>gb|AC116347.2| Homo sapiens chromosome 5 clone RP11-274E7, complete sequence
          Length = 132384

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 499    ctgaaactctggacagcataca 520
              ||||||||||||||||||||||
Sbjct: 114130 ctgaaactctggacagcataca 114151

>gb|AC134821.2| Homo sapiens chromosome 5 clone RP11-995J21, complete sequence
          Length = 40499

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 499   ctgaaactctggacagcataca 520
             ||||||||||||||||||||||
Sbjct: 32294 ctgaaactctggacagcataca 32273

>gb|AC140830.2| Homo sapiens chromosome 5 clone RP11-901K15, complete sequence
          Length = 168242

 Score = 44.1 bits (22), Expect = 0.48
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 499    ctgaaactctggacagcataca 520
              ||||||||||||||||||||||
Sbjct: 142834 ctgaaactctggacagcataca 142855

>emb|AL441964.4| Human DNA sequence from clone RP11-151G12 on chromosome X Contains a
             mortality factor 4 like 1 (MORF4L1) pseudogene and a novel
             pseudogene, complete sequence
          Length = 92775

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 289   tgtagatacagaggccaaca 308
             ||||||||||||||||||||
Sbjct: 56487 tgtagatacagaggccaaca 56506

>emb|AL355003.10| Human DNA sequence from clone RP11-753M10 on chromosome 13, complete
             sequence
          Length = 133309

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 250   ttcagcattccacaatgtat 269
             ||||||||||||||||||||
Sbjct: 86872 ttcagcattccacaatgtat 86891

>emb|AL353595.9| Human DNA sequence from clone RP11-81P8 on chromosome 9, complete
             sequence
          Length = 167629

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 151   tttacagctttaccaattttgaat 174
             |||||| |||||||||||||||||
Sbjct: 20579 tttacatctttaccaattttgaat 20602

>emb|AL353814.1|ATF26G5 Arabidopsis thaliana DNA chromosome 3, BAC clone F26G5
          Length = 102873

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 238   accatgccaagcttcagcattcca 261
             ||||||||||||||||| ||||||
Sbjct: 41050 accatgccaagcttcagaattcca 41073

>emb|BX530069.10| Zebrafish DNA sequence from clone DKEY-22L17 in linkage group 10,
              complete sequence
          Length = 222308

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 149    attttacagctttaccaatt 168
              ||||||||||||||||||||
Sbjct: 167762 attttacagctttaccaatt 167743

>gb|AF145049.1|AF145049 Streptomyces fradiae tylosin-biosynthetic regulatory gene cluster,
            complete sequence
          Length = 10467

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 371  gcggagaagtcgagccgcac 390
            ||||||||||||||||||||
Sbjct: 2982 gcggagaagtcgagccgcac 2963

>gb|AC069164.11|AC069164 Homo sapiens chromosome 13 clone RP11-338F18, complete sequence
          Length = 169903

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 250    ttcagcattccacaatgtat 269
              ||||||||||||||||||||
Sbjct: 125439 ttcagcattccacaatgtat 125458

>emb|BX510657.9| Zebrafish DNA sequence from clone CH211-142K18 in linkage group 20,
              complete sequence
          Length = 163967

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 260    cacaatgtatgtgaatggca 279
              ||||||||||||||||||||
Sbjct: 150362 cacaatgtatgtgaatggca 150381

>gb|AF055922.1|AF055922 Streptomyces fradiae dipeptidil carboxypeptidase (ddcA), tylosin
             resistance protein (tlrB), glycosyltransferase (tylN),
             methyltransferase (tylE), 4-ketoreductase (tylD),
             ferredoxin (tylH2), cytochrome P450 (tylH1), macrocin
             O-methyltransferase (tylF), epimerase (tylJ), acyl-CoA
             oxydase (tylP), and butyrolactone receptor (tylQ) genes,
             complete cds
          Length = 12905

 Score = 40.1 bits (20), Expect = 7.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 371   gcggagaagtcgagccgcac 390
             ||||||||||||||||||||
Sbjct: 12541 gcggagaagtcgagccgcac 12522


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,716,452
Number of Sequences: 3902068
Number of extensions: 4716452
Number of successful extensions: 175308
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 175291
Number of HSP's gapped (non-prelim): 17
length of query: 551
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 528
effective length of database: 17,143,297,704
effective search space: 9051661187712
effective search space used: 9051661187712
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)