Clone Name | rbasd18o04 |
---|---|
Clone Library Name | barley_pub |
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 75.8 bits (38), Expect = 2e-11 Identities = 54/58 (93%), Gaps = 1/58 (1%) Strand = Plus / Minus Query: 56 ttacttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||||||| |||||||||| || ||||||||||||||||||| |||||| Sbjct: 810 ttacttgccggggacaa-agttggtggcgaatgcccatgcattgttgttgacggggtc 754
>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein mRNA, partial cds Length = 575 Score = 71.9 bits (36), Expect = 4e-10 Identities = 52/56 (92%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||||| ||||||||||||| ||||| ||||||||||||| |||||| Sbjct: 470 acttgccggggacaa-agttggtggcaaaagcccaggcattgttgttgacggggtc 416
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 3C (LHCP) mRNA, partial cds Length = 661 Score = 58.0 bits (29), Expect = 6e-06 Identities = 32/33 (96%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||||||||||| ||||||||||||| Sbjct: 657 agttggtggcaaacgcccaggcattgttgttga 625
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 980 Score = 58.0 bits (29), Expect = 6e-06 Identities = 32/33 (96%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||||| ||||||||||||||||||| Sbjct: 826 agttggtggcaaaggcccatgcattgttgttga 794
>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I precursor (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1015 Score = 58.0 bits (29), Expect = 6e-06 Identities = 45/49 (91%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 56 ttacttgccggggacaagagttggtggcaaacgcccatgcattgttgtt 104 |||||| |||||||||| ||||||||||| | ||||||||||||||||| Sbjct: 824 ttactttccggggacaa-agttggtggcataggcccatgcattgttgtt 777
>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding protein Length = 869 Score = 56.0 bits (28), Expect = 2e-05 Identities = 50/56 (89%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 |||||||||| |||| ||||||||||| | |||||||| |||||||||| |||||| Sbjct: 808 acttgccgggcacaa-agttggtggcataggcccatgcgttgttgttgacggggtc 754
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA, complete cds Length = 1022 Score = 56.0 bits (28), Expect = 2e-05 Identities = 50/56 (89%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||||| |||||||||| | |||||||| |||||||||| |||||| Sbjct: 838 acttgccggggacaa-agttggtggcgtaggcccatgcgttgttgttgacggggtc 784
>emb|X68333.1|HHLHC H.helix mRNA for light harvesting chlorophyll a/b binding protein Length = 686 Score = 54.0 bits (27), Expect = 9e-05 Identities = 43/47 (91%), Gaps = 1/47 (2%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgtt 104 |||| |||||||||| ||||||||||| | ||||||||||||||||| Sbjct: 580 actttccggggacaa-agttggtggcataggcccatgcattgttgtt 535
>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll A/B-binding protein gene, complete cds Length = 1260 Score = 54.0 bits (27), Expect = 9e-05 Identities = 52/59 (88%), Gaps = 1/59 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtcagc 116 |||| |||||||||| ||||||||||| | ||||| ||||||||||||| |||||||| Sbjct: 990 actttccggggacaa-agttggtggcataggcccaagcattgttgttgactgggtcagc 933
>emb|AJ131044.1|CAR131044 Cicer arietinum mRNA for chlorophyll a/b binding protein Length = 983 Score = 52.0 bits (26), Expect = 4e-04 Identities = 38/42 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttgatggggtcag 115 ||||||||||| | ||||||||||||||||||| ||||||| Sbjct: 798 agttggtggcataggcccatgcattgttgttgacagggtcag 757
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 52.0 bits (26), Expect = 4e-04 Identities = 51/58 (87%), Gaps = 1/58 (1%) Strand = Plus / Minus Query: 56 ttacttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||||| | |||||||||| || ||||| ||||||||||| | |||||| Sbjct: 975 ttacttgccggggacga-agttggtggcgaaggcccaggcattgttgtttacggggtc 919
