Clone Name	rbasd18n03
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene	882	0.0
2	emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid tra...	686	0.0
3	emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene	640	e-180
4	gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt...	640	e-180
5	emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA	617	e-173
6	gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer prote...	607	e-170
7	emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA	500	e-138
8	emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non sp...	396	e-107
9	emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific l...	381	e-102
10	emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non sp...	381	e-102
11	gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid...	377	e-101
12	gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipi...	377	e-101
13	emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for ...	351	2e-93
14	gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipi...	311	2e-81
15	gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) g...	226	7e-56
16	gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein ...	226	7e-56
17	gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein ...	226	7e-56
18	emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non sp...	226	7e-56
19	gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) m...	218	2e-53
20	gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4)...	210	4e-51
21	gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) m...	210	4e-51
22	gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid...	202	1e-48
23	emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid tr...	176	6e-41
24	emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA	163	9e-37
25	emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA	117	5e-23
26	gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome...	111	3e-21
27	dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D...	111	3e-21
28	dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clon...	111	3e-21
29	dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clon...	111	3e-21
30	gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome...	111	3e-21
31	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	107	5e-20
32	emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15	107	5e-20
33	dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clon...	107	5e-20
34	gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome...	107	5e-20
35	emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136...	107	5e-20
36	gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid tran...	100	1e-17
37	emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein	100	1e-17
38	dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clon...	100	1e-17
39	dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clon...	100	1e-17
40	emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa...	100	1e-17
41	gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) m...	100	1e-17
42	gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT I...	92	3e-15
43	gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT I...	92	3e-15
44	gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid tran...	80	1e-11
45	emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, comp...	80	1e-11
46	emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA	80	1e-11
47	emb|X71667.1|SVLTP1 S.vulgare ltp1 gene	80	1e-11
48	emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1	80	1e-11
49	dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clon...	80	1e-11
50	dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clon...	80	1e-11
51	gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT I...	80	1e-11
52	gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA,...	78	4e-11
53	emb|X71668.1|SVLTP2 S.vulgare ltp2 gene	76	2e-10
54	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	76	2e-10
55	dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic D...	76	2e-10
56	gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA...	72	3e-09
57	gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transf...	72	3e-09
58	gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfe...	72	3e-09
59	gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transf...	72	3e-09
60	gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholi...	72	3e-09
61	gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholip...	72	3e-09
62	gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transf...	72	3e-09
63	gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfe...	72	3e-09
64	gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transf...	72	3e-09
65	gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfe...	72	3e-09
66	gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfe...	72	3e-09
67	gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfe...	72	3e-09
68	gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transf...	72	3e-09
69	gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transf...	72	3e-09
70	gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfe...	72	3e-09
71	gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transf...	72	3e-09
72	gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transf...	72	3e-09
73	gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholi...	72	3e-09
74	gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholi...	72	3e-09
75	gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholi...	72	3e-09
76	gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phosphol...	72	3e-09
77	gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholi...	72	3e-09
78	gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholip...	72	3e-09
79	gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholip...	72	3e-09
80	gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholi...	72	3e-09
81	gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholi...	72	3e-09
82	gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholip...	72	3e-09
83	gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholip...	72	3e-09
84	gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholip...	72	3e-09
85	dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clon...	70	1e-08
86	dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
87	dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
88	dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
89	dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clon...	68	4e-08
90	gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence	64	6e-07
91	gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precurs...	64	6e-07
92	gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfe...	64	6e-07
93	gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholi...	64	6e-07
94	gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholi...	64	6e-07
95	gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholi...	64	6e-07
96	gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phosphol...	64	6e-07
97	gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholip...	64	6e-07
98	gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholip...	64	6e-07
99	gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholip...	64	6e-07
100	gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholip...	64	6e-07
101	gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholip...	64	6e-07
102	gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phosphol...	64	6e-07
103	gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholip...	64	6e-07
104	gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3...	64	6e-07
105	gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, co...	64	6e-07
106	gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholip...	56	2e-04
107	gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid...	50	0.009
108	gb|BC045114.1| Mus musculus cyclic nucleotide gated channel beta...	44	0.58
109	gb|AC182436.1| Mus musculus chromosome 5, clone wi1-1982K15, com...	44	0.58
110	gb|AC102518.11| Mus musculus chromosome 8, clone RP24-502J8, com...	44	0.58
111	gb|AC159631.2| Mus musculus BAC clone RP24-177F21 from chromosom...	42	2.3
112	emb|AL590822.36| Human DNA sequence from clone RP11-181G12 on ch...	42	2.3
113	emb|AL158158.14| Human DNA sequence from clone RP11-427L11 on ch...	42	2.3
114	gb|AF548001.1| Homo sapiens thioredoxin (TXN) gene, complete cds	42	2.3
115	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	42	2.3
116	dbj|AP004073.2| Oryza sativa (japonica cultivar-group) genomic D...	42	2.3
117	dbj|AP003687.3| Oryza sativa (japonica cultivar-group) genomic D...	42	2.3
118	dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	2.3
119	dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	2.3
120	gb|AY109327.1| Zea mays CL468_1 mRNA sequence	42	2.3
121	emb|X54541.1|HSTRXE4E5 H.sapiens Trx gene for thioredoxin, exon ...	42	2.3
122	emb|X70288.1|HSTHDC H.sapiens gene for thioredoxin, exons 4 and 5	42	2.3
123	gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholip...	42	2.3
124	gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome	40	9.1
125	gb|AC105067.8| Mus musculus chromosome 18, clone RP23-232D3, com...	40	9.1
126	gb|AC141628.2| Mus musculus BAC clone RP24-358E15 from chromosom...	40	9.1
127	gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete s...	40	9.1
128	emb|AL590110.11| Human DNA sequence from clone RP11-254O21 on ch...	40	9.1
129	emb|AL356305.11| Human DNA sequence from clone RP11-109K20 on ch...	40	9.1
130	emb|AL157829.24| Human DNA sequence from clone RP11-305F14 on ch...	40	9.1
131	gb|AC130187.4| Atelerix albiventris clone LB4-344F17, complete s...	40	9.1
132	dbj|AK056395.1| Homo sapiens cDNA FLJ31833 fis, clone NT2RP6000130	40	9.1
133	gb|AC117458.3| Homo sapiens 3 BAC RP11-345M4 (Roswell Park Cance...	40	9.1
134	gb|AC110774.3| Homo sapiens BAC clone RP11-254A24 from 4, comple...	40	9.1
135	gb|AC021183.6| Homo sapiens BAC clone RP11-737D22 from 4, comple...	40	9.1
136	gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold	40	9.1
137	emb|BX649439.8| Zebrafish DNA sequence from clone DKEY-21A8 in l...	40	9.1
138	gb|AC044817.5|AC044817 Homo sapiens, clone RP11-197P20, complete...	40	9.1
139	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	40	9.1
140	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	40	9.1
141	emb|AL662967.2|OSJN00166 Oryza sativa genomic DNA, chromosome 4,...	40	9.1
142	gb|AC091182.5| Homo sapiens chromosome 8, clone RP11-527N22, com...	40	9.1
143	gb|AC148962.4| Atelerix albiventris clone LB4-372K23, complete s...	40	9.1
144	dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic D...	40	9.1
145	dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic D...	40	9.1
146	gb|AC131741.4| Mus musculus BAC clone RP23-66E21 from 7, complet...	40	9.1
147	dbj|AP006306.1| Homo sapiens genomic DNA, chromosome 8 clone:RP1...	40	9.1
148	dbj|AP006304.1| Homo sapiens genomic DNA, chromosome 8 clone:RP1...	40	9.1
149	emb|AL662931.10| Mouse DNA sequence from clone RP23-24M17 on chr...	40	9.1
150	dbj|AP000070.1| Homo sapiens genomic DNA, chromosome 8p11.2, sen...	40	9.1

---

>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene
          Length = 1862

 Score =  882 bits (445), Expect = 0.0
 Identities = 452/453 (99%), Gaps = 1/453 (0%)
 Strand = Plus / Minus

                                                                        
Query: 214  aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 273
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1454 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 1395

                                                                        
Query: 274  tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 333
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1394 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 1335

                                                                        
Query: 334  gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 393
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1334 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 1275

                                                                        
Query: 394  gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 453
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1274 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 1215

                                                                        
Query: 454  gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 513
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1214 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 1155

                                                                        
Query: 514  taggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggt 573
            ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 1154 taggagatgcaagggctcaaggcagagctcacctgaccgcaggagatgg-ccgcgtcggt 1096

                                                                        
Query: 574  ggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcg 633
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1095 ggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcg 1036

                                             
Query: 634  agccatttcgatcacaagctagcaatagtagtg 666
            |||||||||||||||||||||||||||||||||
Sbjct: 1035 agccatttcgatcacaagctagcaatagtagtg 1003



 Score =  252 bits (127), Expect = 1e-63
 Identities = 134/135 (99%), Gaps = 1/135 (0%)
 Strand = Plus / Minus

                                                                        
Query: 2    tatgatacatatat-aaaagtgcacatggtacaaagtacaacaaactcacgattcctctc 60
            |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1667 tatgatacatatatcaaaagtgcacatggtacaaagtacaacaaactcacgattcctctc 1608

                                                                        
Query: 61   aaaggaagtaaatattaattataacatcgatacaacagtgtgccggccatgcagagctgg 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1607 aaaggaagtaaatattaattataacatcgatacaacagtgtgccggccatgcagagctgg 1548

                           
Query: 121  ctcaacgtacgtact 135
            |||||||||||||||
Sbjct: 1547 ctcaacgtacgtact 1533



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 40/40 (100%)
 Strand = Plus / Minus

                                                    
Query: 156  ccacatggagataatatatgagagcatttattcatatata 195
            ||||||||||||||||||||||||||||||||||||||||
Sbjct: 1512 ccacatggagataatatatgagagcatttattcatatata 1473

