || |||||| |||| ||| | || ||
Sbjct: 1018 gtacgtgtacggctccggctgggggctgaacgtgccgagcatctccttgtggctgtcaac 959

                                   
Query: 366  tcttactccggtcttccagacgg 388
            | | |  ||||||||||||||||
Sbjct: 958  tttgatgccggtcttccagacgg 936



to top

>gb|AY288198.2| Oryza sativa (japonica cultivar-group) Rac GDP-dissociation
           inhibitor 1 (RacGDI1) mRNA, complete cds
          Length = 1079

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 306 gtacgtgtagggctcctgctgagggctgaatgtccccagcatcaccttctggttctccac 365
           ||||||||| |||||| |||| |||||||| || || |||||| |||| ||| | || ||
Sbjct: 627 gtacgtgtacggctccggctgggggctgaacgtgccgagcatctccttgtggctgtcaac 568

                                  
Query: 366 tcttactccggtcttccagacgg 388
           | | |  ||||||||||||||||
Sbjct: 567 tttgatgccggtcttccagacgg 545



to top

>dbj|AK073093.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033007K19, full
            insert sequence
          Length = 1607

 Score = 46.1 bits (23), Expect = 0.100
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                        
Query: 306  gtacgtgtagggctcctgctgagggctgaatgtccccagcatcaccttctggttctccac 365
            ||||||||| |||||| |||| |||||||| || || |||||| |||| ||| | || ||
Sbjct: 1018 gtacgtgtacggctccggctgggggctgaacgtgccgagcatctccttgtggctgtcaac 959

                                   
Query: 366  tcttactccggtcttccagacgg 388
            | | |  ||||||||||||||||
Sbjct: 958  tttgatgccggtcttccagacgg 936



to top

>ref|NM_127306.2| Arabidopsis thaliana IRE1A; kinase AT2G17520 (IRE1A) mRNA, complete
            cds
          Length = 2899

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 56   gacacaacctaaactaaacat 76
            |||||||||||||||||||||
Sbjct: 2126 gacacaacctaaactaaacat 2106



to top

>gb|AC007584.4| Arabidopsis thaliana chromosome 2 clone MJB20 map mi398, complete
             sequence
          Length = 84592

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 56    gacacaacctaaactaaacat 76
             |||||||||||||||||||||
Sbjct: 45007 gacacaacctaaactaaacat 44987



to top

>emb|BX511223.6| Zebrafish DNA sequence from clone DKEYP-96B6 in linkage group 14,
             complete sequence
          Length = 190254

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 71    aaacattcatctcatctttca 91
             |||||||||||||||||||||
Sbjct: 25815 aaacattcatctcatctttca 25795



to top

>gb|AF308596.1|AF308596 Arabidopsis thaliana endoribonuclease/protein kinase IRE1-like
            protein (IRE1A) mRNA, complete cds
          Length = 2812

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 56   gacacaacctaaactaaacat 76
            |||||||||||||||||||||
Sbjct: 2039 gacacaacctaaactaaacat 2019



to top

>dbj|AK222006.1| Arabidopsis thaliana mRNA for endoribonuclease/protein kinase IRE1,
           complete cds, clone: RAFL22-66-D10
          Length = 999

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 56  gacacaacctaaactaaacat 76
           |||||||||||||||||||||
Sbjct: 232 gacacaacctaaactaaacat 212



to top

>emb|BX819767.1|CNS0A8F2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS25ZB07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1117

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 56  gacacaacctaaactaaacat 76
           |||||||||||||||||||||
Sbjct: 437 gacacaacctaaactaaacat 417



to top

>emb|BX818884.1|CNS0A7ZK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB23ZB07 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 2757

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 56   gacacaacctaaactaaacat 76
            |||||||||||||||||||||
Sbjct: 2076 gacacaacctaaactaaacat 2056



to top

>emb|AL928805.18| Mouse DNA sequence from clone RP23-291H20 on chromosome 2, complete
             sequence
          Length = 192688

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 11    aataataataaacatcaccta 31
             |||||||||||||||||||||
Sbjct: 48702 aataataataaacatcaccta 48682



to top

>dbj|AB049937.1| Arabidopsis thaliana mRNA for Ire1 homolog-2, complete cds
          Length = 2639