>gb|U20983.1|STU20983 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-2) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 50.1 bits (25), Expect = 0.001 Identities = 31/33 (93%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 |||| |||||||| ||||||||||||||||||| Sbjct: 781 agtttgtggcaaaggcccatgcattgttgttga 749
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | |||||||| |||||||||| |||||| Sbjct: 796 acttgccggggacga-agttggtggcgtaggcccatgcgttgttgttgacggggtc 742
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase IV-1 gene, complete cds Length = 15000 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Plus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | |||||||| |||||||||| |||||| Sbjct: 13878 acttgccggggacga-agttggtggcgtaggcccatgcgttgttgttgacggggtc 13932
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| ||||||| || |||||||||| |||||| Sbjct: 10793780 acttgccggggacga-agttggtggcgtacgcccaggcgttgttgttgacggggtc 10793726
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | |||||||| |||||||||| |||||| Sbjct: 30025133 acttgccggggacga-agttggtggcgtaggcccatgcgttgttgttgacggggtc 30025079 Score = 40.1 bits (20), Expect = 1.4 Identities = 48/56 (85%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | ||||| || |||||||||| |||||| Sbjct: 23604327 acttgccggggacga-agttggtggcgtaggcccaggcgttgttgttgacggggtc 23604273
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0690B02 Length = 153116 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | |||||||| |||||||||| |||||| Sbjct: 21123 acttgccggggacga-agttggtggcgtaggcccatgcgttgttgttgacggggtc 21069
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| ||||||| || |||||||||| |||||| Sbjct: 17503 acttgccggggacga-agttggtggcgtacgcccaggcgttgttgttgacggggtc 17449
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0085I16 Length = 141701 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| ||||||| || |||||||||| |||||| Sbjct: 130398 acttgccggggacga-agttggtggcgtacgcccaggcgttgttgttgacggggtc 130344
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full insert sequence Length = 1013 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| ||||||| || |||||||||| |||||| Sbjct: 848 acttgccggggacga-agttggtggcgtacgcccaggcgttgttgttgacggggtc 794
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full insert sequence Length = 1021 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| ||||||| || |||||||||| |||||| Sbjct: 853 acttgccggggacga-agttggtggcgtacgcccaggcgttgttgttgacggggtc 799
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full insert sequence Length = 1056 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| ||||||| || |||||||||| |||||| Sbjct: 855 acttgccggggacga-agttggtggcgtacgcccaggcgttgttgttgacggggtc 801
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full insert sequence Length = 1055 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | |||||||| |||||||||| |||||| Sbjct: 877 acttgccggggacga-agttggtggcgtaggcccatgcgttgttgttgacggggtc 823
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full insert sequence Length = 1055 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | |||||||| |||||||||| |||||| Sbjct: 877 acttgccggggacga-agttggtggcgtaggcccatgcgttgttgttgacggggtc 823
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full insert sequence Length = 1057 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | |||||||| |||||||||| |||||| Sbjct: 879 acttgccggggacga-agttggtggcgtaggcccatgcgttgttgttgacggggtc 825
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full insert sequence Length = 1235 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| ||||||| || |||||||||| |||||| Sbjct: 853 acttgccggggacga-agttggtggcgtacgcccaggcgttgttgttgacggggtc 799
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full insert sequence Length = 1040 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | |||||||| |||||||||| |||||| Sbjct: 862 acttgccggggacga-agttggtggcgtaggcccatgcgttgttgttgacggggtc 808