---

>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor
          Length = 691

 Score =  686 bits (346), Expect = 0.0
 Identities = 413/434 (95%), Gaps = 1/434 (0%)
 Strand = Plus / Minus

                                                                       
Query: 214 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 273
           ||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||
Sbjct: 439 aaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggcagcaagga 380

                                                                       
Query: 274 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 333
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 379 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 320

                                                                       
Query: 334 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 393
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 319 gggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccc 260

                                                                       
Query: 394 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 453
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 259 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctgcgccg 200

                                                                       
Query: 454 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 513
           |||| |||||||||||||||||||||||||  |||| |  || |||||||||||| ||||
Sbjct: 199 gccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggca 140

                                                                       
Query: 514 taggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggt 573
           ||||| ||||| |||| |||||||||||||||||||||||||||||||| | ||||||| 
Sbjct: 139 taggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatgg-ctgcgtcggc 81

                                                                       
Query: 574 ggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcg 633
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||
Sbjct: 80  ggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagaacg 21

                         
Query: 634 agccatttcgatca 647
            |||||||||||||
Sbjct: 20  ggccatttcgatca 7



 Score =  180 bits (91), Expect = 4e-42
 Identities = 116/124 (93%), Gaps = 4/124 (3%)
 Strand = Plus / Minus

                                                                       
Query: 16  aaaagtgcacatggtacaaagtacaacaaactcacgattcctctcaaaggaagtaaatat 75
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 650 aaaagtgcacatggtacaaagtacaacaaactcacgattcctctcaaaggaagtaaatat 591

                                                                       
Query: 76  taatta----taacatcgatacaacagtgtgccggccatgcagagctggctcaacgtacg 131
            |||||    ||||||||||||||||| |||  |||||||||||||||||||||||||||
Sbjct: 590 aaattataattaacatcgatacaacagagtgttggccatgcagagctggctcaacgtacg 531

               
Query: 132 tact 135
           ||||
Sbjct: 530 tact 527



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 40/40 (100%)
 Strand = Plus / Minus

                                                   
Query: 156 ccacatggagataatatatgagagcatttattcatatata 195
           ||||||||||||||||||||||||||||||||||||||||
Sbjct: 510 ccacatggagataatatatgagagcatttattcatatata 471

---

>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene
          Length = 1567

 Score =  640 bits (323), Expect = e-180
 Identities = 354/363 (97%), Gaps = 1/363 (0%)
 Strand = Plus / Minus

                                                                        
Query: 277  cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 336
            ||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 1026 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 967

                                                                        
Query: 337  acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 396
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 966  acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 907

                                                                        
Query: 397  gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 456
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 906  gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 847

                                                                        
Query: 457  agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 516
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 846  agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 787

                                                                        
Query: 517  gagatgcaagggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggtggc 576
            |||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| ||
Sbjct: 786  gagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg-ccgcgtcggtagc 728

                                                                        
Query: 577  tacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagc 636
            ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 727  tacgatgagcatggcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagc 668

               
Query: 637  cat 639
            |||
Sbjct: 667  cat 665



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 44/49 (89%), Gaps = 1/49 (2%)
 Strand = Plus / Minus

                                                             
Query: 2    tatgatacatatataaa-agtgcacatggtacaaagtacaacaaactca 49
            |||||| ||||||| || |||||||||| |||||||||||| |||||||
Sbjct: 1269 tatgatccatatatcaacagtgcacatgttacaaagtacaataaactca 1221



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 102  gccggccatgcagagctggctcaacgtacg 131
            |||||||||||||| |||||||||| ||||
Sbjct: 1167 gccggccatgcagaactggctcaacatacg 1138

---

>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds
          Length = 3238

 Score =  640 bits (323), Expect = e-180
 Identities = 354/363 (97%), Gaps = 1/363 (0%)
 Strand = Plus / Minus

                                                                        
Query: 277  cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 336
            ||||||||||| ||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 2422 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 2363

                                                                        
Query: 337  acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 396
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2362 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 2303

                                                                        
Query: 397  gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 456
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2302 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 2243

                                                                        
Query: 457  agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 516
            ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2242 agtctcttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 2183

                                                                        
Query: 517  gagatgcaagggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggtggc 576
            |||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| ||
Sbjct: 2182 gagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg-ccgcgtcggtagc 2124

                                                                        
Query: 577  tacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagc 636
            ||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2123 tacgatgagcatggcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagc 2064

               
Query: 637  cat 639
            |||
Sbjct: 2063 cat 2061



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 44/49 (89%), Gaps = 1/49 (2%)
 Strand = Plus / Minus

                                                             
Query: 2    tatgatacatatataaa-agtgcacatggtacaaagtacaacaaactca 49
            |||||| ||||||| || |||||||||| |||||||||||| |||||||
Sbjct: 2665 tatgatccatatatcaacagtgcacatgttacaaagtacaataaactca 2617



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 102  gccggccatgcagagctggctcaacgtacg 131
            |||||||||||||| |||||||||| ||||
Sbjct: 2563 gccggccatgcagaactggctcaacatacg 2534

---

>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA
          Length = 705

 Score =  617 bits (311), Expect = e-173
 Identities = 351/363 (96%), Gaps = 1/363 (0%)
 Strand = Plus / Minus

                                                                       
Query: 277 cagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 336
           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 421 cagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 362

                                                                       
Query: 337 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 396
           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||
Sbjct: 361 acgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagca 302

                                                                       
Query: 397 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcc 456
           ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 301 gcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggcc 242

                                                                       
Query: 457 agtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatag 516
           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 241 agtctcttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcatag 182

                                                                       
Query: 517 gagatgcaagggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggtggc 576
           |||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |||
Sbjct: 181 gagatgcaggggctcaaggcagagctcacctgaccgcaggagatgg-ccgcgtcggcggc 123

                                                                       
Query: 577 tacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagc 636
           |||||||||||| |||||||||| ||||||||||||||||||| ||||||||||||||||
Sbjct: 122 tacgaggagcatggcggccaccagggcgaccagcacgagctgactagctgcagcgcgagc 63

              
Query: 637 cat 639
           |||
Sbjct: 62  cat 60



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 171 atatgagagcatttattcatatata 195
           |||||||||||||||||||||||||
Sbjct: 498 atatgagagcatttattcatatata 474



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 43/48 (89%), Gaps = 1/48 (2%)
 Strand = Plus / Minus

                                                           
Query: 2   tatgatacatatataaa-agtgcacatggtacaaagtacaacaaactc 48
           |||||| ||||||| || ||||||||||||||||| ||||| ||||||
Sbjct: 683 tatgattcatatatcaacagtgcacatggtacaaaatacaataaactc 636



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 102 gccggccatgcagagctggctcaac 126
           |||||||||||||| ||||||||||
Sbjct: 581 gccggccatgcagaactggctcaac 557

---

>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene,
           complete cds
          Length = 573

 Score =  607 bits (306), Expect = e-170
 Identities = 418/453 (92%), Gaps = 3/453 (0%)
 Strand = Plus / Minus

                                                                       
Query: 214 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 273
           ||||||||||||||||||||| ||||||| |||||||||||||||||||||||| || ||
Sbjct: 510 aaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggcagaaacga 451

                                                                       
Query: 274 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 333
            | |||||||||||||||||| |||||||||||||||||||||||| |||||||| ||||
Sbjct: 450 cggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtag 391

                                                                       
Query: 334 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 393
           |||||||||||||||||| |||||||||| |||||||||||||||||||||| |||| | 
Sbjct: 390 gggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcg 331

                                                                       
Query: 394 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccg 453
           |||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||
Sbjct: 330 gcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccg 271

                                                                       
Query: 454 gccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggca 513
           |||| |||||||||||||||||||||||||  |||| |  || |||||||||||| ||||
Sbjct: 270 gccaatctcttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggca 211

                                                                       
Query: 514 taggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggt 573
           ||||| ||||| |||| |||||||||||||||||||||||||||||||| | ||||||| 
Sbjct: 210 taggaaatgcaggggcgcaaggcagagctcacctgaccgcaggagatgg-ctgcgtcggc 152

                                                                       
Query: 574 ggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcg 633
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||
Sbjct: 151 ggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagaacg 92

                                            
Query: 634 agccatttcgatcacaagctagcaatagtagtg 666
            |||||||||||  |||||||||||||||||||
Sbjct: 91  ggccatttcgat--caagctagcaatagtagtg 61



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 33/34 (97%)
 Strand = Plus / Minus

                                             
Query: 162 ggagataatatatgagagcatttattcatatata 195
           ||||||||||||||||| ||||||||||||||||
Sbjct: 573 ggagataatatatgagatcatttattcatatata 540

---

>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA
          Length = 660

 Score =  500 bits (252), Expect = e-138
 Identities = 265/268 (98%), Gaps = 1/268 (0%)
 Strand = Plus / Minus

                                                                       
Query: 399 gctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 458
           |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226

                                                                       
Query: 459 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 518
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 225 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 166

                                                                       
Query: 519 gatgcaagggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggtggcta 578
           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 165 gatgcaagggctcaaggcagagctcacctgaccgcaggagatgg-ccgcgtcggtggcta 107

                                                                       
Query: 579 cgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagcca 638
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 106 cgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagcca 47

                                       
Query: 639 tttcgatcacaagctagcaatagtagtg 666
           ||||||||||||||||||||||||||||
Sbjct: 46  tttcgatcacaagctagcaatagtagtg 19

---

>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2122

 Score =  396 bits (200), Expect = e-107
 Identities = 348/395 (88%), Gaps = 3/395 (0%)
 Strand = Plus / Minus

                                                                        
Query: 272  gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 331
            |||| ||||||||| |||||||||||||||||||||||||||| |||| |||||||||||
Sbjct: 1636 gatggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 1577

