ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd19d22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|DQ167203.2| Triticum aestivum eukaryotic translation initiati... 1098 0.0
2gb|DQ234393.1| Aegilops tauschii translation initiation factor 5... 926 0.0
3gb|DQ234391.1| Secale cereale translation initiation factor 5A m... 926 0.0
4gb|DQ234390.1| Dasypyrum breviaristatum translation initiation f... 912 0.0
5gb|DQ234394.1| Secale sylvestre translation initiation factor 5A... 902 0.0
6gb|DQ234392.1| Thinopyrum intermedium translation initiation fac... 807 0.0
7gb|DQ167202.1| Triticum aestivum eukaryotic translation initiati... 363 5e-97
8gb|DQ167201.1| Triticum aestivum eukaryotic translation initiati... 363 5e-97
9ref|NM_194115.2| Oryza sativa (japonica cultivar-group), mRNA 289 6e-75
10dbj|AK058206.1| Oryza sativa (japonica cultivar-group) cDNA clon... 289 6e-75
11ref|XM_469841.1| Oryza sativa (japonica cultivar-group), mRNA 287 2e-74
12emb|AJ312906.1|OSA312906 Oryza sativa mRNA for translation initi... 287 2e-74
13emb|AJ252135.1|OSA252135 Oryza sativa mRNA for translation initi... 287 2e-74
14dbj|AK121592.1| Oryza sativa (japonica cultivar-group) cDNA clon... 287 2e-74
15dbj|AK060387.1| Oryza sativa (japonica cultivar-group) cDNA clon... 287 2e-74
16gb|DQ414518.1| Dasypyrum breviaristatum eukaryotic translation i... 228 2e-56
17gb|DQ279897.1| Secale cereale translation initiation factor gene... 228 2e-56
18gb|DQ279894.1| Lophopyrum elongatum translation initiation facto... 228 2e-56
19gb|DQ279893.1| Pseudoroegneria spicata translation initiation fa... 224 3e-55
20gb|DQ279900.1| Haynaldia villosa translation initiation factor g... 220 5e-54
21gb|DQ279896.1| Aegilops tauschii translation initiation factor g... 212 1e-51
22ref|XM_479006.1| Oryza sativa (japonica cultivar-group), mRNA 208 2e-50
23ref|XM_506443.1| PREDICTED Oryza sativa (japonica cultivar-group... 208 2e-50
24dbj|AK062134.1| Oryza sativa (japonica cultivar-group) cDNA clon... 208 2e-50
25gb|AF094773.1|AF094773 Oryza sativa translation initiation facto... 208 2e-50
26gb|DQ279899.1| Crithopsis delileana translation initiation facto... 206 7e-50
27emb|AJ843977.1| Plantago major mRNA for eukaryotic translation i... 202 1e-48
28dbj|AK103429.1| Oryza sativa (japonica cultivar-group) cDNA clon... 200 4e-48
29gb|DQ279895.1| Eremopyrum bonaepartis translation initiation fac... 198 2e-47
30dbj|AK061867.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 7e-47
31gb|DQ345329.1| Rosa chinensis eukaryotic translation initiation ... 196 7e-47
32dbj|AK099039.1| Oryza sativa (japonica cultivar-group) cDNA clon... 196 7e-47
33gb|DQ279898.1| Psathyrostachys juncea translation initiation fac... 196 7e-47
34emb|AJ238624.1|SVE238624 Senecio vernalis mRNA for translation i... 192 1e-45
35gb|AF516357.1| Hevea brasiliensis eukaryotic translation initiat... 190 4e-45
36gb|AY496435.1| Brassica napus eukaryotic translation initiation ... 182 1e-42
37emb|Y07920.1|ZMTRINF5A Z.mays mRNA for translation initiation fa... 172 1e-39
38gb|AY103556.1| Zea mays PCO150862 mRNA sequence 172 1e-39
39emb|X63542.1|NPNEIF5A2 N.plumbaginifolia mRNA NeIF-5A2 for initi... 167 6e-38
40gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 165 2e-37
41gb|AC079887.17| Oryza sativa (japonica cultivar-group) chromosom... 165 2e-37
42gb|AC084282.6| Oryza sativa chromosome 3 BAC OSJNBb0048A17 genom... 165 2e-37
43dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 165 2e-37
44dbj|AB004825.1| Solanum tuberosum mRNA for eukaryotic initiation... 165 2e-37
45gb|AY484392.1| Capsicum annuum eukaryotic initiation factor 5A2 ... 163 9e-37
46gb|AY484391.1| Capsicum annuum mary storys protein mRNA, complet... 163 9e-37
47gb|AY587771.1| Tamarix androssowii translation initiation factor... 161 4e-36
48gb|BT018311.1| Zea mays clone EL01T0207A06.c mRNA sequence 159 1e-35
49ref|NM_105608.2| Arabidopsis thaliana translation initiation fac... 157 6e-35
50gb|DQ200358.1| Solanum tuberosum clone 053D09 eukaryotic initiat... 157 6e-35
51gb|AY060530.1| Arabidopsis thaliana At1g69410/F10D13.8 mRNA, com... 157 6e-35
52gb|AF372933.1|AF372933 Arabidopsis thaliana At1g69410/F10D13.8 m... 157 6e-35
53emb|BX818518.1|CNS0AE6E Arabidopsis thaliana Full-length cDNA Co... 157 6e-35
54gb|AY087040.1| Arabidopsis thaliana clone 30884 mRNA, complete s... 157 6e-35
55gb|AF296081.1|AF296081 Dianthus caryophyllus eukaryotic translat... 151 4e-33
56dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 149 1e-32
57dbj|AP003874.5| Oryza sativa (japonica cultivar-group) genomic D... 149 1e-32
58dbj|AP005244.3| Oryza sativa (japonica cultivar-group) genomic D... 149 1e-32
59gb|AY488173.1| Capsicum annuum M1C3b mRNA, partial sequence 145 2e-31
60gb|AF296085.1|AF296085 Lycopersicon esculentum eukaryotic transl... 139 1e-29
61dbj|D10399.1|RIC225 Oryza sativa mRNA for initiation factor eIF-... 139 1e-29
62gb|AF225297.1|AF225297 Euphorbia esula translation initiation fa... 135 2e-28
63ref|NM_102425.2| Arabidopsis thaliana translation initiation fac... 133 8e-28
64gb|BT016590.1| Zea mays clone Contig423 mRNA sequence 133 8e-28
65gb|BT017712.1| Zea mays clone EL01N0446G03.c mRNA sequence 133 8e-28
66gb|AF492850.1| Arabidopsis thaliana putative initiation factor 5... 133 8e-28
67gb|AY055789.1| Arabidopsis thaliana At1g26630/T24P13_1 mRNA, com... 133 8e-28
68gb|AY039588.1| Arabidopsis thaliana At1g26630/T24P13_1 mRNA, com... 133 8e-28
69emb|BX814148.1|CNS0AEAE Arabidopsis thaliana Full-length cDNA Co... 133 8e-28
70gb|AY084827.1| Arabidopsis thaliana clone 118823 mRNA, complete ... 133 8e-28
71gb|AF034943.1|AF034943 Zea mays translation initiation factor 5A... 133 8e-28
72gb|AF516356.1| Hevea brasiliensis eukaryotic translation initiat... 131 3e-27
73gb|DQ207846.1| Solanum tuberosum clone 073A09 eukaryotic initiat... 127 5e-26
74gb|AY389707.1| Hyacinthus orientalis eukaryotic translation init... 127 5e-26
75dbj|AB004827.1| Solanum tuberosum mRNA for eukaryotic initiation... 127 5e-26
76dbj|AB004824.1| Solanum tuberosum mRNA for eukaryotic initiation... 127 5e-26
77dbj|AB004823.1| Solanum tuberosum mRNA for eukaryotic initiation... 127 5e-26
78gb|AF516351.1| Hevea brasiliensis eukaryotic translation initiat... 123 8e-25
79gb|AF516350.1| Hevea brasiliensis eukaryotic translation initiat... 123 8e-25
80gb|DQ083198.1| Oryza sativa (indica cultivar-group) clone 5S10E1... 123 8e-25
81gb|AF296086.1|AF296086 Lycopersicon esculentum eukaryotic transl... 123 8e-25
82emb|X63541.1|NPNEIF5A1 N.plumbaginifolia mRNA NeIF-5A1 for initi... 121 3e-24
83gb|AF516353.1| Hevea brasiliensis eukaryotic translation initiat... 119 1e-23
84gb|AF516358.1| Hevea brasiliensis eukaryotic translation initiat... 117 5e-23
85gb|AF516352.1| Hevea brasiliensis eukaryotic translation initiat... 115 2e-22
86gb|AY961927.1| Picea abies eukaryotic translation initiation fac... 111 3e-21
87gb|AF516355.1| Hevea brasiliensis eukaryotic translation initiat... 111 3e-21
88gb|AF516354.1| Hevea brasiliensis eukaryotic translation initiat... 111 3e-21
89gb|AF266464.1|AF266464 Manihot esculenta translation initiation ... 111 3e-21
90gb|AF296084.1|AF296084 Lycopersicon esculentum eukaryotic transl... 111 3e-21
91emb|BX816465.1|CNS0ABU4 Arabidopsis thaliana Full-length cDNA Co... 111 3e-21
92emb|BX817162.1|CNS0ABMR Arabidopsis thaliana Full-length cDNA Co... 111 3e-21
93gb|AF323604.1|AF323604 Manihot esculenta initiation factor eIF5-... 111 3e-21
94gb|AC073178.9|AC073178 Arabidopsis thaliana chromosome 1 BAC F10... 111 3e-21
95gb|AC018364.5|AC018364 Arabidopsis thaliana chromosome 1 BAC F23... 111 3e-21
96ref|NM_101261.1| Arabidopsis thaliana EIF-5A; translation initia... 107 5e-20
97gb|AY961932.1| Picea abies eukaryotic translation initiation fac... 107 5e-20
98gb|AY117272.1| Arabidopsis thaliana putative initiation factor 5... 107 5e-20
99gb|AY063780.1| Arabidopsis thaliana putative initiation factor 5... 107 5e-20
100emb|X59441.1|MSEIF4DMR M.sativa mRNA for eIF-4D 107 5e-20
101gb|AF296082.1|AF296082 Arabidopsis thaliana eukaryotic translati... 107 5e-20
102emb|BX817272.1|CNS0AAJ3 Arabidopsis thaliana Full-length cDNA Co... 107 5e-20
103gb|DQ228346.1| Solanum tuberosum clone 148H01 eukaryotic initiat... 105 2e-19
104gb|DQ222495.1| Solanum tuberosum clone 103C10 eukaryotic initiat... 105 2e-19
105gb|AF416338.1|AF416338 Medicago sativa eukaryotic translation in... 105 2e-19
106dbj|AP004534.1| Lotus japonicus genomic DNA, chromosome 4, clone... 105 2e-19
107dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 103 7e-19
108dbj|AP004275.3| Oryza sativa (japonica cultivar-group) genomic D... 103 7e-19
109gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 103 7e-19
110emb|AL731759.2|CNS07YPA Oryza sativa chromosome 12, . BAC OSJNBa... 103 7e-19
111gb|AY961931.1| Picea abies eukaryotic translation initiation fac... 100 1e-17
112emb|BX814371.1|CNS0ABYU Arabidopsis thaliana Full-length cDNA Co... 100 1e-17
113gb|DQ407749.1| Gymnadenia conopsea eukaryotic translation initia... 98 5e-17
114dbj|AB004826.1| Solanum tuberosum mRNA for eukaryotic initiation... 98 5e-17
115gb|AY961929.1| Picea abies eukaryotic translation initiation fac... 94 7e-16
116emb|X63543.1|NTNEIF5A3 N.tabacum NeIF-5A3 gene for initiation fa... 90 1e-14
117gb|AC122160.21| Medicago truncatula clone mth2-23d6, complete se... 88 4e-14
118gb|AC152068.17| Medicago truncatula clone mth2-29p8, complete se... 88 4e-14
119gb|AY961930.1| Picea abies eukaryotic translation initiation fac... 86 2e-13
120emb|AJ608752.1| Nicotiana plumbaginifolia cDNA-AFLP fragment, cl... 86 2e-13
121dbj|AP004303.2| Oryza sativa (japonica cultivar-group) genomic D... 84 7e-13
122gb|AC006535.7|AC006535 Genomic sequence for Arabidopsis thaliana... 80 1e-11
123gb|AY961928.1| Picea abies eukaryotic translation initiation fac... 74 7e-10
124gb|AF296083.1|AF296083 Lycopersicon esculentum eukaryotic transl... 72 3e-09
125gb|AF329432.1| Crypthecodinium cohnii translation initiation fac... 66 2e-07
126ref|NM_186716.1| Oryza sativa (japonica cultivar-group), mRNA 64 6e-07
127emb|CR733838.2|CNS0GT0D Tetraodon nigroviridis full-length cDNA 64 6e-07
128emb|CR726932.2|CNS0GNUI Tetraodon nigroviridis full-length cDNA 64 6e-07
129emb|CR721475.2|CNS0GJMX Tetraodon nigroviridis full-length cDNA 64 6e-07
130emb|CR709005.2|CNS0GA0P Tetraodon nigroviridis full-length cDNA 64 6e-07
131emb|CR695202.2|CNS0FZDA Tetraodon nigroviridis full-length cDNA 64 6e-07
132emb|CR693511.2|CNS0FY2B Tetraodon nigroviridis full-length cDNA 64 6e-07
133emb|CR692588.2|CNS0FXCO Tetraodon nigroviridis full-length cDNA 64 6e-07
134emb|CR681099.2|CNS0FOHJ Tetraodon nigroviridis full-length cDNA 64 6e-07
135emb|CR679331.2|CNS0FN4F Tetraodon nigroviridis full-length cDNA 64 6e-07
136emb|CR679298.2|CNS0FN3I Tetraodon nigroviridis full-length cDNA 64 6e-07
137emb|CR677549.2|CNS0FLRC Tetraodon nigroviridis full-length cDNA 64 6e-07
138emb|CR677762.2|CNS0FLX6 Tetraodon nigroviridis full-length cDNA 64 6e-07
139emb|CR676683.2|CNS0FL3B Tetraodon nigroviridis full-length cDNA 64 6e-07
140emb|CR673625.2|CNS0FIQN Tetraodon nigroviridis full-length cDNA 64 6e-07
141emb|CR669512.2|CNS0FFKE Tetraodon nigroviridis full-length cDNA 64 6e-07
142emb|CR668234.2|CNS0FEKW Tetraodon nigroviridis full-length cDNA 64 6e-07
143emb|CR664325.2|CNS0FBKB Tetraodon nigroviridis full-length cDNA 64 6e-07
144emb|CR679002.1|CNS0FMVA Tetraodon nigroviridis full-length cDNA 62 3e-06
145emb|CR687566.2|CNS0FTH6 Tetraodon nigroviridis full-length cDNA 58 4e-05
146emb|AL121815.1|SPBC336 S.pombe chromosome II cosmid c336 58 4e-05
147ref|NM_001022048.1| Schizosaccharomyces pombe 972h- hypothetical... 58 4e-05
148ref|NM_102426.3| Arabidopsis thaliana unknown protein AT1G26640 ... 56 2e-04
149gb|AC007576.3| Arabidopsis thaliana chromosome I BAC F7A19 genom... 56 2e-04
150emb|CR735083.2|CNS0GTYY Tetraodon nigroviridis full-length cDNA 56 2e-04
151emb|CR734939.2|CNS0GTUY Tetraodon nigroviridis full-length cDNA 56 2e-04
152emb|CR674619.2|CNS0FJI9 Tetraodon nigroviridis full-length cDNA 56 2e-04
153emb|CR732972.2|CNS0GSH7 Tetraodon nigroviridis full-length cDNA 56 2e-04
154emb|CR728110.2|CNS0GOR8 Tetraodon nigroviridis full-length cDNA 56 2e-04
155emb|CR727086.2|CNS0GNYS Tetraodon nigroviridis full-length cDNA 56 2e-04
156emb|CR723793.2|CNS0GLFB Tetraodon nigroviridis full-length cDNA 56 2e-04
157emb|CR723119.2|CNS0GKWL Tetraodon nigroviridis full-length cDNA 56 2e-04
158emb|CR704324.2|CNS0G6EO Tetraodon nigroviridis full-length cDNA 56 2e-04
159emb|CR701860.2|CNS0G4I8 Tetraodon nigroviridis full-length cDNA 56 2e-04
160emb|CR694976.2|CNS0FZ70 Tetraodon nigroviridis full-length cDNA 56 2e-04
161emb|CR690497.2|CNS0FVQL Tetraodon nigroviridis full-length cDNA 56 2e-04
162emb|CR689165.2|CNS0FUPL Tetraodon nigroviridis full-length cDNA 56 2e-04
163emb|CR680208.2|CNS0FNSS Tetraodon nigroviridis full-length cDNA 56 2e-04
164emb|CR679806.1|CNS0FNHM Tetraodon nigroviridis full-length cDNA 56 2e-04
165emb|CR677093.2|CNS0FLEP Tetraodon nigroviridis full-length cDNA 56 2e-04
166emb|CR666270.2|CNS0FD2C Tetraodon nigroviridis full-length cDNA 56 2e-04
167emb|CR665688.2|CNS0FCM6 Tetraodon nigroviridis full-length cDNA 56 2e-04
168emb|CR664326.2|CNS0FBKC Tetraodon nigroviridis full-length cDNA 56 2e-04
169emb|CR663961.2|CNS0FBA7 Tetraodon nigroviridis full-length cDNA 56 2e-04
170emb|CR663558.2|CNS0FAZ0 Tetraodon nigroviridis full-length cDNA 56 2e-04
171emb|CR663257.2|CNS0FAQN Tetraodon nigroviridis full-length cDNA 56 2e-04
172emb|CR660890.2|CNS0F8WW Tetraodon nigroviridis full-length cDNA 56 2e-04
173emb|CR660318.2|CNS0F8H0 Tetraodon nigroviridis full-length cDNA 56 2e-04
174emb|CR658879.2|CNS0F7D1 Tetraodon nigroviridis full-length cDNA 56 2e-04
175emb|CR657648.2|CNS0F6EU Tetraodon nigroviridis full-length cDNA 56 2e-04
176emb|CR656930.2|CNS0F5UW Tetraodon nigroviridis full-length cDNA 56 2e-04
177emb|CR656825.2|CNS0F5RZ Tetraodon nigroviridis full-length cDNA 56 2e-04
178emb|CR632683.2|CNS0EN5D Tetraodon nigroviridis full-length cDNA 56 2e-04
179emb|CR632007.2|CNS0EMML Tetraodon nigroviridis full-length cDNA 56 2e-04
180emb|CR631901.2|CNS0EMJN Tetraodon nigroviridis full-length cDNA 56 2e-04
181gb|AC068197.4|AC068197 Genomic sequence for Arabidopsis thaliana... 56 2e-04
182emb|CR674419.2|CNS0FJCP Tetraodon nigroviridis full-length cDNA 54 6e-04
183ref|XM_382131.1| Gibberella zeae PH-1 chromosome 1 conserved hyp... 52 0.002
184emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 52 0.002
185gb|AC117827.6| Mus musculus chromosome 1, clone RP24-88L2, compl... 50 0.010
186gb|AC151350.2| Xenopus tropicalis clone ISB-400N1, complete sequ... 50 0.010
187ref|XM_369445.1| Magnaporthe grisea 70-15 chromosome III hypothe... 50 0.010
188emb|CR392002.14| Zebrafish DNA sequence from clone DKEY-61D19 in... 50 0.010
189emb|CR731732.2|CNS0GRJT Tetraodon nigroviridis full-length cDNA 50 0.010
190emb|CR728530.2|CNS0GP2W Tetraodon nigroviridis full-length cDNA 50 0.010
191emb|CR686010.2|CNS0FS9Y Tetraodon nigroviridis full-length cDNA 50 0.010
192emb|AL391134.13| Human DNA sequence from clone RP11-245M24 on ch... 50 0.010
193emb|BX547935.12| Zebrafish DNA sequence from clone CH211-207C1 i... 50 0.010
194emb|BX950219.10| Mouse DNA sequence from clone RP23-303E24 on ch... 50 0.010
195gb|AC102666.13| Mus musculus chromosome 1, clone RP23-444A8, com... 50 0.010
196emb|CT030739.10| Mouse DNA sequence from clone RP24-496K8 on chr... 50 0.010
197gb|AC133097.3| Mus musculus BAC clone RP23-287O2 from 1, complet... 50 0.010
198gb|AC107677.7| Mus musculus chromosome 3, clone RP23-235F22, com... 48 0.038
199gb|AC156576.3| Mus musculus BAC clone RP23-7C22 from chromosome ... 48 0.038
200ref|XM_656527.1| Aspergillus nidulans FGSC A4 hypothetical prote... 48 0.038
201gb|AC122820.4| Mus musculus BAC clone RP23-200M5 from chromosome... 48 0.038
202ref|XM_745063.1| Aspergillus fumigatus Af293 eukaryotic initiati... 48 0.038
203gb|AC124486.4| Mus musculus BAC clone RP23-451E1 from chromosome... 48 0.038
204gb|AC124501.3| Mus musculus BAC clone RP23-412F10 from chromosom... 48 0.038
205gb|AC101142.9| Mus musculus chromosome 13, clone RP23-170P21, co... 48 0.038
206emb|AL683870.15| Human DNA sequence from clone RP11-261P4 on chr... 48 0.038
207gb|AC164168.3| Mus musculus 6 BAC RP23-343D21 (Roswell Park Canc... 48 0.038
208gb|AC164662.6| Mus musculus 10 BAC RP24-279D11 (Roswell Park Can... 48 0.038
209emb|AJ719748.1| Gallus gallus mRNA for hypothetical protein, clo... 48 0.038
210gb|AC098642.5| Genomic sequence for Mus musculus, clone RP23-270... 48 0.038
211dbj|AB226196.1| Aspergillus oryzae cDNA, contig sequence: AoEST3055 48 0.038
212gb|AC084407.10| Mus Musculus Strain C57BL6/J Chromosome 11 Clone... 48 0.038
213dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003 48 0.038
214emb|CR390079.1| Gallus gallus finished cDNA, clone ChEST993f19 48 0.038
215gb|AC154817.2| Mus musculus BAC clone RP23-72G6 from chromosome ... 48 0.038
216gb|AC153496.4| Mus musculus 10 BAC RP23-373D1 (Roswell Park Canc... 48 0.038
217emb|AL929209.17| Mouse DNA sequence from clone RP23-415C3 on chr... 48 0.038
218gb|AC140301.3| Mus musculus BAC clone RP23-435M8 from 5, complet... 48 0.038
219emb|AL606704.20| Mouse DNA sequence from clone RP23-375B1 on chr... 48 0.038
220emb|AL672188.6| Mouse DNA sequence from clone RP23-53B2 on chrom... 48 0.038
221gb|AC118009.7| Mus musculus chromosome 8, clone RP23-442H2, comp... 46 0.15
222gb|AC122239.4| Mus musculus BAC clone RP23-143K14 from chromosom... 46 0.15
223ref|XM_546586.2| PREDICTED: Canis familiaris similar to eukaryot... 46 0.15
224ref|XM_843935.1| PREDICTED: Canis familiaris similar to eukaryot... 46 0.15
225emb|CR699189.1|CNS0G2G1 Tetraodon nigroviridis full-length cDNA 46 0.15
226emb|CR667426.2|CNS0FDYG Tetraodon nigroviridis full-length cDNA 46 0.15
227gb|AC142328.1| Pan troglodytes BAC clone RP43-24E4 from 7, compl... 46 0.15
228emb|AJ391219.1|APY391219 Aethia pygmaea microsatellite DNA, clon... 46 0.15
229emb|AL591521.8| Human DNA sequence from clone RP5-965F6 on chrom... 46 0.15
230emb|AL589740.4| Human DNA sequence from clone RP11-436D23 on chr... 46 0.15
231emb|AL512510.13| Human DNA sequence from clone RP11-537P24 on ch... 46 0.15
232gb|AC098719.3| Mus musculus clone RP23-2M3, complete sequence 46 0.15
233gb|AF385410.1|AF385410 Cricetulus griseus eukaryotic translation... 46 0.15
234gb|AC024887.22| Homo sapiens 3 BAC RP11-307B9 (Roswell Park Canc... 46 0.15
235gb|AC112230.5| Homo sapiens BAC clone RP11-85D18 from 2, complet... 46 0.15
236gb|AF054116.1|AF054116 Rattus norvegicus polymorphic marker D5UI... 46 0.15
237gb|AY610331.1| Sus scrofa clone rebs02c_k2.y1.abd, mRNA sequence 46 0.15
238gb|AC149588.4| Mus musculus BAC clone RP23-366I10 from 15, compl... 46 0.15
239gb|AC124097.6| Mus musculus chromosome 15, clone RP23-431H12, co... 44 0.60
240gb|AC111115.13| Mus musculus chromosome 5, clone RP23-213H20, co... 44 0.60
241gb|AC110195.14| Mus musculus chromosome 3, clone RP24-291L17, co... 44 0.60
242gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome... 44 0.60
243gb|AC162466.6| Mus musculus 6 BAC RP23-196O2 (Roswell Park Cance... 44 0.60
244gb|AC115930.10| Mus musculus chromosome 3, clone RP24-534H10, co... 44 0.60
245gb|AC099644.6| Mus musculus chromosome 15, clone RP24-359B20, co... 44 0.60
246ref|NM_001013019.1| Mus musculus RIKEN cDNA 1110067I12 gene (111... 44 0.60
247gb|AC161210.5| Mus musculus chromosome 3, clone RP23-71N6, compl... 44 0.60
248gb|AF153595.1| Sebastes alutus microsatellite Sal1,6 sequence 44 0.60
249gb|AY324145.1| Desmognathus auriculatus clone Dau11 microsatelli... 44 0.60
250gb|U93889.1|MNU93889 Megaptera novaeangliae clone GATA019 micros... 44 0.60
251gb|AY024187.1| Oryza sativa microsatellite MRG6512 containing (T... 44 0.60
252gb|AY024166.1| Oryza sativa microsatellite MRG6491 containing (T... 44 0.60
253gb|AY023432.1| Oryza sativa microsatellite MRG5757 containing (T... 44 0.60
254gb|AY023429.1| Oryza sativa microsatellite MRG5754 containing (T... 44 0.60
255gb|AC145809.3| Oryza sativa (japonica cultivar-group) chromosome... 44 0.60
256gb|AC151815.1| Solanum demissum chromosome 5 clone PGEC472P22 ma... 44 0.60
257gb|AC149301.1| Solanum demissum chromosome 5 clone PGEC517A09 ma... 44 0.60
258gb|AC162291.13| Mus musculus chromosome 18, clone RP23-264B14, c... 44 0.60
259gb|AY730340.1| Solanum tuberosum strain P6/210 clone BAC BA87d17... 44 0.60
260gb|AC142496.2| Homo sapiens chromosome X clone RP1-8N8 map p11.2... 44 0.60
261gb|AY526337.1| Panulirus argus clone Par3(4D19) microsatellite s... 44 0.60
262gb|AC115878.12| Mus musculus chromosome 15, clone RP24-358G9, co... 44 0.60
263gb|AC133874.10| Mus musculus chromosome 19, clone RP23-81N16, co... 44 0.60
264gb|AC100986.9| Mus musculus chromosome 3, clone RP23-77E5, compl... 44 0.60
265gb|AC134611.4| Mus musculus BAC clone RP23-98D8 from chromosome ... 44 0.60
266gb|AC120845.11| Mus musculus chromosome 3, clone RP23-468E4, com... 44 0.60
267gb|AC133649.2| Mus musculus BAC clone RP23-341M13 from chromosom... 44 0.60
268gb|AC147380.2| Mus musculus BAC clone RP24-119J10 from chromosom... 44 0.60
269gb|AC139335.3| Mus musculus BAC clone RP23-376N11 from chromosom... 44 0.60
270gb|AC102195.14| Mus musculus chromosome 18, clone RP24-430B21, c... 44 0.60
271gb|AY572977.1| Branchiostoma belcheri eukaryotic translation ini... 44 0.60
272gb|AC162285.6| Mus musculus chromosome 7, clone RP23-312O8, comp... 44 0.60
273gb|AC165348.3| Mus musculus BAC clone RP23-300C11 from chromosom... 44 0.60
274gb|AC164603.4| Mus musculus chromosome 8, clone RP24-114E3, comp... 44 0.60
275gb|DQ168326.1| Solanum tuberosum clone 149E01 metallocarboxypept... 44 0.60
276gb|DQ168312.1| Solanum tuberosum clone 024H10 metallocarboxypept... 44 0.60
277gb|AC164102.2| Mus musculus BAC clone RP23-7E23 from chromosome ... 44 0.60
278gb|AC137991.3| Oryza sativa chromosome 3 BAC OSJNBa0034D21 genom... 44 0.60
279gb|AC139863.5| Mus musculus chromosome 14, clone RP23-19M21, com... 44 0.60
280gb|AC118227.12| Mus musculus chromosome 15, clone RP23-379H6, co... 44 0.60
281emb|BX908756.12| Zebrafish DNA sequence from clone CH211-190D13 ... 44 0.60
282emb|AL133390.7| Human DNA sequence from clone RP1-317G22 on chro... 44 0.60
283ref|XM_570147.1| Cryptococcus neoformans var. neoformans JEC21 i... 44 0.60
284gb|AC124444.4| Mus musculus BAC clone RP24-185P7 from chromosome... 44 0.60
285gb|AC130550.4| Mus musculus BAC clone RP24-463N15 from chromosom... 44 0.60
286gb|AC118607.12| Mus musculus chromosome 14, clone RP23-479D1, co... 44 0.60
287gb|AC121996.3| Mus musculus BAC clone RP24-312F5 from chromosome... 44 0.60
288gb|AC129217.3| Mus musculus BAC clone RP24-458M20 from chromosom... 44 0.60
289gb|AC127563.4| Mus musculus BAC clone RP24-283E13 from chromosom... 44 0.60
290gb|AC124523.5| Mus musculus BAC clone RP23-399P19 from chromosom... 44 0.60
291gb|AC112792.4| Mus musculus BAC clone RP23-192J17 from 18, compl... 44 0.60
292gb|AC124752.4| Mus musculus BAC clone RP23-283G18 from 13, compl... 44 0.60
293gb|AC122880.4| Mus musculus BAC clone RP23-77F18 from 8, complet... 44 0.60
294gb|AC122912.2| Mus musculus BAC clone RP23-61E5 from 7, complete... 44 0.60
295gb|AC114006.3| Mus musculus BAC clone RP23-185F9 from 17, comple... 44 0.60
296gb|AC122027.1| Mus musculus BAC clone RP24-390L20 from 1, comple... 44 0.60
297gb|AC114823.4| Mus musculus BAC clone RP23-209L10 from 2, comple... 44 0.60
298gb|AC107369.9| Mus musculus chromosome 15, clone RP23-368M2, com... 44 0.60
299gb|AC113025.9| Mus musculus chromosome 6, clone RP23-196D12, com... 44 0.60
300gb|AC093714.2| Homo sapiens BAC clone RP11-458K10 from 7, comple... 44 0.60
301gb|AC116451.7| Mus musculus chromosome 19, clone RP24-273P9, com... 44 0.60
302gb|AC100590.9| Mus musculus chromosome 10, clone RP23-156N5, com... 44 0.60
303gb|AC107781.9| Mus musculus, clone RP23-56O1, complete sequence 44 0.60
304emb|AL391840.6| Human DNA sequence from clone RP11-342L8 on chro... 44 0.60
305gb|AC159970.4| Mus musculus chromosome 3, clone RP23-301J11, com... 44 0.60
306emb|AL022161.1|HS380C13 Human DNA sequence from clone RP3-380C13... 44 0.60
307emb|Z99126.1|SPAC26H5 S.pombe chromosome I cosmid c26H5 44 0.60
308gb|AC073153.16| Mus musculus Strain C57BL6/J chromosome 19 BAC, ... 44 0.60
309gb|AC165148.2| Mus musculus BAC clone RP24-278K24 from chromosom... 44 0.60
310emb|CR352297.14| Zebrafish DNA sequence from clone CH211-165L15 ... 44 0.60
311emb|CR384099.6| Zebrafish DNA sequence from clone DKEY-266I18 in... 44 0.60
312emb|BX323089.13| Zebrafish DNA sequence from clone DKEYP-10D2 in... 44 0.60
313emb|AL713925.10| Mouse DNA sequence from clone RP23-298B18 on ch... 44 0.60
314emb|AL646093.9| Mouse DNA sequence from clone RP23-55I2 on chrom... 44 0.60
315emb|AL669858.8| Mouse DNA sequence from clone RP23-51G7 on chrom... 44 0.60
316emb|AL663035.8| Mouse DNA sequence from clone RP23-432G17 on chr... 44 0.60
317emb|BX276104.14| Mouse DNA sequence from clone RP24-313E3 on chr... 44 0.60
318emb|AL928592.13| Mouse DNA sequence from clone RP24-168J7 on chr... 44 0.60
319emb|BX511109.4| Zebrafish DNA sequence from clone DKEY-288G16 in... 44 0.60
320gb|AC124771.4| Mus musculus BAC clone RP23-28G12 from chromosome... 44 0.60
321emb|AL929566.30| Zebrafish DNA sequence from clone CH211-159C13 ... 44 0.60
322emb|CR293511.11| Zebrafish DNA sequence from clone DKEY-93H22 in... 44 0.60
323emb|BX629347.20| Zebrafish DNA sequence from clone DKEY-103K21 i... 44 0.60
324gb|DQ402491.1| Liposcelis decolor microsatellite Lip135 sequence 44 0.60
325emb|AL844587.19| Zebrafish DNA sequence from clone DKEY-7E14 in ... 44 0.60
326gb|AC008249.14| Homo sapiens 3 BAC RP11-211P13 (Roswell Park Can... 44 0.60
327emb|BX571955.15| Zebrafish DNA sequence from clone DKEY-27B3 in ... 44 0.60
328gb|AC006065.3| Homo sapiens 12q24.2 BAC RPCI11-407A16 (Roswell P... 44 0.60
329gb|AC097515.5| Homo sapiens BAC clone RP11-446J8 from 4, complet... 44 0.60
330gb|AY034584.1| Mus musculus cathepsin M (CtsM) pseudogene, parti... 44 0.60
331gb|AF467894.1|AF467894 Homo sapiens cytochrome P450, subfamily I... 44 0.60
332gb|AC083751.6| Genomic sequence for Oryza sativa, Nipponbare str... 44 0.60
333gb|AC147620.5| Mus musculus BAC clone RP24-285H21 from chromosom... 44 0.60
334gb|AC153596.5| Mus musculus 6 BAC RP23-305C1 (Roswell Park Cance... 44 0.60
335emb|BX571983.11| Zebrafish DNA sequence from clone DKEY-18M7 in ... 44 0.60
336gb|AC096627.28| Mus musculus strain C57BL/6J clone rp23-77b23 ma... 44 0.60
337gb|AC159099.4| Mus musculus chromosome 15, clone RP24-132A22, co... 44 0.60
338gb|AC158239.2| Mus musculus BAC clone RP23-48A24 from chromosome... 44 0.60
339gb|AC158533.2| Mus musculus BAC clone RP23-107I15 from chromosom... 44 0.60
340gb|AC131183.4| Mus musculus BAC clone RP23-225A14 from chromosom... 44 0.60
341gb|AC154778.2| Mus musculus BAC clone RP24-459I17 from chromosom... 44 0.60
342ref|NM_001019886.1| Schizosaccharomyces pombe 972h- hypothetical... 44 0.60
343dbj|AK087615.1| Mus musculus 2 days pregnant adult female oviduc... 44 0.60
344dbj|AK049485.1| Mus musculus 7 days embryo whole body cDNA, RIKE... 44 0.60
345dbj|AK049402.1| Mus musculus 7 days embryo whole body cDNA, RIKE... 44 0.60
346gb|AC006576.15| Homo sapiens Chromosome 12p13.3 BAC Clone 762c12... 44 0.60
347gb|AC005336.1|AC005336 Homo sapien chromosome 19, cosmid F20129,... 44 0.60
348gb|AF226042.1|AF226038S5 Mus musculus isovaleryl CoA dehydrogena... 44 0.60
349ref|NG_002774.1| Mus musculus cathepsin M, pseudogene (Ctsm-ps) ... 44 0.60
350emb|BX539340.7| Zebrafish DNA sequence from clone DKEY-57K2 in l... 44 0.60
351emb|AL116789.1|CNS01DGD Botrytis cinerea strain T4 cDNA library 44 0.60
352emb|AL116272.1|CNS01D20 Botrytis cinerea strain T4 cDNA library 44 0.60
353emb|AL113348.1|CNS01ASS Botrytis cinerea strain T4 cDNA library 44 0.60
354emb|BX005024.13| Zebrafish DNA sequence from clone DKEY-211F1, c... 44 0.60
355dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.60
356dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.60
357dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.60
358emb|BX085194.14| Zebrafish DNA sequence from clone DKEY-242M13, ... 44 0.60
359gb|AC079818.56| Mus musculus strain C57BL/6J chromosome 10 clone... 44 0.60
360gb|AC005104.1| Homo sapiens BAC clone CTA-442F18 from 2, complet... 44 0.60
361gb|AC102461.15| Mus musculus chromosome 8, clone RP24-319H6, com... 44 0.60
362gb|AC005904.19| Homo sapiens 12 PAC RP4-751H1 (Roswell Park Canc... 44 0.60
363dbj|AP002744.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.60
364gb|AY183109.1| Trifolium repens clone c3.10 microsatellite sequence 44 0.60
365gb|AY183098.1| Trifolium repens clone c1.9 microsatellite sequence 44 0.60
366gb|AY183073.1| Trifolium repens clone a2.22 microsatellite sequence 44 0.60
367gb|AY183071.1| Trifolium repens clone A2.10 microsatellite sequence 44 0.60
368gb|AF482426.1| Homo sapiens encephalopsin splice variant 1 (OPN3... 44 0.60
369gb|AC068812.13|AC068812 Homo sapiens chromosome N/A clone RP11-2... 44 0.60
370gb|AC012155.17|AC012155 Homo sapiens 6 BAC RP11-114J19 (Roswell ... 44 0.60
371gb|AY178300.1| Trifolium repens microsatellite agr1012 sequence 44 0.60
372gb|AY178297.1| Trifolium repens microsatellite agr1009 sequence 44 0.60
373gb|AY178296.1| Trifolium repens microsatellite agr1007 sequence 44 0.60
374gb|AC124982.13| Mus musculus chromosome 3, clone RP24-173F6, com... 44 0.60
375gb|AC011001.2|AC011001 Arabidopsis thaliana chromosome I BAC F4H... 44 0.60
376dbj|AP002839.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.60
377gb|AC107815.11| Mus musculus chromosome 7, clone RP23-114A6, com... 44 0.60
378dbj|AP005875.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.60
379emb|AL935129.25| Mouse DNA sequence from clone RP23-181O3 on chr... 44 0.60
380emb|BX649621.5| Mouse DNA sequence from clone RP23-173F3 on chro... 44 0.60
381dbj|BS000169.1| Pan troglodytes chromosome 22 clone:RP43-042E01,... 44 0.60
382gb|AC121359.8| Mus musculus chromosome 15, clone RP23-138I21, co... 44 0.60
383dbj|AK067735.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.60
384emb|BX936406.24| Zebrafish DNA sequence from clone DKEY-13K17 in... 44 0.60
385emb|BX248410.4| Zebrafish DNA sequence from clone DKEY-65M5 in l... 44 0.60
386gb|AC119264.8| Mus musculus chromosome 15, clone RP24-289J12, co... 44 0.60
387emb|BX936423.12| Zebrafish DNA sequence from clone DKEY-174M14 i... 44 0.60
388emb|BX539307.6| Zebrafish DNA sequence from clone DKEY-253D23 in... 44 0.60
389emb|BX323595.8| Zebrafish DNA sequence from clone CH211-155O21 i... 44 0.60
390emb|BX120005.6| Zebrafish DNA sequence from clone RP71-56I13 in ... 44 0.60
391emb|BX000986.4| Zebrafish DNA sequence from clone CH211-210B19 i... 44 0.60
392emb|CR925790.6| Zebrafish DNA sequence from clone DKEY-275J21 in... 44 0.60
393gb|AC133283.13| Mus musculus chromosome 15, clone RP24-435N1, co... 44 0.60
394emb|BX901950.7| Zebrafish DNA sequence from clone DKEY-111C4 in ... 44 0.60
395gb|AC158911.7| Mus musculus chromosome 5, clone RP24-363D4, comp... 44 0.60
396emb|CT030740.8| Mouse DNA sequence from clone RP24-312D7 on chro... 44 0.60
397emb|AL162464.5|CNS01RHT Human chromosome 14 DNA sequence BAC R-8... 44 0.60
398emb|AL121775.3|CNS01DSG Human chromosome 14 DNA sequence BAC R-5... 44 0.60
399gb|AC107045.9| Mus musculus chromosome 1, clone RP23-334J7, comp... 44 0.60
400dbj|AP000626.5| Homo sapiens genomic DNA, chromosome 11q clone:C... 44 0.60
401gb|AC109608.14| Mus musculus strain C57BL/6J chromosome 5 clone ... 44 0.60
402gb|AC109606.11| Mus musculus strain C57BL/6J chromosome 5 clone ... 44 0.60
403gb|AC161764.4| Mus musculus BAC clone RP23-193D1 from chromosome... 44 0.60
404gb|AF056032.1|AF056032 Homo sapiens kynurenine 3-hydroxylase mRN... 44 0.60
405emb|AL928547.12| Mouse DNA sequence from clone RP23-226B16 on ch... 44 0.60
406gb|AC174083.2| Mus musculus BAC clone RP23-25B17 from chromosome... 44 0.60
407gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.60
408emb|AL929565.16| Mouse DNA sequence from clone RP23-454N16 on ch... 44 0.60
409gb|AC138456.5| Mus musculus BAC clone RP24-262P4 from 3, complet... 44 0.60
410emb|CT030233.6| Mouse DNA sequence from clone RP24-103C16 on chr... 44 0.60
411gb|AC134608.3| Mus musculus BAC clone RP23-68H13 from 13, comple... 44 0.60
412gb|AC151578.1| Mus musculus BAC clone RP23-218K4 from 18, comple... 44 0.60
413gb|M25858.1|HUMVWFA31 Human von Willebrand factor gene, exon 39,... 44 0.60
414gb|AC161488.7| Mus musculus chromosome 7, clone RP24-300N16, com... 44 0.60
415gb|AC161932.5| Mus musculus chromosome 18, clone RP24-78F20, com... 44 0.60
416gb|AC161166.7| Mus musculus chromosome 7, clone RP23-26A14, comp... 44 0.60
417ref|NM_003679.2| Homo sapiens kynurenine 3-monooxygenase (kynure... 44 0.60
418emb|AL845518.6| Mouse DNA sequence from clone RP23-300M9 on chro... 44 0.60
419emb|AL607074.13| Mouse DNA sequence from clone RP23-174M9 on chr... 44 0.60
420emb|AL607066.23| Mouse DNA sequence from clone RP23-406N5 on chr... 44 0.60
421emb|AL672106.9| Mouse DNA sequence from clone RP23-372E6 on chro... 44 0.60
422emb|AL845500.6| Mouse DNA sequence from clone RP23-221K3 on chro... 44 0.60
423emb|AL772255.12| Mouse DNA sequence from clone RP23-172B16 on ch... 44 0.60
424gb|AC164983.2| Mus musculus BAC clone RP23-16J24 from chromosome... 44 0.60
425emb|AL732448.6| Mouse DNA sequence from clone RP23-116F12 on chr... 44 0.60
426emb|AL713916.13| Mouse DNA sequence from clone RP23-129N3 on chr... 44 0.60
427emb|AL627076.14| Mouse DNA sequence from clone RP23-402I22 on ch... 44 0.60
428emb|AL663028.12| Mouse DNA sequence from clone RP23-23J11 on chr... 44 0.60
429gb|AC154026.1| Mus musculus 6 NOVECTOR RP24-423A5 (Roswell Park ... 42 2.4
430gb|AC121281.19| Mus musculus chromosome 3, clone RP23-61G16, com... 42 2.4
431gb|AC115727.10| Mus musculus chromosome 3, clone RP23-30A13, com... 42 2.4
432gb|AC102696.6| Mus musculus chromosome 7, clone RP24-112I14, com... 42 2.4
433gb|AC154262.1| Mus musculus chromosome 14 clone RP24-304G19, com... 42 2.4
434gb|AC116896.7| Mus musculus chromosome 8, clone RP24-531D19, com... 42 2.4
435gb|AC136372.13| Mus musculus chromosome 15, clone RP23-232G24, c... 42 2.4
436gb|AC160134.2| Mus musculus BAC clone RP23-139G11 from chromosom... 42 2.4
437gb|AC102908.11| Mus musculus chromosome 16, clone RP24-288K2, co... 42 2.4
438gb|AC101748.7| Mus musculus chromosome 5, clone RP24-133H21, com... 42 2.4
439gb|AC165078.2| Mus musculus BAC clone RP24-287O1 from chromosome... 42 2.4
440gb|AC153380.1| Mus musculus BAC RP23-256G5 (Roswell Park Cancer... 42 2.4
441gb|AC161571.11| Mus musculus chromosome 7, clone RP23-403M22, co... 42 2.4
442gb|AC164079.11| Mus musculus chromosome 1, clone RP23-15E12, com... 42 2.4
443gb|AC170862.1| Mus musculus chromosome 19, clone wi1-593J16, com... 42 2.4
444gb|AC163689.3| Mus musculus BAC clone CH36-200G6 from chromosome... 42 2.4
445gb|AC154102.15| Mus musculus chromosome 8, clone RP24-186O14, co... 42 2.4
446gb|AC125018.15| Mus musculus chromosome 7, clone RP24-158A20, co... 42 2.4
447gb|AC153645.4| Mus musculus BAC clone RP24-534E8 from chromosome... 42 2.4
448gb|AC164095.4| Mus musculus BAC clone RP23-355A22 from chromosom... 42 2.4
449gb|AC164648.3| Mus musculus BAC clone RP23-434H4 from chromosome... 42 2.4
450gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosom... 42 2.4
451gb|AC134662.11| Mus musculus chromosome 15, clone RP24-445D14, c... 42 2.4
452gb|AC116121.8| Mus musculus chromosome 8, clone RP23-79K4, compl... 42 2.4
453gb|AC108768.14| Mus musculus chromosome 8, clone RP23-398L15, co... 42 2.4
454gb|AC154786.2| Mus musculus BAC clone RP24-468B14 from chromosom... 42 2.4
455gb|AC102081.15| Mus musculus chromosome 18, clone RP23-43H5, com... 42 2.4
456gb|AC167963.5| Mus musculus chromosome 1, clone RP24-171A4, comp... 42 2.4
457gb|AC152999.1| Homo sapiens chromosome X clone Qc-3H10 map q28, ... 42 2.4
458gb|AC107757.15| Mus musculus chromosome 15, clone RP23-207L14, c... 42 2.4
459gb|AC115691.8| Mus musculus chromosome 18, clone RP24-286B14, co... 42 2.4
460gb|AC131085.16| Mus musculus chromosome 13, clone RP23-452D10, c... 42 2.4
461gb|AC115011.27| Mus musculus chromosome 1, clone RP24-192A11, co... 42 2.4
462gb|AC118193.9| Mus musculus chromosome 8, clone RP23-241A10, com... 42 2.4
463gb|AC115749.12| Mus musculus chromosome 3, clone RP23-14C17, com... 42 2.4
464gb|AC122014.3| Mus musculus chromosome 1 clone RP24-358F15, comp... 42 2.4
465gb|AC104203.11| Mus musculus chromosome 5, clone RP24-301M6, com... 42 2.4
466gb|AC102525.8| Mus musculus chromosome 8, clone RP24-133K20, com... 42 2.4
467gb|AC123703.8| Mus musculus chromosome 3, clone RP23-345N18, com... 42 2.4
468gb|AC154555.3| Mus musculus BAC clone RP23-418L12 from chromosom... 42 2.4
469gb|AC163612.3| Mus musculus BAC clone RP23-89N5 from chromosome ... 42 2.4
470gb|AC154236.2| Mus musculus BAC clone RP24-160E14 from chromosom... 42 2.4
471gb|AC163281.3| Mus musculus BAC clone RP23-443B19 from chromosom... 42 2.4
472gb|AC166821.2| Mus musculus BAC clone RP24-68F22 from chromosome... 42 2.4
473gb|AC159285.3| Mus musculus BAC clone RP23-306M13 from chromosom... 42 2.4
474gb|AC165075.3| Mus musculus BAC clone RP24-465N15 from chromosom... 42 2.4
475gb|AC161411.11| Mus musculus chromosome 1, clone RP24-223E1, com... 42 2.4
476gb|AC169502.1| Mus musculus BAC clone RP24-409G12 from chromosom... 42 2.4
477gb|AC165317.8| Mus musculus chromosome 5, clone RP23-265O20, com... 42 2.4
478gb|AC169503.1| Mus musculus BAC clone RP24-281B5 from chromosome... 42 2.4
479gb|AC162520.7| Mus musculus chromosome 5, clone RP24-118C7, comp... 42 2.4
480gb|AC169813.2| Rhesus Macaque BAC CH250-16M3 (Children's Hospit... 42 2.4
481gb|AC114653.11| Mus musculus chromosome 5, clone RP24-158G19, co... 42 2.4
482gb|AC137842.8| Mus musculus chromosome 15, clone RP23-91M6, comp... 42 2.4
483gb|AC163094.5| Mus musculus chromosome 5, clone RP23-123P10, com... 42 2.4
484gb|AC104918.13| Mus musculus chromosome 7, clone RP23-335G1, com... 42 2.4
485gb|AC154107.3| Mus musculus BAC clone RP23-67L1 from chromosome ... 42 2.4
486gb|AC102150.10| Mus musculus chromosome 7, clone RP23-310N5, com... 42 2.4
487gb|AC110194.11| Mus musculus chromosome 7, clone RP23-238J3, com... 42 2.4
488gb|AY453831.1| Mandarina ponderosa clone Mpo5 microsatellite seq... 42 2.4
489gb|AC129588.10| Mus musculus chromosome 3, clone RP23-296L7, com... 42 2.4
490gb|AC152010.1| Homo sapiens chromosome X clone Qc-13B12 map q28,... 42 2.4
491gb|AC151961.1| Homo sapiens chromosome X clone RP11-76K17 map q2... 42 2.4
492gb|AC151960.1| Homo sapiens chromosome X clone RP11-76K17 map q2... 42 2.4
493gb|AC151959.1| Homo sapiens chromosome X clone RP11-76K17 map q2... 42 2.4
494gb|AC102410.5| Mus musculus chromosome 18, clone RP24-369O1, com... 42 2.4
495gb|AC124083.14| Mus musculus chromosome 5, clone RP24-400H4, com... 42 2.4
496gb|AC119856.13| Mus musculus chromosome 5, clone RP23-256B18, co... 42 2.4
497gb|AC107786.14| Mus musculus chromosome 5, clone RP23-5E3, compl... 42 2.4
498gb|AC168277.2| Mus musculus BAC RP24-186L17 (Roswell Park Cance... 42 2.4
499gb|AC079290.12| Mus musculus chromosome 18, clone RP23-330E13, c... 42 2.4
500gb|AC120867.10| Mus musculus chromosome 5, clone RP23-91O14, com... 42 2.4

