Clone Name | rbasd19g01 |
---|---|
Clone Library Name | barley_pub |
>gb|AC116347.2| Homo sapiens chromosome 5 clone RP11-274E7, complete sequence Length = 132384 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 510 ctgaaactctggacagcataca 531 |||||||||||||||||||||| Sbjct: 114130 ctgaaactctggacagcataca 114151
>gb|AC134821.2| Homo sapiens chromosome 5 clone RP11-995J21, complete sequence Length = 40499 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 510 ctgaaactctggacagcataca 531 |||||||||||||||||||||| Sbjct: 32294 ctgaaactctggacagcataca 32273
>gb|AC140830.2| Homo sapiens chromosome 5 clone RP11-901K15, complete sequence Length = 168242 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 510 ctgaaactctggacagcataca 531 |||||||||||||||||||||| Sbjct: 142834 ctgaaactctggacagcataca 142855
>gb|AC125137.3| Mus musculus BAC clone RP24-324K9 from chromosome 6, complete sequence Length = 170336 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 15 atttacacctgatccacaag 34 |||||||||||||||||||| Sbjct: 15090 atttacacctgatccacaag 15071
>emb|CR848003.7| Zebrafish DNA sequence from clone DKEY-180K21 in linkage group 1, complete sequence Length = 53659 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 6 aacatttctatttacacctg 25 |||||||||||||||||||| Sbjct: 12894 aacatttctatttacacctg 12875
>emb|AL441964.4| Human DNA sequence from clone RP11-151G12 on chromosome X Contains a mortality factor 4 like 1 (MORF4L1) pseudogene and a novel pseudogene, complete sequence Length = 92775 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 300 tgtagatacagaggccaaca 319 |||||||||||||||||||| Sbjct: 56487 tgtagatacagaggccaaca 56506
>emb|AL355003.10| Human DNA sequence from clone RP11-753M10 on chromosome 13, complete sequence Length = 133309 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 261 ttcagcattccacaatgtat 280 |||||||||||||||||||| Sbjct: 86872 ttcagcattccacaatgtat 86891
>emb|AL353595.9| Human DNA sequence from clone RP11-81P8 on chromosome 9, complete sequence Length = 167629 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 162 tttacagctttaccaattttgaat 185 |||||| ||||||||||||||||| Sbjct: 20579 tttacatctttaccaattttgaat 20602
>gb|AC125503.3| Oryctolagus cuniculus clone LB1-115H21, complete sequence Length = 176296 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 12 tctatttacacctgatccac 31 |||||||||||||||||||| Sbjct: 46846 tctatttacacctgatccac 46827
>emb|AL353814.1|ATF26G5 Arabidopsis thaliana DNA chromosome 3, BAC clone F26G5 Length = 102873 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 249 accatgccaagcttcagcattcca 272 ||||||||||||||||| |||||| Sbjct: 41050 accatgccaagcttcagaattcca 41073
>emb|BX530069.10| Zebrafish DNA sequence from clone DKEY-22L17 in linkage group 10, complete sequence Length = 222308 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 160 attttacagctttaccaatt 179 |||||||||||||||||||| Sbjct: 167762 attttacagctttaccaatt 167743
>gb|AF145049.1|AF145049 Streptomyces fradiae tylosin-biosynthetic regulatory gene cluster, complete sequence Length = 10467 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 382 gcggagaagtcgagccgcac 401 |||||||||||||||||||| Sbjct: 2982 gcggagaagtcgagccgcac 2963
>gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold Length = 1889755 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 12 tctatttacacctgatccac 31 |||||||||||||||||||| Sbjct: 1476292 tctatttacacctgatccac 1476273
>gb|AC069164.11|AC069164 Homo sapiens chromosome 13 clone RP11-338F18, complete sequence Length = 169903 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 261 ttcagcattccacaatgtat 280 |||||||||||||||||||| Sbjct: 125439 ttcagcattccacaatgtat 125458
>emb|BX510657.9| Zebrafish DNA sequence from clone CH211-142K18 in linkage group 20, complete sequence Length = 163967 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 271 cacaatgtatgtgaatggca 290 |||||||||||||||||||| Sbjct: 150362 cacaatgtatgtgaatggca 150381
>gb|AF055922.1|AF055922 Streptomyces fradiae dipeptidil carboxypeptidase (ddcA), tylosin resistance protein (tlrB), glycosyltransferase (tylN), methyltransferase (tylE), 4-ketoreductase (tylD), ferredoxin (tylH2), cytochrome P450 (tylH1), macrocin O-methyltransferase (tylF), epimerase (tylJ), acyl-CoA oxydase (tylP), and butyrolactone receptor (tylQ) genes, complete cds Length = 12905 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 382 gcggagaagtcgagccgcac 401 |||||||||||||||||||| Sbjct: 12541 gcggagaagtcgagccgcac 12522
>emb|CR788257.9| Zebrafish DNA sequence from clone DKEY-244H24 in linkage group 1, complete sequence Length = 198219 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 6 aacatttctatttacacctg 25 |||||||||||||||||||| Sbjct: 9127 aacatttctatttacacctg 9146 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,940,791 Number of Sequences: 3902068 Number of extensions: 4940791 Number of successful extensions: 179769 Number of sequences better than 10.0: 17 Number of HSP's better than 10.0 without gapping: 17 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 179723 Number of HSP's gapped (non-prelim): 46 length of query: 567 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 544 effective length of database: 17,143,297,704 effective search space: 9325953950976 effective search space used: 9325953950976 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)