                                                                        
Query: 332  aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 391
            |||||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| 
Sbjct: 1576 aggggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 1517

                                                                        
Query: 392  ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 451
            | |||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||
Sbjct: 1516 cagcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 1457

                                                                        
Query: 452  cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 511
             ||| || ||| | |||||||||||||||||| |||  ||  |||||||||||||||| |
Sbjct: 1456 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 1397

                                                                        
Query: 512  cataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcg 571
            ||||||||||||| ||||||||||||||||||||||||||||| || |  | |||| || 
Sbjct: 1396 cataggagatgcaggggctcaaggcagagctcacctgaccgcacgatacag-ccgcctcc 1338

                                                                        
Query: 572  gtggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcg 631
            ||| || ||||||||||||||||||||| |||||| ||||||| ||||| | | ||||  
Sbjct: 1337 gtgactgcgaggagcatagcggccaccacggcgacgagcacgacctgagcaacagcagaa 1278

                                               
Query: 632  cgagccatttcgatcacaagctagcaatagtagtg 666
            || ||||| |||||  |||||||||||||||||||
Sbjct: 1277 cgggccatctcgat--caagctagcaatagtagtg 1245



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 37/38 (97%), Gaps = 1/38 (2%)
 Strand = Plus / Minus

                                                  
Query: 83   aacatcgatacaacagtgt-gccggccatgcagagctg 119
            ||||||||||||||||||| ||||||||||||||||||
Sbjct: 1819 aacatcgatacaacagtgtggccggccatgcagagctg 1782



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 16   aaaagtgcacatggtacaaagtaca 40
            |||||| ||||||||||||||||||
Sbjct: 1872 aaaagtacacatggtacaaagtaca 1848



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 171  atatgagagcatttattcata 191
            |||||||||||||||||||||
Sbjct: 1745 atatgagagcatttattcata 1725

---

>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer
           protein precursor (ltp9.2 gene)
          Length = 708

 Score =  381 bits (192), Expect = e-102
 Identities = 346/395 (87%), Gaps = 3/395 (0%)
 Strand = Plus / Minus

                                                                       
Query: 272 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 331
           |||| ||||| ||| |||||||||||||||||||||||||||| |||| |||||||||||
Sbjct: 433 gatggcagcatgtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 374

                                                                       
Query: 332 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 391
           |||||| ||| ||||||||| | | |||||| |||||||||||||||||||| |||||| 
Sbjct: 373 aggggatgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 314

                                                                       
Query: 392 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 451
           | |||||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||
Sbjct: 313 cagcagcgctcttgatacacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 254

                                                                       
Query: 452 cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 511
            ||| || ||| | |||||||||||||||||| ||| |||  |||||||||||||||| |
Sbjct: 253 tggctagactcctaacgccgctgcagcaggccgcagacgggctggcgccgttgccgcgtg 194

                                                                       
Query: 512 cataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcg 571
           ||||||||||||| ||||||||||||||||||||||||||||| || |  | |||| || 
Sbjct: 193 cataggagatgcaggggctcaaggcagagctcacctgaccgcacgatacag-ccgcctcc 135

                                                                       
Query: 572 gtggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcg 631
           ||| || ||||||||||||||||||||| |||||| ||||||| ||||| | | ||||  
Sbjct: 134 gtgactgcgaggagcatagcggccaccacggcgacgagcacgacctgagcaacagcagaa 75

                                              
Query: 632 cgagccatttcgatcacaagctagcaatagtagtg 666
           || ||||| |||||  |||||||||||||||||||
Sbjct: 74  cgggccatctcgat--caagctagcaatagtagtg 42



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 49/54 (90%), Gaps = 1/54 (1%)
 Strand = Plus / Minus

                                                                 
Query: 83  aacatcgatacaacagtgtg-ccggccatgcagagctggctcaacgtacgtact 135
           |||||||||||||||||||| |||||||||||||||||  |  |||||||||||
Sbjct: 619 aacatcgatacaacagtgtggccggccatgcagagctgcttggacgtacgtact 566



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 169 atatatgagagcatttattcatatata 195
           |||||||||||||||||||||||||||
Sbjct: 542 atatatgagagcatttattcatatata 516



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 16  aaaagtgcacatggtacaaagtacaacaaactc 48
           |||||| |||||||||||||||||| |||||||
Sbjct: 672 aaaagtacacatggtacaaagtacagcaaactc 640

---

>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2087

 Score =  381 bits (192), Expect = e-102
 Identities = 346/395 (87%), Gaps = 3/395 (0%)
 Strand = Plus / Minus

                                                                        
Query: 272  gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 331
            |||| ||||||||| |||||||| ||||||||||||||||||| |||| |||||||||||
Sbjct: 1624 gatggcagcaagtgctcgatcagtgaatcttagagcagtcgaccgaagagctgatggcgt 1565

                                                                        
Query: 332  aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 391
            |||||||||| ||||||||| | | |||||| ||||||||||||||||| || |||||| 
Sbjct: 1564 aggggacgctaacgccgcactttgtggggatgccggcggccttgccagcattgagcccag 1505

                                                                        
Query: 392  ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 451
            | |||||||||||||||||||||||| ||||||||||||||||||||||| |||||| ||
Sbjct: 1504 cagcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctccgggctgagc 1445

                                                                        
Query: 452  cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 511
             ||| || ||| | |||||||||||||||||| |||  ||  |||||||||||||||| |
Sbjct: 1444 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 1385

                                                                        
Query: 512  cataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcg 571
            ||||||||||||| ||||||||||||||||||||||||||||| || | || |||| || 
Sbjct: 1384 cataggagatgcaggggctcaaggcagagctcacctgaccgcacgatacgg-ccgcctcc 1326

                                                                        
Query: 572  gtggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcagcg 631
            ||| || ||||||||||||||||||||| |||||| ||||||| ||||| | | ||||  
Sbjct: 1325 gtgactgcgaggagcatagcggccaccacggcgacgagcacgacctgagcaacagcagaa 1266

                                               
Query: 632  cgagccatttcgatcacaagctagcaatagtagtg 666
            || ||||| |||||  |||||||||||||||||||
Sbjct: 1265 cgggccatctcgat--caagctagcaatagtagtg 1233



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 36/38 (94%), Gaps = 1/38 (2%)
 Strand = Plus / Minus

                                                  
Query: 83   aacatcgatacaacagtgtg-ccggccatgcagagctg 119
            |||||||||| ||||||||| |||||||||||||||||
Sbjct: 1807 aacatcgatataacagtgtggccggccatgcagagctg 1770



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 171  atatgagagcatttattcatatata 195
            |||||||||||||||||||||||||
Sbjct: 1733 atatgagagcatttattcatatata 1709



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 16   aaaagtgcacatggtacaaagtaca 40
            |||||| ||||||||||||||||||
Sbjct: 1860 aaaagtacacatggtacaaagtaca 1836

---

>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  377 bits (190), Expect = e-101
 Identities = 296/330 (89%), Gaps = 1/330 (0%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 350
           |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 351 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 410
           | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 411 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgcc 470
           ||||||||||||||||||||||||||||||| |||||| || ||| || ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 471 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggct 530
           ||||||||||||| ||| ||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 531 caaggcagagctcacctgaccgcaggagatggcccgcgtcggtggctacgaggagcatag 590
           |||||||||||||||||||||||| || | || |||| || |||||| ||||||||||||
Sbjct: 108 caaggcagagctcacctgaccgcacgatacgg-ccgcctccgtggctgcgaggagcatag 50

                                         
Query: 591 cggccaccatggcgaccagcacgagctgag 620
           ||||||||| |||||| ||||||| |||||
Sbjct: 49  cggccaccacggcgacgagcacgacctgag 20

---

>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  377 bits (190), Expect = e-101
 Identities = 296/330 (89%), Gaps = 1/330 (0%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 350
           |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 351 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 410
           | | | |||||| || ||||||||||||||||| |||||| | |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 411 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgcc 470
           ||||||||||||||||||||||||||||||| |||||| || ||| || ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                                                                       
Query: 471 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggct 530
           ||||||||||||| ||| ||| ||||||||||||||||| |||||||||||||| |||||
Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 531 caaggcagagctcacctgaccgcaggagatggcccgcgtcggtggctacgaggagcatag 590
           |||||||||||||||||||||||| || | || |||| || |||||| ||||||||||||
Sbjct: 108 caaggcagagctcacctgaccgcacgatacgg-ccgcctccgtggctgcgaggagcatag 50

                                         
Query: 591 cggccaccatggcgaccagcacgagctgag 620
           ||||||||| |||||| ||||||| |||||
Sbjct: 49  cggccaccacggcgacgagcacgacctgag 20

---

>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific
           lipid transfer protein precursor (ltp9.2 gene)
          Length = 604

 Score =  351 bits (177), Expect = 2e-93
 Identities = 295/333 (88%), Gaps = 1/333 (0%)
 Strand = Plus / Minus

                                                                       
Query: 272 gatgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 331
           |||| ||||||||| |||||||||||||||||||||||||||| |||| |||||||||||
Sbjct: 332 gatggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 273

                                                                       
Query: 332 aggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccac 391
           | |||||||| ||||||||| | | |||||| |||||||||||||||||||| |||||| 
Sbjct: 272 aagggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 213

                                                                       
Query: 392 ccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgc 451
           | |||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||
Sbjct: 212 cagcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctgagc 153

                                                                       
Query: 452 cggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcggg 511
            ||| || ||| | |||||||||||||||||| |||  ||  |||||||||||||||| |
Sbjct: 152 tggctagactcctaacgccgctgcagcaggccgcagatgggctggcgccgttgccgcgtg 93

                                                                       
Query: 512 cataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcg 571
           ||||||||||||| ||||||||||||||||||||||||||||| || |  | |||| || 
Sbjct: 92  cataggagatgcaggggctcaaggcagagctcacctgaccgcacgatacag-ccgcctcc 34

