ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd19e16
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC130187.4| Atelerix albiventris clone LB4-344F17, complete s... 44 0.31
2gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold 44 0.31
3gb|AC169675.2| Mus musculus BAC clone RP24-200J3 from chromosome... 42 1.2
4emb|AL162573.15| Human DNA sequence from clone RP11-275J18 on ch... 42 1.2
5gb|AC010736.13| Homo sapiens BAC clone RP11-436F6 from 2, comple... 42 1.2
6emb|AL672150.19| Mouse DNA sequence from clone RP23-338A17 on ch... 42 1.2
7gb|AC171111.2| Mus musculus BAC clone RP24-131J20 from chromosom... 42 1.2
8gb|AC152110.1| Pichia stipitis clone JGIAHYZ-13H24, complete seq... 40 4.8
9gb|AC102270.8| Mus musculus chromosome 3, clone RP24-266A23, com... 40 4.8
10gb|AC163494.3| Mus musculus chromosome 7, clone RP23-221O21, com... 40 4.8
11gb|AC101818.9| Mus musculus chromosome 7, clone RP24-363I8, comp... 40 4.8
12ref|XM_672112.1| Plasmodium berghei strain ANKA hypothetical pro... 40 4.8
13emb|AL627443.6| Human DNA sequence from clone RP11-459F1 on chro... 40 4.8
14emb|AL807239.5| Zebrafish DNA sequence from clone CH211-231H1 in... 40 4.8
15gb|AC116913.6| Homo sapiens chromosome 15, clone CTD-3185P2, com... 40 4.8
16dbj|AB190353.1| Brassica rapa BrSLGf2b, BrSLGf2a genes, complete... 40 4.8
17gb|DP000033.1| Carollia perspicillata target 116 genomic scaffold 40 4.8
18gb|AC159504.5| Mus musculus 10 BAC RP23-302J6 (Roswell Park Canc... 40 4.8
19dbj|AK038965.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 40 4.8
20emb|BX511226.5| Zebrafish DNA sequence from clone DKEY-41K7 in l... 40 4.8
21gb|AC093760.3| Homo sapiens BAC clone RP11-77N9 from 4, complete... 40 4.8
22gb|AC016595.4| Homo sapiens chromosome 5 clone CTD-2012M11, comp... 40 4.8
23gb|AC156390.3| Mus musculus 10 BAC RP24-280O23 (Roswell Park Can... 40 4.8
24emb|AL160471.5|CNS01RH4 Human chromosome 14 DNA sequence BAC R-3... 40 4.8
25emb|AL352982.3|CNS05TBY Human chromosome 14 DNA sequence Partial... 40 4.8
26gb|AE017125.1| Helicobacter hepaticus ATCC 51449, complete genome 40 4.8

>gb|AC130187.4| Atelerix albiventris clone LB4-344F17, complete sequence
          Length = 150117

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 334   ccattgttttaaaatattactt 355
             ||||||||||||||||||||||
Sbjct: 38568 ccattgttttaaaatattactt 38547



to top

>gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold
          Length = 2136267

 Score = 44.1 bits (22), Expect = 0.31
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 334     ccattgttttaaaatattactt 355
               ||||||||||||||||||||||
Sbjct: 1725864 ccattgttttaaaatattactt 1725843



to top

>gb|AC169675.2| Mus musculus BAC clone RP24-200J3 from chromosome 17, complete sequence
          Length = 171242

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 253   gctcaggtgctaccatgccag 273
             |||||||||||||||||||||
Sbjct: 78448 gctcaggtgctaccatgccag 78468



to top

>emb|AL162573.15| Human DNA sequence from clone RP11-275J18 on chromosome 13, complete
              sequence
          Length = 166509

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 332    aaccattgttttaaaatatta 352
              |||||||||||||||||||||
Sbjct: 155686 aaccattgttttaaaatatta 155666



to top

>gb|AC010736.13| Homo sapiens BAC clone RP11-436F6 from 2, complete sequence
          Length = 204267

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 236    ttgccctggagatgcttgctcaggt 260
              ||||||||||||||| |||||||||
Sbjct: 175088 ttgccctggagatgcctgctcaggt 175112



to top

>emb|AL672150.19| Mouse DNA sequence from clone RP23-338A17 on chromosome X, complete
            sequence
          Length = 196140

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 220  cacttgttcatcccttttgcc 240
            |||||||||||||||||||||
Sbjct: 8766 cacttgttcatcccttttgcc 8786



to top

>gb|AC171111.2| Mus musculus BAC clone RP24-131J20 from chromosome 17, complete
             sequence
          Length = 167872

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 253   gctcaggtgctaccatgccag 273
             |||||||||||||||||||||
Sbjct: 20736 gctcaggtgctaccatgccag 20756



to top

>gb|AC152110.1| Pichia stipitis clone JGIAHYZ-13H24, complete sequence
          Length = 36108

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 264   accatgccagcagtagtatc 283
             ||||||||||||||||||||
Sbjct: 34051 accatgccagcagtagtatc 34032



to top

>gb|AC102270.8| Mus musculus chromosome 3, clone RP24-266A23, complete sequence
          Length = 185321

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 328    catcaaccattgttttaaaa 347
              ||||||||||||||||||||
Sbjct: 119227 catcaaccattgttttaaaa 119246



to top

>gb|AC163494.3| Mus musculus chromosome 7, clone RP23-221O21, complete sequence
          Length = 193210

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 331    caaccattgttttaaaatat 350
              ||||||||||||||||||||
Sbjct: 130444 caaccattgttttaaaatat 130463



to top

>gb|AC101818.9| Mus musculus chromosome 7, clone RP24-363I8, complete sequence
          Length = 137430