>gb|DQ167203.2| Triticum aestivum eukaryotic translation initiation factor 5A3
           mRNA, complete cds
          Length = 768

 Score = 1098 bits (554), Expect = 0.0
 Identities = 596/610 (97%)
 Strand = Plus / Minus

                                                                       
Query: 72  ataatagagatagatagatagataacaaagtactagcagcacctcgagcattcggtgtaa 131
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 768 ataatagagatagatagatagataacaaagtactagcagcacctcgagcattcggtgtaa 709

                                                                       
Query: 132 aaaacacacaaatctggatcaaacttgtttcacccaacagatatcttgatgcctatgtat 191
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 708 aaaacacacaaatctggatcaaacttgtttcacccaacagatatcttgatgcctatgtat 649

                                                                       
Query: 192 gtgtatctcaaacacccagaagcactagataccaagtatcacagctaggcaaccatgcac 251
           |||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||
Sbjct: 648 gtgtatctcaaacacccagaagcactagataccaagtatcgcaggtaggcaaccacgcac 589

                                                                       
Query: 252 cgctgcttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggc 311
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 588 agctgcttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggc 529

                                                                       
Query: 312 agacatcacagacaggatcaggtccttgccatcagcaaatccagtcttgatctggccaag 371
            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 528 ggacatcacagacaggatcaggtccttgccatcagcaaatccagtcttgatctggccaag 469

                                                                       
Query: 372 cagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcag 431
           |||||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||
Sbjct: 468 cagaacatcatcagtgggaagcttcaggtcatccttagtgttaccactctcagtgagaag 409

                                                                       
Query: 432 gctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 491
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 408 gctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 349

                                                                       
Query: 492 aacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtc 551
            |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 348 gacgtcacagttgtgggatgaaggaacgatatcctcaagcttctttccattaaagatgtc 289

                                                                       
Query: 552 aatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctc 611
           ||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 288 aatggcaacaaagtgacactttgcgtgaccatgcttcccagtcttggaggtggagacctc 229

                                                                       
Query: 612 aacgaccttgcaggggcgggccttgatgacgatgtgtccacccttgcggatggcgccggc 671
           ||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 228 aacaaccttgcagggacgggccttgatgacgatgtgtccacccttgcggatggcgccggc 169

                     
Query: 672 ctgctgcggg 681
           ||||||||||
Sbjct: 168 ctgctgcggg 159



to top

>gb|DQ234393.1| Aegilops tauschii translation initiation factor 5A gene, complete
           cds
          Length = 636

 Score =  926 bits (467), Expect = 0.0
 Identities = 506/519 (97%)
 Strand = Plus / Minus

                                                                       
Query: 163 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 222
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 636 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 577

                                                                       
Query: 223 ccaagtatcacagctaggcaaccatgcaccgctgcttacttgccaccaccgatttccttc 282
           ||||||||| ||| |||||||||| |||| ||||||||||||||||||||||||||||||
Sbjct: 576 ccaagtatcgcaggtaggcaaccacgcacagctgcttacttgccaccaccgatttccttc 517

                                                                       
Query: 283 acagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcca 342
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 516 acagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtccttgcca 457

                                                                       
Query: 343 tcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtca 402
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 456 tcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtca 397

                                                                       
Query: 403 tccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatc 462
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 396 tccttagtgttgccactctcagtgagaaggctgacatatccatcatcagttatgtcaatc 337

                                                                       
Query: 463 agctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaata 522
           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 336 agctgataatcttggcggtcaacatgggggacgtcacagttgtgggatgaaggaacgata 277

                                                                       
Query: 523 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggcca 582
           |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 276 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtgacactttgcgtgacca 217

                                                                       
Query: 583 tgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacg 642
           |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 216 tgcttcccagtcttggaggtggagacctcaacaaccttgcagggacgggccttgatgacg 157

                                                  
Query: 643 atgtgtccacccttgcggatggcgccggcctgctgcggg 681
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 156 atgtgtccacccttgcggatggcgccggcctgctgcggg 118



to top

>gb|DQ234391.1| Secale cereale translation initiation factor 5A mRNA, complete cds
          Length = 636

 Score =  926 bits (467), Expect = 0.0
 Identities = 506/519 (97%)
 Strand = Plus / Minus

                                                                       
Query: 163 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 222
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 636 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 577

                                                                       
Query: 223 ccaagtatcacagctaggcaaccatgcaccgctgcttacttgccaccaccgatttccttc 282
           ||||||||| ||| |||||||||  |||| ||||||||||||||||||||||||||||||
Sbjct: 576 ccaagtatcgcaggtaggcaaccgcgcacagctgcttacttgccaccaccgatttccttc 517

                                                                       
Query: 283 acagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcca 342
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 516 acagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtccttgcca 457

                                                                       
Query: 343 tcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtca 402
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 456 tcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtca 397

                                                                       
Query: 403 tccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatc 462
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 396 tccttagtgttgccactctcagttagaaggctgacatatccatcatcagttatgtcaatc 337

                                                                       
Query: 463 agctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaata 522
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 336 agctgataatcttggcggtcaacatgggggacgtcacagttgtgggatgaaggaacaata 277

                                                                       
Query: 523 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggcca 582
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 276 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtgacca 217

                                                                       
Query: 583 tgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacg 642
           |||||||||||||| ||||||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 216 tgcttcccagtctttgaggtggagacctcaacaaccttgcagggacgggccttgatgacg 157

                                                  
Query: 643 atgtgtccacccttgcggatggcgccggcctgctgcggg 681
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 156 atgtgtccacccttgcggatggcgccggcctgctgcggg 118



to top

>gb|DQ234390.1| Dasypyrum breviaristatum translation initiation factor 5A mRNA,
           complete cds
          Length = 637

 Score =  912 bits (460), Expect = 0.0
 Identities = 506/520 (97%), Gaps = 1/520 (0%)
 Strand = Plus / Minus

                                                                       
Query: 163 acccaacagatatcttgatgcctatgtat-gtgtatctcaaacacccagaagcactagat 221
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 637 acccaacagatatcttgatgcctatgtattgtgtatctcaaacacccagaagcactagat 578

                                                                       
Query: 222 accaagtatcacagctaggcaaccatgcaccgctgcttacttgccaccaccgatttcctt 281
           |||||||||| ||| |||||||||| || | |||||||||||||||||||| ||||||||
Sbjct: 577 accaagtatcgcagataggcaaccacgcgcagctgcttacttgccaccaccaatttcctt 518

                                                                       
Query: 282 cacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcc 341
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 517 cacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcc 458

                                                                       
Query: 342 atcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtc 401
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 457 atcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtc 398

                                                                       
Query: 402 atccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaat 461
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 397 atccttagtgttgccactctcagtcagaaggctgacatatccatcatcagttatgtcaat 338

                                                                       
Query: 462 cagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaat 521
           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 337 cagctgataatcttggcggtcaacatgggggacgtcacagttgtgggatgaaggaacgat 278

                                                                       
Query: 522 atcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggcc 581
           ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| ||
Sbjct: 277 atcctcaagcttctttccattaaagatgtcaatggcaacgaagtgacactttgcgtgacc 218

                                                                       
Query: 582 atgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgac 641
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 217 atgcttcccagtcttggaggtggagacctcaacgaccttgcagggacgggccttgatgac 158

                                                   
Query: 642 gatgtgtccacccttgcggatggcgccggcctgctgcggg 681
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 157 gatgtgtccacccttgcggatggcgccggcctgctgcggg 118



to top

>gb|DQ234394.1| Secale sylvestre translation initiation factor 5A mRNA, complete
           cds
          Length = 636

 Score =  902 bits (455), Expect = 0.0
 Identities = 503/519 (96%)
 Strand = Plus / Minus

                                                                       
Query: 163 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 222
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 636 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 577

                                                                       
Query: 223 ccaagtatcacagctaggcaaccatgcaccgctgcttacttgccaccaccgatttccttc 282
           ||||||||| ||| |||||||||  |||| ||||||||||||||||||||||||||||| 
Sbjct: 576 ccaagtatcgcaggtaggcaaccgcgcacagctgcttacttgccaccaccgatttcctta 517

                                                                       
Query: 283 acagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcca 342
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 516 acagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtccttgcca 457

                                                                       
Query: 343 tcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtca 402
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 456 tcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtca 397

                                                                       
Query: 403 tccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatc 462
           ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 396 tccttagtgttgccactctcagtgagaaggctgacatatccatcatcagttatgtcaatc 337

                                                                       
Query: 463 agctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaata 522
           ||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||
Sbjct: 336 agctgataatcttggcggtcaacatgggggacgtcacagttgtgggatgaaggaacgata 277

                                                                       
Query: 523 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggcca 582
           |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||
Sbjct: 276 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtgacactttgcgtgacca 217

                                                                       
Query: 583 tgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacg 642
           ||| |||||||||||||||||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 216 tgcctcccagtcttggaggtggagacctcaacaaccttgcagggacgggccttgatgacg 157

                                                  
Query: 643 atgtgtccacccttgcggatggcgccggcctgctgcggg 681
           |||||||||||||||||||||||||||||||||||||||
Sbjct: 156 atgtgtccacccttgcggatggcgccggcctgctgcggg 118



to top

>gb|DQ234392.1| Thinopyrum intermedium translation initiation factor 5A mRNA,
           complete cds
          Length = 636

 Score =  807 bits (407), Expect = 0.0
 Identities = 491/519 (94%)
 Strand = Plus / Minus

                                                                       
Query: 163 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 222
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 636 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 577

                                                                       
Query: 223 ccaagtatcacagctaggcaaccatgcaccgctgcttacttgccaccaccgatttccttc 282
           ||||||| | |||||||||||||| |||| |||||||||||||||||||||| |||||||
Sbjct: 576 ccaagtaccgcagctaggcaaccacgcacagctgcttacttgccaccaccgacttccttc 517

                                                                       
Query: 283 acagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcca 342
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 516 acagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtccttgcca 457

                                                                       
Query: 343 tcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtca 402
           ||||||||||||| |||||||||| |||||||| ||||||||||||||||||||||||||
Sbjct: 456 tcagcaaatccagccttgatctgggcaagcagagcatcatcagtgggaagcttcaggtca 397

                                                                       
Query: 403 tccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatc 462
           ||||||||| ||||||||||||| || ||||||||||||||||||||||| |||||||||
Sbjct: 396 tccttagtgctgccactctcagttagaaggctgacatatccatcatcagtgatgtcaatc 337

                                                                       
Query: 463 agctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaata 522
           |||||| ||||  | |||  ||||||||| || |||||||||||||||||||| || |||
Sbjct: 336 agctgaaaatccagacgggtaacatgggggacatcacagttgtgggatgaagggacgata 277

                                                                       
Query: 523 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggcca 582
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 276 tcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtgacca 217

                                                                       
Query: 583 tgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacg 642
           |||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||
Sbjct: 216 tgcttcccagtcttggaggtggagacctcaacaaccttgcagggacgggccttgatgacg 157

                                                  
Query: 643 atgtgtccacccttgcggatggcgccggcctgctgcggg 681
           |||  ||||||||||||||||||||||||||||||||||
Sbjct: 156 atgaatccacccttgcggatggcgccggcctgctgcggg 118



to top

>gb|DQ167202.1| Triticum aestivum eukaryotic translation initiation factor 5A2 gene,
            complete cds
          Length = 1679

 Score =  363 bits (183), Expect = 5e-97
 Identities = 198/203 (97%)
 Strand = Plus / Minus

                                                                        
Query: 163  acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 222
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1679 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 1620

                                                                        
Query: 223  ccaagtatcacagctaggcaaccatgcaccgctgcttacttgccaccaccgatttccttc 282
            ||||||||| ||| |||||||||| |||| ||||||||||||||||||||||||||||||
Sbjct: 1619 ccaagtatcgcaggtaggcaaccacgcacagctgcttacttgccaccaccgatttccttc 1560

                                                                        
Query: 283  acagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcca 342
            ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 1559 acagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtccttgcca 1500

                                   
Query: 343  tcagcaaatccagtcttgatctg 365
            |||||||||||||||||||||||
Sbjct: 1499 tcagcaaatccagtcttgatctg 1477



 Score =  220 bits (111), Expect = 5e-54
 Identities = 123/127 (96%)
 Strand = Plus / Minus

                                                                        
Query: 493  acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1085 acgtcacagttgtgggatgaaggaacgatatcctcaagcttctttccattaaagatgtca 1026

                                                                        
Query: 553  atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
            |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1025 atggcaacaaagtgacactttgcgtgaccatgcttcccagtcttggaggtggagacctca 966

                   
Query: 613  acgacct 619
            || ||||
Sbjct: 965  acaacct 959



 Score =  117 bits (59), Expect = 5e-23
 Identities = 71/75 (94%)
 Strand = Plus / Minus

                                                                        
Query: 363  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 422
            ||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||
Sbjct: 1389 ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagggttaccactctc 1330

                           
Query: 423  agtcagcaggctgac 437
            ||| || ||||||||
Sbjct: 1329 agtgagaaggctgac 1315



 Score =  117 bits (59), Expect = 5e-23
 Identities = 65/67 (97%)
 Strand = Plus / Minus

                                                                       
Query: 615 gaccttgcaggggcgggccttgatgacgatgtgtccacccttgcggatggcgccggcctg 674
           |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 291 gaccttgcagggacgggccttgatgacgatgtgtccacccttgcggatggcgccagcctg 232

                  
Query: 675 ctgcggg 681
           |||||||
Sbjct: 231 ctgcggg 225



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                    
Query: 436  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 491
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1233 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 1178



to top

>gb|DQ167201.1| Triticum aestivum eukaryotic translation initiation factor 5A1 gene,
            complete cds
          Length = 1910

 Score =  363 bits (183), Expect = 5e-97
 Identities = 198/203 (97%)
 Strand = Plus / Minus

                                                                        
Query: 163  acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 222
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1910 acccaacagatatcttgatgcctatgtatgtgtatctcaaacacccagaagcactagata 1851

                                                                        
Query: 223  ccaagtatcacagctaggcaaccatgcaccgctgcttacttgccaccaccgatttccttc 282
            ||||||||| ||| |||||||||| |||| ||||||||||||||||||||||||||||||
Sbjct: 1850 ccaagtatcgcaggtaggcaaccacgcacagctgcttacttgccaccaccgatttccttc 1791

                                                                        
Query: 283  acagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcca 342
            ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 1790 acagcgcagatctgttcttcacccatggcggacatcacagacaggatcaggtccttgcca 1731

                                   
Query: 343  tcagcaaatccagtcttgatctg 365
            |||||||||||||||||||||||
Sbjct: 1730 tcagcaaatccagtcttgatctg 1708



 Score =  220 bits (111), Expect = 5e-54
 Identities = 123/127 (96%)
 Strand = Plus / Minus

                                                                        
Query: 493  acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
            |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1321 acgtcacagttgtgggatgaaggaacgatatcctcaagcttctttccattaaagatgtca 1262

                                                                        
Query: 553  atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
            |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1261 atggcaacaaagtgacactttgcgtgaccatgcttcccagtcttggaggtggagacctca 1202

                   
Query: 613  acgacct 619
            || ||||
Sbjct: 1201 acaacct 1195



 Score =  133 bits (67), Expect = 8e-28
 Identities = 73/75 (97%)
 Strand = Plus / Minus

                                                                        
Query: 363  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 422
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1622 ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 1563

                           
Query: 423  agtcagcaggctgac 437
            ||| || ||||||||
Sbjct: 1562 agttagaaggctgac 1548



 Score =  117 bits (59), Expect = 5e-23
 Identities = 62/63 (98%)
 Strand = Plus / Minus

                                                                       
Query: 615 gaccttgcaggggcgggccttgatgacgatgtgtccacccttgcggatggcgccggcctg 674
           |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 303 gaccttgcagggacgggccttgatgacgatgtgtccacccttgcggatggcgccggcctg 244

              
Query: 675 ctg 677
           |||
Sbjct: 243 ctg 241



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                    
Query: 436  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 491
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1465 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 1410



to top

>ref|NM_194115.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 863

 Score =  289 bits (146), Expect = 6e-75
 Identities = 331/392 (84%), Gaps = 3/392 (0%)
 Strand = Plus / Minus

                                                                       
Query: 289 cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatc---a 345
           ||||||||||||||||||||||| |||||||||| || |||||  |||||||| ||   |
Sbjct: 542 cagatctgttcttcacccatggcggacatcacagtcaagatcatatccttgccttcttca 483

                                                                       
Query: 346 gcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcc 405
            |||| ||  |||||||||||  |  ||||  |||||||||||||||| ||| |||||||
Sbjct: 482 ccaaacccgttcttgatctggttagtcagagtatcatcagtgggaagcctcaagtcatcc 423

                                                                       
Query: 406 ttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagc 465
           ||||||||||| ||||||||||  ||||| ||| ||||||| || |  ||||||||||||
Sbjct: 422 ttagtgttgccgctctcagtcaaaaggctcacaaatccatcttccgaaatgtcaatcagc 363

                                                                       
Query: 466 tgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcc 525
           || |||||    || |||||||| ||||||||||||||||||||||| || |||||||| 
Sbjct: 362 tggtaatcagtacgatcaacatgaggaacgtcacagttgtgggatgaggggacaatatct 303

                                                                       
Query: 526 tcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgc 585
           ||||||||||||||||| || ||||||||  ||||||||||||| || ||||| ||||||
Sbjct: 302 tcaagcttctttccattgaaaatgtcaataccaacaaagtggcatttggcgtgaccatgc 243

                                                                       
Query: 586 ttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacgatg 645
           |||||||||||||| || ||||||||||| |||||||||||||||  ||| ||||| || 
Sbjct: 242 ttcccagtcttggaagtagagacctcaaccaccttgcaggggcggttcttaatgacaata 183

                                           
Query: 646 tgtccacccttgcggatggcgccggcctgctg 677
           | |||   ||| ||||||| ||||||||||||
Sbjct: 182 tatccgttcttccggatggtgccggcctgctg 151



to top

>dbj|AK058206.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-010-A08, full
           insert sequence
          Length = 863

 Score =  289 bits (146), Expect = 6e-75
 Identities = 331/392 (84%), Gaps = 3/392 (0%)
 Strand = Plus / Minus

                                                                       
Query: 289 cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatc---a 345
           ||||||||||||||||||||||| |||||||||| || |||||  |||||||| ||   |
Sbjct: 542 cagatctgttcttcacccatggcggacatcacagtcaagatcatatccttgccttcttca 483

                                                                       
Query: 346 gcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcc 405
            |||| ||  |||||||||||  |  ||||  |||||||||||||||| ||| |||||||
Sbjct: 482 ccaaacccgttcttgatctggttagtcagagtatcatcagtgggaagcctcaagtcatcc 423

                                                                       
Query: 406 ttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagc 465
           ||||||||||| ||||||||||  ||||| ||| ||||||| || |  ||||||||||||
Sbjct: 422 ttagtgttgccgctctcagtcaaaaggctcacaaatccatcttccgaaatgtcaatcagc 363

                                                                       
Query: 466 tgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcc 525
           || |||||    || |||||||| ||||||||||||||||||||||| || |||||||| 
Sbjct: 362 tggtaatcagtacgatcaacatgaggaacgtcacagttgtgggatgaggggacaatatct 303

                                                                       
Query: 526 tcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgc 585
           ||||||||||||||||| || ||||||||  ||||||||||||| || ||||| ||||||
Sbjct: 302 tcaagcttctttccattgaaaatgtcaataccaacaaagtggcatttggcgtgaccatgc 243

                                                                       
Query: 586 ttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacgatg 645
           |||||||||||||| || ||||||||||| |||||||||||||||  ||| ||||| || 
Sbjct: 242 ttcccagtcttggaagtagagacctcaaccaccttgcaggggcggttcttaatgacaata 183

                                           
Query: 646 tgtccacccttgcggatggcgccggcctgctg 677
           | |||   ||| ||||||| ||||||||||||
Sbjct: 182 tatccgttcttccggatggtgccggcctgctg 151



to top

>ref|XM_469841.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 859

 Score =  287 bits (145), Expect = 2e-74
 Identities = 310/365 (84%)
 Strand = Plus / Minus

                                                                       
Query: 277 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 336
           ||||||| |||||||||||| || |||||||||||||||||||| |  |  ||||| |||
Sbjct: 542 tccttcagagcgcagatctgctcctcacccatggcagacatcacggtaacaatcagatcc 483

                                                                       
Query: 337 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 396
           || || || || ||||||  |||||||||   ||||||| | |||||| | || ||| ||
Sbjct: 482 ttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggagcctc 423

                                                                       
Query: 397 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 456
           |||||||||||||||   ||||| |||||||| ||||||||| ||||||| ||||  |||
Sbjct: 422 aggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcagaaatg 363

                                                                       
Query: 457 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 516
           |||||||||||||||||    ||||  || ||||| ||||||||||||||||| || || 
Sbjct: 362 tcaatcagctgataatcagtacggttcacgtgggggacgtcacagttgtgggaggagggc 303

                                                                       
Query: 517 acaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcg 576
           |||||||| ||||||||||| ||||| |||||||||||||| ||||||||||| ||||| 
Sbjct: 302 acaatatcttcaagcttcttcccattgaagatgtcaatggccacaaagtggcattttgca 243