                                            
Query: 572 gtggctacgaggagcatagcggccaccatggcg 604
           ||| || ||||||||||||| ||||||| ||||
Sbjct: 33  gtgactgcgaggagcatagcagccaccacggcg 1



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 49/54 (90%), Gaps = 1/54 (1%)
 Strand = Plus / Minus

                                                                 
Query: 83  aacatcgatacaacagtgtg-ccggccatgcagagctggctcaacgtacgtact 135
           |||||||||||||||||||| |||||||||||||||||  |  |||||||||||
Sbjct: 516 aacatcgatacaacagtgtggccggccatgcagagctgcttggacgtacgtact 463



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 16  aaaagtgcacatggtacaaagtacaacaaactc 48
           |||||| |||||||||||||||||| |||||||
Sbjct: 569 aaaagtacacatggtacaaagtacagcaaactc 537



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 171 atatgagagcatttattcatatata 195
           |||||||||||||||||||||||||
Sbjct: 437 atatgagagcatttattcatatata 413

---

>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  311 bits (157), Expect = 2e-81
 Identities = 302/349 (86%), Gaps = 1/349 (0%)
 Strand = Plus / Minus

                                                                       
Query: 291 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 350
           ||||||||||||||||||||| ||||| | ||| ||||||||||||| ||||||||||||
Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289

                                                                       
Query: 351 catggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgca 410
           | |||||||||| || |||||||| |||||||| |||||||| ||||| ||||| |||||
Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229

                                                                       
Query: 411 cttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgcc 470
           ||||||||||||||||||||||||||||||| | |||||||||||||| ||| |||| ||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgcgctgcgccggccagactcctgacacc 169

                                                                       
Query: 471 gctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggct 530
            |||||||||||| |||| ||  ||| |||| ||||||| |||||||||||||| |||||
Sbjct: 168 actgcagcaggccgcaggtgggctggagccgctgccgcgtgcataggagatgcaggggct 109

                                                                       
Query: 531 caaggcagagctcacctgaccgcaggagatggcccgcgtcggtggctacgaggagcatag 590
           |||||||||||||||||| || |||||||| | | ||||| ||||||  ||||| ||| |
Sbjct: 108 caaggcagagctcacctggccacaggagattg-cagcgtctgtggctgtgaggaccattg 50

                                                            
Query: 591 cggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 639
           | ||||| | || || || |||||| |||| ||||||||| || |||||
Sbjct: 49  ctgccacgagggtgaacaacacgagttgagcagctgcagcacgggccat 1

---

>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds
          Length = 3448

 Score =  226 bits (114), Expect = 7e-56
 Identities = 298/358 (83%), Gaps = 1/358 (0%)
 Strand = Plus / Minus

                                                                        
Query: 287  tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 346
            |||||||| | |||||||||||||| ||||| |||||||||| |||||||| ||||||||
Sbjct: 3208 tcgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgc 3149

                                                                        
Query: 347  cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 406
            ||||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||
Sbjct: 3148 cgcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttga 3089

                                                                        
Query: 407  tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 466
            ||||| |||| |||||||||||||| ||||||||| | |||  |||||||| |||| | |
Sbjct: 3088 tgcacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaa 3029

                                                                        
Query: 467  cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 526
            | |||   ||||||||| |||||||  |||| ||| ||||    || ||||||| ||| |
Sbjct: 3028 ctccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcagg 2969

                                                                        
Query: 527  ggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggtggctacgaggagc 586
             |  || ||||||| ||||||||||||||||||| | ||||||||| |||||| ||||||
Sbjct: 2968 aggccagggcagagttcacctgaccgcaggagatcg-ccgcgtcggaggctaccaggagc 2910

                                                                      
Query: 587  atagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccatttcga 644
            || || ||||||| |||||||||||||||||  || ||||||| ||||||||| ||||
Sbjct: 2909 attgccgccaccagggcgaccagcacgagctttgttgctgcagtgcgagccatctcga 2852



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 44/47 (93%), Gaps = 1/47 (2%)
 Strand = Plus / Minus

                                                           
Query: 89   gatacaacagtgtgccggccatgcagagctggctcaacgtacgtact 135
            |||||||||||| |||||| ||||||||||||||| |||||||||||
Sbjct: 3394 gatacaacagtg-gccggctatgcagagctggctcgacgtacgtact 3349

---

>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA,
           complete cds
          Length = 730

 Score =  226 bits (114), Expect = 7e-56
 Identities = 298/358 (83%), Gaps = 1/358 (0%)
 Strand = Plus / Minus

                                                                       
Query: 287 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 346
           |||||||| | |||||||||||||| ||||| |||||||| | |||||||||||||||||
Sbjct: 431 tcgatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgc 372

                                                                       
Query: 347 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 406
           ||||| ||||||| || || |||||||||   | ||| ||||| || ||| | |||||||
Sbjct: 371 cgcacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttga 312

                                                                       
Query: 407 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 466
            |||| |||| |  ||||||||||| ||||||||| | |||  |||||||| | || |||
Sbjct: 311 ggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctga 252

                                                                       
Query: 467 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 526
           ||||||||||||||||| ||| |||  |||  ||| ||||    ||||||| || ||| |
Sbjct: 251 cgccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagg 192

                                                                       
Query: 527 ggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggtggctacgaggagc 586
           || ||||||||||||||||||| ||||||  ||||| ||||||||| |||| |||||| |
Sbjct: 191 gggtcaaggcagagctcacctggccgcagctgatgg-ccgcgtcggaggctgcgaggatc 133

                                                                     
Query: 587 atagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccatttcga 644
           || || ||||||| ||||||||||||||||| ||||||||||| ||||||||| ||||
Sbjct: 132 attgccgccaccagggcgaccagcacgagcttagtagctgcagtgcgagccatctcga 75



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 24  acatggtacaaagtacaacaaactc 48
           |||| ||||||||||||||||||||
Sbjct: 680 acatcgtacaaagtacaacaaactc 656

---

>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA,
           complete cds
          Length = 737

 Score =  226 bits (114), Expect = 7e-56
 Identities = 298/358 (83%), Gaps = 1/358 (0%)
 Strand = Plus / Minus

                                                                       
Query: 287 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 346
           |||||||| | |||||||||||||| ||||| |||||||||| |||||||| ||||||||
Sbjct: 412 tcgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgc 353

                                                                       
Query: 347 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 406
           ||||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||
Sbjct: 352 cgcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttga 293

                                                                       
Query: 407 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 466
           ||||| |||| |||||||||||||| ||||||||| | |||  |||||||| |||| | |
Sbjct: 292 tgcacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaa 233

                                                                       
Query: 467 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 526
           | |||   ||||||||| |||||||  |||| ||| ||||    || ||||||| ||| |
Sbjct: 232 ctccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcagg 173

                                                                       
Query: 527 ggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggtggctacgaggagc 586
            |  || ||||||| ||||||||||||||||||| | ||||||||| |||||| ||||||
Sbjct: 172 aggccagggcagagttcacctgaccgcaggagatcg-ccgcgtcggaggctaccaggagc 114

                                                                     
Query: 587 atagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccatttcga 644
           || || ||||||| |||||||||||||||||  || ||||||| ||||||||| ||||
Sbjct: 113 attgccgccaccagggcgaccagcacgagctttgttgctgcagtgcgagccatctcga 56



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 44/47 (93%), Gaps = 1/47 (2%)
 Strand = Plus / Minus

                                                          
Query: 89  gatacaacagtgtgccggccatgcagagctggctcaacgtacgtact 135
           |||||||||||| |||||| ||||||||||||||| |||||||||||
Sbjct: 598 gatacaacagtg-gccggctatgcagagctggctcgacgtacgtact 553



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                         
Query: 19  agtgcacatggtacaaagtacaacaaactc 48
           ||||||||||||||||||||||||||||||
Sbjct: 679 agtgcacatggtacaaagtacaacaaactc 650

---

>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid
           transfer protein precursor
          Length = 496

 Score =  226 bits (114), Expect = 7e-56
 Identities = 298/358 (83%), Gaps = 1/358 (0%)
 Strand = Plus / Minus

                                                                       
Query: 287 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 346
           |||||||| | |||||||||||||| ||||| |||||||| | |||||||||||||||||
Sbjct: 372 tcgatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgc 313

                                                                       
Query: 347 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 406
           ||||| ||||||| || || |||||||||   | ||| ||||| || ||| | |||||||
Sbjct: 312 cgcacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttga 253

                                                                       
Query: 407 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 466
            |||| |||| |  ||||||||||| ||||||||| | |||  |||||||| | || |||
Sbjct: 252 ggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctga 193

                                                                       
Query: 467 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 526
           ||||||||||||||||| ||| |||  |||  ||| ||||    ||||||| || ||| |
Sbjct: 192 cgccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagg 133

                                                                       
Query: 527 ggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggtggctacgaggagc 586
           || ||||||||||||||||||| ||||||  ||||| ||||||||| |||| |||||| |
Sbjct: 132 gggtcaaggcagagctcacctggccgcagctgatgg-ccgcgtcggaggctgcgaggatc 74

                                                                     
Query: 587 atagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccatttcga 644
           || || ||||||| ||||||||||||||||| ||||||||||| ||||||||| ||||
Sbjct: 73  attgccgccaccagggcgaccagcacgagcttagtagctgcagtgcgagccatctcga 16

---

>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds
          Length = 348

 Score =  218 bits (110), Expect = 2e-53
 Identities = 285/342 (83%), Gaps = 1/342 (0%)
 Strand = Plus / Minus

                                                                       
Query: 298 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 357
           |||||||||||||| ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 358 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 417
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                                                       
Query: 418 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgccgctgcag 477
           |||||||||||||| ||||||||| | |||  |||||||| |||| | || |||   |||
Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162