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 56   gacacaacctaaactaaacat 76
            |||||||||||||||||||||
Sbjct: 1917 gacacaacctaaactaaacat 1897



to top

>emb|AL772308.4| Mouse DNA sequence from clone RP23-451I21 on chromosome 15, complete
              sequence
          Length = 148496

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 4      accacacaataataataaaca 24
              |||||||||||||||||||||
Sbjct: 115850 accacacaataataataaaca 115870



to top

>gb|AC133004.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0046F10, complete sequence
          Length = 184041

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 7     acacaataataataaacatc 26
             ||||||||||||||||||||
Sbjct: 73552 acacaataataataaacatc 73571



to top

>ref|XM_958361.1| Neurospora crassa OR74A hypothetical protein ( hypothetical protein
           B7J19.40 [imported] - Neurospora crassa OR74A )
           (NCU05463.1) partial mRNA
          Length = 894

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 297 ttcggccttgtacgtgtagggctc 320
           |||||||||||||||| |||||||
Sbjct: 372 ttcggccttgtacgtgaagggctc 349



to top

>ref|XM_325317.1| Neurospora crassa OR74A hypothetical protein ( hypothetical protein
           B7J19.40 [imported] - Neurospora crassa OR74A )
           (NCU05463.1) partial mRNA
          Length = 894

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 297 ttcggccttgtacgtgtagggctc 320
           |||||||||||||||| |||||||
Sbjct: 372 ttcggccttgtacgtgaagggctc 349



to top

>gb|AY590560.1| Treponema pallidum subsp. endemicum isolate Iraq B TprC (tprC)
           gene, complete cds
          Length = 2000

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 919 ggcgaaggagaagcggaagc 900



to top

>gb|AY532698.1| Treponema pallidum subsp. pallidum isolate Sea 81-3 truncated
           repeat protein F (tprF) gene, complete cds
          Length = 1221

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 841 ggcgaaggagaagcggaagc 822



to top

>gb|AY532697.1| Treponema pallidum subsp. pallidum isolate Mexico A truncated
           repeat protein F (tprF) gene, complete cds
          Length = 1221

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 841 ggcgaaggagaagcggaagc 822



to top

>gb|AY532696.1| Treponema pallidum subsp. pallidum isolate Sea 81-4 truncated
           repeat protein F (tprF) gene, complete cds
          Length = 1221

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 841 ggcgaaggagaagcggaagc 822



to top

>gb|AY532695.1| Treponema pallidum subsp. pallidum isolate Chicago truncated repeat
           protein F (tprF) gene, complete cds
          Length = 1221

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 841 ggcgaaggagaagcggaagc 822



to top

>gb|AY532694.1| Treponema pallidum subsp. pallidum isolate Bal-7 truncated repeat
           protein F (tprF) gene, complete cds
          Length = 1221

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 841 ggcgaaggagaagcggaagc 822



to top

>gb|AY532693.1| Treponema pallidum subsp. pallidum isolate Bal-3 truncated repeat
           protein F (tprF) gene, complete cds
          Length = 1221

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 841 ggcgaaggagaagcggaagc 822



to top

>gb|AY550205.1| Treponema pallidum subsp. pallidum isolate Bal 73-1 TprF (tprF)
           gene, complete cds
          Length = 1221

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 841 ggcgaaggagaagcggaagc 822



to top

>gb|AY550204.1| Treponema pallidum subsp. pallidum isolate Bal-3 TprC (tprC) gene,
           complete cds
          Length = 1904

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 863 ggcgaaggagaagcggaagc 844



to top

>gb|AY550206.1| Treponema pallidum subsp. pertenue isolate Gauthier TprC gene,
            complete cds
          Length = 2168

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 429  ggcgaaggagaagcggaagc 448
            ||||||||||||||||||||
Sbjct: 1007 ggcgaaggagaagcggaagc 988



to top

>gb|AY542157.1| Treponema pallidum subsp. pallidum isolate Sea 81-4 TprC (tprC) gene,
            complete cds
          Length = 2237

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 429  ggcgaaggagaagcggaagc 448
            ||||||||||||||||||||
Sbjct: 1002 ggcgaaggagaagcggaagc 983



to top

>gb|AY542156.1| Treponema pallidum subsp. pallidum isolate Bal 73-1 TprD (tprD)
           gene, complete cds
          Length = 1968