                                                                       
Query: 577 tggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttg 636
           || ||||||||||||||||||||||||||||||||||| |||||||| ||||||  ||||
Sbjct: 242 tgtccatgcttcccagtcttggaggtggagacctcaacaaccttgcatgggcggttcttg 183

                
Query: 637 atgac 641
           |||||
Sbjct: 182 atgac 178



to top

>emb|AJ312906.1|OSA312906 Oryza sativa mRNA for translation initiation factor, eIF-5A (eIF-5A
           gene)
          Length = 831

 Score =  287 bits (145), Expect = 2e-74
 Identities = 310/365 (84%)
 Strand = Plus / Minus

                                                                       
Query: 277 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 336
           ||||||| |||||||||||| || |||||||||||||||||||| |  |  ||||| |||
Sbjct: 537 tccttcagagcgcagatctgctcctcacccatggcagacatcacggtaacaatcagatcc 478

                                                                       
Query: 337 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 396
           || || || || ||||||  |||||||||   ||||||| | |||||| | || ||| ||
Sbjct: 477 ttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggagcctc 418

                                                                       
Query: 397 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 456
           |||||||||||||||   ||||| |||||||| ||||||||| ||||||| ||||  |||
Sbjct: 417 aggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcagaaatg 358

                                                                       
Query: 457 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 516
           |||||||||||||||||    ||||  || ||||| ||||||||||||||||| || || 
Sbjct: 357 tcaatcagctgataatcagtacggttcacgtgggggacgtcacagttgtgggaggagggc 298

                                                                       
Query: 517 acaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcg 576
           |||||||| ||||||||||| ||||| |||||||||||||| ||||||||||| ||||| 
Sbjct: 297 acaatatcttcaagcttcttcccattgaagatgtcaatggccacaaagtggcattttgca 238

                                                                       
Query: 577 tggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttg 636
           || ||||||||||||||||||||||||||||||||||| |||||||| ||||||  ||||
Sbjct: 237 tgtccatgcttcccagtcttggaggtggagacctcaacaaccttgcatgggcggttcttg 178

                
Query: 637 atgac 641
           |||||
Sbjct: 177 atgac 173



to top

>emb|AJ252135.1|OSA252135 Oryza sativa mRNA for translation initiation factor eIF-5A
          Length = 722

 Score =  287 bits (145), Expect = 2e-74
 Identities = 310/365 (84%)
 Strand = Plus / Minus

                                                                       
Query: 277 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 336
           ||||||| |||||||||||| || |||||||||||||||||||| |  |  ||||| |||
Sbjct: 537 tccttcagagcgcagatctgctcctcacccatggcagacatcacggtaacaatcagatcc 478

                                                                       
Query: 337 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 396
           || || || || ||||||  |||||||||   ||||||| | |||||| | || ||| ||
Sbjct: 477 ttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggagcctc 418

                                                                       
Query: 397 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 456
           |||||||||||||||   ||||| |||||||| ||||||||| ||||||| ||||  |||
Sbjct: 417 aggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcagaaatg 358

                                                                       
Query: 457 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 516
           |||||||||||||||||    ||||  || ||||| ||||||||||||||||| || || 
Sbjct: 357 tcaatcagctgataatcagtacggttcacgtgggggacgtcacagttgtgggaggagggc 298

                                                                       
Query: 517 acaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcg 576
           |||||||| ||||||||||| ||||| |||||||||||||| ||||||||||| ||||| 
Sbjct: 297 acaatatcttcaagcttcttcccattgaagatgtcaatggccacaaagtggcattttgca 238

                                                                       
Query: 577 tggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttg 636
           || ||||||||||||||||||||||||||||||||||| |||||||| ||||||  ||||
Sbjct: 237 tgtccatgcttcccagtcttggaggtggagacctcaacaaccttgcatgggcggttcttg 178

                
Query: 637 atgac 641
           |||||
Sbjct: 177 atgac 173



to top

>dbj|AK121592.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033038B14, full
           insert sequence
          Length = 838

 Score =  287 bits (145), Expect = 2e-74
 Identities = 310/365 (84%)
 Strand = Plus / Minus

                                                                       
Query: 277 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 336
           ||||||| |||||||||||| || |||||||||||||||||||| |  |  ||||| |||
Sbjct: 547 tccttcagagcgcagatctgctcctcacccatggcagacatcacggtaacaatcagatcc 488

                                                                       
Query: 337 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 396
           || || || || ||||||  |||||||||   ||||||| | |||||| | || ||| ||
Sbjct: 487 ttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggagcctc 428

                                                                       
Query: 397 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 456
           |||||||||||||||   ||||| |||||||| ||||||||| ||||||| ||||  |||
Sbjct: 427 aggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcagaaatg 368

                                                                       
Query: 457 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 516
           |||||||||||||||||    ||||  || ||||| ||||||||||||||||| || || 
Sbjct: 367 tcaatcagctgataatcagtacggttcacgtgggggacgtcacagttgtgggaggagggc 308

                                                                       
Query: 517 acaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcg 576
           |||||||| ||||||||||| ||||| |||||||||||||| ||||||||||| ||||| 
Sbjct: 307 acaatatcttcaagcttcttcccattgaagatgtcaatggccacaaagtggcattttgca 248

                                                                       
Query: 577 tggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttg 636
           || ||||||||||||||||||||||||||||||||||| |||||||| ||||||  ||||
Sbjct: 247 tgtccatgcttcccagtcttggaggtggagacctcaacaaccttgcatgggcggttcttg 188

                
Query: 637 atgac 641
           |||||
Sbjct: 187 atgac 183



to top

>dbj|AK060387.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-G06, full
           insert sequence
          Length = 947

 Score =  287 bits (145), Expect = 2e-74
 Identities = 310/365 (84%)
 Strand = Plus / Minus

                                                                       
Query: 277 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 336
           ||||||| |||||||||||| || |||||||||||||||||||| |  |  ||||| |||
Sbjct: 553 tccttcagagcgcagatctgctcctcacccatggcagacatcacggtaacaatcagatcc 494

                                                                       
Query: 337 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 396
           || || || || ||||||  |||||||||   ||||||| | |||||| | || ||| ||
Sbjct: 493 ttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggagcctc 434

                                                                       
Query: 397 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 456
           |||||||||||||||   ||||| |||||||| ||||||||| ||||||| ||||  |||
Sbjct: 433 aggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcagaaatg 374

                                                                       
Query: 457 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 516
           |||||||||||||||||    ||||  || ||||| ||||||||||||||||| || || 
Sbjct: 373 tcaatcagctgataatcagtacggttcacgtgggggacgtcacagttgtgggaggagggc 314

                                                                       
Query: 517 acaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcg 576
           |||||||| ||||||||||| ||||| |||||||||||||| ||||||||||| ||||| 
Sbjct: 313 acaatatcttcaagcttcttcccattgaagatgtcaatggccacaaagtggcattttgca 254

                                                                       
Query: 577 tggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttg 636
           || ||||||||||||||||||||||||||||||||||| |||||||| ||||||  ||||
Sbjct: 253 tgtccatgcttcccagtcttggaggtggagacctcaacaaccttgcatgggcggttcttg 194

                
Query: 637 atgac 641
           |||||
Sbjct: 193 atgac 189



to top

>gb|DQ414518.1| Dasypyrum breviaristatum eukaryotic translation initiation factor
           eIF5A gene, partial cds
          Length = 1344

 Score =  228 bits (115), Expect = 2e-56
 Identities = 124/127 (97%)
 Strand = Plus / Minus

                                                                       
Query: 493 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 878 acgtcacagttgtgggatgaaggaacgatatcctcaagcttctttccattaaagatgtca 819

                                                                       
Query: 553 atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 818 atggcaacaaagtgacactttgcgtgaccatgcttcccagtcttggaggtggagacctca 759

                  
Query: 613 acgacct 619
           |||||||
Sbjct: 758 acgacct 752



 Score =  147 bits (74), Expect = 6e-32
 Identities = 74/74 (100%)
 Strand = Plus / Minus

                                                                        
Query: 292  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 351
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1344 atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 1285

                          
Query: 352  ccagtcttgatctg 365
            ||||||||||||||
Sbjct: 1284 ccagtcttgatctg 1271



 Score =  141 bits (71), Expect = 3e-30
 Identities = 74/75 (98%)
 Strand = Plus / Minus

                                                                        
Query: 363  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 422
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1184 ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 1125

                           
Query: 423  agtcagcaggctgac 437
            |||||| ||||||||
Sbjct: 1124 agtcagaaggctgac 1110



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                    
Query: 436  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 491
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1026 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 971



to top

>gb|DQ279897.1| Secale cereale translation initiation factor gene, partial cds
          Length = 1298

 Score =  228 bits (115), Expect = 2e-56
 Identities = 124/127 (97%)
 Strand = Plus / Minus

                                                                       
Query: 493 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 828 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 769

                                                                       
Query: 553 atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
           |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 768 atggcaacaaagtggcactttgcgtgaccatgcttcccagtctttgaggtggagacctca 709

                  
Query: 613 acgacct 619
           || ||||
Sbjct: 708 acaacct 702



 Score =  131 bits (66), Expect = 3e-27
 Identities = 72/74 (97%)
 Strand = Plus / Minus

                                                                        
Query: 292  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 351
            ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 1298 atctgctcttcacccatggcggacatcacagacaggatcaggtccttgccatcagcaaat 1239

                          
Query: 352  ccagtcttgatctg 365
            ||||||||||||||
Sbjct: 1238 ccagtcttgatctg 1225



 Score =  125 bits (63), Expect = 2e-25
 Identities = 72/75 (96%)
 Strand = Plus / Minus

                                                                        
Query: 363  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 422
            |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 1137 ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgtcgccactctc 1078

                           
Query: 423  agtcagcaggctgac 437
            ||| || ||||||||
Sbjct: 1077 agttagaaggctgac 1063



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                   
Query: 436 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 491
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 976 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 921



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 615 gaccttgcaggggcgggccttga 637
           |||||||||||||||||||||||
Sbjct: 23  gaccttgcaggggcgggccttga 1



to top

>gb|DQ279894.1| Lophopyrum elongatum translation initiation factor gene, partial
           cds
          Length = 1334

 Score =  228 bits (115), Expect = 2e-56
 Identities = 124/127 (97%)
 Strand = Plus / Minus

                                                                       
Query: 493 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 865 acgtcacagttgtgggatgaaggaacgatatcctcaagcttctttccattaaagatgtca 806

                                                                       
Query: 553 atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 805 atggcaacaaagtggcactttgcgtgaccatgcttcccagtcttggaggtggagacctca 746

                  
Query: 613 acgacct 619
           || ||||
Sbjct: 745 acaacct 739



 Score =  139 bits (70), Expect = 1e-29
 Identities = 73/74 (98%)
 Strand = Plus / Minus

                                                                        
Query: 292  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 351
            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 1334 atctgttcttcacccatggcggacatcacagacaggatcaggtccttgccatcagcaaat 1275

                          
Query: 352  ccagtcttgatctg 365
            ||||||||||||||
Sbjct: 1274 ccagtcttgatctg 1261



 Score =  133 bits (67), Expect = 8e-28
 Identities = 73/75 (97%)
 Strand = Plus / Minus

                                                                        
Query: 363  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 422
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1173 ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 1114

                           
Query: 423  agtcagcaggctgac 437
            ||| || ||||||||
Sbjct: 1113 agttagaaggctgac 1099



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                    
Query: 436  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 491
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1013 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 958



to top

>gb|DQ279893.1| Pseudoroegneria spicata translation initiation factor gene, partial
           cds
          Length = 1358

 Score =  224 bits (113), Expect = 3e-55
 Identities = 125/129 (96%)
 Strand = Plus / Minus

                                                                       
Query: 496 tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 882 tcacagttgtgggatgaagggacaatatcctcaagcttctttccattaaagatgtcaatg 823

                                                                       
Query: 556 gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| 
Sbjct: 822 gcaacaaagtggcactttgcgtgaccatgcttcccagtcttggaggtggagacctcaaca 763

                    
Query: 616 accttgcag 624
           |||| ||||
Sbjct: 762 acctagcag 754



 Score =  123 bits (62), Expect = 8e-25
 Identities = 71/74 (95%)
 Strand = Plus / Minus

                                                                        
Query: 292  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 351
            ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||
Sbjct: 1358 atctgttcttcacccattgcggacatcacagacaggatcaggtccttgccatcagcaaat 1299

                          
Query: 352  ccagtcttgatctg 365
            |||| |||||||||
Sbjct: 1298 ccagccttgatctg 1285



 Score =  101 bits (51), Expect = 3e-18
 Identities = 69/75 (92%)
 Strand = Plus / Minus

                                                                        
Query: 363  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 422
            |||| |||||||| ||||||||||||||||||||||||||||||||||| |||| |||||
Sbjct: 1195 ctgggcaagcagagcatcatcagtgggaagcttcaggtcatccttagtgctgccgctctc 1136

                           
Query: 423  agtcagcaggctgac 437
            ||| || ||||||||
Sbjct: 1135 agttagaaggctgac 1121



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 33/33 (100%)
 Strand = Plus / Minus

                                             
Query: 436  acatatccatcatcagttatgtcaatcagctga 468
            |||||||||||||||||||||||||||||||||
Sbjct: 1037 acatatccatcatcagttatgtcaatcagctga 1005



to top

>gb|DQ279900.1| Haynaldia villosa translation initiation factor gene, partial cds
          Length = 1338

 Score =  220 bits (111), Expect = 5e-54
 Identities = 123/127 (96%)
 Strand = Plus / Minus

                                                                       
Query: 493 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 873 acgtcacagttgtgggatgaaggaacgatatcctcaagcttctttccattaaagatgtca 814

                                                                       
Query: 553 atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
           |||||||||||||| |||||||| || |||||||||||||||||||||||||||||||||
Sbjct: 813 atggcaacaaagtgacactttgcatgaccatgcttcccagtcttggaggtggagacctca 754

                  
Query: 613 acgacct 619
           |||||||
Sbjct: 753 acgacct 747



 Score =  143 bits (72), Expect = 9e-31
 Identities = 72/72 (100%)
 Strand = Plus / Minus

                                                                        
Query: 292  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 351
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1338 atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 1279

                        
Query: 352  ccagtcttgatc 363
            ||||||||||||
Sbjct: 1278 ccagtcttgatc 1267



 Score =  135 bits (68), Expect = 2e-28
 Identities = 71/72 (98%)
 Strand = Plus / Minus

                                                                        
Query: 363  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 422
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1178 ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 1119

                        
Query: 423  agtcagcaggct 434
            |||||| |||||
Sbjct: 1118 agtcagaaggct 1107



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                    
Query: 436  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 491
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1021 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 966



to top

>gb|DQ279896.1| Aegilops tauschii translation initiation factor gene, partial cds
          Length = 1282

 Score =  212 bits (107), Expect = 1e-51
 Identities = 122/127 (96%)
 Strand = Plus / Minus

                                                                       
Query: 493 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
           |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||
Sbjct: 817 acgtcacagttgtgggatgaaggaacgatatcctcaagcttcttcccattaaagatgtca 758

                                                                       
Query: 553 atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
           |||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 757 atggcaacaaagtgacactttgcgtgaccatgcttcccagtcttggaggtggagacctca 698

                  
Query: 613 acgacct 619
           || ||||
Sbjct: 697 acaacct 691



 Score =  133 bits (67), Expect = 8e-28
 Identities = 73/75 (97%)
 Strand = Plus / Minus

                                                                        
Query: 363  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 422
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1121 ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 1062

                           
Query: 423  agtcagcaggctgac 437
            ||| || ||||||||
Sbjct: 1061 agtgagaaggctgac 1047



 Score =  131 bits (66), Expect = 3e-27
 Identities = 72/74 (97%)
 Strand = Plus / Minus

                                                                        
Query: 292  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 351
            ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||
Sbjct: 1282 atctgttcttcacccattgcggacatcacagacaggatcaggtccttgccatcagcaaat 1223

                          
Query: 352  ccagtcttgatctg 365
            ||||||||||||||
Sbjct: 1222 ccagtcttgatctg 1209



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                   
Query: 436 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 491
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 965 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 910



to top

>ref|XM_479006.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 934

 Score =  208 bits (105), Expect = 2e-50
 Identities = 318/389 (81%)
 Strand = Plus / Minus

                                                                       
Query: 289 cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagca 348
           |||||||| || || |||||||| ||||| |||| ||  |  || |||||||| ||| ||
Sbjct: 553 cagatctgctcctcccccatggcggacatgacagtcacaacaagatccttgccttcacca 494

                                                                       
Query: 349 aatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcctta 408
           ||||||||||||||||| || || |||   |||||||| || ||  | || |||||||||
Sbjct: 493 aatccagtcttgatctgacccaggagactgtcatcagttgggagtctaagatcatcctta 434

                                                                       
Query: 409 gtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctga 468
           ||||| ||||||||||| || ||||| ||  ||||||| || | ||||||||||||||| 
Sbjct: 433 gtgttaccactctcagtaagaaggctcacgaatccatcctctgatatgtcaatcagctgg 374

                                                                       
Query: 469 taatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctca 528
           || |||  |||||  ||||| ||||| |||||||||||||| ||||||||||||||||||
Sbjct: 373 tactctgtgcggttcacatgtggaacatcacagttgtgggacgaaggaacaatatcctca 314

                                                                       
Query: 529 agcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttc 588
           ||||| || ||||| || || || |||||||||||||| ||||| || || || ||||| 
Sbjct: 313 agctttttaccattgaatatatctatggcaacaaagtgacacttggcatgaccgtgctta 254

                                                                       
Query: 589 ccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacgatgtgt 648
           |||||||| ||||| || ||||| || |||||||||||||||  |||||| || || |  
Sbjct: 253 ccagtcttcgaggtagaaacctccaccaccttgcaggggcggttcttgataacaatatac 194

                                        
Query: 649 ccacccttgcggatggcgccggcctgctg 677
           |||  |||||||||||  |||||||||||
Sbjct: 193 ccattcttgcggatggttccggcctgctg 165



to top

>ref|XM_506443.1| PREDICTED Oryza sativa (japonica cultivar-group), P0453E05.118 mRNA
          Length = 996

 Score =  208 bits (105), Expect = 2e-50
 Identities = 318/389 (81%)
 Strand = Plus / Minus

                                                                       
Query: 289 cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagca 348
           |||||||| || || |||||||| ||||| |||| ||  |  || |||||||| ||| ||
Sbjct: 556 cagatctgctcctcccccatggcggacatgacagtcacaacaagatccttgccttcacca 497

                                                                       
Query: 349 aatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcctta 408
           ||||||||||||||||| || || |||   |||||||| || ||  | || |||||||||
Sbjct: 496 aatccagtcttgatctgacccaggagactgtcatcagttgggagtctaagatcatcctta 437

                                                                       
Query: 409 gtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctga 468
           ||||| ||||||||||| || ||||| ||  ||||||| || | ||||||||||||||| 
Sbjct: 436 gtgttaccactctcagtaagaaggctcacgaatccatcctctgatatgtcaatcagctgg 377

                                                                       
Query: 469 taatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctca 528
           || |||  |||||  ||||| ||||| |||||||||||||| ||||||||||||||||||
Sbjct: 376 tactctgtgcggttcacatgtggaacatcacagttgtgggacgaaggaacaatatcctca 317

                                                                       
Query: 529 agcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttc 588
           ||||| || ||||| || || || |||||||||||||| ||||| || || || ||||| 
Sbjct: 316 agctttttaccattgaatatatctatggcaacaaagtgacacttggcatgaccgtgctta 257

                                                                       
Query: 589 ccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacgatgtgt 648
           |||||||| ||||| || ||||| || |||||||||||||||  |||||| || || |  
Sbjct: 256 ccagtcttcgaggtagaaacctccaccaccttgcaggggcggttcttgataacaatatac 197

                                        
Query: 649 ccacccttgcggatggcgccggcctgctg 677
           |||  |||||||||||  |||||||||||
Sbjct: 196 ccattcttgcggatggttccggcctgctg 168



to top

>dbj|AK062134.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-E11, full
           insert sequence
          Length = 934

 Score =  208 bits (105), Expect = 2e-50
 Identities = 318/389 (81%)
 Strand = Plus / Minus

                                                                       
Query: 289 cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagca 348
           |||||||| || || |||||||| ||||| |||| ||  |  || |||||||| ||| ||
Sbjct: 553 cagatctgctcctcccccatggcggacatgacagtcacaacaagatccttgccttcacca 494

                                                                       
Query: 349 aatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcctta 408
           ||||||||||||||||| || || |||   |||||||| || ||  | || |||||||||
Sbjct: 493 aatccagtcttgatctgacccaggagactgtcatcagttgggagtctaagatcatcctta 434

                                                                       
Query: 409 gtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctga 468
           ||||| ||||||||||| || ||||| ||  ||||||| || | ||||||||||||||| 
Sbjct: 433 gtgttaccactctcagtaagaaggctcacgaatccatcctctgatatgtcaatcagctgg 374

                                                                       
Query: 469 taatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctca 528
           || |||  |||||  ||||| ||||| |||||||||||||| ||||||||||||||||||
Sbjct: 373 tactctgtgcggttcacatgtggaacatcacagttgtgggacgaaggaacaatatcctca 314

                                                                       
Query: 529 agcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttc 588
           ||||| || ||||| || || || |||||||||||||| ||||| || || || ||||| 
Sbjct: 313 agctttttaccattgaatatatctatggcaacaaagtgacacttggcatgaccgtgctta 254

                                                                       
Query: 589 ccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacgatgtgt 648
           |||||||| ||||| || ||||| || |||||||||||||||  |||||| || || |  
Sbjct: 253 ccagtcttcgaggtagaaacctccaccaccttgcaggggcggttcttgataacaatatac 194

                                        
Query: 649 ccacccttgcggatggcgccggcctgctg 677
           |||  |||||||||||  |||||||||||
Sbjct: 193 ccattcttgcggatggttccggcctgctg 165



to top

>gb|AF094773.1|AF094773 Oryza sativa translation initiation factor 5A (eIF-5A) mRNA,
           complete cds
          Length = 822

 Score =  208 bits (105), Expect = 2e-50
 Identities = 318/389 (81%)
 Strand = Plus / Minus

                                                                       
Query: 289 cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagca 348
           |||||||| || || |||||||| ||||| |||| ||  |  || |||||||| ||| ||
Sbjct: 549 cagatctgctcctcccccatggcggacatgacagtcacaacaagatccttgccttcacca 490

                                                                       
Query: 349 aatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcctta 408
           ||||||||||||||||| || || |||   |||||||| || ||  | || |||||||||
Sbjct: 489 aatccagtcttgatctgacccaggagactgtcatcagttgggagtctaagatcatcctta 430

                                                                       
Query: 409 gtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctga 468
           ||||| ||||||||||| || ||||| ||  ||||||| || | ||||||||||||||| 
Sbjct: 429 gtgttaccactctcagtaagaaggctcacgaatccatcctctgatatgtcaatcagctgg 370

                                                                       
Query: 469 taatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctca 528
           || |||  |||||  ||||| ||||| |||||||||||||| ||||||||||||||||||
Sbjct: 369 tactctgtgcggttcacatgtggaacatcacagttgtgggacgaaggaacaatatcctca 310

                                                                       
Query: 529 agcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttc 588
           ||||| || ||||| || || || |||||||||||||| ||||| || || || ||||| 
Sbjct: 309 agctttttaccattgaatatatctatggcaacaaagtgacacttggcatgaccgtgctta 250

                                                                       
Query: 589 ccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacgatgtgt 648
           |||||||| ||||| || ||||| || |||||||||||||||  |||||| || || |  
Sbjct: 249 ccagtcttcgaggtagaaacctccaccaccttgcaggggcggttcttgataacaatatac 190

                                        
Query: 649 ccacccttgcggatggcgccggcctgctg 677
           |||  |||||||||||  |||||||||||
Sbjct: 189 ccattcttgcggatggttccggcctgctg 161



to top

>gb|DQ279899.1| Crithopsis delileana translation initiation factor gene, partial cds
          Length = 1494

 Score =  206 bits (104), Expect = 7e-50
 Identities = 119/124 (95%)
 Strand = Plus / Minus

                                                                        
Query: 496  tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
            |||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||
Sbjct: 1020 tcacagttgtgggatgaagggacgatatcctcaagtttctttccattaaagatgtcaatg 961

                                                                        
Query: 556  gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
            ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| 
Sbjct: 960  gcaacaaagtggcactttgcgtgaccatgcttcccagtcttggaggtggagacctcaaca 901

                
Query: 616  acct 619
            ||||
Sbjct: 900  acct 897



 Score =  139 bits (70), Expect = 1e-29
 Identities = 73/74 (98%)
 Strand = Plus / Minus

                                                                        
Query: 292  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 351
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1494 atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 1435

                          
Query: 352  ccagtcttgatctg 365
            |||| |||||||||
Sbjct: 1434 ccagccttgatctg 1421



 Score =  117 bits (59), Expect = 5e-23
 Identities = 71/75 (94%)
 Strand = Plus / Minus

                                                                        
Query: 363  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 422
            |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1333 ctgggcaagcagagcatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 1274

                           
Query: 423  agtcagcaggctgac 437
            ||| || ||||||||
Sbjct: 1273 agttagaaggctgac 1259



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 51/56 (91%)
 Strand = Plus / Minus

                                                                    
Query: 436  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 491
            ||||||||||||||||| ||||||||||||||||||||  |||||  |||||||||
Sbjct: 1175 acatatccatcatcagtgatgtcaatcagctgataatccaggcgggtaacatgggg 1120



to top

>emb|AJ843977.1| Plantago major mRNA for eukaryotic translation initiation factor
           5A-1 (eif5a1 gene)
          Length = 890

 Score =  202 bits (102), Expect = 1e-48
 Identities = 213/250 (85%)
 Strand = Plus / Minus

                                                                       
Query: 377 catcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctga 436
           |||||||||| || ||| | ||||||||||||||| | ||| | ||||| |||| ||| |
Sbjct: 510 catcatcagttgggagcctaaggtcatccttagtgcttccattgtcagttagcaagctca 451

                                                                       
Query: 437 catatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgt 496
           || ||||||| ||||  ||||||||||||||||||||    |||| |||||| || || |
Sbjct: 450 caaatccatcctcagaaatgtcaatcagctgataatcaacacggttaacatgagggacat 391

                                                                       
Query: 497 cacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatgg 556
           |||| |||||||| |||||||||||||||||||||||||| |||||||||||||||||||
Sbjct: 390 cacaattgtgggaagaaggaacaatatcctcaagcttcttgccattaaagatgtcaatgg 331

                                                                       
Query: 557 caacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacga 616
           |||||||||| || |||||||| || ||||| ||||| ||||| || || ||||| || |
Sbjct: 330 caacaaagtgacattttgcgtgaccgtgctttccagttttggaagttgaaacctccacaa 271

                     
Query: 617 ccttgcaggg 626
           ||||||||||
Sbjct: 270 ccttgcaggg 261



to top

>dbj|AK103429.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033128M07, full
           insert sequence
          Length = 996

 Score =  200 bits (101), Expect = 4e-48
 Identities = 317/389 (81%)
 Strand = Plus / Minus

                                                                       
Query: 289 cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagca 348
           |||||||| || || |||||||| ||||| |||| ||  |  || |||||||| ||| ||
Sbjct: 556 cagatctgctcctcccccatggcggacatgacagtcacaacaagatccttgccttcacca 497

                                                                       
Query: 349 aatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcctta 408
           |||||||||| |||||| || || |||   |||||||| || ||  | || |||||||||
Sbjct: 496 aatccagtctcgatctgacccaggagactgtcatcagttgggagtctaagatcatcctta 437

                                                                       
Query: 409 gtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctga 468
           ||||| ||||||||||| || ||||| ||  ||||||| || | ||||||||||||||| 
Sbjct: 436 gtgttaccactctcagtaagaaggctcacgaatccatcctctgatatgtcaatcagctgg 377

                                                                       
Query: 469 taatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctca 528
           || |||  |||||  ||||| ||||| |||||||||||||| ||||||||||||||||||
Sbjct: 376 tactctgtgcggttcacatgtggaacatcacagttgtgggacgaaggaacaatatcctca 317

                                                                       
Query: 529 agcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttc 588
           ||||| || ||||| || || || |||||||||||||| ||||| || || || ||||| 
Sbjct: 316 agctttttaccattgaatatatctatggcaacaaagtgacacttggcatgaccgtgctta 257

                                                                       
Query: 589 ccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacgatgtgt 648
           |||||||| ||||| || ||||| || |||||||||||||||  |||||| || || |  
Sbjct: 256 ccagtcttcgaggtagaaacctccaccaccttgcaggggcggttcttgataacaatatac 197

                                        
Query: 649 ccacccttgcggatggcgccggcctgctg 677
           |||  |||||||||||  |||||||||||
Sbjct: 196 ccattcttgcggatggttccggcctgctg 168



to top

>gb|DQ279895.1| Eremopyrum bonaepartis translation initiation factor gene, partial
           cds
          Length = 1334

 Score =  198 bits (100), Expect = 2e-47
 Identities = 112/116 (96%)
 Strand = Plus / Minus

                                                                       
Query: 496 tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 879 tcacagttgtgggatgaaggaacgatatcctcaagcttctttccattaaagatgtcaatg 820

                                                                   
Query: 556 gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctc 611
           ||||||||||||||||||||||| || ||||||||||||||||||||||| |||||
Sbjct: 819 gcaacaaagtggcactttgcgtgaccgtgcttcccagtcttggaggtggaaacctc 764



 Score =  125 bits (63), Expect = 2e-25
 Identities = 72/75 (96%)
 Strand = Plus / Minus

                                                                        
Query: 363  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 422
            ||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 1174 ctggccaagaagaacatcatcagtgggaagcttcaggtcatccttagtattgccactctc 1115

                           
Query: 423  agtcagcaggctgac 437
            |||||| ||||||||
Sbjct: 1114 agtcagaaggctgac 1100



 Score =  123 bits (62), Expect = 8e-25
 Identities = 71/74 (95%)
 Strand = Plus / Minus

                                                                        
Query: 292  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 351
            ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| 
Sbjct: 1334 atctgttcttcacccatcgcggacatcacagacaggatcaggtccttgccatcagcaaac 1275

                          
Query: 352  ccagtcttgatctg 365
            ||||||||||||||
Sbjct: 1274 ccagtcttgatctg 1261



 Score =  111 bits (56), Expect = 3e-21
 Identities = 56/56 (100%)
 Strand = Plus / Minus

                                                                    
Query: 436  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 491
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1016 acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggg 961



to top

>dbj|AK061867.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-H10, full
           insert sequence
          Length = 961

 Score =  196 bits (99), Expect = 7e-47
 Identities = 333/411 (81%)
 Strand = Plus / Minus

                                                                       
Query: 271 ccgatttccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatc 330
           ||||| |||||||  ||||||||||| || || |||||||||||||| |||| ||  | |
Sbjct: 573 ccgatgtccttcagcgcgcagatctgctcctctcccatggcagacataacagtcaccacc 514

                                                                       
Query: 331 aggtccttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtggga 390
           |||||||| || ||  ||||||||  ||||||||| | ||||||   ||||||||| || 
Sbjct: 513 aggtccttcccttctccaaatccatccttgatctgactaagcaggttatcatcagtaggg 454

                                                                       
Query: 391 agcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatca 450
           ||| | ||||||||||| ||||||||| | ||||| | ||| || ||| ||||||| |||
Sbjct: 453 agcctgaggtcatccttggtgttgccattttcagttaacagactcacaaatccatcctca 394

                                                                       
Query: 451 gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 510
           | ||| ||||| ||||| || ||    ||||  ||||| || || ||||||||||| || 
Sbjct: 393 gatatatcaatgagctggtactccgtacggttcacatgcgggacatcacagttgtgagaa 334

                                                                       
Query: 511 gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 570
           || || |||||||| || ||||||||  || ||||||||||||| |||||||||||||||
Sbjct: 333 gatggcacaatatcttcgagcttcttggcagtaaagatgtcaattgcaacaaagtggcac 274

                                                                       
Query: 571 tttgcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgg 630
           || ||||| || ||||||||||| || ||||| || |||||||| |||||||||||||||
Sbjct: 273 ttggcgtgaccgtgcttcccagttttagaggttgaaacctcaacaaccttgcaggggcgg 214

                                                              
Query: 631 gccttgatgacgatgtgtccacccttgcggatggcgccggcctgctgcggg 681
             ||||||||| ||||  |||   ||||||||||  || ||||||||||||
Sbjct: 213 ttcttgatgactatgtagccatttttgcggatggtcccagcctgctgcggg 163



to top

>gb|DQ345329.1| Rosa chinensis eukaryotic translation initiation factor eIF5A mRNA,
           complete cds
          Length = 474

 Score =  196 bits (99), Expect = 7e-47
 Identities = 282/343 (82%)
 Strand = Plus / Minus

                                                                       
Query: 304 cccatggcagacatcacagacaggatcaggtccttgccatcagcaaatccagtcttgatc 363
           |||||||||||||| |||| ||  |  || |||||||| ||||||||||||  ||| | |
Sbjct: 437 cccatggcagacatgacagtcaccacaagatccttgccctcagcaaatccatccttaagc 378

                                                                       
Query: 364 tggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctca 423
           ||    |||||| ||||||||||||||||| |||| |||||||| ||||| ||| | |||
Sbjct: 377 tgagtgagcagagcatcatcagtgggaagcctcagatcatccttggtgtttccattttca 318

                                                                       
Query: 424 gtcagcaggctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtca 483
           ||||  || || ||| | ||||| ||||  || ||||||||||| || ||    ||||  
Sbjct: 317 gtcaagagactcacaaagccatcttcagagatatcaatcagctggtagtcagtacggttc 258

                                                                       
Query: 484 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 543
           ||||| ||||| ||||| |||||||||||||| |||||||||||||||||||| ||||| 
Sbjct: 257 acatgaggaacatcacaattgtgggatgaagggacaatatcctcaagcttcttgccattg 198

                                                                       
Query: 544 aagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtg 603
           ||||| ||||| ||||||||||||||||| || || || ||||| || |||||||| |||
Sbjct: 197 aagatatcaattgcaacaaagtggcacttagcatgaccgtgctttcctgtcttggaagtg 138

                                                      
Query: 604 gagacctcaacgaccttgcaggggcgggccttgatgacgatgt 646
           ||||| ||||| |||||||| || | |||||||||||||||||
Sbjct: 137 gagacttcaacaaccttgcaaggcctggccttgatgacgatgt 95



to top

>dbj|AK099039.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013131C14, full
           insert sequence
          Length = 981

 Score =  196 bits (99), Expect = 7e-47
 Identities = 333/411 (81%)
 Strand = Plus / Minus

                                                                       
Query: 271 ccgatttccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatc 330
           ||||| |||||||  ||||||||||| || || |||||||||||||| |||| ||  | |
Sbjct: 572 ccgatgtccttcagcgcgcagatctgctcctctcccatggcagacataacagtcaccacc 513

                                                                       
Query: 331 aggtccttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtggga 390
           |||||||| || ||  ||||||||  ||||||||| | ||||||   ||||||||| || 
Sbjct: 512 aggtccttcccttctccaaatccatccttgatctgactaagcaggttatcatcagtaggg 453

                                                                       
Query: 391 agcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatca 450
           ||| | ||||||||||| ||||||||| | ||||| | ||| || ||| ||||||| |||
Sbjct: 452 agcctgaggtcatccttggtgttgccattttcagttaacagactcacaaatccatcctca 393

                                                                       
Query: 451 gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 510
           | ||| ||||| ||||| || ||    ||||  ||||| || || ||||||||||| || 
Sbjct: 392 gatatatcaatgagctggtactccgtacggttcacatgcgggacatcacagttgtgagaa 333

                                                                       
Query: 511 gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 570
           || || |||||||| || ||||||||  || ||||||||||||| |||||||||||||||
Sbjct: 332 gatggcacaatatcttcgagcttcttggcagtaaagatgtcaattgcaacaaagtggcac 273

                                                                       
Query: 571 tttgcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgg 630
           || ||||| || ||||||||||| || ||||| || |||||||| |||||||||||||||
Sbjct: 272 ttggcgtgaccgtgcttcccagttttagaggttgaaacctcaacaaccttgcaggggcgg 213