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full insert sequence Length = 1045 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| ||||||| || |||||||||| |||||| Sbjct: 853 acttgccggggacga-agttggtggcgtacgcccaggcgttgttgttgacggggtc 799
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full insert sequence Length = 1057 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | |||||||| |||||||||| |||||| Sbjct: 879 acttgccggggacga-agttggtggcgtaggcccatgcgttgttgttgacggggtc 825
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds Length = 1633 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| || ||||| || |||||||||| |||||| Sbjct: 1193 acttgccggggacga-agttggtggcgaaggcccaggcgttgttgttgacggggtc 1139
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 1022 Score = 48.1 bits (24), Expect = 0.006 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| ||||||| || |||||||||| |||||| Sbjct: 834 acttgccggggacga-agttggtggcgtacgcccaggcgttgttgttgacggggtc 780
>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 987 Score = 46.1 bits (23), Expect = 0.022 Identities = 38/43 (88%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttgatggggtcagc 116 ||||||||||||| ||||| || |||||||||| |||||||| Sbjct: 836 agttggtggcaaaagcccaggcgttgttgttgactgggtcagc 794
>gb|AY288914.1| Brassica oleracea chlorophyll a/b binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 1042 Score = 46.1 bits (23), Expect = 0.022 Identities = 29/31 (93%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgtt 104 ||||||| ||||| ||||||||||||||||| Sbjct: 859 agttggtagcaaaggcccatgcattgttgtt 829
>gb|AF279250.1|AF279250 Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*3) mRNA, complete cds; nuclear gene for chloroplast product Length = 941 Score = 46.1 bits (23), Expect = 0.022 Identities = 51/59 (86%), Gaps = 1/59 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtcagc 116 |||| |||||||||| |||| |||||| | ||||| ||||||||||||| |||||||| Sbjct: 848 actttccggggacaa-agtttgtggcatatgcccaagcattgttgttgacagggtcagc 791
>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25 Length = 1184 Score = 46.1 bits (23), Expect = 0.022 Identities = 38/43 (88%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttgatggggtcagc 116 |||| |||||||| ||||| ||||||||||| | ||||||||| Sbjct: 1014 agtttgtggcaaaggcccacgcattgttgttaacggggtcagc 972
>gb|K00976.1|PETCAB102 Petunia major chlorophyll a/b binding protein (Cab) clone pCab102, 3' end and flank Length = 302 Score = 46.1 bits (23), Expect = 0.022 Identities = 38/43 (88%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttgatggggtcagc 116 |||| |||||||| ||||| ||||||||||| | ||||||||| Sbjct: 172 agtttgtggcaaaggcccacgcattgttgttaacggggtcagc 130
>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1042 Score = 46.1 bits (23), Expect = 0.022 Identities = 38/43 (88%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttgatggggtcagc 116 |||||||||| || ||||| ||||||||||||| |||||||| Sbjct: 811 agttggtggcgaaggcccaagcattgttgttgactgggtcagc 769
>emb|X02357.1|PECAB13 Petunia gene for chlorophyll a/b binding protein cab 13 Length = 1019 Score = 44.1 bits (22), Expect = 0.087 Identities = 34/38 (89%) Strand = Plus / Minus Query: 79 gtggcaaacgcccatgcattgttgttgatggggtcagc 116 |||||||| ||||| ||||||||||| | ||||||||| Sbjct: 900 gtggcaaaggcccacgcattgttgttaacggggtcagc 863
>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1) mRNA, complete cds Length = 1008 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||| || || ||||||||||||||||||| Sbjct: 846 agttggtagcgaaggcccatgcattgttgttga 814
>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2) mRNA, complete cds Length = 1176 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||||| ||||| || |||||||||| Sbjct: 854 agttggtggcaaaggcccaagcgttgttgttga 822