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 331   caaccattgttttaaaatat 350
             ||||||||||||||||||||
Sbjct: 14266 caaccattgttttaaaatat 14247



to top

>ref|XM_672112.1| Plasmodium berghei strain ANKA hypothetical protein (PB100542.00.0)
            partial mRNA
          Length = 1803

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 323  aagtgcatcaaccattgttttaaa 346
            ||||||||||| ||||||||||||
Sbjct: 1173 aagtgcatcaaacattgttttaaa 1196



to top

>emb|AL627443.6| Human DNA sequence from clone RP11-459F1 on chromosome 6 Contains a
             glyceraldehyde-3-phosphate dehydrogenase (GAPD)
             pseudogene, a novel gene, the T gene for T, brachyury
             homolog (mouse) and a CpG island, complete sequence
          Length = 164820

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 237   tgccctggagatgcttgctcaggt 260
             |||||||||||||||||| |||||
Sbjct: 82930 tgccctggagatgcttgcacaggt 82953



to top

>emb|AL807239.5| Zebrafish DNA sequence from clone CH211-231H1 in linkage group 14
              Contains the 5' part of a novel gene similar to human,
              rodent and Oreochromis mossambicus GRIA3 (ionotropic
              glutamate receptor AMPA3) and five CpG islands, complete
              sequence
          Length = 210702

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 332    aaccattgttttaaaatattactt 355
              ||||| ||||||||||||||||||
Sbjct: 165786 aaccaatgttttaaaatattactt 165809



to top

>gb|AC116913.6| Homo sapiens chromosome 15, clone CTD-3185P2, complete sequence
          Length = 152561

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 235   tttgccctggagatgcttgc 254
             ||||||||||||||||||||
Sbjct: 97593 tttgccctggagatgcttgc 97574



to top

>dbj|AB190353.1| Brassica rapa BrSLGf2b, BrSLGf2a genes, complete cds
          Length = 39220

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    acaccaaaagaaggatgtcc 89
             ||||||||||||||||||||
Sbjct: 36320 acaccaaaagaaggatgtcc 36301



to top

>gb|DP000033.1| Carollia perspicillata target 116 genomic scaffold
          Length = 347743

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 336    attgttttaaaatattactt 355
              ||||||||||||||||||||
Sbjct: 327529 attgttttaaaatattactt 327548



to top

>gb|AC159504.5| Mus musculus 10 BAC RP23-302J6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 201259

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 336    attgttttaaaatattactt 355
              ||||||||||||||||||||
Sbjct: 131118 attgttttaaaatattactt 131099



to top

>dbj|AK038965.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length enriched
            library, clone:A230079I08 product:unclassifiable, full
            insert sequence
          Length = 3841

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 328  catcaaccattgttttaaaa 347
            ||||||||||||||||||||
Sbjct: 3370 catcaaccattgttttaaaa 3389



to top

>emb|BX511226.5| Zebrafish DNA sequence from clone DKEY-41K7 in linkage group 1,
             complete sequence
          Length = 252757

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 332   aaccattgttttaaaatattactt 355
             ||||| ||||||||||||||||||
Sbjct: 15127 aaccaatgttttaaaatattactt 15150



to top

>gb|AC093760.3| Homo sapiens BAC clone RP11-77N9 from 4, complete sequence
          Length = 41338

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 291   atttgttgacatgtccatgcaatagaat 318
             |||||||||||||||||| || ||||||
Sbjct: 31713 atttgttgacatgtccatacagtagaat 31740



to top

>gb|AC016595.4| Homo sapiens chromosome 5 clone CTD-2012M11, complete sequence
          Length = 131484

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 224   tgttcatcccttttgccctg 243
             ||||||||||||||||||||
Sbjct: 71377 tgttcatcccttttgccctg 71358



to top

>gb|AC156390.3| Mus musculus 10 BAC RP24-280O23 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 158038

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 336    attgttttaaaatattactt 355
              ||||||||||||||||||||
Sbjct: 145040 attgttttaaaatattactt 145059



to top

>emb|AL160471.5|CNS01RH4 Human chromosome 14 DNA sequence BAC R-304L20 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 193559

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 94    catgtatgggtcaagttaatctgc 117
             ||||||||| ||||||||||||||
Sbjct: 79453 catgtatggttcaagttaatctgc 79476



to top

>emb|AL352982.3|CNS05TBY Human chromosome 14 DNA sequence Partial sequence from BAC R-661F4 of
             library RPCI-11 from chromosome 14 of Homo sapiens
             (Human), complete sequence
          Length = 157058

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 94    catgtatgggtcaagttaatctgc 117
             ||||||||| ||||||||||||||
Sbjct: 56785 catgtatggttcaagttaatctgc 56762



to top

>gb|AE017125.1| Helicobacter hepaticus ATCC 51449, complete genome
          Length = 1799146

 Score = 40.1 bits (20), Expect = 4.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 194    ttgttcagctctggcacaaaagga 217
              ||||| ||||||||||||||||||
Sbjct: 545999 ttgttaagctctggcacaaaagga 546022


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,321,447
Number of Sequences: 3902068
Number of extensions: 3321447
Number of successful extensions: 65904
Number of sequences better than 10.0: 26
Number of HSP's better than 10.0 without gapping: 26
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 65831
Number of HSP's gapped (non-prelim): 73
length of query: 360
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 338
effective length of database: 17,147,199,772
effective search space: 5795753522936
effective search space used: 5795753522936
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top