                                                              
Query: 631 gccttgatgacgatgtgtccacccttgcggatggcgccggcctgctgcggg 681
             ||||||||| ||||  |||   ||||||||||  || ||||||||||||
Sbjct: 212 ttcttgatgactatgtagccatttttgcggatggtcccagcctgctgcggg 162



to top

>gb|DQ279898.1| Psathyrostachys juncea translation initiation factor gene, partial
           cds
          Length = 1375

 Score =  196 bits (99), Expect = 7e-47
 Identities = 120/127 (94%)
 Strand = Plus / Minus

                                                                       
Query: 493 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
           ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||
Sbjct: 912 acgtcacagttgtgggatgaaggaacaatatcctccagcttctttccattgaagatgtca 853

                                                                       
Query: 553 atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
           |||||||||||||| ||||| || || |||||||||||||||||||||||||||||||||
Sbjct: 852 atggcaacaaagtgacacttagcatgaccatgcttcccagtcttggaggtggagacctca 793

                  
Query: 613 acgacct 619
           || ||||
Sbjct: 792 acaacct 786



 Score =  131 bits (66), Expect = 3e-27
 Identities = 72/74 (97%)
 Strand = Plus / Minus

                                                                        
Query: 292  atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 351
            |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 1375 atctgttcttcacccatggcggacatcacagacaggatcaggtccttgccatcagcaaat 1316

                          
Query: 352  ccagtcttgatctg 365
            ||||||| ||||||
Sbjct: 1315 ccagtctcgatctg 1302



 Score =  109 bits (55), Expect = 1e-20
 Identities = 70/75 (93%)
 Strand = Plus / Minus

                                                                        
Query: 363  ctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctc 422
            |||| |||||||| ||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 1214 ctgggcaagcagagcatcatcagtgggaagcttcaggtcatccttagtgctgccactctc 1155

                           
Query: 423  agtcagcaggctgac 437
            ||| || ||||||||
Sbjct: 1154 agttagaaggctgac 1140



 Score =  101 bits (51), Expect = 3e-18
 Identities = 57/59 (96%)
 Strand = Plus / Minus

                                                                       
Query: 436  acatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaac 494
            ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||
Sbjct: 1058 acatatccatcatcagttatgtcaatcagttgataatcttggcggtcaacatgaggaac 1000



to top

>emb|AJ238624.1|SVE238624 Senecio vernalis mRNA for translation initiation factor 5A
           precursor protein eIF-5A (eifsv1 gene)
          Length = 480

 Score =  192 bits (97), Expect = 1e-45
 Identities = 232/277 (83%)
 Strand = Plus / Minus

                                                                       
Query: 347 caaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcct 406
           ||||||||  ||||||||||  ||| ||| |||||||||| || ||||||||||||||||
Sbjct: 394 caaatccatccttgatctgggtaagaagagcatcatcagttggcagcttcaggtcatcct 335

                                                                       
Query: 407 tagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagct 466
           | ||||| ||| | ||||||||||  || ||| ||||||| ||||  || ||||| ||||
Sbjct: 334 tggtgttaccattttcagtcagcaaactcacaaatccatcctcagaaatatcaattagct 275

                                                                       
Query: 467 gataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcct 526
           | |||||    ||||  ||||| ||||| ||||| |||||||| || ||||||||||| |
Sbjct: 274 ggtaatcagtacggttgacatgaggaacatcacaattgtgggaagatggaacaatatctt 215

                                                                       
Query: 527 caagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgct 586
           |||||||||||||||||||||||||||| ||||||||||| ||||| ||||| || ||||
Sbjct: 214 caagcttctttccattaaagatgtcaatagcaacaaagtgacacttagcgtgaccgtgct 155

                                                
Query: 587 tcccagtcttggaggtggagacctcaacgaccttgca 623
           | |||||||||||||| || || || || ||||||||
Sbjct: 154 tgccagtcttggaggtagaaacttccacaaccttgca 118



to top

>gb|AF516357.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform VIII (eIF-5A) mRNA, partial cds
          Length = 597

 Score =  190 bits (96), Expect = 4e-45
 Identities = 225/268 (83%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 438
           |||||||| |||||| | ||||||||||| ||||| ||| ||||||||||||| ||||||
Sbjct: 359 tcatcagttggaagccttaggtcatccttggtgtttccattctcagtcagcagactgaca 300

                                                                       
Query: 439 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 498
            ||||||| ||||  || |||||||||||||||||    |||  |||||||||||| |||
Sbjct: 299 aatccatcctcagagatatcaatcagctgataatcagtacgggtaacatggggaacatca 240

                                                                       
Query: 499 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 558
           |||||||| || ||||| || ||||| ||||||||||| ||||| ||||| |||||  ||
Sbjct: 239 cagttgtgagaagaagggacgatatcttcaagcttcttgccattgaagatatcaattcca 180

                                                                       
Query: 559 acaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgacc 618
           ||||| || || ||||| || |||||||| ||||| |||||||| ||||||||||| |||
Sbjct: 179 acaaaatgacattttgcatgaccatgcttgccagttttggaggttgagacctcaacaacc 120

                                       
Query: 619 ttgcaggggcgggccttgatgacgatgt 646
           || ||||| |||   |||||||||||||
Sbjct: 119 ttacagggacggtttttgatgacgatgt 92



to top

>gb|AY496435.1| Brassica napus eukaryotic translation initiation factor-5A mRNA,
           complete cds
          Length = 658

 Score =  182 bits (92), Expect = 1e-42
 Identities = 158/180 (87%)
 Strand = Plus / Minus

                                                                       
Query: 484 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 543
           ||||||||||| ||||| |||||||| || |||||||||||||| ||||||||  || | 
Sbjct: 254 acatggggaacatcacaattgtgggaagagggaacaatatcctcgagcttcttagcagtg 195

                                                                       
Query: 544 aagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtg 603
           |||||||| || ||||||||||| ||||||||||| || |||||||||||||| || || 
Sbjct: 194 aagatgtcgatagcaacaaagtgacactttgcgtgaccgtgcttcccagtcttcgaagtc 135

                                                                       
Query: 604 gagacctcaacgaccttgcaggggcgggccttgatgacgatgtgtccacccttgcggatg 663
           || |||||||| ||||||||||| ||| |||||||||||||||| |||||||||||||||
Sbjct: 134 gaaacctcaacaaccttgcagggacggcccttgatgacgatgtgaccacccttgcggatg 75



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 317
           ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 480 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 421

                   
Query: 318 cacagaca 325
            |||||||
Sbjct: 420 gacagaca 413



to top

>emb|Y07920.1|ZMTRINF5A Z.mays mRNA for translation initiation factor 5A
          Length = 807

 Score =  172 bits (87), Expect = 1e-39
 Identities = 209/247 (84%), Gaps = 2/247 (0%)
 Strand = Plus / Minus

                                                                       
Query: 400 tcatccttagtgttgccactctca-gtcagcaggctgacatatccatcatcagttatgtc 458
           |||||||||||||||||| ||| | || || ||||| ||| ||||||| ||||  || ||
Sbjct: 418 tcatccttagtgttgcca-tctgaagtaagaaggctcacaaatccatcctcagaaatatc 360

                                                                       
Query: 459 aatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaac 518
           |||||||||||| ||    ||||  ||||| |||| |||||||||||| |||||||||||
Sbjct: 359 aatcagctgatactcagtacggttcacatgcggaatgtcacagttgtgtgatgaaggaac 300

                                                                       
Query: 519 aatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtg 578
           |||||| |||||||| || ||||| || ||||| ||||| ||||||||||| || |||||
Sbjct: 299 aatatcttcaagctttttcccattgaatatgtctatggcgacaaagtggcatttggcgtg 240

                                                                       
Query: 579 gccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgat 638
           ||||||||| |||||||||||||| || ||||| || ||||||||||| |||  ||||||
Sbjct: 239 gccatgcttaccagtcttggaggtagaaacctccacaaccttgcagggacggttcttgat 180

                  
Query: 639 gacgatg 645
           |||||||
Sbjct: 179 gacgatg 173



to top

>gb|AY103556.1| Zea mays PCO150862 mRNA sequence
          Length = 966

 Score =  172 bits (87), Expect = 1e-39
 Identities = 209/247 (84%), Gaps = 2/247 (0%)
 Strand = Plus / Minus

                                                                       
Query: 400 tcatccttagtgttgccactctca-gtcagcaggctgacatatccatcatcagttatgtc 458
           |||||||||||||||||| ||| | || || ||||| ||| ||||||| ||||  || ||
Sbjct: 531 tcatccttagtgttgcca-tctgaagtaagaaggctcacaaatccatcctcagaaatatc 473

                                                                       
Query: 459 aatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaac 518
           |||||||||||| ||    ||||  ||||| |||| |||||||||||| |||||||||||
Sbjct: 472 aatcagctgatactcagtacggttcacatgcggaatgtcacagttgtgtgatgaaggaac 413

                                                                       
Query: 519 aatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtg 578
           |||||| |||||||| || ||||| || ||||| ||||| ||||||||||| || |||||
Sbjct: 412 aatatcttcaagctttttcccattgaatatgtctatggcgacaaagtggcatttggcgtg 353

                                                                       
Query: 579 gccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgat 638
           ||||||||| |||||||||||||| || ||||| || ||||||||||| |||  ||||||
Sbjct: 352 gccatgcttaccagtcttggaggtagaaacctccacaaccttgcagggacggttcttgat 293

                  
Query: 639 gacgatg 645
           |||||||
Sbjct: 292 gacgatg 286



to top

>emb|X63542.1|NPNEIF5A2 N.plumbaginifolia mRNA NeIF-5A2 for initiation factor 5A(2)
          Length = 1224

 Score =  167 bits (84), Expect = 6e-38
 Identities = 288/356 (80%)
 Strand = Plus / Minus

                                                                       
Query: 292 atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 351
           ||||| || ||||||||||| ||||| |||||||  |  ||||| || || |||||||| 
Sbjct: 487 atctgctcctcacccatggctgacatgacagacacaacaaggtcttttccctcagcaaac 428

                                                                       
Query: 352 ccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtg 411
           |||  |||||||||   ||| ||   ||||||||| |||||| | ||||||||||| |||
Sbjct: 427 ccatccttgatctgtgtaaggaggttatcatcagtaggaagcctaaggtcatccttggtg 368

                                                                       
Query: 412 ttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctgataa 471
           || ||| ||||||| ||||| || ||| ||||||| ||||  |||||||| |||||||||
Sbjct: 367 ttaccattctcagtgagcagactcacaaatccatcttcagaaatgtcaataagctgataa 308

                                                                       
Query: 472 tcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagc 531
           |||   || | ||| ||||| || ||||| ||||| || || ||||||||||||||||||
Sbjct: 307 tctgtacgattaacgtggggcacatcacaattgtgtgaagagggaacaatatcctcaagc 248

                                                                       
Query: 532 ttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccca 591
           ||||||||| | ||||||||||| || ||||| || || ||||| || || ||||| || 
Sbjct: 247 ttctttccagtgaagatgtcaatagcgacaaaatgacattttgcatgaccgtgctttccg 188

                                                                   
Query: 592 gtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacgatgtg 647
           || ||||| || ||||| || || ||||||||||| ||| | ||||||||||||||
Sbjct: 187 gttttggatgtagagacttccacaaccttgcagggacggcctttgatgacgatgtg 132



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  165 bits (83), Expect = 2e-37
 Identities = 116/127 (91%)
 Strand = Plus / Minus

                                                                            
Query: 493      acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
                ||||||||||||||||| || || |||||||| ||||||||||| ||||| |||||||||
Sbjct: 31085889 acgtcacagttgtgggaggagggcacaatatcttcaagcttcttcccattgaagatgtca 31085830

                                                                            
Query: 553      atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
                ||||| ||||||||||| ||||| || |||||||||||||||||||||||||||||||||
Sbjct: 31085829 atggccacaaagtggcattttgcatgtccatgcttcccagtcttggaggtggagacctca 31085770

                       
Query: 613      acgacct 619
                || ||||
Sbjct: 31085769 acaacct 31085763



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                            
Query: 277      tccttcacagcgcagatctgttcttcacccatggcagacatcac 320
                ||||||| |||||||||||| || ||||||||||||||||||||
Sbjct: 31086565 tccttcagagcgcagatctgctcctcacccatggcagacatcac 31086522



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                            
Query: 369      aagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcag 428
                ||||||| | |||||| | || ||| |||||||||||||||||   ||||| ||||||||
Sbjct: 31086382 aagcagagcctcatcactagggagcctcaggtcatccttagtgcctccactttcagtcag 31086323

                         
Query: 429      caggctgac 437
                 ||||||||
Sbjct: 31086322 gaggctgac 31086314



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                  
Query: 440      atccatcatcagttatgtcaatcagctgataatc 473
                ||||||| ||||  ||||||||||||||||||||
Sbjct: 31086027 atccatcttcagaaatgtcaatcagctgataatc 31085994



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 79       agatagatagatagataacaaa 100
                ||||||||||||||||||||||
Sbjct: 25712037 agatagatagatagataacaaa 25712058



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 77       agagatagatagatagataac 97
                |||||||||||||||||||||
Sbjct: 18170243 agagatagatagatagataac 18170263



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 71       tataatagagatagatagatagat 94
                ||||||||| ||||||||||||||
Sbjct: 22470462 tataatagaaatagatagatagat 22470439



to top

>gb|AC079887.17| Oryza sativa (japonica cultivar-group) chromosome 3 BAC OSJNBa0040E01
             genomic sequence, complete sequence
          Length = 168759

 Score =  165 bits (83), Expect = 2e-37
 Identities = 116/127 (91%)
 Strand = Plus / Plus

                                                                         
Query: 493   acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
             ||||||||||||||||| || || |||||||| ||||||||||| ||||| |||||||||
Sbjct: 10175 acgtcacagttgtgggaggagggcacaatatcttcaagcttcttcccattgaagatgtca 10234

                                                                         
Query: 553   atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
             ||||| ||||||||||| ||||| || |||||||||||||||||||||||||||||||||
Sbjct: 10235 atggccacaaagtggcattttgcatgtccatgcttcccagtcttggaggtggagacctca 10294

                    
Query: 613   acgacct 619
             || ||||
Sbjct: 10295 acaacct 10301



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Plus

                                                        
Query: 277  tccttcacagcgcagatctgttcttcacccatggcagacatcac 320
            ||||||| |||||||||||| || ||||||||||||||||||||
Sbjct: 9499 tccttcagagcgcagatctgctcctcacccatggcagacatcac 9542



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Plus

                                                                        
Query: 369  aagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcag 428
            ||||||| | |||||| | || ||| |||||||||||||||||   ||||| ||||||||
Sbjct: 9682 aagcagagcctcatcactagggagcctcaggtcatccttagtgcctccactttcagtcag 9741

                     
Query: 429  caggctgac 437
             ||||||||
Sbjct: 9742 gaggctgac 9750



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 440   atccatcatcagttatgtcaatcagctgataatc 473
             ||||||| ||||  ||||||||||||||||||||
Sbjct: 10037 atccatcttcagaaatgtcaatcagctgataatc 10070



to top

>gb|AC084282.6| Oryza sativa chromosome 3 BAC OSJNBb0048A17 genomic sequence,
            complete sequence
          Length = 128017

 Score =  165 bits (83), Expect = 2e-37
 Identities = 116/127 (91%)
 Strand = Plus / Minus

                                                                        
Query: 493  acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
            ||||||||||||||||| || || |||||||| ||||||||||| ||||| |||||||||
Sbjct: 6530 acgtcacagttgtgggaggagggcacaatatcttcaagcttcttcccattgaagatgtca 6471

                                                                        
Query: 553  atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
            ||||| ||||||||||| ||||| || |||||||||||||||||||||||||||||||||
Sbjct: 6470 atggccacaaagtggcattttgcatgtccatgcttcccagtcttggaggtggagacctca 6411

                   
Query: 613  acgacct 619
            || ||||
Sbjct: 6410 acaacct 6404



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                        
Query: 277  tccttcacagcgcagatctgttcttcacccatggcagacatcac 320
            ||||||| |||||||||||| || ||||||||||||||||||||
Sbjct: 7206 tccttcagagcgcagatctgctcctcacccatggcagacatcac 7163



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                        
Query: 369  aagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcag 428
            ||||||| | |||||| | || ||| |||||||||||||||||   ||||| ||||||||
Sbjct: 7023 aagcagagcctcatcactagggagcctcaggtcatccttagtgcctccactttcagtcag 6964

                     
Query: 429  caggctgac 437
             ||||||||
Sbjct: 6963 gaggctgac 6955



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                              
Query: 440  atccatcatcagttatgtcaatcagctgataatc 473
            ||||||| ||||  ||||||||||||||||||||
Sbjct: 6668 atccatcttcagaaatgtcaatcagctgataatc 6635



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  165 bits (83), Expect = 2e-37
 Identities = 116/127 (91%)
 Strand = Plus / Minus

                                                                            
Query: 493      acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
                ||||||||||||||||| || || |||||||| ||||||||||| ||||| |||||||||
Sbjct: 31176412 acgtcacagttgtgggaggagggcacaatatcttcaagcttcttcccattgaagatgtca 31176353

                                                                            
Query: 553      atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
                ||||| ||||||||||| ||||| || |||||||||||||||||||||||||||||||||
Sbjct: 31176352 atggccacaaagtggcattttgcatgtccatgcttcccagtcttggaggtggagacctca 31176293

                       
Query: 613      acgacct 619
                || ||||
Sbjct: 31176292 acaacct 31176286



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                            
Query: 277      tccttcacagcgcagatctgttcttcacccatggcagacatcac 320
                ||||||| |||||||||||| || ||||||||||||||||||||
Sbjct: 31177088 tccttcagagcgcagatctgctcctcacccatggcagacatcac 31177045



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                            
Query: 369      aagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcag 428
                ||||||| | |||||| | || ||| |||||||||||||||||   ||||| ||||||||
Sbjct: 31176905 aagcagagcctcatcactagggagcctcaggtcatccttagtgcctccactttcagtcag 31176846

                         
Query: 429      caggctgac 437
                 ||||||||
Sbjct: 31176845 gaggctgac 31176837



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                  
Query: 440      atccatcatcagttatgtcaatcagctgataatc 473
                ||||||| ||||  ||||||||||||||||||||
Sbjct: 31176550 atccatcttcagaaatgtcaatcagctgataatc 31176517



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 79       agatagatagatagataacaaa 100
                ||||||||||||||||||||||
Sbjct: 25803346 agatagatagatagataacaaa 25803367



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 77       agagatagatagatagataac 97
                |||||||||||||||||||||
Sbjct: 18163784 agagatagatagatagataac 18163804



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 71       tataatagagatagatagatagat 94
                ||||||||| ||||||||||||||
Sbjct: 22463491 tataatagaaatagatagatagat 22463468



to top

>dbj|AB004825.1| Solanum tuberosum mRNA for eukaryotic initiation factor 5A4,
           complete cds
          Length = 726

 Score =  165 bits (83), Expect = 2e-37
 Identities = 287/355 (80%)
 Strand = Plus / Minus

                                                                       
Query: 292 atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 351
           |||||||| |||||||| || ||||| |||||||  |  ||||| || || |||||||| 
Sbjct: 492 atctgttcctcacccatagctgacataacagacacaacgaggtctttaccctcagcaaac 433

                                                                       
Query: 352 ccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtg 411
           |||  |||||||||   |||||||  |||||| || |||||| | ||||||||||| |||
Sbjct: 432 ccatccttgatctgtgaaagcagactatcatcggtaggaagcctgaggtcatccttggtg 373

                                                                       
Query: 412 ttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctgataa 471
           || ||| | ||||| ||||| || ||| ||||||| ||||  |||||||| |||||||||
Sbjct: 372 ttaccattgtcagtgagcagactcacaaatccatcttcagagatgtcaataagctgataa 313

                                                                       
Query: 472 tcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagc 531
           |||  ||| | ||||||||| || ||||| ||||| || || || |||||||||||||||
Sbjct: 312 tctgtgcgattaacatggggcacatcacaattgtgagaagaggggacaatatcctcaagc 253

                                                                       
Query: 532 ttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccca 591
           ||||||||| | ||||| ||||| ||||| || || || || || || |||||||| |||
Sbjct: 252 ttctttccagtgaagatatcaatagcaacgaaatgacatttggcatgaccatgcttgcca 193

                                                                  
Query: 592 gtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacgatgt 646
           || ||||| || ||||| || || |||||||| || ||| | |||||||||||||
Sbjct: 192 gttttggatgtagagacttccacaaccttgcatggacggcctttgatgacgatgt 138



to top

>gb|AY484392.1| Capsicum annuum eukaryotic initiation factor 5A2 (eIF5A2) mRNA,
           complete cds
          Length = 718

 Score =  163 bits (82), Expect = 9e-37
 Identities = 283/350 (80%)
 Strand = Plus / Minus

                                                                       
Query: 277 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 336
           ||||||||||| || ||||||||||||||||| ||||||||||| ||||| |  || |||
Sbjct: 493 tccttcacagcacaaatctgttcttcacccattgcagacatcaccgacagcacgagatcc 434

                                                                       
Query: 337 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 396
           || || ||  ||||||||   || | |||||  |||||    ||||| ||||||||| | 
Sbjct: 433 tttccttcctcaaatccacctttaacctggctcagcagggtgtcatcggtgggaagcctg 374

                                                                       
Query: 397 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 456
           |||||||| || ||||| ||| | ||||| || ||    ||| | ||||| ||||  |||
Sbjct: 373 aggtcatctttggtgttaccattttcagtaagaagagacacaaaaccatcttcagagatg 314

                                                                       
Query: 457 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 516
           |||||||||||||| |||   ||||  ||||| || || ||||| ||||| |||||||||
Sbjct: 313 tcaatcagctgatagtctgtacggttgacatgtggcacatcacaattgtgagatgaagga 254

                                                                       
Query: 517 acaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcg 576
           |||||||| ||||||||||||||||| || |||||||| || |||||||| || ||||| 
Sbjct: 253 acaatatcttcaagcttctttccattgaaaatgtcaattgccacaaagtgacattttgca 194

                                                             
Query: 577 tggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggg 626
           || || ||||| ||||| ||||| |||||||||||||| |||||||||||
Sbjct: 193 tgtccgtgcttgccagttttggaagtggagacctcaacaaccttgcaggg 144



to top

>gb|AY484391.1| Capsicum annuum mary storys protein mRNA, complete cds
          Length = 718

 Score =  163 bits (82), Expect = 9e-37
 Identities = 283/350 (80%)
 Strand = Plus / Minus

                                                                       
Query: 277 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 336
           ||||||||||| || ||||||||||||||||| ||||||||||| ||||| |  || |||
Sbjct: 493 tccttcacagcacaaatctgttcttcacccattgcagacatcaccgacagcacgagatcc 434

                                                                       
Query: 337 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 396
           || || ||  ||||||||   || | |||||  |||||    ||||| ||||||||| | 
Sbjct: 433 tttccttcctcaaatccacctttaacctggctcagcagggtgtcatcggtgggaagcctg 374

                                                                       
Query: 397 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 456
           |||||||| || ||||| ||| | ||||| || ||    ||| | ||||| ||||  |||
Sbjct: 373 aggtcatctttggtgttaccattttcagtaagaagagacacaaaaccatcttcagagatg 314

                                                                       
Query: 457 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 516
           |||||||||||||| |||   ||||  ||||| || || ||||| ||||| |||||||||
Sbjct: 313 tcaatcagctgatagtctgtacggttgacatgtggcacatcacaattgtgagatgaagga 254

                                                                       
Query: 517 acaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcg 576
           |||||||| ||||||||||||||||| || |||||||| || |||||||| || ||||| 
Sbjct: 253 acaatatcttcaagcttctttccattgaaaatgtcaattgccacaaagtgacattttgca 194

                                                             
Query: 577 tggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggg 626
           || || ||||| ||||| ||||| |||||||||||||| |||||||||||
Sbjct: 193 tgtccgtgcttgccagttttggaagtggagacctcaacaaccttgcaggg 144



to top

>gb|AY587771.1| Tamarix androssowii translation initiation factor 5A mRNA, complete
           cds
          Length = 801

 Score =  161 bits (81), Expect = 4e-36
 Identities = 144/165 (87%)
 Strand = Plus / Minus

                                                                       
Query: 483 aacatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatt 542
           |||||| || || ||||||||||| ||||| ||||||||||||||||||||||| ||| |
Sbjct: 322 aacatgagggacatcacagttgtgagatgatggaacaatatcctcaagcttcttgccagt 263

                                                                       
Query: 543 aaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggt 602
            |||||||||||  |||||||||| ||||| || || || ||||| |||||||| |||||
Sbjct: 262 gaagatgtcaataccaacaaagtgacacttggcatgcccgtgcttgccagtcttcgaggt 203

                                                        
Query: 603 ggagacctcaacgaccttgcaggggcgggccttgatgacgatgtg 647
            ||||||||||||||||||||||| |||  |||||||||||||||
Sbjct: 202 agagacctcaacgaccttgcagggacggttcttgatgacgatgtg 158



to top

>gb|BT018311.1| Zea mays clone EL01T0207A06.c mRNA sequence
          Length = 775

 Score =  159 bits (80), Expect = 1e-35
 Identities = 182/216 (84%)
 Strand = Plus / Minus

                                                                       
Query: 430 aggctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgg 489
           ||||| ||| ||||||| ||||  || |||||||||||||| ||    ||||  ||||| 
Sbjct: 360 aggctcacaaatccatcctcagaaatatcaatcagctgatactcagtacggttcacatgc 301

                                                                       
Query: 490 ggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatg 549
           |||| |||||||||||| ||||||||||||||||| |||||||| || ||||| || |||
Sbjct: 300 ggaatgtcacagttgtgtgatgaaggaacaatatcttcaagctttttcccattgaatatg 241

                                                                       
Query: 550 tcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacc 609
           || ||||| |||||| |||| || |||||||||||||| |||||||||||||| || |||
Sbjct: 240 tctatggcgacaaaggggcatttggcgtggccatgcttaccagtcttggaggtagaaacc 181

                                               
Query: 610 tcaacgaccttgcaggggcgggccttgatgacgatg 645
           || || ||||||||||| |||  |||||||||||||
Sbjct: 180 tccacaaccttgcagggacggttcttgatgacgatg 145



to top

>ref|NM_105608.2| Arabidopsis thaliana translation initiation factor AT1G69410 mRNA,
           complete cds
          Length = 763

 Score =  157 bits (79), Expect = 6e-35
 Identities = 217/263 (82%)
 Strand = Plus / Minus

                                                                       
Query: 391 agcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatca 450
           |||||||| |||||||||||| | ||| | ||||| || || || ||| | ||||| |||
Sbjct: 443 agcttcagatcatccttagtgctaccattatcagtaagaagactaacaaagccatcttca 384

                                                                       
Query: 451 gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 510
           |  || ||||||| |||||||||    || |  ||||| ||||| ||||| |||||||| 
Sbjct: 383 gagatatcaatcaactgataatcaacacgattcacatgtggaacatcacaattgtgggaa 324

                                                                       
Query: 511 gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 570
           |||||||| ||||| |||||||||||   | ||||||| ||||||||||||||||| |||
Sbjct: 323 gaaggaacgatatcttcaagcttcttagaagtaaagatatcaatggcaacaaagtgacac 264

                                                                       
Query: 571 tttgcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgg 630
           || ||||| ||||||||||||||||| || || || |||||||| ||||||||||| || 
Sbjct: 263 ttggcgtgaccatgcttcccagtcttcgaagtcgatacctcaaccaccttgcagggacgt 204

                                  
Query: 631 gccttgatgacgatgtgtccacc 653
            |||||||||||||||| |||||
Sbjct: 203 cccttgatgacgatgtgaccacc 181



to top

>gb|DQ200358.1| Solanum tuberosum clone 053D09 eukaryotic initiation factor
           5A4-like protein mRNA, complete cds
          Length = 790

 Score =  157 bits (79), Expect = 6e-35
 Identities = 286/355 (80%)
 Strand = Plus / Minus

                                                                       
Query: 292 atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 351
           |||||||| |||||||| || ||||| |||||||  |  ||||| || || |||||||| 
Sbjct: 497 atctgttcctcacccatagctgacataacagacacaacgaggtctttaccctcagcaaac 438

                                                                       
Query: 352 ccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtg 411
           |||  |||||||||   |||||||  |||||| || |||||| | ||||||||||| |||
Sbjct: 437 ccatccttgatctgtgaaagcagactatcatcggtaggaagcctgaggtcatccttggtg 378

                                                                       
Query: 412 ttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctgataa 471
           || ||| | ||||| ||||| || ||| ||||||| ||||  |||||||| |||||||||
Sbjct: 377 ttaccattgtcagtgagcagactcacaaatccatcttcagagatgtcaataagctgataa 318

                                                                       
Query: 472 tcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagc 531
           |||  ||| | ||||||||| || ||||| ||||| || || || |||||||||||||||
Sbjct: 317 tctgtgcgattaacatggggcacatcacaattgtgagaagaggggacaatatcctcaagc 258

                                                                       
Query: 532 ttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccca 591
            |||||||| | ||||| ||||| ||||| || || || || || || |||||||| |||
Sbjct: 257 ctctttccagtgaagatatcaatagcaacgaaatgacatttggcatgaccatgcttgcca 198

                                                                  
Query: 592 gtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacgatgt 646
           || ||||| || ||||| || || |||||||| || ||| | |||||||||||||
Sbjct: 197 gttttggatgtagagacttccacaaccttgcatggacggcctttgatgacgatgt 143



to top

>gb|AY060530.1| Arabidopsis thaliana At1g69410/F10D13.8 mRNA, complete cds
          Length = 477

 Score =  157 bits (79), Expect = 6e-35
 Identities = 217/263 (82%)
 Strand = Plus / Minus

                                                                       
Query: 391 agcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatca 450
           |||||||| |||||||||||| | ||| | ||||| || || || ||| | ||||| |||
Sbjct: 347 agcttcagatcatccttagtgctaccattatcagtaagaagactaacaaagccatcttca 288

                                                                       
Query: 451 gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 510
           |  || ||||||| |||||||||    || |  ||||| ||||| ||||| |||||||| 
Sbjct: 287 gagatatcaatcaactgataatcaacacgattcacatgtggaacatcacaattgtgggaa 228

                                                                       
Query: 511 gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 570
           |||||||| ||||| |||||||||||   | ||||||| ||||||||||||||||| |||
Sbjct: 227 gaaggaacgatatcttcaagcttcttagaagtaaagatatcaatggcaacaaagtgacac 168

                                                                       
Query: 571 tttgcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgg 630
           || ||||| ||||||||||||||||| || || || |||||||| ||||||||||| || 
Sbjct: 167 ttggcgtgaccatgcttcccagtcttcgaagtcgatacctcaaccaccttgcagggacgt 108

                                  
Query: 631 gccttgatgacgatgtgtccacc 653
            |||||||||||||||| |||||
Sbjct: 107 cccttgatgacgatgtgaccacc 85



to top

>gb|AF372933.1|AF372933 Arabidopsis thaliana At1g69410/F10D13.8 mRNA, complete cds
          Length = 676

 Score =  157 bits (79), Expect = 6e-35
 Identities = 217/263 (82%)
 Strand = Plus / Minus

                                                                       
Query: 391 agcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatca 450
           |||||||| |||||||||||| | ||| | ||||| || || || ||| | ||||| |||
Sbjct: 411 agcttcagatcatccttagtgctaccattatcagtaagaagactaacaaagccatcttca 352

                                                                       
Query: 451 gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 510
           |  || ||||||| |||||||||    || |  ||||| ||||| ||||| |||||||| 
Sbjct: 351 gagatatcaatcaactgataatcaacacgattcacatgtggaacatcacaattgtgggaa 292

                                                                       
Query: 511 gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 570
           |||||||| ||||| |||||||||||   | ||||||| ||||||||||||||||| |||
Sbjct: 291 gaaggaacgatatcttcaagcttcttagaagtaaagatatcaatggcaacaaagtgacac 232

                                                                       
Query: 571 tttgcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgg 630
           || ||||| ||||||||||||||||| || || || |||||||| ||||||||||| || 
Sbjct: 231 ttggcgtgaccatgcttcccagtcttcgaagtcgatacctcaaccaccttgcagggacgt 172

                                  
Query: 631 gccttgatgacgatgtgtccacc 653
            |||||||||||||||| |||||
Sbjct: 171 cccttgatgacgatgtgaccacc 149



to top

>emb|BX818518.1|CNS0AE6E Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL83ZE12 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 723

 Score =  157 bits (79), Expect = 6e-35
 Identities = 217/263 (82%)
 Strand = Plus / Minus

                                                                       
Query: 391 agcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatca 450
           |||||||| |||||||||||| | ||| | ||||| || || || ||| | ||||| |||
Sbjct: 401 agcttcagatcatccttagtgctaccattatcagtaagaagactaacaaagccatcttca 342

                                                                       
Query: 451 gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 510
           |  || ||||||| |||||||||    || |  ||||| ||||| ||||| |||||||| 
Sbjct: 341 gagatatcaatcaactgataatcaacacgattcacatgtggaacatcacaattgtgggaa 282

                                                                       
Query: 511 gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 570
           |||||||| ||||| |||||||||||   | ||||||| ||||||||||||||||| |||
Sbjct: 281 gaaggaacgatatcttcaagcttcttagaagtaaagatatcaatggcaacaaagtgacac 222

                                                                       
Query: 571 tttgcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgg 630
           || ||||| ||||||||||||||||| || || || |||||||| ||||||||||| || 
Sbjct: 221 ttggcgtgaccatgcttcccagtcttcgaagtcgatacctcaaccaccttgcagggacgt 162

                                  
Query: 631 gccttgatgacgatgtgtccacc 653
            |||||||||||||||| |||||
Sbjct: 161 cccttgatgacgatgtgaccacc 139



to top

>gb|AY087040.1| Arabidopsis thaliana clone 30884 mRNA, complete sequence
          Length = 752

 Score =  157 bits (79), Expect = 6e-35
 Identities = 217/263 (82%)
 Strand = Plus / Minus

                                                                       
Query: 391 agcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatca 450
           |||||||| |||||||||||| | ||| | ||||| || || || ||| | ||||| |||
Sbjct: 443 agcttcagatcatccttagtgctaccattatcagtaagaagactaacaaagccatcttca 384

                                                                       
Query: 451 gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 510
           |  || ||||||| |||||||||    || |  ||||| ||||| ||||| |||||||| 
Sbjct: 383 gagatatcaatcaactgataatcaacacgattcacatgtggaacatcacaattgtgggaa 324

                                                                       
Query: 511 gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 570
           |||||||| ||||| |||||||||||   | ||||||| ||||||||||||||||| |||
Sbjct: 323 gaaggaacgatatcttcaagcttcttagaagtaaagatatcaatggcaacaaagtgacac 264

                                                                       
Query: 571 tttgcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgg 630
           || ||||| ||||||||||||||||| || || || |||||||| ||||||||||| || 
Sbjct: 263 ttggcgtgaccatgcttcccagtcttcgaagtcgatacctcaaccaccttgcagggacgt 204

                                  
Query: 631 gccttgatgacgatgtgtccacc 653
            |||||||||||||||| |||||
Sbjct: 203 cccttgatgacgatgtgaccacc 181



to top

>gb|AF296081.1|AF296081 Dianthus caryophyllus eukaryotic translation initiation factor 5A
           mRNA, complete cds
          Length = 810

 Score =  151 bits (76), Expect = 4e-33
 Identities = 232/284 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 438
           |||||||  ||||||||||| |||||||| ||||  ||||| ||||||||||| || |||
Sbjct: 428 tcatcagcaggaagcttcagatcatccttggtgtcaccactgtcagtcagcagactaaca 369

                                                                       
Query: 439 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 498
            | ||||| ||||| || |||| |||||| || ||    ||||  ||||| ||||| |||
Sbjct: 368 aagccatcttcagtgatatcaagcagctggtagtcgacacggttgacatgtggaacatca 309

                                                                       
Query: 499 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 558
           || ||||||||||| || |||||||| || |||||||| || || || ||||||||||||
Sbjct: 308 caattgtgggatgaggggacaatatcttccagcttcttgccgttgaaaatgtcaatggca 249

                                                                       
Query: 559 acaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgacc 618
           |||||||| || || || || || ||||| |||||||||||||| || |||||||| |||
Sbjct: 248 acaaagtgacatttggcatgaccgtgcttgccagtcttggaggtagaaacctcaaccacc 189