>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence Length = 762 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||||| ||||| || |||||||||| Sbjct: 745 agttggtggcaaaggcccaagcgttgttgttga 713
>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative photosystem II type I chlorophyll a /b binding protein (At1g29920) mRNA, complete cds Length = 1044 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||||| ||||| || |||||||||| Sbjct: 840 agttggtggcaaaggcccaagcgttgttgttga 808
>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 851 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||| || || ||||||||||||||||||| Sbjct: 784 agttggtagcgaaggcccatgcattgttgttga 752
>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 1019 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||| || || ||||||||||||||||||| Sbjct: 846 agttggtagcgaaggcccatgcattgttgttga 814
>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein, putative (At1g29920) mRNA, complete cds Length = 994 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||||| ||||| || |||||||||| Sbjct: 840 agttggtggcaaaggcccaagcgttgttgttga 808
>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 1003 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||| || || ||||||||||||||||||| Sbjct: 846 agttggtagcgaaggcccatgcattgttgttga 814
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||| || || ||||||||||||||||||| Sbjct: 96088 agttggtagcgaaggcccatgcattgttgttga 96056
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Plus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||| || || ||||||||||||||||||| Sbjct: 78114 agttggtagcgaaggcccatgcattgttgttga 78146
>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920) mRNA, complete cds Length = 898 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||||| ||||| || |||||||||| Sbjct: 787 agttggtggcaaaggcccaagcgttgttgttga 755
>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920; F1N18.4) mRNA, complete cds Length = 1007 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||||| ||||| || |||||||||| Sbjct: 839 agttggtggcaaaggcccaagcgttgttgttga 807
>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 804 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||||| ||||| || |||||||||| Sbjct: 787 agttggtggcaaaggcccaagcgttgttgttga 755
>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||||| ||||| || |||||||||| Sbjct: 833 agttggtggcaaaggcccaagcgttgttgttga 801
>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||||| ||||| || |||||||||| Sbjct: 839 agttggtggcaaaggcccaagcgttgttgttga 807
>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete cds Length = 1009 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||| || || ||||||||||||||||||| Sbjct: 852 agttggtagcgaaggcccatgcattgttgttga 820
>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS41ZH03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 638 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||| || || ||||||||||||||||||| Sbjct: 504 agttggtagcgaaggcccatgcattgttgttga 472
>gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B binding protein (Lhcb-Pp2) mRNA, complete cds Length = 955 Score = 42.1 bits (21), Expect = 0.34 Identities = 27/29 (93%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttg 102 ||||||||||| | ||||||||||||||| Sbjct: 781 agttggtggcataagcccatgcattgttg 753
>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete sequence Length = 101075 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||||| ||||| || |||||||||| Sbjct: 19879 agttggtggcaaaggcccaagcgttgttgttga 19847
>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence Length = 1041 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||||| ||||| || |||||||||| Sbjct: 854 agttggtggcaaaggcccaagcgttgttgttga 822
>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence Length = 979 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||| || || ||||||||||||||||||| Sbjct: 846 agttggtagcgaaggcccatgcattgttgttga 814