                                                                       
Query: 478 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggctcaaggca 537
           |||||| |||||||  |||| ||| ||||    || ||||||| ||| | |  || ||||
Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102

                                                                       
Query: 538 gagctcacctgaccgcaggagatggcccgcgtcggtggctacgaggagcatagcggccac 597
           ||| ||||||||||||||||||| | ||||||||| |||||| |||||||| || |||||
Sbjct: 101 gagttcacctgaccgcaggagatcg-ccgcgtcggaggctaccaggagcattgccgccac 43

                                                     
Query: 598 catggcgaccagcacgagctgagtagctgcagcgcgagccat 639
           || |||||||||||||||||  || ||||||| |||||||||
Sbjct: 42  cagggcgaccagcacgagctttgttgctgcagtgcgagccat 1

---

>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete
           cds
          Length = 345

 Score =  210 bits (106), Expect = 4e-51
 Identities = 260/310 (83%), Gaps = 1/310 (0%)
 Strand = Plus / Minus

                                                                       
Query: 330 gtaggggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagccc 389
           ||||||||||||||||| |||| ||||||||||  | |||||| ||||  | || | |||
Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250

                                                                       
Query: 390 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgc 449
           ||| ||||| ||||||||||||  ||||||||||| |||||||||||   ||||  ||  
Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtcagcggcagtctgcacttg 190

                                                                       
Query: 450 gccggccagtctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcg 509
           |||||||| |||| |||||||||||||||||||| ||| |||  ||||||||||||||||
Sbjct: 189 gccggccaatctcctgacgccgctgcagcaggccgcagacgggctggcgccgttgccgcg 130

                                                                       
Query: 510 ggcataggagatgcaagggctcaaggcagagctcacctgaccgcaggagatggcccgcgt 569
            |||||||| | ||| ||||  | ||| ||||||||||| ||||||||||| | ||||||
Sbjct: 129 tgcataggaaaggcacgggccaagggcggagctcacctggccgcaggagattg-ccgcgt 71

                                                                       
Query: 570 cggtggctacgaggagcatagcggccaccatggcgaccagcacgagctgagtagctgcag 629
           ||| |||||| ||||| |  || ||||||| ||||||||||||||||| |||||||| ||
Sbjct: 70  cggaggctacaaggaggagtgccgccaccagggcgaccagcacgagcttagtagctgtag 11

                     
Query: 630 cgcgagccat 639
            |||||||||
Sbjct: 10  tgcgagccat 1

---

>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds
          Length = 348

 Score =  210 bits (106), Expect = 4e-51
 Identities = 284/342 (83%), Gaps = 1/342 (0%)
 Strand = Plus / Minus

                                                                       
Query: 298 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 357
           |||||||||||||| ||||| |||||||| | |||||||||||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282

                                                                       
Query: 358 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 417
           || || || |||||||||   | ||| ||||| || ||| | ||||||| |||| |||| 
Sbjct: 281 ggaatgcctgcggccttgttggggttgagccctccggcaacactcttgaggcacctgcat 222

                                                                       
Query: 418 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgccgctgcag 477
           |  ||||||||||| ||||||||| | |||  |||||||| | || ||||||||||||||
Sbjct: 221 gtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacgccgctgcag 162

                                                                       
Query: 478 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggctcaaggca 537
           |||||| ||| |||  |||  ||| ||||    ||||||| || ||| ||| ||||||||
Sbjct: 161 caggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggggtcaaggca 102

                                                                       
Query: 538 gagctcacctgaccgcaggagatggcccgcgtcggtggctacgaggagcatagcggccac 597
           ||||||||||| ||||||  ||||| ||||||||| |||| |||||| ||| || |||||
Sbjct: 101 gagctcacctggccgcagctgatgg-ccgcgtcggaggctgcgaggatcattgccgccac 43

                                                     
Query: 598 catggcgaccagcacgagctgagtagctgcagcgcgagccat 639
           || ||||||||||||||| | ||||||||||| |||||||||
Sbjct: 42  cagggcgaccagcacgagtttagtagctgcagtgcgagccat 1

---

>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  202 bits (102), Expect = 1e-48
 Identities = 283/342 (82%), Gaps = 1/342 (0%)
 Strand = Plus / Minus

                                                                       
Query: 298 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 357
           ||||||||||| || ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 358 gggattccggcggccttgccagcgtttagcccacccgcagcgctcttgatgcacttgcac 417
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                                                       
Query: 418 gccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttgacgccgctgcag 477
           |||||||||||||| ||||||||| | |||  |||||||| |||| | || |||   |||
Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162

                                                                       
Query: 478 caggccacaggcggtttggcgccgttgccgcgggcataggagatgcaagggctcaaggca 537
           |||||| |||||||  |||| ||| ||||    || ||||||| ||| | |  || ||||
Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102

                                                                       
Query: 538 gagctcacctgaccgcaggagatggcccgcgtcggtggctacgaggagcatagcggccac 597
           ||| ||||||||||||||| ||| | ||||||||| |||||| |||||||| || |||||
Sbjct: 101 gagttcacctgaccgcaggggatcg-ccgcgtcggaggctaccaggagcattgccgccac 43

                                                     
Query: 598 catggcgaccagcacgagctgagtagctgcagcgcgagccat 639
           || |||||||||||||||||  || ||||||| |||||||||
Sbjct: 42  cagggcgaccagcacgagctttgttgctgcagtgcgagccat 1

---

>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor
          Length = 627

 Score =  176 bits (89), Expect = 6e-41
 Identities = 288/353 (81%), Gaps = 1/353 (0%)
 Strand = Plus / Minus

                                                                       
Query: 287 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 346
           |||||||| | ||||| |||||||||||    |||||||| | |||||||||||||||||
Sbjct: 354 tcgatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgacgc 295

                                                                       
Query: 347 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 406
           ||||| |||||||||| || |||||| |||| |||||   | | || ||  | |||||||
Sbjct: 294 cgcacctggaggggatgcctgcggccctgccggcgttgtacgcgccggcgacactcttga 235

                                                                       
Query: 407 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 466
            |||| ||||||  ||||||||||| ||||||||| | |||  |||||||| ||||||||
Sbjct: 234 ggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttga 175

                                                                       
Query: 467 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 526
           | ||||| |||||| || |||  ||  ||| |||| ||||    || |||| |  ||| |
Sbjct: 174 ctccgctacagcagcccgcagaagggctggtgccgctgccttttgcgtaggcggcgcagg 115

                                                                       
Query: 527 ggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggtggctacgaggagc 586
           ||| |||||||||||||||||| ||||||| ||||||| ||||||| |||||||||||||
Sbjct: 114 ggcccaaggcagagctcacctggccgcaggtgatggcc-gcgtcggcggctacgaggagc 56

                                                                
Query: 587 atagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccat 639
           || || ||||||| |||||||||| ||||||  || ||||||| |||||||||
Sbjct: 55  attgccgccaccagggcgaccagcgcgagcttggttgctgcagtgcgagccat 3



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 41/45 (91%), Gaps = 1/45 (2%)
 Strand = Plus / Minus

                                                        
Query: 88  cgatacaacagtgtgccggccatgcagagctggctcaacgtacgt 132
           ||||||||||||| || ||||||| |||||||||||| |||||||
Sbjct: 527 cgatacaacagtgagc-ggccatgtagagctggctcagcgtacgt 484

---

>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA
          Length = 732

 Score =  163 bits (82), Expect = 9e-37
 Identities = 290/358 (81%), Gaps = 1/358 (0%)
 Strand = Plus / Minus

                                                                       
Query: 287 tcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgc 346
           |||||||| | ||||| |||||||||||    |||||||| | ||||||||||||||| |
Sbjct: 425 tcgatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgaccc 366

                                                                       
Query: 347 cgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgctcttga 406
           ||||| |||||||||| || |||||| | || |||||   | | || ||  | |||||||
Sbjct: 365 cgcacctggaggggatgcctgcggcccttccggcgttgtacgcgccggcgacactcttga 306

                                                                       
Query: 407 tgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtctcttga 466
            |||| ||||||  ||||||||||| ||||||||| | |||  |||||||| ||||||||
Sbjct: 305 ggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttga 246

                                                                       
Query: 467 cgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagatgcaag 526
           | ||||| |||||| || |||  ||  ||| |||| ||||    || |||| |  ||| |
Sbjct: 245 ctccgctacagcagcccgcagaagggctggtgccgctgccttttgcgtaggcggcgcagg 186

                                                                       
Query: 527 ggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggtggctacgaggagc 586
           ||| |||||||||||||||||| ||||||| ||||||| ||||||| |||||||||||||
Sbjct: 185 ggcccaaggcagagctcacctggccgcaggtgatggcc-gcgtcggcggctacgaggagc 127

                                                                     
Query: 587 atagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccatttcga 644
           || || ||||||| |||||||||| ||||||  || ||||||| ||||||||| ||||
Sbjct: 126 attgccgccaccagggcgaccagcgcgagcttggttgctgcagtgcgagccatctcga 69



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 41/45 (91%), Gaps = 1/45 (2%)
 Strand = Plus / Minus

                                                        
Query: 88  cgatacaacagtgtgccggccatgcagagctggctcaacgtacgt 132
           ||||||||||||| || ||||||| |||||||||||| |||||||
Sbjct: 598 cgatacaacagtgagc-ggccatgtagagctggctcagcgtacgt 555

---

>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA
          Length = 724

 Score =  117 bits (59), Expect = 5e-23
 Identities = 168/203 (82%), Gaps = 1/203 (0%)
 Strand = Plus / Minus

                                                                       
Query: 278 agcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggga 337
           |||| ||| |||||||| | |||||||||||||||||    |||||||| | ||||||||
Sbjct: 431 agcacgtgttcgatcagtggatcttagagcagtcgacactggcgctgatcgtgtagggga 372