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 891 ggcgaaggagaagcggaagc 872



to top

>gb|AY542155.1| Treponema pallidum subsp. pallidum isolate Chicago TprC (tprC)
           gene, complete cds
          Length = 2102

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 970 ggcgaaggagaagcggaagc 951



to top

>gb|AY542154.1| Treponema pallidum subsp. pallidum isolate Mexico A TprC (tprC)
           gene, complete cds
          Length = 2187

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 952 ggcgaaggagaagcggaagc 933



to top

>gb|AY542153.1| Treponema pallidum subsp. pallidum isolate Sea 81-3 TprC (tprC)
           gene, complete cds
          Length = 2141

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 906 ggcgaaggagaagcggaagc 887



to top

>gb|AY536646.1| Treponema pallidum subsp. pallidum isolate Bal-7 TprC (tprC) gene,
           complete cds
          Length = 2188

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 953 ggcgaaggagaagcggaagc 934



to top

>gb|AY536645.1| Treponema pallidum subsp. pallidum isolate Bal 73-1 TprC (tprC)
           gene, complete cds
          Length = 1863

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 840 ggcgaaggagaagcggaagc 821



to top

>gb|AY533515.1| Treponema pallidum subsp. pallidum isolate Chicago TprD gene,
           complete cds
          Length = 1991

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 914 ggcgaaggagaagcggaagc 895



to top

>gb|AY533514.1| Treponema pallidum subsp. pallidum isolate Mexico A TprI gene,
           complete cds
          Length = 1889

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 845 ggcgaaggagaagcggaagc 826



to top

>gb|AY533513.1| Treponema pallidum subsp. pallidum isolate Sea 81-4 TprI gene,
           complete cds
          Length = 1890

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 848 ggcgaaggagaagcggaagc 829



to top

>gb|AY533512.1| Treponema pallidum subsp. pallidum isolate Sea 81-3 TprI gene,
           complete cds
          Length = 1889

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 848 ggcgaaggagaagcggaagc 829



to top

>gb|AY533511.1| Treponema pallidum subsp. pallidum isolate Chicago TprI gene,
           complete cds
          Length = 1899

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 849 ggcgaaggagaagcggaagc 830



to top

>gb|AY533510.1| Treponema pallidum subsp. pallidum isolate Bal 73-1 TprI gene,
           complete cds
          Length = 1904

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 856 ggcgaaggagaagcggaagc 837



to top

>gb|AY533509.1| Treponema pallidum subsp. pallidum isolate Bal-7 TprI gene,
           complete cds
          Length = 1905

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 853 ggcgaaggagaagcggaagc 834



to top

>gb|AY533508.1| Treponema pallidum subsp. pallidum isolate Bal-3 TprI gene,
           complete cds
          Length = 1906

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 856 ggcgaaggagaagcggaagc 837



to top

>ref|XM_824433.1| Trypanosoma brucei TREU927 phosphatidylinositol 3-related kinase
            (Tb11.01.6300) partial mRNA
          Length = 8583

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 194  agctgtacctcatgtccaggtaca 217
            ||||| ||||||||||||||||||
Sbjct: 5792 agctgcacctcatgtccaggtaca 5815



to top

>ref|XM_765080.1| Giardia lamblia ATCC 50803 hypothetical protein (GLP_572_28016_30382)
            partial mRNA
          Length = 2367

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 131  gagtcaagagtctctcttgc 150
            ||||||||||||||||||||
Sbjct: 1678 gagtcaagagtctctcttgc 1659



to top

>gb|AY364312.1| Oryza sativa (japonica cultivar-group) Rho GDP dissociation
           inhibitor 2 mRNA, partial cds
          Length = 1158