>gb|AF220527.1|AF220527 Euphorbia esula chlorophyll a/b binding protein precursor, mRNA, complete cds Length = 927 Score = 42.1 bits (21), Expect = 0.34 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 56 ttacttgccggggacaagagttggtggcaaacgcccatgcattgttgtt 104 |||||| |||||||| | ||||||| ||||| ||||| ||||||||||| Sbjct: 807 ttactttccggggacga-agttggtcgcaaaagcccaagcattgttgtt 760
>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b binding protein Length = 1301 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||| || || ||||||||||||||||||| Sbjct: 1084 agttggtagcgaaggcccatgcattgttgttga 1052
>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein Length = 999 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||||| ||||| || |||||||||| Sbjct: 932 agttggtggcaaaggcccaagcgttgttgttga 900
>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 853 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||| || || ||||||||||||||||||| Sbjct: 784 agttggtagcgaaggcccatgcattgttgttga 752
>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA, complete cds Length = 983 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||| | |||||||| |||||||||| Sbjct: 835 agttggtggcataggcccatgcgttgttgttga 803
>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 977 Score = 42.1 bits (21), Expect = 0.34 Identities = 43/49 (87%), Gaps = 1/49 (2%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttga 106 ||||||||||||| | |||||||||| | ||||| ||||||||||||| Sbjct: 821 acttgccggggacga-agttggtggcgtaggcccaggcattgttgttga 774
>gb|M64619.1|PEACAB66 Pea cab gene, complete cds Length = 1666 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||| | | ||||||||||||||||| Sbjct: 1502 agttggtggcatatgaccatgcattgttgttga 1470
>gb|K02067.1|PEACAB80 Pea (P.sativum) gene AB80 encoding major light-harvesting chlorophyll a/b-binding protein (polypeptide 15) complex precursor, complete coding sequence Length = 1993 Score = 42.1 bits (21), Expect = 0.34 Identities = 30/33 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttga 106 ||||||||||| | | ||||||||||||||||| Sbjct: 1803 agttggtggcatatgaccatgcattgttgttga 1771
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 789 Score = 40.1 bits (20), Expect = 1.4 Identities = 48/56 (85%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | ||||| || |||||||||| |||||| Sbjct: 784 acttgccggggacga-agttggtggcgtaggcccaggcgttgttgttgacggggtc 730
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding protein Length = 2261 Score = 40.1 bits (20), Expect = 1.4 Identities = 48/56 (85%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | ||||| || |||||||||| |||||| Sbjct: 1808 acttgccggggacga-agttggtggcgtaggcccaagcgttgttgttgacggggtc 1754
>ref|XM_532229.2| PREDICTED: Canis familiaris similar to 35 kDa SR repressor protein (SRrp35) (LOC474992), mRNA Length = 1064 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 31 aaataaaaattcttcaaggc 50 |||||||||||||||||||| Sbjct: 1042 aaataaaaattcttcaaggc 1061
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein Length = 1664 Score = 40.1 bits (20), Expect = 1.4 Identities = 48/56 (85%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | ||||| || |||||||||| |||||| Sbjct: 1245 acttgccggggacga-agttggtggcgtaggcccaggcgttgttgttgacggggtc 1191
>emb|CR717240.1|PCC21H1 P. carinii cosmid 21H1 Length = 25824 Score = 40.1 bits (20), Expect = 1.4 Identities = 26/28 (92%) Strand = Plus / Plus Query: 24 aatcttcaaataaaaattcttcaaggca 51 ||||||||||||||| ||||||||||| Sbjct: 23356 aatcttcaaataaaatatcttcaaggca 23383
>emb|AL080316.8|HSJ104O17 Human DNA sequence from clone RP1-104O17 on chromosome 6q16.1-16.3 Contains parts of 3 novel genes, complete sequence Length = 105137 Score = 40.1 bits (20), Expect = 1.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 29 tcaaataaaaattcttcaag 48 |||||||||||||||||||| Sbjct: 25806 tcaaataaaaattcttcaag 25787