                                                                       
Query: 338 cgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcag 397
           |||||||||||||| |||||||||| || |||||| |||| |||||   | | || ||| 
Sbjct: 371 cgctgacgccgcacctggaggggatgcctgcggccctgccggcgttgtacgcgccggca- 313

                                                                       
Query: 398 cgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggcca 457
           | ||||||| |||| ||||||  ||||||||||| ||||||||| | |||  ||||||||
Sbjct: 312 cactcttgaggcacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggcca 253

                                  
Query: 458 gtctcttgacgccgctgcagcag 480
            ||||||||| ||||| ||||||
Sbjct: 252 atctcttgactccgctacagcag 230



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 101/119 (84%), Gaps = 3/119 (2%)
 Strand = Plus / Minus

                                                                       
Query: 526 gggctcaaggcagagctcacctgaccgcaggagatggcccgcgtcggtggctacgaggag 585
           |||| |||||||||||||||||| ||||||| ||||   |||||||| ||||||||||||
Sbjct: 185 gggcccaaggcagagctcacctggccgcaggtgatg---cgcgtcggcggctacgaggag 129

                                                                      
Query: 586 catagcggccaccatggcgaccagcacgagctgagtagctgcagcgcgagccatttcga 644
           ||| || ||||||| ||  |||||| ||||||  || ||||||| ||||||||| ||||
Sbjct: 128 cattgccgccaccaggggcaccagcgcgagcttggttgctgcagtgcgagccatctcga 70



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 41/45 (91%), Gaps = 1/45 (2%)
 Strand = Plus / Minus

                                                        
Query: 88  cgatacaacagtgtgccggccatgcagagctggctcaacgtacgt 132
           ||||||||||||| || ||||||| |||||||||||| |||||||
Sbjct: 582 cgatacaacagtgagc-ggccatgtagagctggctcagcgtacgt 539

---

>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0086N07 map S790A, complete sequence
          Length = 178523

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Plus

                                                                         
Query: 302   tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 361
             |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080

                                         
Query: 362   ttccggcggccttgccagcgtttagccc 389
             | | |||||| ||||| ||||| |||||
Sbjct: 94081 tgctggcggcgttgccggcgttgagccc 94108

---

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                            
Query: 302      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 361
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000

                                            
Query: 362      ttccggcggccttgccagcgtttagccc 389
                | | |||||| ||||| ||||| |||||
Sbjct: 13089999 tgctggcggcgttgccggcgttgagccc 13089972



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                          
Query: 304    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 364    ccggcggccttgccagcgtttagccc 389
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 304    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 364    ccggcggccttgccagcgtt 383
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 304    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 364    ccggcg 369
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 464    tgacgccgctgcagcaggcc 483
              ||||||||||||||||||||
Sbjct: 692595 tgacgccgctgcagcaggcc 692576

---

>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full
           insert sequence
          Length = 843

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 302 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 361
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400

                                       
Query: 362 ttccggcggccttgccagcgtttagccc 389
           | | |||||| ||||| ||||| |||||
Sbjct: 399 tgctggcggcgttgccggcgttgagccc 372

---

>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full
           insert sequence
          Length = 846

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                       
Query: 302 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 361
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399

                                       
Query: 362 ttccggcggccttgccagcgtttagccc 389
           | | |||||| ||||| ||||| |||||
Sbjct: 398 tgctggcggcgttgccggcgttgagccc 371

---

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                            
Query: 302      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 361
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179

                                            
Query: 362      ttccggcggccttgccagcgtttagccc 389
                | | |||||| ||||| ||||| |||||
Sbjct: 13170178 tgctggcggcgttgccggcgttgagccc 13170151



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                          
Query: 304    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 364    ccggcggccttgccagcgtttagccc 389
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 304    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 364    ccggcggccttgccagcgtt 383
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 304    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 364    ccggcg 369
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 464    tgacgccgctgcagcaggcc 483
              ||||||||||||||||||||
Sbjct: 692595 tgacgccgctgcagcaggcc 692576

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score =  107 bits (54), Expect = 5e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 304    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 364    ccggcggccttgccagcgtttagccc 389
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 304    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 364    ccggcggccttgccagcgtt 383
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 304    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 364    ccggcg 369
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 464    tgacgccgctgcagcaggcc 483
              ||||||||||||||||||||
Sbjct: 732447 tgacgccgctgcagcaggcc 732428

---

>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15
          Length = 511

 Score =  107 bits (54), Expect = 5e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354

                                     
Query: 364 ccggcggccttgccagcgtttagccc 389
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328

---

>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full
           insert sequence
          Length = 995

 Score =  107 bits (54), Expect = 5e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611

                                     
Query: 364 ccggcggccttgccagcgtttagccc 389
           | |||||| ||||| ||||| |||||
Sbjct: 610 ctggcggcgttgccggcgttgagccc 585

---

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  107 bits (54), Expect = 5e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 304    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 364    ccggcggccttgccagcgtttagccc 389
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                          
Query: 304    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 364    ccggcggccttgccagcgtt 383
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                          
Query: 304    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 364    ccggcg 369
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 464    tgacgccgctgcagcaggcc 483
              ||||||||||||||||||||
Sbjct: 732447 tgacgccgctgcagcaggcc 732428

---

>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118211

 Score =  107 bits (54), Expect = 5e-20
 Identities = 78/86 (90%)
 Strand = Plus / Plus

                                                                         
Query: 304   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
             |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450

                                       
Query: 364   ccggcggccttgccagcgtttagccc 389
             | |||||| ||||| ||||| |||||
Sbjct: 42451 ctggcggcgttgccggcgttgagccc 42476



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Plus

                                                                         
Query: 304   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 46518 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 46577

                                 
Query: 364   ccggcggccttgccagcgtt 383
             | |||||| ||||| |||||
Sbjct: 46578 ctggcggcattgccggcgtt 46597



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                         
Query: 304   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
             |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 56407 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 56466

                   
Query: 364   ccggcg 369
             ||||||
Sbjct: 56467 ccggcg 56472



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 464   tgacgccgctgcagcaggcc 483
             ||||||||||||||||||||
Sbjct: 46687 tgacgccgctgcagcaggcc 46706

---

>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1
           mRNA, complete cds
          Length = 530

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367

                                     
Query: 364 ccggcggccttgccagcgtttagccc 389
           | |||||| ||||| ||||| |||||
Sbjct: 366 ctggcggcgttgccggcgttgagccc 341

---

>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein
          Length = 799

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 364 ccggcggccttgccagcgtttagccc 389
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353

---

>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full
            insert sequence
          Length = 2882

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                        
Query: 304  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
            |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386

                                      
Query: 364  ccggcggccttgccagcgtttagccc 389
            | |||||| ||||| ||||| |||||
Sbjct: 2385 ctggcggcgttgccggcgttgagccc 2360

---

>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full
           insert sequence
          Length = 551

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263

                                     
Query: 364 ccggcggccttgccagcgtttagccc 389
           | |||||| ||||| ||||| |||||
Sbjct: 262 ctggcggcgttgccggcgttgagccc 237

---

>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from
             chromosome 11 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 181322

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Plus

                                                                         
Query: 304   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
             |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590

                                       
Query: 364   ccggcggccttgccagcgtttagccc 389
             | |||||| ||||| ||||| |||||
Sbjct: 40591 ctggcggcgttgccggcgttgagccc 40616



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Plus

                                                                         
Query: 304   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 50208 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 50267

                                 
Query: 364   ccggcggccttgccagcgtt 383
             | |||||| ||||| |||||
Sbjct: 50268 ctggcggcattgccggcgtt 50287



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Plus

                                                                         
Query: 304   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
             |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 63503 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 63562

                   
Query: 364   ccggcg 369
             ||||||
Sbjct: 63563 ccggcg 63568



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 464   tgacgccgctgcagcaggcc 483
             ||||||||||||||||||||
Sbjct: 50377 tgacgccgctgcagcaggcc 50396

---

>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds
          Length = 799

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 364 ccggcggccttgccagcgtttagccc 389
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353

---

>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds
          Length = 507

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           ||||||| || |||||||||||||| |||||||||||||||||||||| | |||||||| 
Sbjct: 373 gagcagtggatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 314

                                     
Query: 364 ccggcggccttgccagcgtttagccc 389
           | |||||| ||||| ||||| |||||
Sbjct: 313 ctggcggcgttgccggcgttgagccc 288

---

>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds
          Length = 805

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 77/86 (89%), Gaps = 1/86 (1%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||| |||||||||||||| |||||| ||||||||||||||| |||||||||| 
Sbjct: 412 gagcagtcgatggaagcgctgatggtgtaggg-acgctgacgccgcacttggaggggatg 354

                                     
Query: 364 ccggcggccttgccagcgtttagccc 389
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328

---

>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1
           mRNA, complete cds
          Length = 647

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 469 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 410

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 409 ctggcggcattgccggcgtt 390



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 464 tgacgccgctgcagcaggcc 483
           ||||||||||||||||||||
Sbjct: 300 tgacgccgctgcagcaggcc 281

---

>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS
          Length = 1485

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 701 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 642

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 641 ctggcggcattgccggcgtt 622



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 464 tgacgccgctgcagcaggcc 483
           ||||||||||||||||||||
Sbjct: 532 tgacgccgctgcagcaggcc 513

---

>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA
          Length = 717

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 294 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 235

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 234 ctggcggcgttgccggcgtt 215



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 538 gagctcacctgaccgcaggagatggcc 564
           ||||||||||| |||||||||||||||
Sbjct: 54  gagctcacctgcccgcaggagatggcc 28

---

>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene
          Length = 1499

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||| 
Sbjct: 997 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 938

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 937 ctggcggcgttgccggcgtt 918



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 538 gagctcacctgaccgcaggagatggcc 564
           ||||||||||| |||||||||||||||
Sbjct: 754 gagctcacctgcccgcaggagatggcc 728