                                                       
Query: 619 ttgcaggggcgggccttgatgacgatgtgtccacccttgcggat 662
           ||||| |||||    |||||||||||||| || | |||||||||
Sbjct: 188 ttgcaagggcgatttttgatgacgatgtgaccgctcttgcggat 145



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 60/73 (82%)
 Strand = Plus / Minus

                                                                       
Query: 259 tacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacatc 318
           |||||||||||||  |  ||||| || ||||||||||| ||||| ||||| ||| |||| 
Sbjct: 548 tacttgccaccactaacgtccttgacggcgcagatctgctcttctcccattgcacacatg 489

                        
Query: 319 acagacaggatca 331
           || ||||| ||||
Sbjct: 488 actgacagaatca 476



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
              complete sequence
          Length = 29644043

 Score =  149 bits (75), Expect = 1e-32
 Identities = 114/127 (89%)
 Strand = Plus / Minus

                                                                          
Query: 493    acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
              |||||||||||||||||||| || |||||||| ||||||||||||||||| || ||||||
Sbjct: 703558 acgtcacagttgtgggatgaggggacaatatcttcaagcttctttccattgaaaatgtca 703499

                                                                          
Query: 553    atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
              ||  ||||||||||||| || ||||| |||||||||||||||||||| || |||||||||
Sbjct: 703498 ataccaacaaagtggcatttggcgtgaccatgcttcccagtcttggaagtagagacctca 703439

                     
Query: 613    acgacct 619
              || ||||
Sbjct: 703438 accacct 703432



 Score =  103 bits (52), Expect = 7e-19
 Identities = 100/116 (86%)
 Strand = Plus / Plus

                                                                            
Query: 496      tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
                |||||||||||||| ||||||||||||||||||||||| || ||||| || || || |||
Sbjct: 24265904 tcacagttgtgggacgaaggaacaatatcctcaagctttttaccattgaatatatctatg 24265963

                                                                        
Query: 556      gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctc 611
                ||||||||||| ||||| || || || ||||| |||||||| ||||| || |||||
Sbjct: 24265964 gcaacaaagtgacacttggcatgaccgtgcttaccagtcttcgaggtagaaacctc 24266019



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 160/196 (81%), Gaps = 5/196 (2%)
 Strand = Plus / Minus

                                                                           
Query: 334     tccttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagc 393
               |||||||| ||| |||||||||||||||||||||| || |||   |||| ||| || || 
Sbjct: 7610155 tccttgccttcaccaaatccagtcttgatctggcccaggagattgtcataagttgggagt 7610096

                                                                           
Query: 394     ttcaggtcatccttagtgttgccactctcagtcagcaggctgac--ata-tccatcatca 450
                  || |||||||||||||| || |||||||| || ||||| ||  ||| |||||| || 
Sbjct: 7610095 ccaagatcatccttagtgttaccgctctcagtaagaaggctcacgaataatccatcctct 7610036

                                                                           
Query: 451     gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 510
               | ||||||||||||||| |||| |   ||||   |||| ||||| |||||||||||||||
Sbjct: 7610035 gatatgtcaatcagctggtaatttgtacggtt--catgtggaacatcacagttgtgggat 7609978

                               
Query: 511     gaaggaacaatatcct 526
               ||||||||||||||||
Sbjct: 7609977 gaaggaacaatatcct 7609962



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                                
Query: 378    atcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtca 427
              |||||||||||||||| ||| |||||||||||||||||| ||||||||||
Sbjct: 703856 atcatcagtgggaagcctcaagtcatccttagtgttgccgctctcagtca 703807



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 289    cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcc 341
              ||||||||||||||||||||||| |||||||||| || |||||  ||||||||
Sbjct: 704181 cagatctgttcttcacccatggcggacatcacagtcaagatcatatccttgcc 704129



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 108/130 (83%), Gaps = 5/130 (3%)
 Strand = Plus / Minus

                                                                           
Query: 400     tcatccttagtgttgccactctcagtcagcaggctgac--ata-tccatcatcagttatg 456
               |||||||||||||| || |||||||| || ||||| ||  ||| |||||| || | ||||
Sbjct: 7605336 tcatccttagtgttaccgctctcagtaagaaggctcacgaataatccatcctctgatatg 7605277

                                                                           
Query: 457     tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 516
               ||||||||||| |||| |   ||||   |||| ||||| |||||||||||||||||| ||
Sbjct: 7605276 tcaatcagctggtaatttgtacggtt--catgtggaacatcacagttgtgggatgaatga 7605219

                         
Query: 517     acaatatcct 526
               ||||||||||
Sbjct: 7605218 acaatatcct 7605209



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                           
Query: 554     tggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaa 613
               ||||||||||||| ||||| || || || ||||| | |||||| ||||| || ||||| |
Sbjct: 7609961 tggcaacaaagtgacacttggcatgaccgtgcttactagtcttcgaggtagaaacctcca 7609902

                                                                  
Query: 614     cgaccttgcaggggcgggccttgatgacgatgtgtccacccttgcggatgg 664
               | |||||||||||||||  ||| || |||||||  |||  |||||||||||
Sbjct: 7609901 ccaccttgcaggggcggttcttaataacgatgtacccattcttgcggatgg 7609851



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                            
Query: 289      cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagca 348
                |||||||| || || |||||||| ||||| |||| ||  |  || |||||||| ||| ||
Sbjct: 24264562 cagatctgctcctcccccatggcggacatgacagtcacaacaagatccttgccttcacca 24264621

                                 
Query: 349      aatccagtcttgatctg 365
                |||||||||||||||||
Sbjct: 24264622 aatccagtcttgatctg 24264638



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                   
Query: 400      tcatccttagtgttgccactctcagtcagcaggct 434
                |||||||||||||| ||||||||||| || |||||
Sbjct: 24265579 tcatccttagtgttaccactctcagtaagaaggct 24265613



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 71       tataatagagatagatagatagata 95
                ||||||||| |||||||||||||||
Sbjct: 17717912 tataatagaaatagatagatagata 17717888



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 71       tataatagagatagatagatagata 95
                ||||||||| |||||||||||||||
Sbjct: 16008454 tataatagaaatagatagatagata 16008430



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 334     tccttgccatcagcaaatccagtcttgatctg 365
               |||||||| | | |||||||||||||||||||
Sbjct: 7605401 tccttgccttaaccaaatccagtcttgatctg 7605370



to top

>dbj|AP003874.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1118_G09
          Length = 115815

 Score =  149 bits (75), Expect = 1e-32
 Identities = 114/127 (89%)
 Strand = Plus / Minus

                                                                         
Query: 493   acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
             |||||||||||||||||||| || |||||||| ||||||||||||||||| || ||||||
Sbjct: 42089 acgtcacagttgtgggatgaggggacaatatcttcaagcttctttccattgaaaatgtca 42030

                                                                         
Query: 553   atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
             ||  ||||||||||||| || ||||| |||||||||||||||||||| || |||||||||
Sbjct: 42029 ataccaacaaagtggcatttggcgtgaccatgcttcccagtcttggaagtagagacctca 41970

                    
Query: 613   acgacct 619
             || ||||
Sbjct: 41969 accacct 41963



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                               
Query: 378   atcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtca 427
             |||||||||||||||| ||| |||||||||||||||||| ||||||||||
Sbjct: 42387 atcatcagtgggaagcctcaagtcatccttagtgttgccgctctcagtca 42338



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                  
Query: 289   cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcc 341
             ||||||||||||||||||||||| |||||||||| || |||||  ||||||||
Sbjct: 42712 cagatctgttcttcacccatggcggacatcacagtcaagatcatatccttgcc 42660



to top

>dbj|AP005244.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1513_F02
          Length = 126845

 Score =  149 bits (75), Expect = 1e-32
 Identities = 114/127 (89%)
 Strand = Plus / Minus

                                                                         
Query: 493   acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
             |||||||||||||||||||| || |||||||| ||||||||||||||||| || ||||||
Sbjct: 23365 acgtcacagttgtgggatgaggggacaatatcttcaagcttctttccattgaaaatgtca 23306

                                                                         
Query: 553   atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
             ||  ||||||||||||| || ||||| |||||||||||||||||||| || |||||||||
Sbjct: 23305 ataccaacaaagtggcatttggcgtgaccatgcttcccagtcttggaagtagagacctca 23246

                    
Query: 613   acgacct 619
             || ||||
Sbjct: 23245 accacct 23239



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                               
Query: 378   atcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtca 427
             |||||||||||||||| ||| |||||||||||||||||| ||||||||||
Sbjct: 23663 atcatcagtgggaagcctcaagtcatccttagtgttgccgctctcagtca 23614



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                  
Query: 289   cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgcc 341
             ||||||||||||||||||||||| |||||||||| || |||||  ||||||||
Sbjct: 23988 cagatctgttcttcacccatggcggacatcacagtcaagatcatatccttgcc 23936



to top

>gb|AY488173.1| Capsicum annuum M1C3b mRNA, partial sequence
          Length = 457

 Score =  145 bits (73), Expect = 2e-31
 Identities = 148/173 (85%)
 Strand = Plus / Minus

                                                                       
Query: 454 atgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaa 513
           ||||||||||||||||| |||   ||||  ||||| || || ||||| ||||| ||||||
Sbjct: 325 atgtcaatcagctgatagtctgtacggttgacatgtggcacatcacaattgtgagatgaa 266

                                                                       
Query: 514 ggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcacttt 573
           ||||||||||| ||||||||||||||||| || |||||||| || |||||||| || |||
Sbjct: 265 ggaacaatatcttcaagcttctttccattgaaaatgtcaattgccacaaagtgacatttt 206

                                                                
Query: 574 gcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggg 626
           || || || ||||| ||||| ||||| |||||||||||||| |||||||||||
Sbjct: 205 gcatgtccgtgcttgccagttttggaagtggagacctcaacaaccttgcaggg 153



to top

>gb|AF296085.1|AF296085 Lycopersicon esculentum eukaryotic translation initiation factor
           5A-3 mRNA, complete cds
          Length = 713

 Score =  139 bits (70), Expect = 1e-29
 Identities = 217/266 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 438
           |||||||| |||||| | ||||||||||| ||||| ||| | ||||| ||||| || |||
Sbjct: 413 tcatcagtaggaagcctgaggtcatccttggtgttaccattgtcagtaagcagactcaca 354

                                                                       
Query: 439 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 498
            ||||||| ||||  |||||||| ||||||||||||   || | ||||||||| || |||
Sbjct: 353 aatccatcttcagagatgtcaataagctgataatctgtacgattaacatggggcacatca 294

                                                                       
Query: 499 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 558
           || ||||| || || || |||||||||||||||||||| ||| | ||||||||||| |||
Sbjct: 293 caattgtgtgaagaggggacaatatcctcaagcttcttcccagtgaagatgtcaatagca 234

                                                                       
Query: 559 acaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgacc 618
           || || || || || ||||| || ||||| ||||| ||||| || ||||| || || |||
Sbjct: 233 acgaaatgacatttggcgtgaccgtgcttgccagttttggatgtagagacttccacaacc 174

                                     
Query: 619 ttgcaggggcgggccttgatgacgat 644
           ||||| || ||| | |||||||||||
Sbjct: 173 ttgcatggacggcctttgatgacgat 148



to top

>dbj|D10399.1|RIC225 Oryza sativa mRNA for initiation factor eIF-4D (225 gene), partial
           sequence
          Length = 433

 Score =  139 bits (70), Expect = 1e-29
 Identities = 157/186 (84%)
 Strand = Plus / Minus

                                                                       
Query: 496 tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
           ||||||||||| || || || |||||||| || ||||||||  || ||||||||||||| 
Sbjct: 291 tcacagttgtgagaagatggcacaatatcttcgagcttcttggcagtaaagatgtcaatt 232

                                                                       
Query: 556 gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
           ||||||||||||||||| ||||| || ||||||||||| || ||||| || |||||||| 
Sbjct: 231 gcaacaaagtggcacttggcgtgaccgtgcttcccagttttagaggttgaaacctcaaca 172

                                                                       
Query: 616 accttgcaggggcgggccttgatgacgatgtgtccacccttgcggatggcgccggcctgc 675
           |||||||||||||||  ||||||||| ||||  |||   ||||||||||  || ||||||
Sbjct: 171 accttgcaggggcggttcttgatgactatgtagccatttttgcggatggtcccagcctgc 112

                 
Query: 676 tgcggg 681
           ||||||
Sbjct: 111 tgcggg 106



to top

>gb|AF225297.1|AF225297 Euphorbia esula translation initiation factor 5A mRNA, partial cds
          Length = 725

 Score =  135 bits (68), Expect = 2e-28
 Identities = 137/160 (85%)
 Strand = Plus / Minus

                                                                       
Query: 487 tggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaag 546
           |||||||| ||||| |||||||| |||||||| ||||| ||||||||||||||||| |||
Sbjct: 245 tggggaacatcacaattgtgggaagaaggaacgatatcttcaagcttctttccattgaag 186

                                                                       
Query: 547 atgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggag 606
           || |||||  |||||||||| || || || || || ||||| ||||||||||| || |||
Sbjct: 185 atatcaattccaacaaagtgacatttggcatgaccgtgctttccagtcttggatgttgag 126

                                                   
Query: 607 acctcaacgaccttgcaggggcgggccttgatgacgatgt 646
           |||||||| |||||||| || |||  ||||||||||||||
Sbjct: 125 acctcaacaaccttgcaaggacggttcttgatgacgatgt 86



to top

>ref|NM_102425.2| Arabidopsis thaliana translation initiation factor AT1G26630 mRNA,
           complete cds
          Length = 929

 Score =  133 bits (67), Expect = 8e-28
 Identities = 232/287 (80%)
 Strand = Plus / Minus

                                                                       
Query: 377 catcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctga 436
           ||||||| ||||||||||| || |||||||| |||   ||||| ||||| || ||||| |
Sbjct: 493 catcatcggtgggaagcttgagatcatccttggtgccaccactgtcagtgagaaggctca 434

                                                                       
Query: 437 catatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgt 496
           |  | ||||| ||||| || ||||||| ||| |||||    ||||  ||||| ||||| |
Sbjct: 433 cgaagccatcctcagtgatatcaatcaactggtaatcaacacggttcacatgtggaacat 374

                                                                       
Query: 497 cacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatgg 556
           |||| |||||||| || ||||||||||| |||||||||||  || | ||||| ||||| |
Sbjct: 373 cacaattgtgggaagatggaacaatatcttcaagcttcttagcagtgaagatatcaatag 314

                                                                       
Query: 557 caacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacga 616
           |||||||||| || || ||||| || ||||| ||||| ||||| || || |||||||| |
Sbjct: 313 caacaaagtgacatttggcgtgaccgtgcttgccagttttggaagtcgaaacctcaacaa 254

                                                          
Query: 617 ccttgcaggggcgggccttgatgacgatgtgtccacccttgcggatg 663
           |||||||||| |||   |||||||||||||| ||||| || ||||||
Sbjct: 253 ccttgcagggacggtttttgatgacgatgtgaccacctttacggatg 207



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 317
           ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 612 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 553

                   
Query: 318 cacagaca 325
            |||||||
Sbjct: 552 gacagaca 545



to top

>gb|BT016590.1| Zea mays clone Contig423 mRNA sequence
          Length = 945

 Score =  133 bits (67), Expect = 8e-28
 Identities = 204/247 (82%), Gaps = 2/247 (0%)
 Strand = Plus / Minus

                                                                       
Query: 400 tcatccttagtgttgccactctca-gtcagcaggctgacatatccatcatcagttatgtc 458
           |||||||||||||||||| ||| | || || ||||| ||| ||||||| || | ||| ||
Sbjct: 516 tcatccttagtgttgcca-tctgaagtaagaaggctcacaaatccatcctctgatatatc 458

                                                                       
Query: 459 aatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaac 518
           ||||||||| || ||    ||||  ||||| ||||  ||||||||||| || ||||||||
Sbjct: 457 aatcagctggtactcagtacggttcacatgtggaatatcacagttgtgtgacgaaggaac 398

                                                                       
Query: 519 aatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtg 578
           |||||| || ||||| || || || || ||||| ||||||||||||||||| || || ||
Sbjct: 397 aatatcttcgagctttttcccgttgaatatgtctatggcaacaaagtggcatttggcatg 338

                                                                       
Query: 579 gccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgat 638
           ||||||||| |||||||| ||||| || ||||| || |||||||||||||||  ||||||
Sbjct: 337 gccatgcttaccagtctttgaggtagaaacctccacaaccttgcaggggcggttcttgat 278

                  
Query: 639 gacgatg 645
           |||||||
Sbjct: 277 gacgatg 271



to top

>gb|BT017712.1| Zea mays clone EL01N0446G03.c mRNA sequence
          Length = 800

 Score =  133 bits (67), Expect = 8e-28
 Identities = 204/247 (82%), Gaps = 2/247 (0%)
 Strand = Plus / Minus

                                                                       
Query: 400 tcatccttagtgttgccactctca-gtcagcaggctgacatatccatcatcagttatgtc 458
           |||||||||||||||||| ||| | || || ||||| ||| ||||||| || | ||| ||
Sbjct: 404 tcatccttagtgttgcca-tctgaagtaagaaggctcacaaatccatcctctgatatatc 346

                                                                       
Query: 459 aatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaac 518
           ||||||||| || ||    ||||  ||||| ||||  ||||||||||| || ||||||||
Sbjct: 345 aatcagctggtactcagtacggttcacatgtggaatatcacagttgtgtgacgaaggaac 286

                                                                       
Query: 519 aatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtg 578
           |||||| || ||||| || || || || ||||| ||||||||||||||||| || || ||
Sbjct: 285 aatatcttcgagctttttcccgttgaatatgtctatggcaacaaagtggcatttggcatg 226

                                                                       
Query: 579 gccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgat 638
           ||||||||| |||||||| ||||| || ||||| || |||||||||||||||  ||||||
Sbjct: 225 gccatgcttaccagtctttgaggtagaaacctccacaaccttgcaggggcggctcttgat 166

                  
Query: 639 gacgatg 645
           |||||||
Sbjct: 165 gacgatg 159



to top

>gb|AF492850.1| Arabidopsis thaliana putative initiation factor 5A mRNA, complete
           cds
          Length = 726

 Score =  133 bits (67), Expect = 8e-28
 Identities = 232/287 (80%)
 Strand = Plus / Minus

                                                                       
Query: 377 catcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctga 436
           ||||||| ||||||||||| || |||||||| |||   ||||| ||||| || ||||| |
Sbjct: 438 catcatcggtgggaagcttgagatcatccttggtgccaccactgtcagtgagaaggctca 379

                                                                       
Query: 437 catatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgt 496
           |  | ||||| ||||| || ||||||| ||| |||||    ||||  ||||| ||||| |
Sbjct: 378 cgaagccatcctcagtgatatcaatcaactggtaatcaacacggttcacatgtggaacat 319

                                                                       
Query: 497 cacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatgg 556
           |||| |||||||| || ||||||||||| |||||||||||  || | ||||| ||||| |
Sbjct: 318 cacaattgtgggaagatggaacaatatcttcaagcttcttagcagtgaagatatcaatag 259

                                                                       
Query: 557 caacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacga 616
           |||||||||| || || ||||| || ||||| ||||| ||||| || || |||||||| |
Sbjct: 258 caacaaagtgacatttggcgtgaccgtgcttgccagttttggaagtcgaaacctcaacaa 199

                                                          
Query: 617 ccttgcaggggcgggccttgatgacgatgtgtccacccttgcggatg 663
           |||||||||| |||   |||||||||||||| ||||| || ||||||
Sbjct: 198 ccttgcagggacggtttttgatgacgatgtgaccacctttacggatg 152



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 317
           ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 557 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 498

                   
Query: 318 cacagaca 325
            |||||||
Sbjct: 497 gacagaca 490



to top

>gb|AY055789.1| Arabidopsis thaliana At1g26630/T24P13_1 mRNA, complete cds
          Length = 480

 Score =  133 bits (67), Expect = 8e-28
 Identities = 232/287 (80%)
 Strand = Plus / Minus

                                                                       
Query: 377 catcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctga 436
           ||||||| ||||||||||| || |||||||| |||   ||||| ||||| || ||||| |
Sbjct: 361 catcatcggtgggaagcttgagatcatccttggtgccaccactgtcagtgagaaggctca 302

                                                                       
Query: 437 catatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgt 496
           |  | ||||| ||||| || ||||||| ||| |||||    ||||  ||||| ||||| |
Sbjct: 301 cgaagccatcctcagtgatatcaatcaactggtaatcaacacggttcacatgtggaacat 242

                                                                       
Query: 497 cacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatgg 556
           |||| |||||||| || ||||||||||| |||||||||||  || | ||||| ||||| |
Sbjct: 241 cacaattgtgggaagatggaacaatatcttcaagcttcttagcagtgaagatatcaatag 182

                                                                       
Query: 557 caacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacga 616
           |||||||||| || || ||||| || ||||| ||||| ||||| || || |||||||| |
Sbjct: 181 caacaaagtgacatttggcgtgaccgtgcttgccagttttggaagtcgaaacctcaacaa 122

                                                          
Query: 617 ccttgcaggggcgggccttgatgacgatgtgtccacccttgcggatg 663
           |||||||||| |||   |||||||||||||| ||||| || ||||||
Sbjct: 121 ccttgcagggacggtttttgatgacgatgtgaccacctttacggatg 75



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 317
           ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 480 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 421

                   
Query: 318 cacagaca 325
            |||||||
Sbjct: 420 gacagaca 413



to top

>gb|AY039588.1| Arabidopsis thaliana At1g26630/T24P13_1 mRNA, complete cds
          Length = 765

 Score =  133 bits (67), Expect = 8e-28
 Identities = 232/287 (80%)
 Strand = Plus / Minus

                                                                       
Query: 377 catcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctga 436
           ||||||| ||||||||||| || |||||||| |||   ||||| ||||| || ||||| |
Sbjct: 444 catcatcggtgggaagcttgagatcatccttggtgccaccactgtcagtgagaaggctca 385

                                                                       
Query: 437 catatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgt 496
           |  | ||||| ||||| || ||||||| ||| |||||    ||||  ||||| ||||| |
Sbjct: 384 cgaagccatcctcagtgatatcaatcaactggtaatcaacacggttcacatgtggaacat 325

                                                                       
Query: 497 cacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatgg 556
           |||| |||||||| || ||||||||||| |||||||||||  || | ||||| ||||| |
Sbjct: 324 cacaattgtgggaagatggaacaatatcttcaagcttcttagcagtgaagatatcaatag 265

                                                                       
Query: 557 caacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacga 616
           |||||||||| || || ||||| || ||||| ||||| ||||| || || |||||||| |
Sbjct: 264 caacaaagtgacatttggcgtgaccgtgcttgccagttttggaagtcgaaacctcaacaa 205

                                                          
Query: 617 ccttgcaggggcgggccttgatgacgatgtgtccacccttgcggatg 663
           |||||||||| |||   |||||||||||||| ||||| || ||||||
Sbjct: 204 ccttgcagggacggtttttgatgacgatgtgaccacctttacggatg 158



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 317
           ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 563 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 504

                   
Query: 318 cacagaca 325
            |||||||
Sbjct: 503 gacagaca 496



to top

>emb|BX814148.1|CNS0AEAE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB59ZC08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 737

 Score =  133 bits (67), Expect = 8e-28
 Identities = 232/287 (80%)
 Strand = Plus / Minus

                                                                       
Query: 377 catcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctga 436
           ||||||| ||||||||||| || |||||||| |||   ||||| ||||| || ||||| |
Sbjct: 418 catcatcggtgggaagcttgagatcatccttggtgccaccactgtcagtaagaaggctca 359

                                                                       
Query: 437 catatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgt 496
           |  | ||||| ||||| || ||||||| ||| |||||    ||||  ||||| ||||| |
Sbjct: 358 cgaagccatcctcagtgatatcaatcaactggtaatcaacacggttcacatgtggaacat 299

                                                                       
Query: 497 cacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatgg 556
           |||| |||||||| || ||||||||||| |||||||||||  || | ||||| ||||| |
Sbjct: 298 cacaattgtgggaagatggaacaatatcttcaagcttcttagcagtgaagatatcaatag 239

                                                                       
Query: 557 caacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacga 616
           |||||||||| || || ||||| || ||||| ||||| ||||| || || |||||||| |
Sbjct: 238 caacaaagtgacatttggcgtgaccgtgcttgccagttttggaagtcgaaacctcaacaa 179

                                                          
Query: 617 ccttgcaggggcgggccttgatgacgatgtgtccacccttgcggatg 663
           |||||||||| |||   |||||||||||||| ||||| || ||||||
Sbjct: 178 ccttgcagggacggtttttgatgacgatgtgaccacctttacggatg 132



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 258 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 317
           ||||||||||||||| | |||||| || || || ||||| || || ||||||| ||||||
Sbjct: 537 ttacttgccaccaccaacttccttgacggcacaaatctgctcctctcccatggaagacat 478

                   
Query: 318 cacagaca 325
            |||||||
Sbjct: 477 gacagaca 470



to top

>gb|AY084827.1| Arabidopsis thaliana clone 118823 mRNA, complete sequence
          Length = 781

 Score =  133 bits (67), Expect = 8e-28
 Identities = 232/287 (80%)
 Strand = Plus / Minus

                                                                       
Query: 377 catcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctga 436
           ||||||| ||||||||||| || |||||||| |||   ||||| ||||| || ||||| |
Sbjct: 492 catcatcggtgggaagcttgagatcatccttggtgccaccactgtcagtgagaaggctca 433

                                                                       
Query: 437 catatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgt 496
           |  | ||||| ||||| || ||||||| ||| |||||    ||||  ||||| ||||| |
Sbjct: 432 cgaagccatcctcagtgatatcaatcaactggtaatcaacacggttcacatgtggaacat 373

                                                                       
Query: 497 cacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatgg 556
           |||| |||||||| || ||||||||||| |||||||||||  || | ||||| ||||| |
Sbjct: 372 cacaattgtgggaagatggaacaatatcttcaagcttcttagcagtgaagatatcaatag 313

                                                                       
Query: 557 caacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacga 616
           |||||||||| || || ||||| || ||||| ||||| ||||| || || |||||||| |
Sbjct: 312 caacaaagtgacatttggcgtgaccgtgcttgccagttttggaagtcgaaacctcaacaa 253

                                                          
Query: 617 ccttgcaggggcgggccttgatgacgatgtgtccacccttgcggatg 663
           |||||||||| |||   |||||||||||||| ||||| || ||||||
Sbjct: 252 ccttgcagggacggtttttgatgacgatgtgaccacctttacggatg 206



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 317
           ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 611 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 552

                   
Query: 318 cacagaca 325
            |||||||
Sbjct: 551 gacagaca 544



to top

>gb|AF034943.1|AF034943 Zea mays translation initiation factor 5A (TIF5A) mRNA, complete
           cds
          Length = 831

 Score =  133 bits (67), Expect = 8e-28
 Identities = 204/247 (82%), Gaps = 2/247 (0%)
 Strand = Plus / Minus

                                                                       
Query: 400 tcatccttagtgttgccactctca-gtcagcaggctgacatatccatcatcagttatgtc 458
           |||||||||||||||||| ||| | || || ||||| ||| ||||||| || | ||| ||
Sbjct: 409 tcatccttagtgttgcca-tctgaagtaagaaggctcacaaatccatcctctgatatatc 351

                                                                       
Query: 459 aatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaac 518
           ||||||||| || ||    ||||  ||||| ||||  ||||||||||| || ||||||||
Sbjct: 350 aatcagctggtactcagtacggttcacatgcggaatatcacagttgtgtgacgaaggaac 291

                                                                       
Query: 519 aatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtg 578
           |||||| || ||||| || || || || ||||| ||||||||||||||||| || || ||
Sbjct: 290 aatatcttcgagctttttcccgttgaatatgtctatggcaacaaagtggcatttggcatg 231

                                                                       
Query: 579 gccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgat 638
           ||||||||| |||||||| ||||| || ||||| || |||||||||||||||  ||||||
Sbjct: 230 gccatgcttaccagtctttgaggtagaaacctccacaaccttgcaggggcggttcttgat 171

                  
Query: 639 gacgatg 645
           |||||||
Sbjct: 170 gacgatg 164



to top

>gb|AF516356.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform VII (eIF-5A) mRNA, complete cds
          Length = 895

 Score =  131 bits (66), Expect = 3e-27
 Identities = 165/198 (83%)
 Strand = Plus / Minus

                                                                       
Query: 484 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 543
           ||||| ||||| |||||||| ||||| || ||||||||||| |||||||| ||  |||| 
Sbjct: 277 acatgaggaacatcacagttatgggaggagggaacaatatcttcaagctttttggcattg 218

                                                                       
Query: 544 aagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtg 603
           |||||||| ||  |||| || || ||||| || || |||||||| |||||||||||||||
Sbjct: 217 aagatgtctattccaacgaaatgacacttagcatgaccatgctttccagtcttggaggtg 158

                                                                       
Query: 604 gagacctcaacgaccttgcaggggcgggccttgatgacgatgtgtccacccttgcggatg 663
           || || ||||| ||||||||||||||   ||||||||||||||  |||  ||||||||||
Sbjct: 157 gaaacatcaacaaccttgcaggggcgattcttgatgacgatgtaaccattcttgcggatg 98

                             
Query: 664 gcgccggcctgctgcggg 681
           |  ||||| |||||||||
Sbjct: 97  gtaccggcttgctgcggg 80



to top

>gb|DQ207846.1| Solanum tuberosum clone 073A09 eukaryotic initiation factor
           5A3-like mRNA, complete cds
          Length = 696

 Score =  127 bits (64), Expect = 5e-26
 Identities = 217/268 (80%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 438
           ||||| |||||||||   ||||||||||| ||||| ||||| ||||| || |||  ||||
Sbjct: 451 tcatcggtgggaagccggaggtcatccttggtgtttccactttcagtaagaagggagaca 392

                                                                       
Query: 439 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 498
            | ||||| ||||  ||||||||||||||||| ||    ||||  ||||| || ||||||
Sbjct: 391 aaaccatcttcagagatgtcaatcagctgatagtcggtacggttgacatgtggcacgtca 332

                                                                       
Query: 499 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 558
           || |||||||| || ||||| ||||| || || ||||||||||| || |||||||| || 
Sbjct: 331 caattgtgggaggatggaacgatatcttcgagtttctttccattgaaaatgtcaattgcc 272

                                                                       
Query: 559 acaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgacc 618
           |||||||| || || || || || ||||| ||||| || || |||||||||||||| |||
Sbjct: 271 acaaagtgacatttagcatgtccgtgctttccagtttttgaagtggagacctcaacaacc 212

                                       
Query: 619 ttgcaggggcgggccttgatgacgatgt 646
           |||||||| ||| | ||||| |||||||
Sbjct: 211 ttgcagggacggcctttgataacgatgt 184



to top

>gb|AY389707.1| Hyacinthus orientalis eukaryotic translation initiation factor 5A-4
           mRNA, complete cds
          Length = 794

 Score =  127 bits (64), Expect = 5e-26
 Identities = 283/356 (79%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaa 350
           |||||||||||| |||||||||||||| ||||| |  |  || |||||||| ||||||||
Sbjct: 479 gatctgttcttctcccatggcagacatgacagagaccacgagctccttgccttcagcaaa 420

                                                                       
Query: 351 tccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagt 410
            |||   |||||||||  ||||||    |||||||| |||||| |||| |||||||||||
Sbjct: 419 accatctttgatctgggtaagcagggagtcatcagttggaagcctcagatcatccttagt 360

                                                                       
Query: 411 gttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctgata 470
           |   ||| ||||||| |  || || ||| ||||||| |||| |||||| || || |||||
Sbjct: 359 gccaccattctcagttaagagactcacaaatccatcttcagatatgtcgatgagttgata 300

                                                                       
Query: 471 atcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctcaag 530
            ||   ||||  |||||| ||||| |||||||| ||||| || || |||||||| |||||
Sbjct: 299 gtcagtgcgggtaacatgaggaacatcacagttatgggaagatggcacaatatcttcaag 240

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||  || | ||||| || || || |||||||| ||||| || || |||||||| ||
Sbjct: 239 cttcttagcagtgaagatatctatcgcgacaaagtgacacttagcatgtccatgctttcc 180

                                                                   
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacgatgt 646
            || || ||||| || |||||||| |||||||| ||||||  ||||||||| ||||
Sbjct: 179 ggttttagaggttgaaacctcaaccaccttgcaagggcggttcttgatgactatgt 124



to top

>dbj|AB004827.1| Solanum tuberosum mRNA for eukaryotic initiation factor 5A1,
           complete cds
          Length = 632

 Score =  127 bits (64), Expect = 5e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                       
Query: 496 tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
           ||||| ||||||||||||||||||||||| ||||||||||||||||| || ||||| || 
Sbjct: 287 tcacaattgtgggatgaaggaacaatatcttcaagcttctttccattgaaaatgtcgatt 228

                                                                       
Query: 556 gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
           || |||||||| || ||||| || || ||||| ||||| ||||| |||||||||||||| 
Sbjct: 227 gccacaaagtgacattttgcatgtccgtgcttgccagttttggaagtggagacctcaaca 168

                   
Query: 616 accttgca 623
           ||||||||
Sbjct: 167 accttgca 160



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                             
Query: 277 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacag 326
           ||||||||||| |||||||| ||||||||||| |||||||||||||||||
Sbjct: 506 tccttcacagcacagatctgctcttcacccattgcagacatcacagacag 457



to top

>dbj|AB004824.1| Solanum tuberosum mRNA for eukaryotic initiation factor 5A3,
           complete cds
          Length = 733

 Score =  127 bits (64), Expect = 5e-26
 Identities = 217/268 (80%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 438
           ||||| |||||||||   ||||||||||| ||||| ||||| ||||| || |||  ||||
Sbjct: 409 tcatcggtgggaagccggaggtcatccttggtgtttccactttcagtaagaagggagaca 350

                                                                       
Query: 439 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 498
            | ||||| ||||  ||||||||||||||||| ||    ||||  ||||| || ||||||
Sbjct: 349 aaaccatcttcagagatgtcaatcagctgatagtcggtacggttgacatgtggcacgtca 290

                                                                       
Query: 499 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 558
           || |||||||| || ||||| ||||| || || ||||||||||| || |||||||| || 
Sbjct: 289 caattgtgggaggatggaacgatatcttcgagtttctttccattgaaaatgtcaattgcc 230

                                                                       
Query: 559 acaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgacc 618
           |||||||| || || || || || ||||| ||||| || || |||||||||||||| |||
Sbjct: 229 acaaagtgacatttagcatgtccgtgctttccagtttttgaagtggagacctcaacaacc 170

                                       
Query: 619 ttgcaggggcgggccttgatgacgatgt 646
           |||||||| ||| | ||||| |||||||
Sbjct: 169 ttgcagggacggcctttgataacgatgt 142



to top

>dbj|AB004823.1| Solanum tuberosum mRNA for eukaryotic initiation factor 5A2,
           complete cds
          Length = 716

 Score =  127 bits (64), Expect = 5e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                       
Query: 496 tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
           ||||| ||||||||||||||||||||||| ||||||||||||||||| || ||||| || 
Sbjct: 301 tcacaattgtgggatgaaggaacaatatcttcaagcttctttccattgaaaatgtcgatt 242

                                                                       
Query: 556 gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
           || |||||||| || ||||| || || ||||| ||||| ||||| |||||||||||||| 
Sbjct: 241 gccacaaagtgacattttgcatgtccgtgcttgccagttttggaagtggagacctcaaca 182

                   
Query: 616 accttgca 623
           ||||||||
Sbjct: 181 accttgca 174



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 277 tccttcacagcgcagatctgttcttcacccatggcagacatcacagaca 325
           ||||||||||| |||||||| ||||||||||| ||||||||||||||||
Sbjct: 520 tccttcacagcacagatctgctcttcacccattgcagacatcacagaca 472



to top

>gb|AF516351.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform II (eIF-5A) mRNA, complete cds
          Length = 828

 Score =  123 bits (62), Expect = 8e-25
 Identities = 230/286 (80%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 438
           ||||| ||||||||| |||| ||||| || ||||| ||| | |||||||| || || |||
Sbjct: 392 tcatcggtgggaagcctcagatcatctttggtgtttccattttcagtcagaagactcaca 333