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 310 gtgtagggctcctgctgagggctgaatgtccccagcatcacctt 353
           ||||| |||||| ||||||||||||| || || |||||| ||||
Sbjct: 644 gtgtacggctccagctgagggctgaacgtgccaagcatctcctt 601



to top

>gb|AY158568.1| Treponema pallidum clone 5C-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158567.1| Treponema pallidum clone 5B-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158566.1| Treponema pallidum clone 5A-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158565.1| Treponema pallidum clone 11C-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158564.1| Treponema pallidum clone 11B-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158563.1| Treponema pallidum clone 11A-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158562.1| Treponema pallidum clone 8C-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158561.1| Treponema pallidum clone 8B-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158560.1| Treponema pallidum clone 8A-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158559.1| Treponema pallidum clone 7C-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158558.1| Treponema pallidum clone 7B-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158557.1| Treponema pallidum clone 7A-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158556.1| Treponema pallidum clone 4C-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158555.1| Treponema pallidum clone 4B-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158554.1| Treponema pallidum clone 4A-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158553.1| Treponema pallidum clone 2C-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158552.1| Treponema pallidum clone 2B-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158551.1| Treponema pallidum clone 2A-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158550.1| Treponema pallidum clone 10B-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158549.1| Treponema pallidum clone 10A-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158548.1| Treponema pallidum clone 10C-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158547.1| Treponema pallidum clone 9B-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158546.1| Treponema pallidum clone 9A-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158545.1| Treponema pallidum clone 9C-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158544.1| Treponema pallidum clone 6C-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158543.1| Treponema pallidum clone 6B-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158541.1| Treponema pallidum clone 3C-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158540.1| Treponema pallidum clone 3B-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158539.1| Treponema pallidum clone 3A-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158538.1| Treponema pallidum clone 1C-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158537.1| Treponema pallidum clone 1B-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>gb|AY158536.1| Treponema pallidum clone 1A-J TprJ (tprJ) gene, partial cds
          Length = 1074

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 264 ggcgaaggagaagcggaagc 245



to top

>emb|CR387929.4| Zebrafish DNA sequence from clone DKEY-172H18 in linkage group 5,
              complete sequence
          Length = 245364

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 11     aataataataaacatcacctaaca 34
              |||||||||||||||||| |||||
Sbjct: 232584 aataataataaacatcacataaca 232561



to top

>gb|AF334830.1| Homo sapiens cartilage-hair hypoplasia region gene sequence
          Length = 138754

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 351   cttctggttctccactctta 370
             ||||||||||||||||||||
Sbjct: 36125 cttctggttctccactctta 36106



to top

>emb|BX511101.3| Zebrafish DNA sequence from clone DKEYP-92F1 in linkage group 2,
            complete sequence
          Length = 81968

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 11   aataataataaacatcacctaaca 34
            |||||||||||||||||| |||||
Sbjct: 6217 aataataataaacatcacataaca 6240



to top

>dbj|AK040321.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched
            library, clone:A430087A18 product:unclassifiable, full
            insert sequence
          Length = 2574

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 6    cacacaataataataaacat 25
            ||||||||||||||||||||
Sbjct: 1414 cacacaataataataaacat 1433



to top

>emb|AL928617.13| Mouse DNA sequence from clone RP23-326E21 on chromosome 2, complete
            sequence
          Length = 190652

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 351  cttctggttctccactctta 370
            ||||||||||||||||||||
Sbjct: 2526 cttctggttctccactctta 2545



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 7        acacaataataataaacatc 26
                ||||||||||||||||||||
Sbjct: 11104058 acacaataataataaacatc 11104039



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                            
Query: 310      gtgtagggctcctgctgagggctgaatgtccccagcatcacctt 353
                ||||| |||||| ||||||||||||| || || |||||| ||||
Sbjct: 12166267 gtgtacggctccagctgagggctgaacgtgccaagcatctcctt 12166310



to top

>gb|AF261077.1|AF261077 Treponema pallidum strain SS14 clone 3 TprJ gene, complete cds
          Length = 2277

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 849 ggcgaaggagaagcggaagc 830



to top

>gb|AF261075.1|AF261075 Treponema pallidum strain SS14 clone 1 TprJ gene, complete cds
          Length = 2277

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 849 ggcgaaggagaagcggaagc 830



to top

>gb|AC112187.2| Homo sapiens chromosome 5 clone RP11-269M20, complete sequence
          Length = 186165

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 78     catctcatctttcagaccaacccttgctaggt 109
              |||||| |||||||||||||||  ||||||||
Sbjct: 144682 catctcttctttcagaccaacctgtgctaggt 144713



to top

>gb|AF217541.1|AF217541 Treponema pallidum subsp. pallidum strain Sea81-4 TprD2 (tprD) gene,
            tprD-2 allele, complete cds
          Length = 2353