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 40.1 bits (20), Expect = 1.4 Identities = 48/56 (85%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | ||||| || |||||||||| |||||| Sbjct: 67026 acttgccggggacga-agttggtggcgtaggcccaggcgttgttgttgacggggtc 66972
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 40.1 bits (20), Expect = 1.4 Identities = 48/56 (85%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | ||||| || |||||||||| |||||| Sbjct: 2719 acttgccggggacga-agttggtggcgtaagcccaggcgttgttgttgacggggtc 2665
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full insert sequence Length = 1180 Score = 40.1 bits (20), Expect = 1.4 Identities = 48/56 (85%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | ||||| || |||||||||| |||||| Sbjct: 855 acttgccggggacga-agttggtggcgtaggcccaggcgttgttgttgacggggtc 801
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full insert sequence Length = 1126 Score = 40.1 bits (20), Expect = 1.4 Identities = 48/56 (85%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | ||||| || |||||||||| |||||| Sbjct: 854 acttgccggggacga-agttggtggcgtaggcccaggcgttgttgttgacggggtc 800
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein LHCP Length = 967 Score = 40.1 bits (20), Expect = 1.4 Identities = 48/56 (85%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | ||||| || |||||||||| |||||| Sbjct: 860 acttgccggggacga-agttggtggcgtaggcccaagcgttgttgttgacggggtc 806
>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein Length = 1036 Score = 40.1 bits (20), Expect = 1.4 Identities = 26/28 (92%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgtt 101 ||||||||||||| ||||| |||||||| Sbjct: 856 agttggtggcaaaggcccaggcattgtt 829
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein Length = 1442 Score = 40.1 bits (20), Expect = 1.4 Identities = 48/56 (85%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | ||||| || |||||||||| |||||| Sbjct: 1284 acttgccggggacga-agttggtggcgtaggcccaggcgttgttgttgacggggtc 1230
>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full insert sequence Length = 650 Score = 40.1 bits (20), Expect = 1.4 Identities = 48/56 (85%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | ||||| || |||||||||| |||||| Sbjct: 384 acttgccggggacga-agttggtggcgtaggcccaggcgttgttgttgacggggtc 330
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence Length = 2262 Score = 40.1 bits (20), Expect = 1.4 Identities = 48/56 (85%), Gaps = 1/56 (1%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 ||||||||||||| | |||||||||| | ||||| || |||||||||| |||||| Sbjct: 1808 acttgccggggacga-agttggtggcgtaggcccaagcgttgttgttgacggggtc 1754
>gb|AY845253.1| Pisum sativum light-harvesting chlorophyll-a/b binding protein Lhcb1 mRNA, complete cds Length = 801 Score = 38.2 bits (19), Expect = 5.4 Identities = 28/31 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgtt 104 ||||||||||| | | ||||||||||||||| Sbjct: 784 agttggtggcatatgaccatgcattgttgtt 754
>gb|AC120420.11| Mus musculus chromosome 5, clone RP24-481P22, complete sequence Length = 213649 Score = 38.2 bits (19), Expect = 5.4 Identities = 22/23 (95%) Strand = Plus / Minus Query: 25 atcttcaaataaaaattcttcaa 47 |||| |||||||||||||||||| Sbjct: 134832 atctgcaaataaaaattcttcaa 134810
>ref|XM_642065.1| Dictyostelium discoideum hypothetical protein (DDB0189398), partial mRNA Length = 5424 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 29 tcaaataaaaattcttcaa 47 ||||||||||||||||||| Sbjct: 5380 tcaaataaaaattcttcaa 5398
>ref|XM_633941.1| Dictyostelium discoideum WD-40 repeat-containing protein (DDB0229872), partial mRNA Length = 2757 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 29 tcaaataaaaattcttcaa 47 ||||||||||||||||||| Sbjct: 1489 tcaaataaaaattcttcaa 1507