---

>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1
          Length = 692

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 331 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 272

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 271 ctggcggcattgccggcgtt 252



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 464 tgacgccgctgcagcaggcc 483
           ||||||||||||||||||||
Sbjct: 162 tgacgccgctgcagcaggcc 143

---

>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full
           insert sequence
          Length = 1003

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 654 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 595

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 594 ctggcggcattgccggcgtt 575



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 464 tgacgccgctgcagcaggcc 483
           ||||||||||||||||||||
Sbjct: 485 tgacgccgctgcagcaggcc 466

---

>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full
           insert sequence
          Length = 840

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 437 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 378

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 377 ctggcggcattgccggcgtt 358



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 464 tgacgccgctgcagcaggcc 483
           ||||||||||||||||||||
Sbjct: 268 tgacgccgctgcagcaggcc 249

---

>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds
          Length = 845

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 419 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 360

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 359 ctggcggcattgccggcgtt 340



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 464 tgacgccgctgcagcaggcc 483
           ||||||||||||||||||||
Sbjct: 250 tgacgccgctgcagcaggcc 231

---

>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 695

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 63/71 (88%)
 Strand = Plus / Minus

                                                                       
Query: 316 gaagcgctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttg 375
           |||| |||||||| |||||||| ||||||||||||| |||||||||| | |||||| |||
Sbjct: 325 gaagggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattg 266

                      
Query: 376 ccagcgtttag 386
           || ||||||||
Sbjct: 265 ccggcgtttag 255



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 464 tgacgccgctgcagcaggcc 483
           ||||||||||||||||||||
Sbjct: 168 tgacgccgctgcagcaggcc 149

---

>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene
          Length = 1800

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 965 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 906

                         
Query: 364 ccggcggccttgcc 377
           | ||||||||||||
Sbjct: 905 ctggcggccttgcc 892

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                            
Query: 304      gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
                |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||| 
Sbjct: 14437064 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 14437005

                      
Query: 364      ccggcg 369
                ||||||
Sbjct: 14437004 ccggcg 14436999

---

>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1116_C12
          Length = 116758

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                         
Query: 304   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
             |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||| 
Sbjct: 45562 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 45503

                   
Query: 364   ccggcg 369
             ||||||
Sbjct: 45502 ccggcg 45497

---

>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds
          Length = 770

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 423 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 364

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 363 ctggcggcgttgccggcgtt 344

---

>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 698

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 333 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 274

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 273 ctggcggcgttgccggcgtt 254

---

>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 514

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 460 ctcttgacgccgctgcagcag 480
           |||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagcag 140

---

>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 514

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 460 ctcttgacgccgctgcagcag 480
           |||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagcag 140

---

>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 804

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 374 ctggcggcgttgccggcgtt 355

---

>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 391 ctggcggcgttgccggcgtt 372



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 460 ctcttgacgccgctgcagcag 480
           |||||||||||||||||||||
Sbjct: 286 ctcttgacgccgctgcagcag 266

---

>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265

---

>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265

---

>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265

---

>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265

---

>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265

---

>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265

---

>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265

---

>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265

---

>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265

---

>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 613

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239

---

>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2)
           gene, partial cds
          Length = 613

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239

---

>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336

---

>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336

---

>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 829

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 414 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 355

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcgttgccggcgtt 335

---

>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 816

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336

---

>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336

---

>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336

---

>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 818

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336

---

>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336

---

>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336

---

>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 832

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336

---

>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 820

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336

---

>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336

---

>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full
           insert sequence
          Length = 718

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                       
Query: 321 gctgatggcgtaggggacgctgacgccgcacatggaggggattccggcggccttgccagc 380
           |||||||| |||||||| ||||||||||||| |||||||||| | |||||| ||||| ||
Sbjct: 97  gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggc 156

              
Query: 381 gtt 383
           |||
Sbjct: 157 gtt 159



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 464 tgacgccgctgcagcaggcc 483
           ||||||||||||||||||||
Sbjct: 249 tgacgccgctgcagcaggcc 268

---

>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full
           insert sequence
          Length = 793

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 430 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 371

                 
Query: 364 ccggcg 369
           ||||||
Sbjct: 370 ccggcg 365

---

>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full
            insert sequence
          Length = 3876

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                        
Query: 304  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
            |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 3516 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 3457

                  
Query: 364  ccggcg 369
            ||||||
Sbjct: 3456 ccggcg 3451

---

>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full
           insert sequence
          Length = 792

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||| 
Sbjct: 432 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 373

                 
Query: 364 ccggcg 369
           ||||||
Sbjct: 372 ccggcg 367

---

>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full
           insert sequence
          Length = 745

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||| 
Sbjct: 434 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 375

                 
Query: 364 ccggcg 369
           ||||||
Sbjct: 374 ccggcg 369

---

>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence
          Length = 827

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                   
Query: 364 ccggcggc 371
           | ||||||
Sbjct: 374 ctggcggc 367

---

>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete
           cds
          Length = 840

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||| ||| | |||||||| ||||||||   ||||||||||| |||||||||| 
Sbjct: 414 gagcagtcgatggaggggctgatggtgtaggggatcgtgacgccgcacttggaggggatg 355

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcattgccggcgtt 335



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 464 tgacgccgctgcagcaggcc 483
           ||||||||||||||||||||
Sbjct: 245 tgacgccgctgcagcaggcc 226

---

>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 699

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| ||||||| || 
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggagggtatg 259

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239

---

>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 780

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 416 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 357

                   
Query: 364 ccggcggc 371
           | ||||||
Sbjct: 356 ctggcggc 349

---

>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 714

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 341 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 282

                   
Query: 364 ccggcggc 371
           | ||||||
Sbjct: 281 ctggcggc 274

---

>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 648

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 440 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 381

                   
Query: 364 ccggcggc 371
           | ||||||
Sbjct: 380 ctggcggc 373

---

>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 829

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 364 ccggcggc 371
           | ||||||
Sbjct: 393 ctggcggc 386

---

>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 455 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 396

                   
Query: 364 ccggcggc 371
           | ||||||
Sbjct: 395 ctggcggc 388

---

>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 821

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 364 ccggcggc 371
           | ||||||
Sbjct: 390 ctggcggc 383

---

>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 832

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 364 ccggcggc 371
           | ||||||
Sbjct: 393 ctggcggc 386

---

>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 835

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 364 ccggcggc 371
           | ||||||
Sbjct: 390 ctggcggc 383

---

>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 814

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 364 ccggcggc 371
           | ||||||
Sbjct: 390 ctggcggc 383

---

>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336

---

>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||| 
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 364 ccggcggccttgccagcgtt 383
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336

---

>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end
          Length = 677

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 264 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 205

                   
Query: 364 ccggcggc 371
           | ||||||
Sbjct: 204 ctggcggc 197

---

>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone
           9C2
          Length = 813

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||| 
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                   
Query: 364 ccggcggc 371
           | ||||||
Sbjct: 391 ctggcggc 384

---

>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 709

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 58/68 (85%)
 Strand = Plus / Minus

                                                                       
Query: 304 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatt 363
           |||||||||  ||| | ||||||||  ||||||| ||||||||||||| |||||||||| 
Sbjct: 319 gagcagtcggtggaggtgctgatggtataggggatgctgacgccgcacttggaggggatg 260

                   
Query: 364 ccggcggc 371
           | ||||||
Sbjct: 259 ctggcggc 252

---

>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6
            (Ltp6) gene, promoter and complete cds
          Length = 3257

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 321  gctgatggcgtaggggacgctgacgccgcacatggaggggattccggcg 369
            ||||||||||||||||| | ||||||||||| ||  |||||| ||||||
Sbjct: 2770 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722

---

>gb|BC045114.1| Mus musculus cyclic nucleotide gated channel beta 1b, mRNA (cDNA
           clone IMAGE:4504353), partial cds
          Length = 4763

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 467 cgccgctgcagcaggccacagg 488
           ||||||||||||||||||||||
Sbjct: 367 cgccgctgcagcaggccacagg 388

---

>gb|AC182436.1| Mus musculus chromosome 5, clone wi1-1982K15, complete sequence
          Length = 43869

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 467   cgccgctgcagcaggccacagg 488
             ||||||||||||||||||||||
Sbjct: 43282 cgccgctgcagcaggccacagg 43303

---

>gb|AC102518.11| Mus musculus chromosome 8, clone RP24-502J8, complete sequence
          Length = 199824

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 467   cgccgctgcagcaggccacagg 488
             ||||||||||||||||||||||
Sbjct: 52943 cgccgctgcagcaggccacagg 52964

---

>gb|AC159631.2| Mus musculus BAC clone RP24-177F21 from chromosome 12, complete
             sequence
          Length = 171538

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 529   ctcaaggcagagctcacctgaccgc 553
             |||||||||||| ||||||||||||
Sbjct: 24731 ctcaaggcagagatcacctgaccgc 24755

---

>emb|AL590822.36| Human DNA sequence from clone RP11-181G12 on chromosome 1 Contains the 3'
              end of the PRKCZ gene for protein kinase C zeta, a novel
              gene, a novel gene (FLJ31031), the SKI gene for v-ski
              sarcoma viral oncogene homolog (avian) and five CpG
              islands, complete sequence
          Length = 179836

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 536    cagagctcacctgaccgcagg 556
              |||||||||||||||||||||
Sbjct: 113726 cagagctcacctgaccgcagg 113706

---

>emb|AL158158.14| Human DNA sequence from clone RP11-427L11 on chromosome 9q31.2-32
            Contains the TXN gene for thioredoxin, the gene for a
            novel protein similar to thioredoxin, the 3' end of the
            gene for the likely ortholog of mouse polydom (POLYDOM)
            and two CpG islands, complete sequence
          Length = 194835