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 429  ggcgaaggagaagcggaagc 448
            ||||||||||||||||||||
Sbjct: 1244 ggcgaaggagaagcggaagc 1225



to top

>gb|AF217540.1|AF217540 Treponema pallidum subsp. pallidum strain Sea81-3 TprD2 (tprD) gene,
            tprD-2 allele, complete cds
          Length = 2353

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 429  ggcgaaggagaagcggaagc 448
            ||||||||||||||||||||
Sbjct: 1244 ggcgaaggagaagcggaagc 1225



to top

>gb|AF217539.1|AF217539 Treponema pallidum subsp. pallidum strain MexicoA TprD (tprD) gene,
            tprD-2 allele, complete cds
          Length = 2353

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 429  ggcgaaggagaagcggaagc 448
            ||||||||||||||||||||
Sbjct: 1244 ggcgaaggagaagcggaagc 1225



to top

>gb|AF217538.1|AF217538 Treponema pallidum subsp. pertenue TprD3 (tprD) gene, tprD-3 allele,
            complete cds
          Length = 2349

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 429  ggcgaaggagaagcggaagc 448
            ||||||||||||||||||||
Sbjct: 1234 ggcgaaggagaagcggaagc 1215



to top

>gb|AF217537.1|AF217537 Treponema pallidum subsp. pallidum strain Bal-7 TprD (tprD) gene,
            complete cds
          Length = 2359

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 429  ggcgaaggagaagcggaagc 448
            ||||||||||||||||||||
Sbjct: 1244 ggcgaaggagaagcggaagc 1225



to top

>gb|AF187953.1|AF187953 Treponema pallidum subsp. pallidum isolate Mexico A TprD (tprD)
           gene, partial cds
          Length = 594

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 45  ggcgaaggagaagcggaagc 26



to top

>gb|AF187952.1|AF187952 Treponema pallidum subsp. pallidum isolate Bal-3 TprD (tprD) gene,
            complete cds
          Length = 2354

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 429  ggcgaaggagaagcggaagc 448
            ||||||||||||||||||||
Sbjct: 1245 ggcgaaggagaagcggaagc 1226



to top

>dbj|AP003543.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
            clone:P0592B08
          Length = 131096

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 310  gtgtagggctcctgctgagggctgaatgtccccagcatcacctt 353
            ||||| |||||| ||||||||||||| || || |||||| ||||
Sbjct: 3289 gtgtacggctccagctgagggctgaacgtgccaagcatctcctt 3332



to top

>dbj|AP003507.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0468A12
          Length = 143018

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                          
Query: 310    gtgtagggctcctgctgagggctgaatgtccccagcatcacctt 353
              ||||| |||||| ||||||||||||| || || |||||| ||||
Sbjct: 109056 gtgtacggctccagctgagggctgaacgtgccaagcatctcctt 109099



to top

>dbj|AK065671.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013041C14, full
           insert sequence
          Length = 1208

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 310 gtgtagggctcctgctgagggctgaatgtccccagcatcacctt 353
           ||||| |||||| ||||||||||||| || || |||||| ||||
Sbjct: 760 gtgtacggctccagctgagggctgaacgtgccaagcatctcctt 717



to top

>dbj|AK060873.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-H12, full
           insert sequence
          Length = 1321

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 310 gtgtagggctcctgctgagggctgaatgtccccagcatcacctt 353
           ||||| |||||| ||||||||||||| || || |||||| ||||
Sbjct: 801 gtgtacggctccagctgagggctgaacgtgccaagcatctcctt 758



to top

>emb|CR790363.24| Zebrafish DNA sequence from clone DKEY-175D9 in linkage group 3,
             complete sequence
          Length = 139765

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 65    taaactaaacattcatctca 84
             ||||||||||||||||||||
Sbjct: 63883 taaactaaacattcatctca 63864



to top

>emb|CT573072.1| Kuenenia stuttgartiensis genome fragment KUST_D (4 of 5)
          Length = 896449