                                                                       
Query: 439 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 498
            | ||||| ||||  || |||||||||||||||||    || | |||||| ||||| |||
Sbjct: 332 aagccatcttcagagatatcaatcagctgataatcagtacgattaacatgaggaacatca 273

                                                                       
Query: 499 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 558
           || ||||||||||||||||||||||| ||||| || ||| |||| || || |||||  ||
Sbjct: 272 caattgtgggatgaaggaacaatatcttcaagtttttttgcattgaatatatcaattcca 213

                                                                       
Query: 559 acaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgacc 618
           || ||||||||||| || || ||||| ||||| ||||| || || || ||||| || |||
Sbjct: 212 acgaagtggcacttagcatgaccatgtttccctgtctttgatgttgaaacctccacaacc 153

                                                         
Query: 619 ttgcaggggcgggccttgatgacgatgtgtccacccttgcggatgg 664
           |||||||| ||   |||||| |||||||  |||  |||||||||||
Sbjct: 152 ttgcagggacgattcttgataacgatgtagccattcttgcggatgg 107



to top

>gb|AF516350.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform I (eIF-5A) mRNA, complete cds
          Length = 775

 Score =  123 bits (62), Expect = 8e-25
 Identities = 230/286 (80%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 438
           ||||| ||||||||| |||| ||||| || ||||| ||| | |||||||| || || |||
Sbjct: 387 tcatcggtgggaagcctcagatcatctttggtgtttccattttcagtcagaagactcaca 328

                                                                       
Query: 439 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 498
            | ||||| ||||  || |||||||||||||||||    || | |||||| ||||| |||
Sbjct: 327 aagccatcttcagagatatcaatcagctgataatcagtacgattaacatgaggaacatca 268

                                                                       
Query: 499 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 558
           || ||||||||||||||||||||||| ||||| || ||| |||| || || |||||  ||
Sbjct: 267 caattgtgggatgaaggaacaatatcttcaagtttttttgcattgaatatatcaattcca 208

                                                                       
Query: 559 acaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgacc 618
           || ||||||||||| || || ||||| ||||| ||||| || || || ||||| || |||
Sbjct: 207 acgaagtggcacttagcatgaccatgtttccctgtctttgatgttgaaacctccacaacc 148

                                                         
Query: 619 ttgcaggggcgggccttgatgacgatgtgtccacccttgcggatgg 664
           |||||||| ||   |||||| |||||||  |||  |||||||||||
Sbjct: 147 ttgcagggacgattcttgataacgatgtagccattcttgcggatgg 102



to top

>gb|DQ083198.1| Oryza sativa (indica cultivar-group) clone 5S10E11 mRNA sequence
          Length = 371

 Score =  123 bits (62), Expect = 8e-25
 Identities = 161/194 (82%)
 Strand = Plus / Minus

                                                                       
Query: 277 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatcaggtcc 336
           ||||||| |||||||||||| || |||||||||||||||||||| |  |  ||||| |||
Sbjct: 200 tccttcagagcgcagatctgctcctcacccatggcagacatcacggtaacaatcagatcc 141

                                                                       
Query: 337 ttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttc 396
           || || || || ||||||  |||||||||   ||||||| | |||||| | || ||| ||
Sbjct: 140 ttcccctcggcgaatccatccttgatctgagtaagcagagcctcatcactagggagcctc 81

                                                                       
Query: 397 aggtcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatg 456
           |||||||||||||||   ||||| |||||||| ||||||||| ||||||| ||||  |||
Sbjct: 80  aggtcatccttagtgcctccactttcagtcaggaggctgacaaatccatcttcagaaatg 21

                         
Query: 457 tcaatcagctgata 470
           ||||||||||||||
Sbjct: 20  tcaatcagctgata 7



to top

>gb|AF296086.1|AF296086 Lycopersicon esculentum eukaryotic translation initiation factor
           5A-4 mRNA, complete cds
          Length = 760

 Score =  123 bits (62), Expect = 8e-25
 Identities = 152/182 (83%)
 Strand = Plus / Minus

                                                                       
Query: 442 ccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacag 501
           ||||| |||| |||||||||||||||||| ||    || |  ||||| || || ||||| 
Sbjct: 353 ccatcttcagatatgtcaatcagctgatagtcagtacgattgacatgtggcacatcacaa 294

                                                                       
Query: 502 ttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaaca 561
           ||||||||||||||||||||||| |||||||| ||| |||| || ||||| || || |||
Sbjct: 293 ttgtgggatgaaggaacaatatcttcaagcttttttgcattgaaaatgtcgattgccaca 234

                                                                       
Query: 562 aagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttg 621
           ||||| || ||||| || |||||||| ||||| ||||| |||||||||||||| ||||||
Sbjct: 233 aagtgacattttgcatgtccatgcttgccagttttggaagtggagacctcaacaaccttg 174

             
Query: 622 ca 623
           ||
Sbjct: 173 ca 172



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 47/50 (94%)
 Strand = Plus / Minus

                                                             
Query: 277 tccttcacagcgcagatctgttcttcacccatggcagacatcacagacag 326
           ||||||||||| |||||||| ||||||||||| |||||||||||||||||
Sbjct: 518 tccttcacagcacagatctgctcttcacccattgcagacatcacagacag 469



to top

>emb|X63541.1|NPNEIF5A1 N.plumbaginifolia mRNA NeIF-5A1 for initiation factor 5A(1)
          Length = 702

 Score =  121 bits (61), Expect = 3e-24
 Identities = 271/341 (79%)
 Strand = Plus / Minus

                                                                       
Query: 304 cccatggcagacatcacagacaggatcaggtccttgccatcagcaaatccagtcttgatc 363
           ||||||||||||||||| ||||| | || |||||| || |||||||| |||   ||||||
Sbjct: 397 cccatggcagacatcactgacagaaccaagtccttcccctcagcaaaaccatctttgatc 338

                                                                       
Query: 364 tggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctca 423
            || | || |||  ||| ||||| || ||| ||| ||||||||| ||||| ||| | |||
Sbjct: 337 agggccagaagattatcgtcagttgggagcctcaagtcatccttggtgttaccattttca 278

                                                                       
Query: 424 gtcagcaggctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtca 483
           |||| ||| || ||| ||||||| ||||  || |||||||||||||| ||    |  |  
Sbjct: 277 gtcaacagactcacaaatccatcctcagagatatcaatcagctgatagtcagtcctattc 218

                                                                       
Query: 484 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 543
           ||||| ||||| ||||||||||| || || |||||||| || ||||||||||||||| | 
Sbjct: 217 acatgaggaacatcacagttgtgagaagagggaacaatgtcttcaagcttctttccagtg 158

                                                                       
Query: 544 aagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtg 603
           || |||||||| || ||||||||||| || || || || ||||| || |||||||| |||
Sbjct: 157 aaaatgtcaatagccacaaagtggcatttagcatgaccgtgcttgcctgtcttggaagtg 98

                                                    
Query: 604 gagacctcaacgaccttgcaggggcgggccttgatgacgat 644
           || || ||||| |||||||| || |||   |||||||||||
Sbjct: 97  gaaacttcaactaccttgcaaggacggtttttgatgacgat 57



to top

>gb|AF516353.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform IV (eIF-5A) mRNA, complete cds
          Length = 772

 Score =  119 bits (60), Expect = 1e-23
 Identities = 201/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 438
           ||||| ||||||||| | || |||||||| ||||| ||||| |||||||| || || |||
Sbjct: 391 tcatcggtgggaagcctgagatcatccttggtgtttccactttcagtcagaagactcaca 332

                                                                       
Query: 439 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 498
            | ||||| ||||  || |||||||||||||||||    || | |||||||||| | |||
Sbjct: 331 aaaccatcttcagagatatcaatcagctgataatcagtacgattaacatggggagcatca 272

                                                                       
Query: 499 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 558
           || ||||||||||||||||||||||| ||||| || ||| || | || || |||||  ||
Sbjct: 271 caattgtgggatgaaggaacaatatcttcaagtttttttgcagtgaatatatcaattcca 212

                                                                       
Query: 559 acaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgacc 618
           || ||||||||||| || || || |||||||| ||||| || || || ||||| || |||
Sbjct: 211 acgaagtggcacttagcatgaccgtgcttccctgtctttgatgttgaaacctccacaacc 152

                   
Query: 619 ttgcaggg 626
           ||||||||
Sbjct: 151 ttgcaggg 144



to top

>gb|AF516358.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform IX (eIF-5A) mRNA, partial cds
          Length = 285

 Score =  117 bits (59), Expect = 5e-23
 Identities = 128/151 (84%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 438
           |||||||| |||||| ||||||||||||| ||||| ||| ||||||||||||| || |||
Sbjct: 151 tcatcagttggaagcctcaggtcatccttggtgtttccattctcagtcagcagactcaca 92

                                                                       
Query: 439 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 498
            ||||||| ||||  || |||||||||||||||||   ||||  |||||||||||| |||
Sbjct: 91  aatccatcctcagagatatcaatcagctgataatcagtgcgggtaacatggggaacatca 32

                                          
Query: 499 cagttgtgggatgaaggaacaatatcctcaa 529
           |||||||| || ||||| || ||||| ||||
Sbjct: 31  cagttgtgagaagaagggacgatatcttcaa 1



to top

>gb|AF516352.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform III (eIF-5A) mRNA, complete cds
          Length = 781

 Score =  115 bits (58), Expect = 2e-22
 Identities = 229/286 (80%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 438
           ||||| ||||||||| |||| ||||| || ||||| ||| | |||||||| || || |||
Sbjct: 387 tcatcggtgggaagcctcagatcatctttggtgtttccattttcagtcagaagactcaca 328

                                                                       
Query: 439 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 498
            | ||||| ||||  || |||||||||||||||||    || | |||||| ||||| |||
Sbjct: 327 aagccatcttcagagatatcaatcagctgataatcagtacgattaacatgaggaacatca 268

                                                                       
Query: 499 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 558
           || ||||||||||||||||||||||| ||||| || ||| |||| || || |||||  ||
Sbjct: 267 caattgtgggatgaaggaacaatatcttcaagtttttttgcattgaatatatcaattcca 208

                                                                       
Query: 559 acaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgacc 618
           || ||||||||||| || || ||||| ||||| ||||| || || |  ||||| || |||
Sbjct: 207 acgaagtggcacttagcatgaccatgtttccctgtctttgatgttggaacctccacaacc 148

                                                         
Query: 619 ttgcaggggcgggccttgatgacgatgtgtccacccttgcggatgg 664
           |||||||| ||   |||||| |||||||  |||  |||||||||||
Sbjct: 147 ttgcagggacgattcttgataacgatgtagccattcttgcggatgg 102



to top

>gb|AY961927.1| Picea abies eukaryotic translation initiation factor 5A (eIF5A)
           mRNA, partial cds
          Length = 714

 Score =  111 bits (56), Expect = 3e-21
 Identities = 182/224 (81%)
 Strand = Plus / Minus

                                                                       
Query: 421 tcagtcagcaggctgacatatccatcatcagttatgtcaatcagctgataatcttggcgg 480
           |||| |||||| || ||| ||||||| || | ||||||||||| |||| ||||   ||| 
Sbjct: 587 tcagccagcagactcacaaatccatcctcggatatgtcaatcaactgaaaatcagtgcga 528

                                                                       
Query: 481 tcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttcca 540
             |||||| || ||||||||||| || || || || |||||||| |||||||| || |||
Sbjct: 527 gtaacatgtgggacgtcacagttatgagaagatgggacaatatcttcaagctttttacca 468

                                                                       
Query: 541 ttaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggag 600
           ||||| || ||||| |||||||| |||||||| || || ||||| || |||||||| || 
Sbjct: 467 ttaaaaatatcaattgcaacaaaatggcacttagcatgcccatgttttccagtctttgaa 408

                                                       
Query: 601 gtggagacctcaacgaccttgcaggggcgggccttgatgacgat 644
           ||||| || ||||| ||||||||||| | |||||| ||||||||
Sbjct: 407 gtggatacttcaaccaccttgcagggcctggccttaatgacgat 364



to top

>gb|AF516355.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform VI (eIF-5A) mRNA, complete cds
          Length = 695

 Score =  111 bits (56), Expect = 3e-21
 Identities = 215/268 (80%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 438
           |||||||| |||||| ||||||||||||||||||| ||| | |||||||| |  || |||
Sbjct: 381 tcatcagttggaagcctcaggtcatccttagtgttcccattttcagtcagtaaactcaca 322

                                                                       
Query: 439 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 498
            ||||||| ||||  || ||||| ||||| || ||    ||    ||||||||||| |||
Sbjct: 321 aatccatcctcagaaatatcaattagctggtagtcggtacgagtgacatggggaacatca 262

                                                                       
Query: 499 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 558
           ||||| ||||| || || |||||||| |||||||| ||  |||| |||||||| ||  ||
Sbjct: 261 cagttatgggaggaggggacaatatcttcaagctttttggcattgaagatgtctattcca 202

                                                                       
Query: 559 acaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgacc 618
           || || |||||||| || || || || || ||||||||||||||||| || ||||| |||
Sbjct: 201 acgaaatggcacttagcatgaccgtgttttccagtcttggaggtggaaacttcaacaacc 142

                                       
Query: 619 ttgcaggggcgggccttgatgacgatgt 646
           ||||| |||||   ||||||||||||||
Sbjct: 141 ttgcaagggcgattcttgatgacgatgt 114



to top

>gb|AF516354.1| Hevea brasiliensis eukaryotic translation initiation factor 5A
           isoform V (eIF-5A) mRNA, partial cds
          Length = 427

 Score =  111 bits (56), Expect = 3e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 438
           ||||| ||||||||| | || | |||||| ||||| ||||| |||||||| || || |||
Sbjct: 394 tcatcggtgggaagcctgagattatccttggtgtttccactttcagtcagaagactcaca 335

                                                                       
Query: 439 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 498
            | ||||| ||||  || |||||||||||||||||    || | |||||||||| | |||
Sbjct: 334 aaaccatcttcagagatatcaatcagctgataatcagtacgattaacatggggagcatca 275

                                                                       
Query: 499 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 558
           || ||||||||||||||||||||||| ||||| || ||| || | || || |||||  ||
Sbjct: 274 caattgtgggatgaaggaacaatatcttcaagtttttttgcagtgaatatatcaattcca 215

                                                                       
Query: 559 acaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgacc 618
           || ||||||||||| || || || |||||||| ||||| || || || ||||| || |||
Sbjct: 214 acgaagtggcacttagcatgaccgtgcttccctgtctttgatgttgaaacctccacaacc 155

                   
Query: 619 ttgcaggg 626
           ||||||||
Sbjct: 154 ttgcaggg 147



to top

>gb|AF266464.1|AF266464 Manihot esculenta translation initiation factor 5A mRNA, complete
           cds
          Length = 1288

 Score =  111 bits (56), Expect = 3e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 438
           ||||| ||||||||| | || || ||||| ||||| ||| | |||||||| || || |||
Sbjct: 432 tcatcggtgggaagcctgagatcgtccttggtgtttccagtttcagtcagaagactcaca 373

                                                                       
Query: 439 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 498
            | ||||| ||||  || |||||||||||||||||    |||| |||||| ||||| |||
Sbjct: 372 aaaccatcttcagagatatcaatcagctgataatcagtacggttaacatgaggaacatca 313

                                                                       
Query: 499 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 558
           || ||||||||||||||||||||||| ||||| || |||||||| || || |||||  ||
Sbjct: 312 caattgtgggatgaaggaacaatatcttcaagtttttttccattgaatatatcaattcca 253

                                                                       
Query: 559 acaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgacc 618
           ||||| |||||||| || || ||||| || || ||||| || || || ||||| |  |||
Sbjct: 252 acaaaatggcacttagcatgaccatgttttcccgtctttgatgttgaaacctccataacc 193

                   
Query: 619 ttgcaggg 626
           ||||||||
Sbjct: 192 ttgcaggg 185



to top

>gb|AF296084.1|AF296084 Lycopersicon esculentum eukaryotic translation initiation factor
           5A-2 mRNA, complete cds
          Length = 779

 Score =  111 bits (56), Expect = 3e-21
 Identities = 215/268 (80%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 438
           ||||| ||||||||| | ||||||||||| ||||| ||||| ||||| || ||   ||||
Sbjct: 404 tcatcggtgggaagcctgaggtcatccttggtgtttccactttcagtaagaagtgagaca 345

                                                                       
Query: 439 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 498
            | ||||| ||||  || |||||||||||||| ||    |||| |||||| || || |||
Sbjct: 344 aaaccatcttcagagatatcaatcagctgatagtcggtacggttaacatgtggcacatca 285

                                                                       
Query: 499 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 558
           || |||||||| || ||||| ||||| || || ||||||||||| || |||||||| || 
Sbjct: 284 caattgtgggaggacggaacgatatcttccagtttctttccattgaaaatgtcaattgcc 225

                                                                       
Query: 559 acaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgacc 618
           |||||||| || || || || || || || ||||| || || |||||||||||||| |||
Sbjct: 224 acaaagtgacatttagcatgtccgtgttttccagtttttgaagtggagacctcaacaacc 165

                                       
Query: 619 ttgcaggggcgggccttgatgacgatgt 646
           |||||||| ||| | ||||| |||||||
Sbjct: 164 ttgcagggacggcctttgataacgatgt 137



to top

>emb|BX816465.1|CNS0ABU4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH4ZG03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1411

 Score =  111 bits (56), Expect = 3e-21
 Identities = 107/124 (86%)
 Strand = Plus / Minus

                                                                       
Query: 496 tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
           ||||| |||||||| |||||||| ||||| |||||||||||   | ||||||| ||||||
Sbjct: 500 tcacaattgtgggaagaaggaacgatatcttcaagcttcttagaagtaaagatatcaatg 441

                                                                       
Query: 556 gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
           ||||||||||| ||||| ||||| ||||||||||||||||| || || || |||||||| 
Sbjct: 440 gcaacaaagtgacacttggcgtgaccatgcttcccagtcttcgaagtcgatacctcaacc 381

               
Query: 616 acct 619
           ||||
Sbjct: 380 acct 377



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 618 cttgcaggggcgggccttgatgacgatgtgtccacc 653
           ||||||||| ||  |||||||||||||||| |||||
Sbjct: 144 cttgcagggacgtcccttgatgacgatgtgaccacc 109



to top

>emb|BX817162.1|CNS0ABMR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH8ZF05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1461

 Score =  111 bits (56), Expect = 3e-21
 Identities = 107/124 (86%)
 Strand = Plus / Minus

                                                                       
Query: 496 tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
           ||||| |||||||| |||||||| ||||| |||||||||||   | ||||||| ||||||
Sbjct: 500 tcacaattgtgggaagaaggaacgatatcttcaagcttcttagaagtaaagatatcaatg 441

                                                                       
Query: 556 gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
           ||||||||||| ||||| ||||| ||||||||||||||||| || || || |||||||| 
Sbjct: 440 gcaacaaagtgacacttggcgtgaccatgcttcccagtcttcgaagtcgatacctcaacc 381

               
Query: 616 acct 619
           ||||
Sbjct: 380 acct 377



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 618 cttgcaggggcgggccttgatgacgatgtgtccacc 653
           ||||||||| ||  |||||||||||||||| |||||
Sbjct: 144 cttgcagggacgtcccttgatgacgatgtgaccacc 109



to top

>gb|AF323604.1|AF323604 Manihot esculenta initiation factor eIF5-A mRNA, complete cds
          Length = 925

 Score =  111 bits (56), Expect = 3e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 379 tcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgaca 438
           ||||| ||||||||| | || || ||||| ||||| ||| | |||||||| || || |||
Sbjct: 412 tcatcggtgggaagcctgagatcgtccttggtgtttccagtttcagtcagaagactcaca 353

                                                                       
Query: 439 tatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtca 498
            | ||||| ||||  || |||||||||||||||||    |||| |||||| ||||| |||
Sbjct: 352 aaaccatcttcagagatatcaatcagctgataatcagtacggttaacatgaggaacatca 293

                                                                       
Query: 499 cagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggca 558
           || ||||||||||||||||||||||| ||||| || |||||||| || || |||||  ||
Sbjct: 292 caattgtgggatgaaggaacaatatcttcaagtttttttccattgaatatatcaattcca 233

                                                                       
Query: 559 acaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgacc 618
           ||||| |||||||| || || ||||| || || ||||| || || || ||||| |  |||
Sbjct: 232 acaaaatggcacttagcatgaccatgttttcccgtctttgatgttgaaacctccataacc 173

                   
Query: 619 ttgcaggg 626
           ||||||||
Sbjct: 172 ttgcaggg 165



to top

>gb|AC073178.9|AC073178 Arabidopsis thaliana chromosome 1 BAC F10D13 genomic sequence, complete
             sequence
          Length = 107214

 Score =  111 bits (56), Expect = 3e-21
 Identities = 107/124 (86%)
 Strand = Plus / Minus

                                                                         
Query: 496   tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
             ||||| |||||||| |||||||| ||||| |||||||||||   | ||||||| ||||||
Sbjct: 33098 tcacaattgtgggaagaaggaacgatatcttcaagcttcttagaagtaaagatatcaatg 33039

                                                                         
Query: 556   gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
             ||||||||||| ||||| ||||| ||||||||||||||||| || || || |||||||| 
Sbjct: 33038 gcaacaaagtgacacttggcgtgaccatgcttcccagtcttcgaagtcgatacctcaacc 32979

                 
Query: 616   acct 619
             ||||
Sbjct: 32978 acct 32975



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 616   accttgcaggggcgggccttgatgacgatgtgtccacc 653
             ||||||||||| ||  |||||||||||||||| |||||
Sbjct: 32743 accttgcagggacgtcccttgatgacgatgtgaccacc 32706



to top

>gb|AC018364.5|AC018364 Arabidopsis thaliana chromosome 1 BAC F23O10 genomic sequence,
            complete sequence
          Length = 93802

 Score =  111 bits (56), Expect = 3e-21
 Identities = 107/124 (86%)
 Strand = Plus / Plus

                                                                        
Query: 496  tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
            ||||| |||||||| |||||||| ||||| |||||||||||   | ||||||| ||||||
Sbjct: 7131 tcacaattgtgggaagaaggaacgatatcttcaagcttcttagaagtaaagatatcaatg 7190

                                                                        
Query: 556  gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
            ||||||||||| ||||| ||||| ||||||||||||||||| || || || |||||||| 
Sbjct: 7191 gcaacaaagtgacacttggcgtgaccatgcttcccagtcttcgaagtcgatacctcaacc 7250

                
Query: 616  acct 619
            ||||
Sbjct: 7251 acct 7254



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                  
Query: 616  accttgcaggggcgggccttgatgacgatgtgtccacc 653
            ||||||||||| ||  |||||||||||||||| |||||
Sbjct: 7486 accttgcagggacgtcccttgatgacgatgtgaccacc 7523



to top

>ref|NM_101261.1| Arabidopsis thaliana EIF-5A; translation initiation factor
           AT1G13950 (EIF-5A) mRNA, complete cds
          Length = 705

 Score =  107 bits (54), Expect = 5e-20
 Identities = 159/194 (81%)
 Strand = Plus / Minus

                                                                       
Query: 433 ctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggga 492
           |||||||||||||| ||||  ||||||||||||||||||||    ||||  ||||| |||
Sbjct: 360 ctgacatatccatcttcagaaatgtcaatcagctgataatcagtacggttgacatgagga 301

                                                                       
Query: 493 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
           || ||||| |||||||| |||||||||||||| || || ||||| |   | ||||| |||
Sbjct: 300 acatcacaattgtgggaagaaggaacaatatcttcgagtttcttgctggtgaagatatca 241

                                                                       
Query: 553 atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
           || || ||||| || || || || || |||||||| |||||||| ||||| || ||||||
Sbjct: 240 atagctacaaaatgacatttagcatgaccatgcttgccagtcttcgaggttgaaacctca 181

                         
Query: 613 acgaccttgcaggg 626
           || |||||||||||
Sbjct: 180 acaaccttgcaggg 167



to top

>gb|AY961932.1| Picea abies eukaryotic translation initiation factor 5A 2 (eIF5A)
           mRNA, complete cds
          Length = 835

 Score =  107 bits (54), Expect = 5e-20
 Identities = 135/162 (83%)
 Strand = Plus / Minus

                                                                       
Query: 483 aacatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatt 542
           |||||| || ||||||||||| || || || || |||||||| |||||||| || |||||
Sbjct: 455 aacatgtgggacgtcacagttatgagaagatgggacaatatcttcaagctttttaccatt 396

                                                                       
Query: 543 aaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggt 602
           ||| || ||||| |||||||| |||||||| || || ||||| || |||||||| || ||
Sbjct: 395 aaaaatatcaattgcaacaaaatggcacttagcatgcccatgttttccagtctttgaagt 336

                                                     
Query: 603 ggagacctcaacgaccttgcaggggcgggccttgatgacgat 644
           ||| || ||||| ||||||||||| | |||||| ||||||||
Sbjct: 335 ggatacttcaaccaccttgcagggcctggccttaatgacgat 294



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 270 accgatttccttcacagcgcagatctgttcttcacccatggcagacatcacag 322
           |||||| ||||||| ||| || ||||| || || ||||| |||||||||||||
Sbjct: 671 accgatatccttcagagcacaaatctgctcctctcccattgcagacatcacag 619



to top

>gb|AY117272.1| Arabidopsis thaliana putative initiation factor 5A-4 (At1g13950)
           mRNA, complete cds
          Length = 508

 Score =  107 bits (54), Expect = 5e-20
 Identities = 159/194 (81%)
 Strand = Plus / Minus

                                                                       
Query: 433 ctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggga 492
           |||||||||||||| ||||  ||||||||||||||||||||    ||||  ||||| |||
Sbjct: 305 ctgacatatccatcttcagaaatgtcaatcagctgataatcagtacggttgacatgagga 246

                                                                       
Query: 493 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
           || ||||| |||||||| |||||||||||||| || || ||||| |   | ||||| |||
Sbjct: 245 acatcacaattgtgggaagaaggaacaatatcttcgagtttcttgctggtgaagatatca 186

                                                                       
Query: 553 atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
           || || ||||| || || || || || |||||||| |||||||| ||||| || ||||||
Sbjct: 185 atagctacaaaatgacatttagcatgaccatgcttgccagtcttcgaggttgaaacctca 126

                         
Query: 613 acgaccttgcaggg 626
           || |||||||||||
Sbjct: 125 acaaccttgcaggg 112



to top

>gb|AY063780.1| Arabidopsis thaliana putative initiation factor 5A-4 (At1g13950)
           mRNA, complete cds
          Length = 676

 Score =  107 bits (54), Expect = 5e-20
 Identities = 159/194 (81%)
 Strand = Plus / Minus

                                                                       
Query: 433 ctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggga 492
           |||||||||||||| ||||  ||||||||||||||||||||    ||||  ||||| |||
Sbjct: 345 ctgacatatccatcttcagaaatgtcaatcagctgataatcagtacggttgacatgagga 286

                                                                       
Query: 493 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
           || ||||| |||||||| |||||||||||||| || || ||||| |   | ||||| |||
Sbjct: 285 acatcacaattgtgggaagaaggaacaatatcttcgagtttcttgctggtgaagatatca 226

                                                                       
Query: 553 atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
           || || ||||| || || || || || |||||||| |||||||| ||||| || ||||||
Sbjct: 225 atagctacaaaatgacatttagcatgaccatgcttgccagtcttcgaggttgaaacctca 166

                         
Query: 613 acgaccttgcaggg 626
           || |||||||||||
Sbjct: 165 acaaccttgcaggg 152



to top

>emb|X59441.1|MSEIF4DMR M.sativa mRNA for eIF-4D
          Length = 741

 Score =  107 bits (54), Expect = 5e-20
 Identities = 168/206 (81%)
 Strand = Plus / Minus

                                                                       
Query: 268 ccaccgatttccttcacagcgcagatctgttcttcacccatggcagacatcacagacagg 327
           ||||| || ||||||| ||| |||||||| || |||||||| ||||||||||| || |  
Sbjct: 593 ccaccaatatccttcaaagcacagatctgctcctcacccatagcagacatcacggataca 534

                                                                       
Query: 328 atcaggtccttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtg 387
           |  |||||||| || ||||||||||||  |||||||||    ||||||   ||||| |||
Sbjct: 533 acaaggtcctttccctcagcaaatccatccttgatctgagtgagcagactgtcatcggtg 474

                                                                       
Query: 388 ggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgacatatccatca 447
           ||||| || ||||||||||||||||| ||| | ||||| |||| ||| ||| ||||||| 
Sbjct: 473 ggaagtttgaggtcatccttagtgtttccattttcagtgagcaagctcacaaatccatct 414

                                     
Query: 448 tcagttatgtcaatcagctgataatc 473
           ||||  |||||||| |||||||||||
Sbjct: 413 tcagaaatgtcaatgagctgataatc 388



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                       
Query: 526 tcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgc 585
           ||||||||||||  | | ||||| ||||| |||||||| || ||||| || || ||||||
Sbjct: 332 tcaagcttctttgaagtgaagatatcaatagcaacaaaatgacacttggcatgtccatgc 273

                                                 
Query: 586 ttcccagtcttggaggtggagacctcaacgaccttgca 623
           ||||| ||||| || || || || ||||| ||||||||
Sbjct: 272 ttcccggtcttcgaagtcgaaacttcaacaaccttgca 235



to top

>gb|AF296082.1|AF296082 Arabidopsis thaliana eukaryotic translation initiation factor 5A
           mRNA, complete cds
          Length = 702

 Score =  107 bits (54), Expect = 5e-20
 Identities = 159/194 (81%)
 Strand = Plus / Minus

                                                                       
Query: 433 ctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggga 492
           |||||||||||||| ||||  ||||||||||||||||||||    ||||  ||||| |||
Sbjct: 360 ctgacatatccatcttcagaaatgtcaatcagctgataatcagtacggttgacatgagga 301

                                                                       
Query: 493 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
           || ||||| |||||||| |||||||||||||| || || ||||| |   | ||||| |||
Sbjct: 300 acatcacaattgtgggaagaaggaacaatatcttcgagtttcttgctggtgaagatatca 241

                                                                       
Query: 553 atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
           || || ||||| || || || || || |||||||| |||||||| ||||| || ||||||
Sbjct: 240 atagctacaaaatgacatttagcatgaccatgcttgccagtcttcgaggttgaaacctca 181

                         
Query: 613 acgaccttgcaggg 626
           || |||||||||||
Sbjct: 180 acaaccttgcaggg 167



to top

>emb|BX817272.1|CNS0AAJ3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL10ZA11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 649

 Score =  107 bits (54), Expect = 5e-20
 Identities = 159/194 (81%)
 Strand = Plus / Minus

                                                                       
Query: 433 ctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatgggga 492
           |||||||||||||| ||||  ||||||||||||||||||||    ||||  ||||| |||
Sbjct: 338 ctgacatatccatcttcagaaatgtcaatcagctgataatcagtacggttgacatgagga 279

                                                                       
Query: 493 acgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtca 552
           || ||||| |||||||| |||||||||||||| || || ||||| |   | ||||| |||
Sbjct: 278 acatcacaattgtgggaagaaggaacaatatcttcgagtttcttgctggtgaagatatca 219

                                                                       
Query: 553 atggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctca 612
           || || ||||| || || || || || |||||||| |||||||| ||||| || ||||||
Sbjct: 218 atagctacaaaatgacatttagcatgaccatgcttgccagtcttcgaggttgaaacctca 159

                         
Query: 613 acgaccttgcaggg 626
           || |||||||||||
Sbjct: 158 acaaccttgcaggg 145



to top

>gb|DQ228346.1| Solanum tuberosum clone 148H01 eukaryotic initiation factor
           5A5-like protein mRNA, complete cds
          Length = 750

 Score =  105 bits (53), Expect = 2e-19
 Identities = 275/349 (78%)
 Strand = Plus / Minus

                                                                       
Query: 304 cccatggcagacatcacagacaggatcaggtccttgccatcagcaaatccagtcttgatc 363
           ||||||||||||||||| ||||| | ||||||||| || || ||||| |||   |||| |
Sbjct: 483 cccatggcagacatcactgacagaaccaggtccttcccctcggcaaaaccatctttgacc 424

                                                                       
Query: 364 tggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctca 423
           ||  | || |||  ||||||||| || ||| ||| ||||||||| ||||| ||| | |||
Sbjct: 423 tgagccagaagagtatcatcagttgggagcctcaagtcatccttggtgttaccattttca 364

                                                                       
Query: 424 gtcagcaggctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtca 483
           |||| ||| || ||| | ||||| ||||  || ||||| |||||||||||    |  |  
Sbjct: 363 gtcaacagactcacaaagccatcctcagagatatcaataagctgataatcagtcctattc 304

                                                                       
Query: 484 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 543
           ||||| ||||| ||||| ||||| || || ||||||||||||||||||||||||||| | 
Sbjct: 303 acatgaggaacatcacaattgtgagaagagggaacaatatcctcaagcttctttccagtg 244

                                                                       
Query: 544 aagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtg 603
           || |||||||| || |||||||| || || || || || ||||| || |||||||| || 
Sbjct: 243 aaaatgtcaattgccacaaagtgacatttagcatgaccgtgcttgcctgtcttggaagtc 184

                                                            
Query: 604 gagacctcaacgaccttgcaggggcgggccttgatgacgatgtgtccac 652
           || || ||||| |||||||| || ||    |||||||||||||| ||||
Sbjct: 183 gaaacttcaaccaccttgcaaggacgatttttgatgacgatgtgaccac 135



to top

>gb|DQ222495.1| Solanum tuberosum clone 103C10 eukaryotic initiation factor
           5A5-like mRNA, complete cds
          Length = 757

 Score =  105 bits (53), Expect = 2e-19
 Identities = 275/349 (78%)
 Strand = Plus / Minus

                                                                       
Query: 304 cccatggcagacatcacagacaggatcaggtccttgccatcagcaaatccagtcttgatc 363
           ||||||||||||||||| ||||| | ||||||||| || || ||||| |||   |||| |
Sbjct: 492 cccatggcagacatcactgacagaaccaggtccttcccctcggcaaaaccatctttgacc 433

                                                                       
Query: 364 tggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctca 423
           ||  | || |||  ||||||||| || ||| ||| ||||||||| ||||| ||| | |||
Sbjct: 432 tgagccagaagagtatcatcagttgggagcctcaagtcatccttggtgttaccattttca 373

                                                                       
Query: 424 gtcagcaggctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtca 483
           |||| ||| || ||| | ||||| ||||  || ||||| |||||||||||    |  |  
Sbjct: 372 gtcaacagactcacaaagccatcctcagagatatcaataagctgataatcagtcctattc 313

                                                                       
Query: 484 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 543
           ||||| ||||| ||||| ||||| || || ||||||||||||||||||||||||||| | 
Sbjct: 312 acatgaggaacatcacaattgtgagaagagggaacaatatcctcaagcttctttccagtg 253

                                                                       
Query: 544 aagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtg 603
           || |||||||| || |||||||| || || || || || ||||| || |||||||| || 
Sbjct: 252 aaaatgtcaattgccacaaagtgacatttagcatgaccgtgcttgcctgtcttggaagtc 193

                                                            
Query: 604 gagacctcaacgaccttgcaggggcgggccttgatgacgatgtgtccac 652
           || || ||||| |||||||| || ||    |||||||||||||| ||||
Sbjct: 192 gaaacttcaaccaccttgcaaggacgatttttgatgacgatgtgaccac 144



to top

>gb|AF416338.1|AF416338 Medicago sativa eukaryotic translation initiation factor 5A-2 mRNA,
           complete cds
          Length = 649

 Score =  105 bits (53), Expect = 2e-19
 Identities = 215/269 (79%)
 Strand = Plus / Minus

                                                                       
Query: 378 atcatcagtgggaagcttcaggtcatccttagtgttgccactctcagtcagcaggctgac 437
           ||||||||| ||||||||||| ||||| || ||  | ||| | ||||||| ||  || ||
Sbjct: 414 atcatcagtaggaagcttcagatcatctttggtacttccattgtcagtcaacaaactcac 355

                                                                       
Query: 438 atatccatcatcagttatgtcaatcagctgataatcttggcggtcaacatggggaacgtc 497
           | ||||||| ||||  || ||||||| |||||||||    || |  ||||| ||||| ||
Sbjct: 354 aaatccatcttcagaaatatcaatcaactgataatcagtacgattcacatgaggaacatc 295