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 59   tcaaaggaagtaaatattaat 79
            |||||||||||||||||||||
Sbjct: 9384 tcaaaggaagtaaatattaat 9364

---

>gb|AF548001.1| Homo sapiens thioredoxin (TXN) gene, complete cds
          Length = 15100

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 59    tcaaaggaagtaaatattaat 79
             |||||||||||||||||||||
Sbjct: 12943 tcaaaggaagtaaatattaat 12963

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 465      gacgccgctgcagcaggccac 485
                |||||||||||||||||||||
Sbjct: 41554621 gacgccgctgcagcaggccac 41554641

---

>dbj|AP004073.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0614D08
          Length = 147548

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 465    gacgccgctgcagcaggccac 485
              |||||||||||||||||||||
Sbjct: 110914 gacgccgctgcagcaggccac 110934

---

>dbj|AP003687.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0660F12
          Length = 147203

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 465    gacgccgctgcagcaggccac 485
              |||||||||||||||||||||
Sbjct: 122820 gacgccgctgcagcaggccac 122840

---

>dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-B12, full
           insert sequence
          Length = 685

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 298 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 350
           ||||| |||||||||||||| | |||||||| | ||| ||||  |||||||||
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397

---

>dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-156-H07, full
           insert sequence
          Length = 654

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 298 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 350
           ||||| |||||||||||||| | |||||||| | ||| ||||  |||||||||
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397

---

>gb|AY109327.1| Zea mays CL468_1 mRNA sequence
          Length = 2907

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 460  ctcttgacgccgctgcagcag 480
            |||||||||||||||||||||
Sbjct: 2805 ctcttgacgccgctgcagcag 2785

---

>emb|X54541.1|HSTRXE4E5 H.sapiens Trx gene for thioredoxin, exon 4 and exon 5
          Length = 1404

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 59 tcaaaggaagtaaatattaat 79
          |||||||||||||||||||||
Sbjct: 60 tcaaaggaagtaaatattaat 80

---

>emb|X70288.1|HSTHDC H.sapiens gene for thioredoxin, exons 4 and 5
          Length = 1394

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 59 tcaaaggaagtaaatattaat 79
          |||||||||||||||||||||
Sbjct: 31 tcaaaggaagtaaatattaat 51

---

>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 686

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 460 ctcttgacgccgctgcagcag 480
           |||||||||||||||||||||
Sbjct: 155 ctcttgacgccgctgcagcag 135

---

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 591    cggccaccatggcgaccagc 610
              ||||||||||||||||||||
Sbjct: 608556 cggccaccatggcgaccagc 608575

---

>gb|AC105067.8| Mus musculus chromosome 18, clone RP23-232D3, complete sequence
          Length = 186258

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    ggaagtaaatattaattata 83
             ||||||||||||||||||||
Sbjct: 19775 ggaagtaaatattaattata 19794

---

>gb|AC141628.2| Mus musculus BAC clone RP24-358E15 from chromosome 18, complete
             sequence
          Length = 170129

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 64    ggaagtaaatattaattata 83
             ||||||||||||||||||||
Sbjct: 23067 ggaagtaaatattaattata 23048

---

>gb|AC144402.2| Atelerix albiventris clone LBNL4-89B6, complete sequence
          Length = 161430

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 18    aagtgcacatggtacaaagtacaa 41
             ||||||||||||||||||| ||||
Sbjct: 70159 aagtgcacatggtacaaagcacaa 70182

---

>emb|AL590110.11| Human DNA sequence from clone RP11-254O21 on chromosome 1 Contains the 3'
              end of a novel gene, complete sequence
          Length = 128843

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 157    cacatggagataatatatga 176
              ||||||||||||||||||||
Sbjct: 114026 cacatggagataatatatga 114007

---

>emb|AL356305.11| Human DNA sequence from clone RP11-109K20 on chromosome 13, complete
             sequence
          Length = 132436

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 62    aaggaagtaaatattaatta 81
             ||||||||||||||||||||
Sbjct: 74392 aaggaagtaaatattaatta 74373

---

>emb|AL157829.24| Human DNA sequence from clone RP11-305F14 on chromosome 9 Contains part
             of the ASTN2 gene for astrotactin2 (KIAA0634), and a CpG
             island, complete sequence
          Length = 162575

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 161   tggagataatatatgagagc 180
             ||||||||||||||||||||
Sbjct: 31942 tggagataatatatgagagc 31961

---

>gb|AC130187.4| Atelerix albiventris clone LB4-344F17, complete sequence
          Length = 150117

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 18    aagtgcacatggtacaaagtacaa 41
             ||||||||||||||||||| ||||
Sbjct: 66671 aagtgcacatggtacaaagcacaa 66694

---

>dbj|AK056395.1| Homo sapiens cDNA FLJ31833 fis, clone NT2RP6000130
          Length = 3692

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 266  agcaaggatgacagcaagtg 285
            ||||||||||||||||||||
Sbjct: 1826 agcaaggatgacagcaagtg 1807

---

>gb|AC117458.3| Homo sapiens 3 BAC RP11-345M4 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 101243

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 6     atacatatataaaagtgcac 25
             ||||||||||||||||||||
Sbjct: 62349 atacatatataaaagtgcac 62330

---

>gb|AC110774.3| Homo sapiens BAC clone RP11-254A24 from 4, complete sequence
          Length = 121016

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 54    tcctctcaaaggaagtaaat 73
             ||||||||||||||||||||
Sbjct: 18205 tcctctcaaaggaagtaaat 18186

---

>gb|AC021183.6| Homo sapiens BAC clone RP11-737D22 from 4, complete sequence
          Length = 118837

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 67    agtaaatattaattataaca 86
             ||||||||||||||||||||
Sbjct: 82647 agtaaatattaattataaca 82628

---

>gb|DP000003.1| Atelerix albiventris target 1 genomic scaffold
          Length = 2136267

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 18      aagtgcacatggtacaaagtacaa 41
               ||||||||||||||||||| ||||
Sbjct: 1753936 aagtgcacatggtacaaagcacaa 1753959

---

>emb|BX649439.8| Zebrafish DNA sequence from clone DKEY-21A8 in linkage group 2,
             complete sequence
          Length = 146298

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 161   tggagataatatatgagagc 180
             ||||||||||||||||||||
Sbjct: 85666 tggagataatatatgagagc 85685

---

>gb|AC044817.5|AC044817 Homo sapiens, clone RP11-197P20, complete sequence
          Length = 109398

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 266    agcaaggatgacagcaagtg 285
              ||||||||||||||||||||
Sbjct: 100675 agcaaggatgacagcaagtg 100694

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 7        tacatatataaaagtgcaca 26
                ||||||||||||||||||||
Sbjct: 17285662 tacatatataaaagtgcaca 17285643

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 427      ttgtcagcggtgctctgggc 446
                ||||||||||||||||||||
Sbjct: 11569463 ttgtcagcggtgctctgggc 11569482

---

>emb|AL662967.2|OSJN00166 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0034E24,
             complete sequence
          Length = 152220

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 7     tacatatataaaagtgcaca 26
             ||||||||||||||||||||
Sbjct: 85886 tacatatataaaagtgcaca 85867

---

>gb|AC091182.5| Homo sapiens chromosome 8, clone RP11-527N22, complete sequence
          Length = 206852

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 266   agcaaggatgacagcaagtg 285
             ||||||||||||||||||||
Sbjct: 90670 agcaaggatgacagcaagtg 90651

---

>gb|AC148962.4| Atelerix albiventris clone LB4-372K23, complete sequence
          Length = 54256

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 18    aagtgcacatggtacaaagtacaa 41
             ||||||||||||||||||| ||||
Sbjct: 24977 aagtgcacatggtacaaagcacaa 25000

---

>dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1034_C08
          Length = 154441

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 427    ttgtcagcggtgctctgggc 446
              ||||||||||||||||||||
Sbjct: 123597 ttgtcagcggtgctctgggc 123616

---

>dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0467G09
          Length = 158204

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 427   ttgtcagcggtgctctgggc 446
             ||||||||||||||||||||
Sbjct: 29734 ttgtcagcggtgctctgggc 29753

---

>gb|AC131741.4| Mus musculus BAC clone RP23-66E21 from 7, complete sequence
          Length = 193738

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 52    attcctctcaaaggaagtaa 71
             ||||||||||||||||||||
Sbjct: 83149 attcctctcaaaggaagtaa 83130

---

>dbj|AP006306.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-591J4, complete
             sequence
          Length = 211750

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 266   agcaaggatgacagcaagtg 285
             ||||||||||||||||||||
Sbjct: 90149 agcaaggatgacagcaagtg 90168

---

>dbj|AP006304.1| Homo sapiens genomic DNA, chromosome 8 clone:RP11-53I21, complete
              sequence
          Length = 156583

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 266    agcaaggatgacagcaagtg 285
              ||||||||||||||||||||
Sbjct: 142238 agcaaggatgacagcaagtg 142257

---

>emb|AL662931.10| Mouse DNA sequence from clone RP23-24M17 on chromosome X, complete
             sequence
          Length = 175639

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     catatataaaagtgcacatg 28
             ||||||||||||||||||||
Sbjct: 24078 catatataaaagtgcacatg 24097

---

>dbj|AP000070.1| Homo sapiens genomic DNA, chromosome 8p11.2, senescence gene region,
             section 6/19
          Length = 100000

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 266   agcaaggatgacagcaagtg 285
             ||||||||||||||||||||
Sbjct: 19820 agcaaggatgacagcaagtg 19801


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,030,902
Number of Sequences: 3902068
Number of extensions: 5030902
Number of successful extensions: 94415
Number of sequences better than 10.0: 150
Number of HSP's better than 10.0 without gapping: 152
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 93535
Number of HSP's gapped (non-prelim): 843
length of query: 666
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 643
effective length of database: 17,143,297,704
effective search space: 11023140423672
effective search space used: 11023140423672
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---