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 209    ccaggtacaccttcccatcatcat 232
              |||||||||||||||| |||||||
Sbjct: 515588 ccaggtacaccttcccttcatcat 515565



to top

>gb|AC154388.4| Mus musculus BAC clone RP23-14P7 from chromosome 14, complete sequence
          Length = 246800

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 131    gagtcaagagtctctcttgctctt 154
              |||||||||||||||||| |||||
Sbjct: 240924 gagtcaagagtctctctttctctt 240901



to top

>emb|AL389899.1|NCB7J19 Neurospora crassa DNA linkage group II BAC clone B7J19
          Length = 57906

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 297   ttcggccttgtacgtgtagggctc 320
             |||||||||||||||| |||||||
Sbjct: 28617 ttcggccttgtacgtgaagggctc 28640



to top

>gb|AY685240.1| Treponema paraluiscuniculi nonfunctional TprG2 gene, complete
            sequence
          Length = 3018

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 429  ggcgaaggagaagcggaagc 448
            ||||||||||||||||||||
Sbjct: 1084 ggcgaaggagaagcggaagc 1065



to top

>gb|AY685239.1| Treponema paraluiscuniculi nonfunctional TprG1 gene, complete
            sequence
          Length = 3257

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 429  ggcgaaggagaagcggaagc 448
            ||||||||||||||||||||
Sbjct: 1351 ggcgaaggagaagcggaagc 1332



to top

>gb|AY685238.1| Treponema paraluiscuniculi nonfunctional TprG and TprI genes,
            complete sequence
          Length = 2459

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 429  ggcgaaggagaagcggaagc 448
            ||||||||||||||||||||
Sbjct: 1029 ggcgaaggagaagcggaagc 1010



to top

>gb|AY685237.1| Treponema paraluiscuniculi nonfunctional TprD gene, complete sequence
          Length = 2792

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 429  ggcgaaggagaagcggaagc 448
            ||||||||||||||||||||
Sbjct: 1376 ggcgaaggagaagcggaagc 1357



to top

>gb|AY685236.1| Treponema paraluiscuniculi nonfunctional TprC gene, complete
           sequence
          Length = 1916

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 854 ggcgaaggagaagcggaagc 835



to top

>emb|CT030647.17| Mouse DNA sequence from clone RP23-379I9 on chromosome 14, complete
              sequence
          Length = 205598

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 131    gagtcaagagtctctcttgctctt 154
              |||||||||||||||||| |||||
Sbjct: 106434 gagtcaagagtctctctttctctt 106411



to top

>gb|AF073527.1|AF073527 Treponema pallidum subsp. pertenue tprJ gene homolog (tprJ) gene,
           complete cds
          Length = 2508

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 939 ggcgaaggagaagcggaagc 920



to top

>gb|U88957.1|TPU88957 Treponema pallidum major outer sheath protein homolog Msp (msp)
           gene, complete cds
          Length = 2521

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 941 ggcgaaggagaagcggaagc 922



to top

>gb|AE000520.1| Treponema pallidum subsp. pallidum str. Nichols complete genome
          Length = 1138011

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 429    ggcgaaggagaagcggaagc 448
              ||||||||||||||||||||
Sbjct: 976347 ggcgaaggagaagcggaagc 976366



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 429    ggcgaaggagaagcggaagc 448
              ||||||||||||||||||||
Sbjct: 674373 ggcgaaggagaagcggaagc 674392



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 429    ggcgaaggagaagcggaagc 448
              ||||||||||||||||||||
Sbjct: 672069 ggcgaaggagaagcggaagc 672088



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 429    ggcgaaggagaagcggaagc 448
              ||||||||||||||||||||
Sbjct: 333815 ggcgaaggagaagcggaagc 333834



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 429    ggcgaaggagaagcggaagc 448
              ||||||||||||||||||||
Sbjct: 331516 ggcgaaggagaagcggaagc 331535



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 429    ggcgaaggagaagcggaagc 448
              ||||||||||||||||||||
Sbjct: 328833 ggcgaaggagaagcggaagc 328814



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 429    ggcgaaggagaagcggaagc 448
              ||||||||||||||||||||
Sbjct: 152079 ggcgaaggagaagcggaagc 152098



 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 429    ggcgaaggagaagcggaagc 448
              ||||||||||||||||||||
Sbjct: 135879 ggcgaaggagaagcggaagc 135898



to top

>emb|AL832752.1|HSM804063 Homo sapiens mRNA; cDNA DKFZp686A0127 (from clone DKFZp686A0127)
          Length = 5643