                                                                       
Query: 498 acagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatggc 557
           ||| ||||||||||||||||||||||| ||||| || || ||||| || || ||||| ||
Sbjct: 294 acaattgtgggatgaaggaacaatatcttcaagttttttcccattgaaaatatcaatagc 235

                                                                       
Query: 558 aacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacgac 617
           ||||||||| |||||||| || ||||| || || || || || || || |||||||| ||
Sbjct: 234 aacaaagtgacactttgcatgtccatgttttcctgtttttgaagtagaaacctcaacaac 175

                                        
Query: 618 cttgcaggggcgggccttgatgacgatgt 646
           |||||| || | || ||||||||| ||||
Sbjct: 174 cttgcaaggcctggacttgatgactatgt 146



to top

>dbj|AP004534.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT14P20, TM0087,
             complete sequence
          Length = 124300

 Score =  105 bits (53), Expect = 2e-19
 Identities = 95/109 (87%)
 Strand = Plus / Plus

                                                                         
Query: 511   gaaggaacaatatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcac 570
             |||||||||||||||||||||||||| ||| | ||||| |||||  ||||||||||||||
Sbjct: 10155 gaaggaacaatatcctcaagcttcttgccagtgaagatatcaattccaacaaagtggcac 10214

                                                              
Query: 571   tttgcgtggccatgcttcccagtcttggaggtggagacctcaacgacct 619
             || || || || ||||||||||||||||| ||||| || ||||| ||||
Sbjct: 10215 ttagcatgaccgtgcttcccagtcttggaagtggaaacttcaacaacct 10263



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  103 bits (52), Expect = 7e-19
 Identities = 106/124 (85%)
 Strand = Plus / Minus

                                                                            
Query: 496      tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
                ||||||||||| || || || |||||||| || ||||||||  || ||||||||||||| 
Sbjct: 19505067 tcacagttgtgagaagatggcacaatatcttcgagcttcttggcagtaaagatgtcaatt 19505008

                                                                            
Query: 556      gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
                ||||||||||||||||| ||||| || ||||||||||| || ||||| || |||||||| 
Sbjct: 19505007 gcaacaaagtggcacttggcgtgaccgtgcttcccagttttagaggttgaaacctcaaca 19504948

                    
Query: 616      acct 619
                ||||
Sbjct: 19504947 acct 19504944



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                            
Query: 271      ccgatttccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatc 330
                ||||| |||||||  ||||||||||| || || |||||||||||||| |||| ||  | |
Sbjct: 19506016 ccgatgtccttcagcgcgcagatctgctcctctcccatggcagacataacagtcaccacc 19505957

                                                   
Query: 331      aggtccttgccatcagcaaatccagtcttgatctg 365
                |||||||| || ||  ||||||||  |||||||||
Sbjct: 19505956 aggtccttcccttctccaaatccatccttgatctg 19505922



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                            
Query: 616      accttgcaggggcgggccttgatgacgatgtgtccacccttgcggatggcgccggcctgc 675
                |||||||||||||||  ||||||||| ||||  |||   ||||||||||  || ||||||
Sbjct: 19503805 accttgcaggggcggttcttgatgactatgtagccatttttgcggatggtcccagcctgc 19503746

                      
Query: 676      tgcggg 681
                ||||||
Sbjct: 19503745 tgcggg 19503740



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                        
Query: 378      atcatcagtgggaagcttcaggtcatccttagtgttgcca 417
                ||||||||| || ||| | ||||||||||| |||||||||
Sbjct: 19505358 atcatcagtagggagcctgaggtcatccttggtgttgcca 19505319



to top

>dbj|AP004275.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0453E05
          Length = 137364

 Score =  103 bits (52), Expect = 7e-19
 Identities = 100/116 (86%)
 Strand = Plus / Plus

                                                                         
Query: 496   tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
             |||||||||||||| ||||||||||||||||||||||| || ||||| || || || |||
Sbjct: 77455 tcacagttgtgggacgaaggaacaatatcctcaagctttttaccattgaatatatctatg 77514

                                                                     
Query: 556   gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctc 611
             ||||||||||| ||||| || || || ||||| |||||||| ||||| || |||||
Sbjct: 77515 gcaacaaagtgacacttggcatgaccgtgcttaccagtcttcgaggtagaaacctc 77570



 Score = 50.1 bits (25), Expect = 0.010
 Identities = 64/77 (83%)
 Strand = Plus / Plus

                                                                         
Query: 289   cagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagca 348
             |||||||| || || |||||||| ||||| |||| ||  |  || |||||||| ||| ||
Sbjct: 76113 cagatctgctcctcccccatggcggacatgacagtcacaacaagatccttgccttcacca 76172

                              
Query: 349   aatccagtcttgatctg 365
             |||||||||||||||||
Sbjct: 76173 aatccagtcttgatctg 76189



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 400   tcatccttagtgttgccactctcagtcagcaggct 434
             |||||||||||||| ||||||||||| || |||||
Sbjct: 77130 tcatccttagtgttaccactctcagtaagaaggct 77164



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  103 bits (52), Expect = 7e-19
 Identities = 106/124 (85%)
 Strand = Plus / Minus

                                                                            
Query: 496      tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
                ||||||||||| || || || |||||||| || ||||||||  || ||||||||||||| 
Sbjct: 19431280 tcacagttgtgagaagatggcacaatatcttcgagcttcttggcagtaaagatgtcaatt 19431221

                                                                            
Query: 556      gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
                ||||||||||||||||| ||||| || ||||||||||| || ||||| || |||||||| 
Sbjct: 19431220 gcaacaaagtggcacttggcgtgaccgtgcttcccagttttagaggttgaaacctcaaca 19431161

                    
Query: 616      acct 619
                ||||
Sbjct: 19431160 acct 19431157



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                            
Query: 271      ccgatttccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatc 330
                ||||| |||||||  ||||||||||| || || |||||||||||||| |||| ||  | |
Sbjct: 19432229 ccgatgtccttcagcgcgcagatctgctcctctcccatggcagacataacagtcaccacc 19432170

                                                   
Query: 331      aggtccttgccatcagcaaatccagtcttgatctg 365
                |||||||| || ||  ||||||||  |||||||||
Sbjct: 19432169 aggtccttcccttctccaaatccatccttgatctg 19432135



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                            
Query: 616      accttgcaggggcgggccttgatgacgatgtgtccacccttgcggatggcgccggcctgc 675
                |||||||||||||||  ||||||||| ||||  |||   ||||||||||  || ||||||
Sbjct: 19430018 accttgcaggggcggttcttgatgactatgtagccatttttgcggatggtcccagcctgc 19429959

                      
Query: 676      tgcggg 681
                ||||||
Sbjct: 19429958 tgcggg 19429953



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                        
Query: 378      atcatcagtgggaagcttcaggtcatccttagtgttgcca 417
                ||||||||| || ||| | ||||||||||| |||||||||
Sbjct: 19431571 atcatcagtagggagcctgaggtcatccttggtgttgcca 19431532



to top

>emb|AL731759.2|CNS07YPA Oryza sativa chromosome 12, . BAC OSJNBa0009K11 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 144596

 Score =  103 bits (52), Expect = 7e-19
 Identities = 106/124 (85%)
 Strand = Plus / Minus

                                                                         
Query: 496   tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
             ||||||||||| || || || |||||||| || ||||||||  || ||||||||||||| 
Sbjct: 37248 tcacagttgtgagaagatggcacaatatcttcgagcttcttggcagtaaagatgtcaatt 37189

                                                                         
Query: 556   gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
             ||||||||||||||||| ||||| || ||||||||||| || ||||| || |||||||| 
Sbjct: 37188 gcaacaaagtggcacttggcgtgaccgtgcttcccagttttagaggttgaaacctcaaca 37129

                 
Query: 616   acct 619
             ||||
Sbjct: 37128 acct 37125



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                         
Query: 271   ccgatttccttcacagcgcagatctgttcttcacccatggcagacatcacagacaggatc 330
             ||||| |||||||  ||||||||||| || || |||||||||||||| |||| ||  | |
Sbjct: 38197 ccgatgtccttcagcgcgcagatctgctcctctcccatggcagacataacagtcaccacc 38138

                                                
Query: 331   aggtccttgccatcagcaaatccagtcttgatctg 365
             |||||||| || ||  ||||||||  |||||||||
Sbjct: 38137 aggtccttcccttctccaaatccatccttgatctg 38103



 Score = 44.1 bits (22), Expect = 0.60
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                         
Query: 616   accttgcaggggcgggccttgatgacgatgtgtccacccttgcggatggcgccggcctgc 675
             |||||||||||||||  ||||||||| ||||  |||   ||||||||||  || ||||||
Sbjct: 35986 accttgcaggggcggttcttgatgactatgtagccatttttgcggatggtcccagcctgc 35927

                   
Query: 676   tgcggg 681
             ||||||
Sbjct: 35926 tgcggg 35921



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                     
Query: 378   atcatcagtgggaagcttcaggtcatccttagtgttgcca 417
             ||||||||| || ||| | ||||||||||| |||||||||
Sbjct: 37539 atcatcagtagggagcctgaggtcatccttggtgttgcca 37500



to top

>gb|AY961931.1| Picea abies eukaryotic translation initiation factor 5A 4 (eIF5A)
           mRNA, complete cds
          Length = 676

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 113/134 (84%)
 Strand = Plus / Minus

                                                                       
Query: 490 ggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatg 549
           ||||| |||||||| || || |||||||||||||| || ||||| |||  | |||| || 
Sbjct: 412 ggaacatcacagttatgagaggaaggaacaatatcttcgagcttttttgaagtaaatata 353

                                                                       
Query: 550 tcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacc 609
           |||||||| ||||| ||||| ||||| ||||||||||| |||||||| || |||||||| 
Sbjct: 352 tcaatggctacaaaatggcattttgcatggccatgctttccagtcttcgatgtggagact 293

                         
Query: 610 tcaacgaccttgca 623
           ||||| ||||||||
Sbjct: 292 tcaaccaccttgca 279



to top

>emb|BX814371.1|CNS0ABYU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZA04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 689

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 141/170 (82%), Gaps = 1/170 (0%)
 Strand = Plus / Minus

                                                                       
Query: 484 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 543
           ||||| ||||| ||||| |||||||| || ||||||||||| |||||||||||  || | 
Sbjct: 305 acatgtggaacatcacaattgtgggaagatggaacaatatcttcaagcttcttagcagtg 246

                                                                       
Query: 544 aagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtg 603
           ||||| ||||| ||||||||||| || || ||||| || ||||| ||||| ||||| || 
Sbjct: 245 aagatatcaatagcaacaaagtgacatttggcgtgaccgtgcttgccagttttggaagtc 186

                                                             
Query: 604 gagacctcaacgaccttgcaggggcgggccttgatgacgatgtgtccacc 653
           || |||||||| | ||||||||| |||   |||||||||||||| |||||
Sbjct: 185 gaaacctcaac-aacttgcagggacggtttttgatgacgatgtgaccacc 137



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 258 ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 317
           ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 532 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 473

                   
Query: 318 cacagaca 325
            |||||||
Sbjct: 472 gacagaca 465



to top

>gb|DQ407749.1| Gymnadenia conopsea eukaryotic translation initiation factor 5A
           mRNA, complete cds
          Length = 889

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 265/337 (78%)
 Strand = Plus / Minus

                                                                       
Query: 287 cgcagatctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcag 346
           |||||||||| || |||||||| || |||||||| ||||| | ||  ||||| || ||  
Sbjct: 582 cgcagatctgctcctcacccatcgccgacatcaccgacagcaccaaatccttcccttctc 523

                                                                       
Query: 347 caaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcct 406
           |||||||   ||| |||||||  |||||| |||| || ||||| ||| | || |||||||
Sbjct: 522 caaatccttcctttatctggctgagcagagcatcctcggtggggagcctgagatcatcct 463

                                                                       
Query: 407 tagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagct 466
           | ||||| ||| |||||||||| ||||| | | | |||||    | ||| ||||||||||
Sbjct: 462 tggtgttaccattctcagtcagaaggctaagaaagccatctgatgatatatcaatcagct 403

                                                                       
Query: 467 gataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcct 526
           |||| ||    || |  ||||| ||||| ||||| || || || || || ||||||||||
Sbjct: 402 gatagtcagtacgattcacatgaggaacatcacaattatgagaagatggcacaatatcct 343

                                                                       
Query: 527 caagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgct 586
           ||||||||||  || ||||||| ||||| || |||||||| || ||||| || |||||||
Sbjct: 342 caagcttcttggcagtaaagatatcaattgcgacaaagtgacattttgcatgaccatgct 283

                                                
Query: 587 tcccagtcttggaggtggagacctcaacgaccttgca 623
           | ||||| || || ||||| |||||||| ||||||||
Sbjct: 282 ttccagttttagaagtggaaacctcaacaaccttgca 246



to top

>dbj|AB004826.1| Solanum tuberosum mRNA for eukaryotic initiation factor 5A5,
           complete cds
          Length = 688

 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 274/349 (78%)
 Strand = Plus / Minus

                                                                       
Query: 304 cccatggcagacatcacagacaggatcaggtccttgccatcagcaaatccagtcttgatc 363
           ||||||||||||||||| ||||| | ||||||||| || || ||||| |||   |||| |
Sbjct: 500 cccatggcagacatcactgacagaaccaggtccttcccctcggcaaaaccatctttgacc 441

                                                                       
Query: 364 tggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtgttgccactctca 423
           ||  | || |||  ||||||||| || ||| ||| ||||||||| ||||| ||| | |||
Sbjct: 440 tgagccagaagagtatcatcagttgggagcctcaagtcatccttggtgttaccattttca 381

                                                                       
Query: 424 gtcagcaggctgacatatccatcatcagttatgtcaatcagctgataatcttggcggtca 483
           |||| ||  || ||| | ||||| ||||  || ||||| |||||||||||    |  |  
Sbjct: 380 gtcaacaaactcacaaagccatcctcagagatatcaataagctgataatcagtcctattc 321

                                                                       
Query: 484 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 543
           ||||| ||||| ||||| ||||| || || ||||||||||||||||||||||||||| | 
Sbjct: 320 acatgaggaacatcacaattgtgagaagagggaacaatatcctcaagcttctttccagtg 261

                                                                       
Query: 544 aagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtg 603
           || |||||||| || |||||||| || || || || || ||||| || |||||||| || 
Sbjct: 260 aaaatgtcaattgccacaaagtgacatttagcatgaccgtgcttgcctgtcttggaagtc 201

                                                            
Query: 604 gagacctcaacgaccttgcaggggcgggccttgatgacgatgtgtccac 652
           || || ||||| |||||||| || ||    |||||||||||||| ||||
Sbjct: 200 gaaacttcaaccaccttgcaaggacgatttttgatgacgatgtgaccac 152



to top

>gb|AY961929.1| Picea abies eukaryotic translation initiation factor 5A hypusine
           3-like mRNA sequence
          Length = 771

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 182/227 (80%)
 Strand = Plus / Minus

                                                                       
Query: 400 tcatccttagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtca 459
           |||||||| ||||| ||| | |||| |||||| || ||| ||||||| || | |||||||
Sbjct: 466 tcatccttggtgtttccattatcagccagcagactcacaaatccatcctcggatatgtca 407

                                                                       
Query: 460 atcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaaca 519
           |||| |||| ||||   |||   |||||| || ||||||||||| || || || || |||
Sbjct: 406 atcaactgaaaatcagtgcgagtaacatgtgggacgtcacagttatgagaagatgggaca 347

                                                                       
Query: 520 atatcctcaagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtgg 579
           ||||| |||||| |  | |||||||| || ||||| |||||||| |||||||| || || 
Sbjct: 346 atatcttcaagcgttgtaccattaaaaatatcaattgcaacaaaatggcacttagcatgc 287

                                                          
Query: 580 ccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggg 626
           ||||| || |||||||| || ||||| || ||||| |||||||||||
Sbjct: 286 ccatgttttccagtctttgaagtggatacttcaaccaccttgcaggg 240



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 270 accgatttccttcacagcgcagatctgttcttcacccatggcagacatcacag 322
           |||||| ||||||| ||| || ||||| || || ||||| |||||||||||||
Sbjct: 596 accgatatccttcagagcacaaatctgctcctctcccattgcagacatcacag 544



to top

>emb|X63543.1|NTNEIF5A3 N.tabacum NeIF-5A3 gene for initiation factor 5A(3)
          Length = 2443

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 105/125 (84%)
 Strand = Plus / Minus

                                                                        
Query: 496  tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
            ||||||||||| || || ||||||||||| ||||||||||||||| | || |||||||| 
Sbjct: 1556 tcacagttgtgagaagagggaacaatatcttcaagcttctttccagtgaaaatgtcaata 1497

                                                                        
Query: 556  gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
            || ||||||||||| || || || || ||||| || |||||||| ||||| || ||||| 
Sbjct: 1496 gccacaaagtggcatttagcatgaccgtgcttgcctgtcttggaagtggaaacttcaact 1437

                 
Query: 616  acctt 620
            |||||
Sbjct: 1436 acctt 1432



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 304  cccatggcagacatcacagacaggatcaggtccttgccatcagcaaa 350
            ||||||||||||||||| ||||| | ||||||||| || ||||||||
Sbjct: 2317 cccatggcagacatcactgacagaaccaggtccttcccctcagcaaa 2271



to top

>gb|AC122160.21| Medicago truncatula clone mth2-23d6, complete sequence
          Length = 125105

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 80/92 (86%)
 Strand = Plus / Plus

                                                                         
Query: 496   tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
             ||||| |||||||| |||||||||||||| ||||| || || ||||| ||||| ||||| 
Sbjct: 13072 tcacaattgtgggacgaaggaacaatatcttcaagttttttcccattgaagatatcaata 13131

                                             
Query: 556   gcaacaaagtggcactttgcgtggccatgctt 587
             ||||||||||| |||||||| || ||||||||
Sbjct: 13132 gcaacaaagtgacactttgcatgtccatgctt 13163



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                            
Query: 277   tccttcacagcgcagatctgttcttcacccatggcagacatcacaga 323
             ||||||| ||| || ||||| ||||||||||| |||||||| |||||
Sbjct: 11864 tccttcagagcacatatctgctcttcacccatcgcagacatgacaga 11910



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 503  tgtgggatgaaggaacaata 522
            ||||||||||||||||||||
Sbjct: 7736 tgtgggatgaaggaacaata 7755



to top

>gb|AC152068.17| Medicago truncatula clone mth2-29p8, complete sequence
          Length = 118589

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 80/92 (86%)
 Strand = Plus / Minus

                                                                         
Query: 496   tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
             ||||| |||||||| |||||||||||||| ||||| || || ||||| ||||| ||||| 
Sbjct: 46225 tcacaattgtgggacgaaggaacaatatcttcaagttttttcccattgaagatatcaata 46166

                                             
Query: 556   gcaacaaagtggcactttgcgtggccatgctt 587
             ||||||||||| |||||||| || ||||||||
Sbjct: 46165 gcaacaaagtgacactttgcatgtccatgctt 46134



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                            
Query: 277   tccttcacagcgcagatctgttcttcacccatggcagacatcacaga 323
             ||||||| ||| || ||||| ||||||||||| |||||||| |||||
Sbjct: 47433 tccttcagagcacatatctgctcttcacccatcgcagacatgacaga 47387



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 503   tgtgggatgaaggaacaata 522
             ||||||||||||||||||||
Sbjct: 51562 tgtgggatgaaggaacaata 51543



to top

>gb|AY961930.1| Picea abies eukaryotic translation initiation factor 5A (eIF5A)
           mRNA, complete cds
          Length = 848

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 259/331 (78%)
 Strand = Plus / Minus

                                                                       
Query: 347 caaatccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatcct 406
           ||||||||| |||||||||| | |||||    |||||||| || ||||| || |||||||
Sbjct: 480 caaatccagccttgatctgggccagcagttggtcatcagtaggcagcttgagatcatcct 421

                                                                       
Query: 407 tagtgttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagct 466
           | || |  |||   |||||||||||||| ||| | ||||| ||||  || ||||| ||||
Sbjct: 420 tggtctgtccagattcagtcagcaggctaacaaaaccatcctcagaaatatcaattagct 361

                                                                       
Query: 467 gataatcttggcggtcaacatggggaacgtcacagttgtgggatgaaggaacaatatcct 526
           |||||||    ||   |||||| || || || |||||||| || || || |||||||| |
Sbjct: 360 gataatcagtacgagtaacatgagggacatcgcagttgtgtgaagatggcacaatatctt 301

                                                                       
Query: 527 caagcttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgct 586
           ||||||| || ||| | || ||||||||  | |||||||| || || || || |||||||
Sbjct: 300 caagctttttaccactgaaaatgtcaattcctacaaagtgacatttagcatgcccatgct 241

                                                                       
Query: 587 tcccagtcttggaggtggagacctcaacgaccttgcaggggcgggccttgatgacgatgt 646
           | || ||||| || || || || ||||| ||||||||||| | ||||||||| |||||||
Sbjct: 240 ttccggtctttgaagtagatacttcaaccaccttgcagggcctggccttgatcacgatgt 181

                                          
Query: 647 gtccacccttgcggatggcgccggcctgctg 677
             ||   ||||||||||| ||||||||||||
Sbjct: 180 agccgttcttgcggatggtgccggcctgctg 150



to top

>emb|AJ608752.1| Nicotiana plumbaginifolia cDNA-AFLP fragment, clone Np048
          Length = 239

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 148/183 (80%)
 Strand = Plus / Minus

                                                                       
Query: 292 atctgttcttcacccatggcagacatcacagacaggatcaggtccttgccatcagcaaat 351
           ||||| || ||||||||||| ||||| |||||||  |  ||||| || || |||||||| 
Sbjct: 187 atctgctcctcacccatggctgacatgacagacacaacaaggtcttttccctcagcaaac 128

                                                                       
Query: 352 ccagtcttgatctggccaagcagaacatcatcagtgggaagcttcaggtcatccttagtg 411
           |||  |||||||||   ||| ||   ||||||||| |||||| | ||||||||||| |||
Sbjct: 127 ccatccttgatctgtgtaaggaggttatcatcagtaggaagcctaaggtcatccttggtg 68

                                                                       
Query: 412 ttgccactctcagtcagcaggctgacatatccatcatcagttatgtcaatcagctgataa 471
           || ||| ||||||| ||||| || ||| ||||||| ||||  |||||||| |||||||||
Sbjct: 67  ttaccattctcagtgagcagactcacaaatccatcttcagaaatgtcaataagctgataa 8

              
Query: 472 tct 474
           |||
Sbjct: 7   tct 5



to top

>dbj|AP004303.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
              clone:P0407H12
          Length = 167754

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 160/196 (81%), Gaps = 5/196 (2%)
 Strand = Plus / Minus

                                                                          
Query: 334    tccttgccatcagcaaatccagtcttgatctggccaagcagaacatcatcagtgggaagc 393
              |||||||| ||| |||||||||||||||||||||| || |||   |||| ||| || || 
Sbjct: 115565 tccttgccttcaccaaatccagtcttgatctggcccaggagattgtcataagttgggagt 115506

                                                                          
Query: 394    ttcaggtcatccttagtgttgccactctcagtcagcaggctgac--ata-tccatcatca 450
                 || |||||||||||||| || |||||||| || ||||| ||  ||| |||||| || 
Sbjct: 115505 ccaagatcatccttagtgttaccgctctcagtaagaaggctcacgaataatccatcctct 115446

                                                                          
Query: 451    gttatgtcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggat 510
              | ||||||||||||||| |||| |   ||||   |||| ||||| |||||||||||||||
Sbjct: 115445 gatatgtcaatcagctggtaatttgtacggtt--catgtggaacatcacagttgtgggat 115388

                              
Query: 511    gaaggaacaatatcct 526
              ||||||||||||||||
Sbjct: 115387 gaaggaacaatatcct 115372



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 108/130 (83%), Gaps = 5/130 (3%)
 Strand = Plus / Minus

                                                                          
Query: 400    tcatccttagtgttgccactctcagtcagcaggctgac--ata-tccatcatcagttatg 456
              |||||||||||||| || |||||||| || ||||| ||  ||| |||||| || | ||||
Sbjct: 110746 tcatccttagtgttaccgctctcagtaagaaggctcacgaataatccatcctctgatatg 110687

                                                                          
Query: 457    tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 516
              ||||||||||| |||| |   ||||   |||| ||||| |||||||||||||||||| ||
Sbjct: 110686 tcaatcagctggtaatttgtacggtt--catgtggaacatcacagttgtgggatgaatga 110629

                        
Query: 517    acaatatcct 526
              ||||||||||
Sbjct: 110628 acaatatcct 110619



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                          
Query: 554    tggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaa 613
              ||||||||||||| ||||| || || || ||||| | |||||| ||||| || ||||| |
Sbjct: 115371 tggcaacaaagtgacacttggcatgaccgtgcttactagtcttcgaggtagaaacctcca 115312

                                                                 
Query: 614    cgaccttgcaggggcgggccttgatgacgatgtgtccacccttgcggatgg 664
              | |||||||||||||||  ||| || |||||||  |||  |||||||||||
Sbjct: 115311 ccaccttgcaggggcggttcttaataacgatgtacccattcttgcggatgg 115261



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 334    tccttgccatcagcaaatccagtcttgatctg 365
              |||||||| | | |||||||||||||||||||
Sbjct: 110811 tccttgccttaaccaaatccagtcttgatctg 110780



to top

>gb|AC006535.7|AC006535 Genomic sequence for Arabidopsis thaliana BAC T24P13 from chromosome
            I, complete sequence
          Length = 98630

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 103/124 (83%)
 Strand = Plus / Minus

                                                                        
Query: 496  tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
            ||||| |||||||| || ||||||||||| |||||||||||  || | ||||| ||||| 
Sbjct: 6331 tcacaattgtgggaagatggaacaatatcttcaagcttcttagcagtgaagatatcaata 6272

                                                                        
Query: 556  gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
            ||||||||||| || || ||||| || ||||| ||||| ||||| || || |||||||| 
Sbjct: 6271 gcaacaaagtgacatttggcgtgaccgtgcttgccagttttggaagtcgaaacctcaaca 6212

                
Query: 616  acct 619
            ||||
Sbjct: 6211 acct 6208



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                        
Query: 258  ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 317
            ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 6856 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 6797

                    
Query: 318  cacagaca 325
             |||||||
Sbjct: 6796 gacagaca 6789



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                             
Query: 615  gaccttgcaggggcgggccttgatgacgatgtgtccacccttgcggatg 663
            |||||||||||| |||   |||||||||||||| ||||| || ||||||
Sbjct: 5848 gaccttgcagggacggtttttgatgacgatgtgaccacctttacggatg 5800



to top

>gb|AY961928.1| Picea abies eukaryotic translation initiation factor 5A 2 (eIF5A)
           mRNA, complete cds
          Length = 622

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 202/257 (78%)
 Strand = Plus / Minus

                                                                       
Query: 421 tcagtcagcaggctgacatatccatcatcagttatgtcaatcagctgataatcttggcgg 480
           |||||||||||||| ||| | ||||| ||||  || ||||| |||||||||||    || 
Sbjct: 407 tcagtcagcaggctaacaaaaccatcctcagaaatatcaattagctgataatcagtacga 348

                                                                       
Query: 481 tcaacatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttcca 540
             |||||| || || || |||||||| || || || |||||||| |||||||| || |||
Sbjct: 347 gtaacatgagggacatcgcagttgtgtgaagatggcacaatatcttcaagctttttacca 288

                                                                       
Query: 541 ttaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggag 600
            | || ||||||||  | |||||||| || || || || |||||||| || ||||  || 
Sbjct: 287 ctgaaaatgtcaattcctacaaagtgacatttagcatgcccatgctttccggtctctgaa 228

                                                                       
Query: 601 gtggagacctcaacgaccttgcaggggcgggccttgatgacgatgtgtccacccttgcgg 660
           || || || ||||| ||||||||||| | ||||||||| |||||||  ||   |||||||
Sbjct: 227 gtagatacttcaaccaccttgcagggcctggccttgatcacgatgtagccgttcttgcgg 168

                            
Query: 661 atggcgccggcctgctg 677
           |||| ||||||||||||
Sbjct: 167 atggtgccggcctgctg 151



to top

>gb|AF296083.1|AF296083 Lycopersicon esculentum eukaryotic translation initiation factor
           5A-1 mRNA, complete cds
          Length = 715

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 114/140 (81%)
 Strand = Plus / Minus

                                                                       
Query: 484 acatggggaacgtcacagttgtgggatgaaggaacaatatcctcaagcttctttccatta 543
           ||||| ||||| ||||| ||||| || || ||||||||||||||||| ||||||||| | 
Sbjct: 312 acatgaggaacatcacaattgtgagaagagggaacaatatcctcaagtttctttccagtg 253

                                                                       
Query: 544 aagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtg 603
           || |||||||| || || ||||| || || || || || ||||| || |||||||| || 
Sbjct: 252 aaaatgtcaattgccacgaagtgacatttagcatgaccgtgcttgcctgtcttggaagtt 193

                               
Query: 604 gagacctcaacgaccttgca 623
           || || ||||| ||||||||
Sbjct: 192 gaaacttcaaccaccttgca 173



to top

>gb|AF329432.1| Crypthecodinium cohnii translation initiation factor 5A (eIF-5A)
           gene, partial cds
          Length = 489

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 574 gcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggcc 633
           |||||||| ||||| ||||||||||||||||||||||| | |  ||||||||| ||| ||
Sbjct: 164 gcgtggccgtgcttgccagtcttggaggtggagacctcgatgcacttgcagggacggccc 105

                
Query: 634 ttgat 638
           |||||
Sbjct: 104 ttgat 100



to top

>ref|NM_186716.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 771

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 108/130 (83%), Gaps = 5/130 (3%)
 Strand = Plus / Minus

                                                                       
Query: 400 tcatccttagtgttgccactctcagtcagcaggctgac--ata-tccatcatcagttatg 456
           |||||||||||||| || |||||||| || ||||| ||  ||| |||||| || | ||||
Sbjct: 662 tcatccttagtgttaccgctctcagtaagaaggctcacgaataatccatcctctgatatg 603

                                                                       
Query: 457 tcaatcagctgataatcttggcggtcaacatggggaacgtcacagttgtgggatgaagga 516
           ||||||||||| |||| |   ||||   |||| ||||| |||||||||||||||||| ||
Sbjct: 602 tcaatcagctggtaatttgtacggtt--catgtggaacatcacagttgtgggatgaatga 545

                     
Query: 517 acaatatcct 526
           ||||||||||
Sbjct: 544 acaatatcct 535



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 334 tccttgccatcagcaaatccagtcttgatctg 365
           |||||||| | | |||||||||||||||||||
Sbjct: 727 tccttgccttaaccaaatccagtcttgatctg 696



to top

>emb|CR733838.2|CNS0GT0D Tetraodon nigroviridis full-length cDNA
          Length = 1373

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 506 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 447

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 446 ggtcttggaggtggacatctcaacgatcttgcaggg 411



to top

>emb|CR726932.2|CNS0GNUI Tetraodon nigroviridis full-length cDNA
          Length = 1374

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 507 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 448

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 447 ggtcttggaggtggacatctcaacgatcttgcaggg 412



to top

>emb|CR721475.2|CNS0GJMX Tetraodon nigroviridis full-length cDNA
          Length = 718

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 516 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 457

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 456 ggtcttggaggtggacatctcaacgatcttgcaggg 421



to top

>emb|CR709005.2|CNS0GA0P Tetraodon nigroviridis full-length cDNA
          Length = 706

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 504 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 445

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 444 ggtcttggaggtggacatctcaacgatcttgcaggg 409



to top

>emb|CR695202.2|CNS0FZDA Tetraodon nigroviridis full-length cDNA
          Length = 1387

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 515 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 456

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 455 ggtcttggaggtggacatctcaacgatcttgcaggg 420



to top

>emb|CR693511.2|CNS0FY2B Tetraodon nigroviridis full-length cDNA
          Length = 993

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 526 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 467

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 466 ggtcttggaggtggacatctcaacgatcttgcaggg 431



to top

>emb|CR692588.2|CNS0FXCO Tetraodon nigroviridis full-length cDNA
          Length = 735

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 534 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 475

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 474 ggtcttggaggtggacatctcaacgatcttgcaggg 439



to top

>emb|CR681099.2|CNS0FOHJ Tetraodon nigroviridis full-length cDNA
          Length = 1299

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 434 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 375

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 374 ggtcttggaggtggacatctcaacgatcttgcaggg 339



to top

>emb|CR679331.2|CNS0FN4F Tetraodon nigroviridis full-length cDNA
          Length = 1382

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 511 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 452

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 451 ggtcttggaggtggacatctcaacgatcttgcaggg 416



to top

>emb|CR679298.2|CNS0FN3I Tetraodon nigroviridis full-length cDNA
          Length = 1375

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 510 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 451

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 450 ggtcttggaggtggacatctcaacgatcttgcaggg 415



to top

>emb|CR677549.2|CNS0FLRC Tetraodon nigroviridis full-length cDNA
          Length = 724

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 522 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 463

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 462 ggtcttggaggtggacatctcaacgatcttgcaggg 427



to top

>emb|CR677762.2|CNS0FLX6 Tetraodon nigroviridis full-length cDNA
          Length = 1357

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 495 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 436

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 435 ggtcttggaggtggacatctcaacgatcttgcaggg 400



to top

>emb|CR676683.2|CNS0FL3B Tetraodon nigroviridis full-length cDNA
          Length = 1352

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 489 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 430

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 429 ggtcttggaggtggacatctcaacgatcttgcaggg 394



to top

>emb|CR673625.2|CNS0FIQN Tetraodon nigroviridis full-length cDNA
          Length = 1380

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 512 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 453

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 452 ggtcttggaggtggacatctcaacgatcttgcaggg 417



to top

>emb|CR669512.2|CNS0FFKE Tetraodon nigroviridis full-length cDNA
          Length = 1377

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 511 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 452

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 451 ggtcttggaggtggacatctcaacgatcttgcaggg 416



to top

>emb|CR668234.2|CNS0FEKW Tetraodon nigroviridis full-length cDNA
          Length = 711

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 511 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 452

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 451 ggtcttggaggtggacatctcaacgatcttgcaggg 416



to top

>emb|CR664325.2|CNS0FBKB Tetraodon nigroviridis full-length cDNA
          Length = 1365

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 80/96 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 499 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 440

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||| |||||||||
Sbjct: 439 ggtcttggaggtggacatctcaacgatcttgcaggg 404



to top

>emb|CR679002.1|CNS0FMVA Tetraodon nigroviridis full-length cDNA
          Length = 910

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                       
Query: 544 aagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtg 603
           |||||||||||  |||| |||||   ||| |||||||| ||||| || ||||||||||||
Sbjct: 480 aagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgccggtcttggaggtg 421

                                  
Query: 604 gagacctcaacgaccttgcaggg 626
           || | |||||||| |||||||||
Sbjct: 420 gacatctcaacgatcttgcaggg 398



to top

>emb|CR687566.2|CNS0FTH6 Tetraodon nigroviridis full-length cDNA
          Length = 1121

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 574 gcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggg 626
           |||||||| ||||| || |||||||||||||| | |||||||| |||||||||
Sbjct: 463 gcgtggccgtgcttgccggtcttggaggtggacatctcaacgatcttgcaggg 411



to top

>emb|AL121815.1|SPBC336 S.pombe chromosome II cosmid c336
          Length = 39512

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 92/113 (81%)
 Strand = Plus / Plus

                                                                         
Query: 538   ccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttg 597
             ||||| ||||| |||| |||||||| ||||  ||| || || || ||||| |||||||| 
Sbjct: 26502 ccattgaagatatcaagggcaacaatgtggaccttggcatgtccgtgcttaccagtctta 26561

                                                                  
Query: 598   gaggtggagacctcaacgaccttgcaggggcgggccttgatgacgatgtgtcc 650
             |||||||| |  || |||| |||||| || ||| |||||||||||| ||||||
Sbjct: 26562 gaggtggacatgtcgacgatcttgcaaggacggcccttgatgacgacgtgtcc 26614



to top

>ref|NM_001022048.1| Schizosaccharomyces pombe 972h- hypothetical protein (SPBC336.10c),
           partial mRNA
          Length = 474