>gb|AC125346.4| Mus musculus BAC clone RP24-87B17 from chromosome 5, complete sequence Length = 187912 Score = 38.2 bits (19), Expect = 5.4 Identities = 22/23 (95%) Strand = Plus / Plus Query: 25 atcttcaaataaaaattcttcaa 47 |||| |||||||||||||||||| Sbjct: 58561 atctgcaaataaaaattcttcaa 58583
>gb|BT014208.1| Lycopersicon esculentum clone 133385R, mRNA sequence Length = 958 Score = 38.2 bits (19), Expect = 5.4 Identities = 44/51 (86%), Gaps = 1/51 (1%) Strand = Plus / Minus Query: 63 ccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 |||||||||| |||| ||||| || ||||| ||||||||||| | |||||| Sbjct: 835 ccggggacaa-agtttgtggcgaaagcccaggcattgttgtttacggggtc 786
>emb|AL354995.13| Human DNA sequence from clone RP11-512J14 on chromosome 13 Contains the 3' end of the DACH gene for dachshund homolog (Drosophila) (DACH1, FLJ10138), complete sequence Length = 149582 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 90 ccatgcattgttgttgatg 108 ||||||||||||||||||| Sbjct: 2483 ccatgcattgttgttgatg 2465
>gb|AC116546.1| Homo sapiens 3 BAC RP11-312H1 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 160421 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 69 acaagagttggtggcaaac 87 ||||||||||||||||||| Sbjct: 116482 acaagagttggtggcaaac 116464
>emb|BX088585.4| Mouse DNA sequence from clone RP23-185A14 on chromosome 4, complete sequence Length = 43212 Score = 38.2 bits (19), Expect = 5.4 Identities = 22/23 (95%) Strand = Plus / Plus Query: 25 atcttcaaataaaaattcttcaa 47 |||| |||||||||||||||||| Sbjct: 5511 atctgcaaataaaaattcttcaa 5533
>gb|AC106881.9| Homo sapiens BAC clone RP11-710C12 from 4, complete sequence Length = 150889 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 24 aatcttcaaataaaaattc 42 ||||||||||||||||||| Sbjct: 78714 aatcttcaaataaaaattc 78732
>dbj|AK044414.1| Mus musculus adult retina cDNA, RIKEN full-length enriched library, clone:A930011G23 product:hypothetical protein, full insert sequence Length = 2525 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 30 caaataaaaattcttcaag 48 ||||||||||||||||||| Sbjct: 1442 caaataaaaattcttcaag 1460
>gb|AC114625.11| Mus musculus chromosome 3, clone RP24-107N14, complete sequence Length = 160025 Score = 38.2 bits (19), Expect = 5.4 Identities = 22/23 (95%) Strand = Plus / Minus Query: 22 acaatcttcaaataaaaattctt 44 |||||||| |||||||||||||| Sbjct: 66282 acaatctttaaataaaaattctt 66260
>gb|AY660566.1| Huperzia lucidula chloroplast, complete genome Length = 154373 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 26 tcttcaaataaaaattctt 44 ||||||||||||||||||| Sbjct: 124803 tcttcaaataaaaattctt 124821
>emb|BX470163.8| Zebrafish DNA sequence from clone DKEY-27A9 in linkage group 18, complete sequence Length = 241301 Score = 38.2 bits (19), Expect = 5.4 Identities = 22/23 (95%) Strand = Plus / Plus Query: 22 acaatcttcaaataaaaattctt 44 |||||||||||| |||||||||| Sbjct: 186577 acaatcttcaaaaaaaaattctt 186599
>emb|X56538.1|PSCABIIC P.sativum Cab-8 gene for photosystemm II chlorophyll a/b binding protein Length = 2236 Score = 38.2 bits (19), Expect = 5.4 Identities = 28/31 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgtt 104 ||||||||||| | | ||||||||||||||| Sbjct: 2100 agttggtggcatatgaccatgcattgttgtt 2070
>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein Length = 963 Score = 38.2 bits (19), Expect = 5.4 Identities = 28/31 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgtt 104 |||| |||||||| ||||| ||||||||||| Sbjct: 820 agttagtggcaaaggcccaggcattgttgtt 790
>emb|X16535.1|GMCAB4 G.max DNA for Cab4 Length = 1470 Score = 38.2 bits (19), Expect = 5.4 Identities = 41/47 (87%), Gaps = 1/47 (2%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgtt 104 |||| |||||||||| |||| |||||| | ||||| ||||||||||| Sbjct: 1123 actttccggggacaa-agtttgtggcataggcccaagcattgttgtt 1078