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 6    cacacaataataataaacat 25
            ||||||||||||||||||||
Sbjct: 5530 cacacaataataataaacat 5511



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 7        acacaataataataaacatc 26
                ||||||||||||||||||||
Sbjct: 11183247 acacaataataataaacatc 11183228



to top

>emb|AL133410.32| Human DNA sequence from clone RP11-112J3 on chromosome 9p13.1-13.3
              Contains the 3' end of the CA9 gene for carbonic anhydrase
              IX (MN), the TPM2 gene for tropomyosin 2 (beta) (DA1, TMSB,
              AMCD1), the TLN1 gene for talin 1 (TLN, KIAA1027), the
              CREB3 gene for cAMP responsive element binding protein 3
              (luman) (LZIP, LUMAN, MGC15333, MGC19782), the GBA2 gene
              for glucosidase, beta (bile acid) 2 (AD035, KIAA1605,
              MGC16895, DKFZp762K054), a novel gene (KIAA0258), five
              novel genes, the NPR2 gene for natriuretic peptide receptor
              B/guanylate cyclase B (atrionatriuretic peptide receptor B)
              (NPRB, ANPRB, GUC2B, NPRBi), the SPAG8 gene for sperm
              associated antigen 8 (SMP1, BS-84, HSD-1, hSMP-1,
              MGC26201), the HINT2 gene for Histidine triad nucleotide
              binding protein 2, the gene for NAG-5 protein (LOC51754),
              an olfactory receptor pseudogene, the gene for a novel
              seven transmembrane helix receptor, a NADH dehydrogenase
              (ubiquinone) 1 alpha subcomplex, 5,13kDa (B13, NUFM,
              UQOR13, FLJ12147, CI-13KD-B) (NDUFA5) pseudogene and six
              CpG islands, complete sequence
          Length = 195379

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 351    cttctggttctccactctta 370
              ||||||||||||||||||||
Sbjct: 147809 cttctggttctccactctta 147790



to top

>gb|AC132945.3| Mus musculus BAC clone RP24-321A15 from 8, complete sequence
          Length = 230047

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 6      cacacaataataataaacat 25
              ||||||||||||||||||||
Sbjct: 116503 cacacaataataataaacat 116484



to top

>gb|AF045437.1| Treponema pallidum clone 5 putative outer membrane protein gene,
           partial cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 432 ggcgaaggagaagcggaagc 413



to top

>gb|AF045436.1| Treponema pallidum clone 7 putative outer membrane protein gene,
           partial cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 432 ggcgaaggagaagcggaagc 413



to top

>gb|AF045435.1| Treponema pallidum clones 2, 3 and 8 putative outer membrane
           protein gene, partial cds
          Length = 1291

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 432 ggcgaaggagaagcggaagc 413



to top

>gb|AF045434.1| Treponema pallidum clones 6 and 16 putative outer membrane protein
           gene, partial cds
          Length = 1705

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 432 ggcgaaggagaagcggaagc 413



to top

>gb|AF045433.1| Treponema pallidum clones 1, 2, 4, 5 and 7 putative outer membrane
           protein gene, partial cds
          Length = 1687

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 429 ggcgaaggagaagcggaagc 448
           ||||||||||||||||||||
Sbjct: 432 ggcgaaggagaagcggaagc 413



to top

>emb|AL831770.3| Human DNA sequence from clone RP13-297M11 on chromosome 1, complete
              sequence
          Length = 151857

 Score = 40.1 bits (20), Expect = 6.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 78     catctcatctttcagaccaacccttgctaggt 109
              |||||| |||||||||||||||  ||||||||
Sbjct: 113396 catctcttctttcagaccaacctgtgctaggt 113365


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,377,720
Number of Sequences: 3902068
Number of extensions: 5377720
Number of successful extensions: 100615
Number of sequences better than 10.0: 126
Number of HSP's better than 10.0 without gapping: 123
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 100331
Number of HSP's gapped (non-prelim): 289
length of query: 456
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 434
effective length of database: 17,147,199,772
effective search space: 7441884701048
effective search space used: 7441884701048
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top