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                       
Query: 538 ccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttg 597
           ||||| ||||| |||| |||||||| ||||  ||| || || || ||||| |||||||| 
Sbjct: 203 ccattgaagatatcaagggcaacaatgtggaccttggcatgtccgtgcttaccagtctta 144

                                                                
Query: 598 gaggtggagacctcaacgaccttgcaggggcgggccttgatgacgatgtgtcc 650
           |||||||| |  || |||| |||||| || ||| |||||||||||| ||||||
Sbjct: 143 gaggtggacatgtcgacgatcttgcaaggacggcccttgatgacgacgtgtcc 91



to top

>ref|NM_102426.3| Arabidopsis thaliana unknown protein AT1G26640 mRNA, complete cds
          Length = 1762

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Plus

                                                                        
Query: 258  ttacttgccaccaccgatttccttcacagcgcagatctgttcttcacccatggcagacat 317
            ||||||||||||||| | |||||| || || |||||||| || || ||||||| ||||||
Sbjct: 1655 ttacttgccaccaccaacttccttgacggcacagatctgctcctctcccatggaagacat 1714

                    
Query: 318  cacagaca 325
             |||||||
Sbjct: 1715 gacagaca 1722



to top

>gb|AC007576.3| Arabidopsis thaliana chromosome I BAC F7A19 genomic sequence, complete
             sequence
          Length = 112126

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 100/124 (80%)
 Strand = Plus / Minus

                                                                         
Query: 496   tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
             ||||| |||||||| |||||||||||||| || || ||||| |   | ||||| ||||| 
Sbjct: 17195 tcacaattgtgggaagaaggaacaatatcttcgagtttcttgctggtgaagatatcaata 17136

                                                                         
Query: 556   gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
             || ||||| || || || || || |||||||| |||||||| ||||| || |||||||| 
Sbjct: 17135 gctacaaaatgacatttagcatgaccatgcttgccagtcttcgaggttgaaacctcaaca 17076

                 
Query: 616   acct 619
             ||||
Sbjct: 17075 acct 17072



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                   
Query: 436   acatatccatcatcagttatgtcaatcagctgataatc 473
             ||||||||||| ||||  ||||||||||||||||||||
Sbjct: 17348 acatatccatcttcagaaatgtcaatcagctgataatc 17311



to top

>emb|CR735083.2|CNS0GTYY Tetraodon nigroviridis full-length cDNA
          Length = 713

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 512 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 453

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 452 ggtcttggaggtggacatctcgacgatcttgcaggg 417



to top

>emb|CR734939.2|CNS0GTUY Tetraodon nigroviridis full-length cDNA
          Length = 1402

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 533 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 474

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 473 ggtcttggaggtggacatctcgacgatcttgcaggg 438



to top

>emb|CR674619.2|CNS0FJI9 Tetraodon nigroviridis full-length cDNA
          Length = 630

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 428 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 369

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 368 ggtcttggaggtggacatctcgacgatcttgcaggg 333



to top

>emb|CR732972.2|CNS0GSH7 Tetraodon nigroviridis full-length cDNA
          Length = 1362

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 505 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 446

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 445 ggtcttggaggtggacatctcgacgatcttgcaggg 410



to top

>emb|CR728110.2|CNS0GOR8 Tetraodon nigroviridis full-length cDNA
          Length = 1371

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 503 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 444

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 443 ggtcttggaggtggacatctcgacgatcttgcaggg 408



to top

>emb|CR727086.2|CNS0GNYS Tetraodon nigroviridis full-length cDNA
          Length = 1370

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 501 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 442

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 441 ggtcttggaggtggacatctcgacgatcttgcaggg 406



to top

>emb|CR723793.2|CNS0GLFB Tetraodon nigroviridis full-length cDNA
          Length = 1144

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 512 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 453

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 452 ggtcttggaggtggacatctcgacgatcttgcaggg 417



to top

>emb|CR723119.2|CNS0GKWL Tetraodon nigroviridis full-length cDNA
          Length = 737

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 535 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 476

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 475 ggtcttggaggtggacatctcgacgatcttgcaggg 440



to top

>emb|CR704324.2|CNS0G6EO Tetraodon nigroviridis full-length cDNA
          Length = 1354

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 490 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 431

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | |||||||  |||||||||
Sbjct: 430 ggtcttggaggtggacatctcaacgttcttgcaggg 395



to top

>emb|CR701860.2|CNS0G4I8 Tetraodon nigroviridis full-length cDNA
          Length = 1044

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 174 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 115

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 114 ggtcttggaggtggacatctcgacgatcttgcaggg 79



to top

>emb|CR694976.2|CNS0FZ70 Tetraodon nigroviridis full-length cDNA
          Length = 1047

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 176 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 117

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 116 ggtcttggaggtggacatctcgacgatcttgcaggg 81



to top

>emb|CR690497.2|CNS0FVQL Tetraodon nigroviridis full-length cDNA
          Length = 1373

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 506 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 447

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 446 ggtcttggaggtggacatctcgacgatcttgcaggg 411



to top

>emb|CR689165.2|CNS0FUPL Tetraodon nigroviridis full-length cDNA
          Length = 1042

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 176 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 117

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 116 ggtcttggaggtggacatctcgacgatcttgcaggg 81



to top

>emb|CR680208.2|CNS0FNSS Tetraodon nigroviridis full-length cDNA
          Length = 1360

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 503 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 444

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 443 ggtcttggaggtggacatctcgacgatcttgcaggg 408



to top

>emb|CR679806.1|CNS0FNHM Tetraodon nigroviridis full-length cDNA
          Length = 1367

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 507 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 448

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 447 ggtcttggaggtggacatctcgacgatcttgcaggg 412



to top

>emb|CR677093.2|CNS0FLEP Tetraodon nigroviridis full-length cDNA
          Length = 716

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 512 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 453

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 452 ggtcttggaggtggacatctcgacgatcttgcaggg 417



to top

>emb|CR666270.2|CNS0FD2C Tetraodon nigroviridis full-length cDNA
          Length = 1381

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 512 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 453

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 452 ggtcttggaggtggacatctcgacgatcttgcaggg 417



to top

>emb|CR665688.2|CNS0FCM6 Tetraodon nigroviridis full-length cDNA
          Length = 930

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 298 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 239

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 238 ggtcttggaggtggacatctcgacgatcttgcaggg 203



to top

>emb|CR664326.2|CNS0FBKC Tetraodon nigroviridis full-length cDNA
          Length = 998

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 367 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 308

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 307 ggtcttggaggtggacatctcgacgatcttgcaggg 272



to top

>emb|CR663961.2|CNS0FBA7 Tetraodon nigroviridis full-length cDNA
          Length = 1365

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 503 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 444

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 443 ggtcttggaggtggacatctcgacgatcttgcaggg 408



to top

>emb|CR663558.2|CNS0FAZ0 Tetraodon nigroviridis full-length cDNA
          Length = 1362

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 506 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 447

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 446 ggtcttggaggtggacatctcgacgatcttgcaggg 411



to top

>emb|CR663257.2|CNS0FAQN Tetraodon nigroviridis full-length cDNA
          Length = 716

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 514 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 455

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 454 ggtcttggaggtggacatctcgacgatcttgcaggg 419



to top

>emb|CR660890.2|CNS0F8WW Tetraodon nigroviridis full-length cDNA
          Length = 1365

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 519 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 460

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 459 ggtcttggaggtggacatctcgacgatcttgcaggg 424



to top

>emb|CR660318.2|CNS0F8H0 Tetraodon nigroviridis full-length cDNA
          Length = 1383

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 512 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 453

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 452 ggtcttggaggtggacatctcgacgatcttgcaggg 417



to top

>emb|CR658879.2|CNS0F7D1 Tetraodon nigroviridis full-length cDNA
          Length = 712

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 510 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 451

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 450 ggtcttggaggtggacatctcgacgatcttgcaggg 415



to top

>emb|CR657648.2|CNS0F6EU Tetraodon nigroviridis full-length cDNA
          Length = 1348

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 494 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 435

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 434 ggtcttggaggtggacatctcgacgatcttgcaggg 399



to top

>emb|CR656930.2|CNS0F5UW Tetraodon nigroviridis full-length cDNA
          Length = 1374

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 505 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 446

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 445 ggtcttggaggtggacatctcgacgatcttgcaggg 410



to top

>emb|CR656825.2|CNS0F5RZ Tetraodon nigroviridis full-length cDNA
          Length = 1358

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 505 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 446

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 445 ggtcttggaggtggacatctcgacgatcttgcaggg 410



to top

>emb|CR632683.2|CNS0EN5D Tetraodon nigroviridis full-length cDNA
          Length = 714

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 512 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 453

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 452 ggtcttggaggtggacatctcgacgatcttgcaggg 417



to top

>emb|CR632007.2|CNS0EMML Tetraodon nigroviridis full-length cDNA
          Length = 714

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 512 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 453

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 452 ggtcttggaggtggacatctcgacgatcttgcaggg 417



to top

>emb|CR631901.2|CNS0EMJN Tetraodon nigroviridis full-length cDNA
          Length = 714

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 512 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 453

                                               
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggg 626
            |||||||||||||| | ||| |||| |||||||||
Sbjct: 452 ggtcttggaggtggacatctcgacgatcttgcaggg 417



to top

>gb|AC068197.4|AC068197 Genomic sequence for Arabidopsis thaliana BAC F16A14 from chromosome I,
             complete sequence
          Length = 99547

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 100/124 (80%)
 Strand = Plus / Minus

                                                                         
Query: 496   tcacagttgtgggatgaaggaacaatatcctcaagcttctttccattaaagatgtcaatg 555
             ||||| |||||||| |||||||||||||| || || ||||| |   | ||||| ||||| 
Sbjct: 49407 tcacaattgtgggaagaaggaacaatatcttcgagtttcttgctggtgaagatatcaata 49348

                                                                         
Query: 556   gcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtggagacctcaacg 615
             || ||||| || || || || || |||||||| |||||||| ||||| || |||||||| 
Sbjct: 49347 gctacaaaatgacatttagcatgaccatgcttgccagtcttcgaggttgaaacctcaaca 49288

                 
Query: 616   acct 619
             ||||
Sbjct: 49287 acct 49284



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                   
Query: 436   acatatccatcatcagttatgtcaatcagctgataatc 473
             ||||||||||| ||||  ||||||||||||||||||||
Sbjct: 49560 acatatccatcttcagaaatgtcaatcagctgataatc 49523



to top

>emb|CR674419.2|CNS0FJCP Tetraodon nigroviridis full-length cDNA
          Length = 1385

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                       
Query: 544 aagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtg 603
           |||||||||||  |||| |||||   ||| |||||||| ||||| || ||||||||||||
Sbjct: 506 aagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgccggtcttggaggtg 447

                                  
Query: 604 gagacctcaacgaccttgcaggg 626
           || | ||| |||| |||||||||
Sbjct: 446 gacatctcgacgatcttgcaggg 424



to top

>ref|XM_382131.1| Gibberella zeae PH-1 chromosome 1 conserved hypothetical protein
           (FG01955.1) partial mRNA
          Length = 495

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Minus

                                                                       
Query: 574 gcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggcc 633
           ||||| || ||||| ||||||||||||||||| |  || |||| |||||| ||||||  |
Sbjct: 179 gcgtgaccgtgctttccagtcttggaggtggacatgtcgacgatcttgcaagggcggttc 120

                     
Query: 634 ttgatgacga 643
           ||||||||||
Sbjct: 119 ttgatgacga 110



to top

>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica
          Length = 3272609

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 59/70 (84%)
 Strand = Plus / Plus

                                                                          
Query: 574    gcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggcc 633
              ||||| || ||||| ||||||||||||||||| |  |||| || ||||||||| ||| ||
Sbjct: 923382 gcgtgaccgtgcttaccagtcttggaggtggacatgtcaatgatcttgcagggtcggccc 923441

                        
Query: 634    ttgatgacga 643
              ||||| ||||
Sbjct: 923442 ttgatcacga 923451



to top

>gb|AC117827.6| Mus musculus chromosome 1, clone RP24-88L2, complete sequence
          Length = 213655

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 79    agatagatagatagataacaaagta 103
             |||||||||||||||||||||||||
Sbjct: 15731 agatagatagatagataacaaagta 15707



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 75    atagagatagatagatagata 95
             |||||||||||||||||||||
Sbjct: 15775 atagagatagatagatagata 15755



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 77    agagatagatagatagataa 96
             ||||||||||||||||||||
Sbjct: 15928 agagatagatagatagataa 15909



to top

>gb|AC151350.2| Xenopus tropicalis clone ISB-400N1, complete sequence
          Length = 88948

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 70    ttataatagagatagatagatagat 94
             |||||||||||||||||||||||||
Sbjct: 21663 ttataatagagatagatagatagat 21687



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 75    atagagatagatagatagata 95
             |||||||||||||||||||||
Sbjct: 21701 atagagatagatagatagata 21721



to top

>ref|XM_369445.1| Magnaporthe grisea 70-15 chromosome III hypothetical protein
           (MG06019.4) partial mRNA
          Length = 555

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 91/113 (80%)
 Strand = Plus / Minus

                                                                       
Query: 544 aagatgtcaatggcaacaaagtggcactttgcgtggccatgcttcccagtcttggaggtg 603
           |||||||| ||||| || ||||||  ||| ||||| || ||||| || ||||| ||||| 
Sbjct: 188 aagatgtcgatggcgaccaagtggaccttggcgtgaccgtgcttgccggtcttcgaggtc 129

                                                                
Query: 604 gagacctcaacgaccttgcaggggcgggccttgatgacgatgtgtccaccctt 656
           || |  || |||| |||||| || ||| |||||||||||| ||| ||||||||
Sbjct: 128 gacatgtcgacgatcttgcaaggacggcccttgatgacgacgtgaccaccctt 76



to top

>emb|CR392002.14| Zebrafish DNA sequence from clone DKEY-61D19 in linkage group 2,
             complete sequence
          Length = 52053

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 79    agatagatagatagataacaaagta 103
             |||||||||||||||||||||||||
Sbjct: 34208 agatagatagatagataacaaagta 34184



to top

>emb|CR731732.2|CNS0GRJT Tetraodon nigroviridis full-length cDNA
          Length = 1354

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 574 gcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggg 626
           |||||||| |||||  | |||||||||||||| | |||||||| |||||||||
Sbjct: 463 gcgtggccgtgcttgtcggtcttggaggtggacatctcaacgatcttgcaggg 411



to top

>emb|CR728530.2|CNS0GP2W Tetraodon nigroviridis full-length cDNA
          Length = 1373

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 574 gcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggg 626
           |||||||| ||||| || |||||||||||||| | ||| |||| |||||||||
Sbjct: 462 gcgtggccgtgcttgccggtcttggaggtggacatctcgacgatcttgcaggg 410



to top

>emb|CR686010.2|CNS0FS9Y Tetraodon nigroviridis full-length cDNA
          Length = 1383

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 574 gcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggg 626
           |||||||| ||||| || |||||||||||||| | ||| |||| |||||||||
Sbjct: 469 gcgtggccgtgcttgccggtcttggaggtggacatctcgacgatcttgcaggg 417



to top

>emb|AL391134.13| Human DNA sequence from clone RP11-245M24 on chromosome Xp11.22-11.3
            Contains the 3' end of a nove  gene and a keratin 8 (K8,
            KO, CK8, CYK8, K2C8, CARD2) (KRT8) pseudogene, complete
            sequence
          Length = 58094

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 71   tataatagagatagatagatagata 95
            |||||||||||||||||||||||||
Sbjct: 5668 tataatagagatagatagatagata 5692



to top

>emb|BX547935.12| Zebrafish DNA sequence from clone CH211-207C1 in linkage group 16,
              complete sequence
          Length = 195252

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 71     tataatagagatagatagatagata 95
              |||||||||||||||||||||||||
Sbjct: 178914 tataatagagatagatagatagata 178890



to top

>emb|BX950219.10| Mouse DNA sequence from clone RP23-303E24 on chromosome 4, complete
              sequence
          Length = 167874

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                       
Query: 71     tataatagagatagatagatagata 95
              |||||||||||||||||||||||||
Sbjct: 161774 tataatagagatagatagatagata 161750



to top

>gb|AC102666.13| Mus musculus chromosome 1, clone RP23-444A8, complete sequence
          Length = 169085

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 71    tataatagagatagatagatagata 95
             |||||||||||||||||||||||||
Sbjct: 30933 tataatagagatagatagatagata 30909



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 75    atagagatagatagatagata 95
             |||||||||||||||||||||
Sbjct: 31250 atagagatagatagatagata 31230



to top

>emb|CT030739.10| Mouse DNA sequence from clone RP24-496K8 on chromosome 13, complete
             sequence
          Length = 192075

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                      
Query: 72    ataatagagatagatagatagataa 96
             |||||||||||||||||||||||||
Sbjct: 75863 ataatagagatagatagatagataa 75839



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 79     agatagatagatagataaca 98
              ||||||||||||||||||||
Sbjct: 146974 agatagatagatagataaca 146993



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 79     agatagatagatagataaca 98
              ||||||||||||||||||||
Sbjct: 115839 agatagatagatagataaca 115820



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 79    agatagatagatagataaca 98
             ||||||||||||||||||||
Sbjct: 75756 agatagatagatagataaca 75737



to top

>gb|AC133097.3| Mus musculus BAC clone RP23-287O2 from 1, complete sequence
          Length = 199276

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                      
Query: 79    agatagatagatagataacaaagta 103
             |||||||||||||||||||||||||
Sbjct: 12182 agatagatagatagataacaaagta 12206



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 75    atagagatagatagatagata 95
             |||||||||||||||||||||
Sbjct: 12138 atagagatagatagatagata 12158



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 77    agagatagatagatagataa 96
             ||||||||||||||||||||
Sbjct: 11985 agagatagatagatagataa 12004



to top

>gb|AC107677.7| Mus musculus chromosome 3, clone RP23-235F22, complete sequence
          Length = 157746

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 72    ataatagagatagatagatagata 95
             ||||||||||||||||||||||||
Sbjct: 73188 ataatagagatagatagatagata 73165



to top

>gb|AC156576.3| Mus musculus BAC clone RP23-7C22 from chromosome 13, complete sequence
          Length = 205345

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 72    ataatagagatagatagatagata 95
             ||||||||||||||||||||||||
Sbjct: 48774 ataatagagatagatagatagata 48797



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 72     ataatagagatagatagatagata 95
              |||| |||||||||||||||||||
Sbjct: 105856 ataaaagagatagatagatagata 105879



to top

>ref|XM_656527.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4015.2), mRNA
          Length = 480

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 81/100 (81%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           |||||||||  | |||||||| ||||| |||| |||   ||| ||||| || ||||| ||
Sbjct: 213 cttctttccggtgaagatgtcgatggcgacaaggtgaaccttggcgtgaccgtgcttacc 154

                                                   
Query: 591 agtcttggaggtggagacctcaacgaccttgcaggggcgg 630
           |||||||||||| || |  || |||| |||||||||||||
Sbjct: 153 agtcttggaggtagacatgtcgacgatcttgcaggggcgg 114



to top

>gb|AC122820.4| Mus musculus BAC clone RP23-200M5 from chromosome 6, complete sequence
          Length = 215238

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 72    ataatagagatagatagatagata 95
             ||||||||||||||||||||||||
Sbjct: 58932 ataatagagatagatagatagata 58955



to top

>ref|XM_745063.1| Aspergillus fumigatus Af293 eukaryotic initiation factor 5A
           (Afu1g04070) partial mRNA
          Length = 579

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 574 gcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggcc 633
           ||||| || ||||| |||||||||||||| || |  ||||||| ||||||||| ||  ||
Sbjct: 269 gcgtgaccgtgcttgccagtcttggaggtagacatatcaacgatcttgcagggacgaccc 210

                   
Query: 634 ttgatgac 641
           ||||||||
Sbjct: 209 ttgatgac 202



to top

>gb|AC124486.4| Mus musculus BAC clone RP23-451E1 from chromosome 12, complete sequence
          Length = 183140

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 72    ataatagagatagatagatagata 95
             ||||||||||||||||||||||||
Sbjct: 71003 ataatagagatagatagatagata 71026



to top

>gb|AC124501.3| Mus musculus BAC clone RP23-412F10 from chromosome 6, complete sequence
          Length = 210057

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 72    ataatagagatagatagatagata 95
             ||||||||||||||||||||||||
Sbjct: 84493 ataatagagatagatagatagata 84470



to top

>gb|AC101142.9| Mus musculus chromosome 13, clone RP23-170P21, complete sequence
          Length = 176563

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 72    ataatagagatagatagatagata 95
             ||||||||||||||||||||||||
Sbjct: 10502 ataatagagatagatagatagata 10479



to top

>emb|AL683870.15| Human DNA sequence from clone RP11-261P4 on chromosome X Contains the 3'
              end of the IL3RA gene for interleukin 3 receptor, alpha
              (low affinity) (IL3R, CD123, IL3RX, IL3RY, IL3RAY, hIL-3Ra,
              MGC34174), the SLC25A6 gene for solute carrier family 25
              (mitochondrial carrier; adenine nucleotide translocator),
              member 6 (ANT3, ANT3Y, MGC17525), the ASMTL gene for
              acetylserotonin O-methyltransferase-like (ASMTLX), a novel
              gene (LOC286530), a novel gene (FLJ13330) and six CpG
              islands, complete sequence
          Length = 162377

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 72     ataatagagatagatagatagata 95
              ||||||||||||||||||||||||
Sbjct: 130783 ataatagagatagatagatagata 130760



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 72     ataatagagatagatagatagata 95
              |||||||| |||||||||||||||
Sbjct: 130362 ataatagaaatagatagatagata 130339



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 72     ataatagagatagatagatagata 95
              |||||||| |||||||||||||||
Sbjct: 129700 ataatagaaatagatagatagata 129677



to top

>gb|AC164168.3| Mus musculus 6 BAC RP23-343D21 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 236103

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 72     ataatagagatagatagatagata 95
              ||||||||||||||||||||||||
Sbjct: 166712 ataatagagatagatagatagata 166689



to top

>gb|AC164662.6| Mus musculus 10 BAC RP24-279D11 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 154482

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 68    tattataatagagatagatagatagata 95
             |||| |||||||||||||||||||||||
Sbjct: 83143 tattctaatagagatagatagatagata 83170



to top

>emb|AJ719748.1| Gallus gallus mRNA for hypothetical protein, clone 6a12
          Length = 1218

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 574 gcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcg 629
           |||||||| ||||| || |||||||||||||| | ||| |||| ||| ||||||||
Sbjct: 235 gcgtggccgtgcttgccggtcttggaggtggacatctccacgatcttacaggggcg 180



to top

>gb|AC098642.5| Genomic sequence for Mus musculus, clone RP23-270O7, complete sequence
          Length = 188834

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 72     ataatagagatagatagatagata 95
              ||||||||||||||||||||||||
Sbjct: 155238 ataatagagatagatagatagata 155215



to top

>dbj|AB226196.1| Aspergillus oryzae cDNA, contig sequence: AoEST3055
          Length = 915

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 574 gcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggcc 633
           ||||| || ||||| || |||||||||||||| |  || |||| |||||| |||||| ||
Sbjct: 300 gcgtgaccgtgctttccggtcttggaggtggacatgtcgacgatcttgcaagggcggccc 241

                   
Query: 634 ttgatgac 641
           ||||||||
Sbjct: 240 ttgatgac 233



to top

>gb|AC084407.10| Mus Musculus Strain C57BL6/J Chromosome 11 Clone RP23-271O13, complete
              sequence
          Length = 239837

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 72     ataatagagatagatagatagata 95
              ||||||||||||||||||||||||
Sbjct: 185071 ataatagagatagatagatagata 185094



to top

>dbj|AP007155.1| Aspergillus oryzae RIB40 genomic DNA, SC003
          Length = 4170692

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                           
Query: 574     gcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcgggcc 633
               ||||| || ||||| || |||||||||||||| |  || |||| |||||| |||||| ||
Sbjct: 2543898 gcgtgaccgtgctttccggtcttggaggtggacatgtcgacgatcttgcaagggcggccc 2543957

                       
Query: 634     ttgatgac 641
               ||||||||
Sbjct: 2543958 ttgatgac 2543965



to top

>emb|CR390079.1| Gallus gallus finished cDNA, clone ChEST993f19
          Length = 429

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 574 gcgtggccatgcttcccagtcttggaggtggagacctcaacgaccttgcaggggcg 629
           |||||||| ||||| || |||||||||||||| | ||| |||| ||| ||||||||
Sbjct: 65  gcgtggccgtgcttgccggtcttggaggtggacatctccacgatcttacaggggcg 10



to top

>gb|AC154817.2| Mus musculus BAC clone RP23-72G6 from chromosome 13, complete sequence
          Length = 143739

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 72    ataatagagatagatagatagata 95
             ||||||||||||||||||||||||
Sbjct: 43116 ataatagagatagatagatagata 43139



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 76    tagagatagatagatagata 95
             ||||||||||||||||||||
Sbjct: 21632 tagagatagatagatagata 21651



to top

>gb|AC153496.4| Mus musculus 10 BAC RP23-373D1 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 149839

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 68    tattataatagagatagatagatagata 95
             |||| |||||||||||||||||||||||
Sbjct: 47986 tattctaatagagatagatagatagata 47959



to top

>emb|AL929209.17| Mouse DNA sequence from clone RP23-415C3 on chromosome 2, complete
             sequence
          Length = 210790

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 72    ataatagagatagatagatagata 95
             ||||||||||||||||||||||||
Sbjct: 96395 ataatagagatagatagatagata 96372



to top

>gb|AC140301.3| Mus musculus BAC clone RP23-435M8 from 5, complete sequence
          Length = 197633

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 72    ataatagagatagatagatagata 95
             ||||||||||||||||||||||||
Sbjct: 68677 ataatagagatagatagatagata 68700



to top

>emb|AL606704.20| Mouse DNA sequence from clone RP23-375B1 on chromosome 11, complete
             sequence
          Length = 71109

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 72    ataatagagatagatagatagata 95
             ||||||||||||||||||||||||
Sbjct: 19350 ataatagagatagatagatagata 19373



to top

>emb|AL672188.6| Mouse DNA sequence from clone RP23-53B2 on chromosome X, complete
             sequence
          Length = 150121

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 72    ataatagagatagatagatagata 95
             ||||||||||||||||||||||||
Sbjct: 20026 ataatagagatagatagatagata 20049



to top

>gb|AC118009.7| Mus musculus chromosome 8, clone RP23-442H2, complete sequence
          Length = 208458

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 73   taatagagatagatagatagata 95
            |||||||||||||||||||||||
Sbjct: 6748 taatagagatagatagatagata 6726



to top

>gb|AC122239.4| Mus musculus BAC clone RP23-143K14 from chromosome 8, complete
            sequence
          Length = 197109

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 73   taatagagatagatagatagata 95
            |||||||||||||||||||||||
Sbjct: 5725 taatagagatagatagatagata 5747



to top

>ref|XM_546586.2| PREDICTED: Canis familiaris similar to eukaryotic translation
           initiation factor 5A, transcript variant 1 (LOC489468),
           mRNA
          Length = 908

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 532 ttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccca 591
           ||||| ||| |||||||||||||  |||| | ||||  ||| || ||||| ||||| |||
Sbjct: 351 ttcttgccagtaaagatgtcaataccaaccaggtggaccttggcatggccgtgcttgcca 292

                      
Query: 592 gtcttggaggt 602
           |||||||||||
Sbjct: 291 gtcttggaggt 281



to top

>ref|XM_843935.1| PREDICTED: Canis familiaris similar to eukaryotic translation
           initiation factor 5A, transcript variant 2 (LOC489468),
           mRNA
          Length = 1068

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 532 ttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccca 591
           ||||| ||| |||||||||||||  |||| | ||||  ||| || ||||| ||||| |||
Sbjct: 511 ttcttgccagtaaagatgtcaataccaaccaggtggaccttggcatggccgtgcttgcca 452

                      
Query: 592 gtcttggaggt 602
           |||||||||||
Sbjct: 451 gtcttggaggt 441



to top

>emb|CR699189.1|CNS0G2G1 Tetraodon nigroviridis full-length cDNA
          Length = 1152

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 62/75 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 304 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 245

                          
Query: 591 agtcttggaggtgga 605
            ||||||||||||||
Sbjct: 244 ggtcttggaggtgga 230



to top

>emb|CR667426.2|CNS0FDYG Tetraodon nigroviridis full-length cDNA
          Length = 1095

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 62/75 (82%)
 Strand = Plus / Minus

                                                                       
Query: 531 cttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccc 590
           ||||||||||   |||||||||||  |||| |||||   ||| |||||||| ||||| ||
Sbjct: 224 cttctttccagagaagatgtcaataccaaccaagtgcaccttagcgtggccgtgcttgcc 165

                          
Query: 591 agtcttggaggtgga 605
            ||||||||||||||
Sbjct: 164 ggtcttggaggtgga 150



to top

>gb|AC142328.1| Pan troglodytes BAC clone RP43-24E4 from 7, complete sequence
          Length = 192006

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 72    ataatagagatagatagatagat 94
             |||||||||||||||||||||||
Sbjct: 86219 ataatagagatagatagatagat 86241



to top

>emb|AJ391219.1|APY391219 Aethia pygmaea microsatellite DNA, clone AU06B11
          Length = 411

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 79  agatagatagatagataacaaag 101
           |||||||||||||||||||||||
Sbjct: 126 agatagatagatagataacaaag 148



to top

>emb|AL591521.8| Human DNA sequence from clone RP5-965F6 on chromosome 1 Contains the 5'
             end of a novel gene and a thioredoxin (TXN) pseudogene,
             complete sequence
          Length = 97110

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 73    taatagagatagatagatagata 95
             |||||||||||||||||||||||
Sbjct: 91120 taatagagatagatagatagata 91142



to top

>emb|AL589740.4| Human DNA sequence from clone RP11-436D23 on chromosome 6 Contains part
             of a novel gene, complete sequence
          Length = 187863

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 79    agatagatagatagataacaaag 101
             |||||||||||||||||||||||
Sbjct: 84702 agatagatagatagataacaaag 84680



to top

>emb|AL512510.13| Human DNA sequence from clone RP11-537P24 on chromosome 6 Contains a CpG
              island, complete sequence
          Length = 170970

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 75     atagagatagatagatagataac 97
              |||||||||||||||||||||||
Sbjct: 153550 atagagatagatagatagataac 153528



to top

>gb|AC098719.3| Mus musculus clone RP23-2M3, complete sequence
          Length = 219626

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 74   aatagagatagatagatagataa 96
            |||||||||||||||||||||||
Sbjct: 1197 aatagagatagatagatagataa 1175



to top

>gb|AF385410.1|AF385410 Cricetulus griseus eukaryotic translation initiation factor 5A
           isoform II (Eif5a2) gene, exons 2 and 3 and partial cds
          Length = 653

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 577 tggccatgcttcccagtcttgga 599
           |||||||||||||||||||||||
Sbjct: 133 tggccatgcttcccagtcttgga 111



to top

>gb|AC024887.22| Homo sapiens 3 BAC RP11-307B9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 99040

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 73    taatagagatagatagatagata 95
             |||||||||||||||||||||||
Sbjct: 65009 taatagagatagatagatagata 65031



to top

>gb|AC112230.5| Homo sapiens BAC clone RP11-85D18 from 2, complete sequence
          Length = 196480

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 44    ccactcagttccaattccaaagg 66
             |||||||||||||||||||||||
Sbjct: 18065 ccactcagttccaattccaaagg 18087



to top

>gb|AF054116.1|AF054116 Rattus norvegicus polymorphic marker D5UIA10 sequence
          Length = 531

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 69  attataatagagatagatagatagata 95
           |||||| ||||||||||||||||||||
Sbjct: 157 attatattagagatagatagatagata 131



to top

>gb|AY610331.1| Sus scrofa clone rebs02c_k2.y1.abd, mRNA sequence
          Length = 639

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 532 ttctttccattaaagatgtcaatggcaacaaagtggcactttgcgtggccatgcttccca 591
           ||||| ||| |||||||||||||  |||| |  |||  ||| |||||||| ||||| |||
Sbjct: 338 ttcttcccagtaaagatgtcaataccaaccagatggaccttggcgtggccgtgcttgcca 279

                      
Query: 592 gtcttggaggt 602
           |||||||||||
Sbjct: 278 gtcttggaggt 268



to top

>gb|AC149588.4| Mus musculus BAC clone RP23-366I10 from 15, complete sequence
          Length = 200656

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 74    aatagagatagatagatagataa 96
             |||||||||||||||||||||||
Sbjct: 37374 aatagagatagatagatagataa 37396



to top

>gb|AC124097.6| Mus musculus chromosome 15, clone RP23-431H12, complete sequence
          Length = 203639

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 79    agatagatagatagataacaaa 100
             ||||||||||||||||||||||
Sbjct: 31456 agatagatagatagataacaaa 31435



to top

>gb|AC111115.13| Mus musculus chromosome 5, clone RP23-213H20, complete sequence
          Length = 201694

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 79    agatagatagatagataacaaa 100
             ||||||||||||||||||||||
Sbjct: 69131 agatagatagatagataacaaa 69110



to top

>gb|AC110195.14| Mus musculus chromosome 3, clone RP24-291L17, complete sequence
          Length = 171669

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 74     aatagagatagatagatagata 95
              ||||||||||||||||||||||
Sbjct: 124512 aatagagatagatagatagata 124533



to top

>gb|AC165972.4| Mus musculus BAC clone RP23-87D12 from chromosome 17, complete sequence
          Length = 199737

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 75     atagagatagatagatagataa 96
              ||||||||||||||||||||||
Sbjct: 101330 atagagatagatagatagataa 101351



to top

>gb|AC162466.6| Mus musculus 6 BAC RP23-196O2 (Roswell Park Cancer Institute
            (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 186817

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 79   agatagatagatagataacaaa 100
            ||||||||||||||||||||||
Sbjct: 3206 agatagatagatagataacaaa 3185



to top

>gb|AC115930.10| Mus musculus chromosome 3, clone RP24-534H10, complete sequence
          Length = 158041

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 74     aatagagatagatagatagata 95
              ||||||||||||||||||||||
Sbjct: 131868 aatagagatagatagatagata 131847



to top

>gb|AC099644.6| Mus musculus chromosome 15, clone RP24-359B20, complete sequence
          Length = 135063

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 79    agatagatagatagataacaaa 100
             ||||||||||||||||||||||
Sbjct: 46734 agatagatagatagataacaaa 46755



to top

>ref|NM_001013019.1| Mus musculus RIKEN cDNA 1110067I12 gene (1110067I12Rik), mRNA
          Length = 2685

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 74   aatagagatagatagatagata 95
            ||||||||||||||||||||||
Sbjct: 2614 aatagagatagatagatagata 2635



to top

>gb|AC161210.5| Mus musculus chromosome 3, clone RP23-71N6, complete sequence
          Length = 158006

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 74     aatagagatagatagatagata 95
              ||||||||||||||||||||||
Sbjct: 108336 aatagagatagatagatagata 108315



to top

>gb|AF153595.1| Sebastes alutus microsatellite Sal1,6 sequence
          Length = 663

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 79  agatagatagatagataacaaa 100
           ||||||||||||||||||||||
Sbjct: 201 agatagatagatagataacaaa 222



to top

>gb|AY324145.1| Desmognathus auriculatus clone Dau11 microsatellite sequence
          Length = 366

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 74  aatagagatagatagatagata 95
           ||||||||||||||||||||||
Sbjct: 190 aatagagatagatagatagata 211



to top

>gb|U93889.1|MNU93889 Megaptera novaeangliae clone GATA019 microsatellite sequence
          Length = 997

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 74  aatagagatagatagatagata 95
           ||||||||||||||||||||||
Sbjct: 611 aatagagatagatagatagata 590


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,252,916
Number of Sequences: 3902068
Number of extensions: 7252916
Number of successful extensions: 1057626
Number of sequences better than 10.0: 2192
Number of HSP's better than 10.0 without gapping: 2197
Number of HSP's successfully gapped in prelim test: 13
Number of HSP's that attempted gapping in prelim test: 924333
Number of HSP's gapped (non-prelim): 133125
length of query: 681
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 658
effective length of database: 17,143,297,704
effective search space: 11280289889232
effective search space used: 11280289889232
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top