>emb|BX784024.10| Zebrafish DNA sequence from clone CH211-239J19 in linkage group 18, complete sequence Length = 110791 Score = 38.2 bits (19), Expect = 5.4 Identities = 22/23 (95%) Strand = Plus / Minus Query: 22 acaatcttcaaataaaaattctt 44 |||||||||||| |||||||||| Sbjct: 42228 acaatcttcaaaaaaaaattctt 42206
>gb|AC159739.3| Mus musculus BAC clone RP23-442O9 from chromosome 9, complete sequence Length = 207308 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 22 acaatcttcaaataaaaat 40 ||||||||||||||||||| Sbjct: 67651 acaatcttcaaataaaaat 67669
>gb|AC132257.5| Mus musculus BAC clone RP24-361A4 from 5, complete sequence Length = 171729 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 30 caaataaaaattcttcaag 48 ||||||||||||||||||| Sbjct: 81493 caaataaaaattcttcaag 81511
>gb|AC126450.4| Mus musculus BAC clone RP23-379J7 from 3, complete sequence Length = 159914 Score = 38.2 bits (19), Expect = 5.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 75 gttggtggcaaacgcccat 93 ||||||||||||||||||| Sbjct: 127196 gttggtggcaaacgcccat 127178
>dbj|AP004473.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT10J15, TM0007, complete sequence Length = 92741 Score = 38.2 bits (19), Expect = 5.4 Identities = 28/31 (90%) Strand = Plus / Plus Query: 74 agttggtggcaaacgcccatgcattgttgtt 104 ||||||||||| | ||||| ||||||||||| Sbjct: 65576 agttggtggcataggcccaggcattgttgtt 65606
>emb|X14341.1|SOCABP S.oleracea chloroplast mRNA for chlorophyll a/b binding protein Length = 980 Score = 38.2 bits (19), Expect = 5.4 Identities = 41/47 (87%), Gaps = 1/47 (2%) Strand = Plus / Minus Query: 58 acttgccggggacaagagttggtggcaaacgcccatgcattgttgtt 104 |||| |||||||||| ||||||||||||| ||| ||||||||||| Sbjct: 851 actttccggggacaa-agttggtggcaaagttccaagcattgttgtt 806
>gb|U01964.1|GMU01964 Glycine max cv. Dare photosystem II type I chlorophyll a/b-binding protein (lhcb1*7) gene, complete cds Length = 1882 Score = 38.2 bits (19), Expect = 5.4 Identities = 37/43 (86%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttgatggggtcagc 116 |||| |||||| | ||||| ||||||||||||| |||||||| Sbjct: 1535 agtttgtggcataagcccaagcattgttgttgactgggtcagc 1493
>gb|M14443.1|TOMCBPA Tomato chlorophyll a/b-binding protein gene Cab-1B, complete cds Length = 1253 Score = 38.2 bits (19), Expect = 5.4 Identities = 44/51 (86%), Gaps = 1/51 (1%) Strand = Plus / Minus Query: 63 ccggggacaagagttggtggcaaacgcccatgcattgttgttgatggggtc 113 |||||||||| |||| ||||| || ||||| ||||||||||| | |||||| Sbjct: 981 ccggggacaa-agtttgtggcgaaagcccaggcattgttgtttacggggtc 932
>gb|M86906.1|PEACHLROPH Pea (subclone AB9) Cab9 gene, 3' end Length = 1919 Score = 38.2 bits (19), Expect = 5.4 Identities = 28/31 (90%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgtt 104 |||| |||||| | ||||||||||||||||| Sbjct: 568 agtttgtggcatatgcccatgcattgttgtt 538
>gb|M16058.1|CUSLHCPB Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein, partial cds Length = 748 Score = 38.2 bits (19), Expect = 5.4 Identities = 37/43 (86%) Strand = Plus / Minus Query: 74 agttggtggcaaacgcccatgcattgttgttgatggggtcagc 116 |||| |||||| | ||||| ||||||||||||| |||||||| Sbjct: 606 agtttgtggcatatgcccaagcattgttgttgactgggtcagc 564 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,270,565 Number of Sequences: 3902068 Number of extensions: 1270565 Number of successful extensions: 94481 Number of sequences better than 10.0: 109 Number of HSP's better than 10.0 without gapping: 73 Number of HSP's successfully gapped in prelim test: 37 Number of HSP's that attempted gapping in prelim test: 94358 Number of HSP's gapped (non-prelim): 219 length of query: 117 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 96 effective length of database: 17,151,101,840 effective search space: 1646505776640 effective search space used: 1646505776640 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)