ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd19b06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY104443.1| Zea mays PCO095642 mRNA sequence 224 3e-55
2dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 212 1e-51
3dbj|AP003609.2| Oryza sativa (japonica cultivar-group) genomic D... 212 1e-51
4dbj|AK103787.1| Oryza sativa (japonica cultivar-group) cDNA clon... 212 1e-51
5ref|XM_464444.1| Oryza sativa (japonica cultivar-group), mRNA 190 4e-45
6dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 190 4e-45
7dbj|AP000366.2| Oryza sativa (japonica cultivar-group) genomic D... 190 4e-45
8ref|XM_474251.1| Oryza sativa (japonica cultivar-group), predic... 94 7e-16
9emb|AL606646.3|OSJN00091 Oryza sativa genomic DNA, chromosome 4,... 94 7e-16
10dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 94 7e-16
11dbj|AK121951.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 7e-16
12gb|AC166091.3| Glycine max clone gmw1-11j16, complete sequence 62 3e-06
13gb|AY112248.1| Zea mays CL633_5 mRNA sequence 54 6e-04
14dbj|AP006377.1| Lotus japonicus genomic DNA, chromosome 1, clone... 44 0.61
15gb|AC125233.4| Mus musculus BAC clone RP23-9D24 from chromosome ... 42 2.4
16emb|AL035563.19|HS1068E13 Human DNA sequence from clone RP5-1068... 42 2.4
17gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome 42 2.4
18gb|AC121147.8| Mus musculus chromosome 3, clone RP24-369O15, com... 40 9.5
19gb|AC116776.12| Mus musculus chromosome 3, clone RP24-472H5, com... 40 9.5
20gb|AC146396.5| Pan troglodytes BAC clone RP43-55A22 from 7, comp... 40 9.5
21gb|AC111010.5| Mus musculus BAC clone RP23-419L21 from chromosom... 40 9.5
22gb|AC128571.4| Rattus norvegicus 6 BAC CH230-424O13 (Children's ... 40 9.5
23gb|AC026898.8| Homo sapiens chromosome 18, clone RP11-767C4, com... 40 9.5
24gb|AC022138.5| Homo sapiens chromosome 5 clone CTD-2252A20, comp... 40 9.5
25gb|AC004922.2| Homo sapiens PAC clone RP5-900K19 from 7, complet... 40 9.5
26gb|AC026796.5| Homo sapiens chromosome 5 clone CTD-2292M14, comp... 40 9.5
27ref|NM_060388.1| Caenorhabditis elegans B0511.2 (B0511.2) mRNA, ... 40 9.5
28gb|AC146422.4| Pan troglodytes BAC clone RP43-27K9 from chromoso... 40 9.5
29gb|AY171761.1| Oryctolagus cuniculus clone mp072VL antibody vari... 40 9.5
30emb|AJ331519.1|HSA331519 Homo sapiens genomic sequence surroundi... 40 9.5

>gb|AY104443.1| Zea mays PCO095642 mRNA sequence
          Length = 1246

 Score =  224 bits (113), Expect = 3e-55
 Identities = 239/281 (85%)
 Strand = Plus / Minus

                                                                       
Query: 378 accattgcactggcatggttgacctgatcaaacgatccctcgagctcaatgtttttatgg 437
           |||||||| || || || |||| ||| ||||| | |||||||||||| ||||||||||||
Sbjct: 837 accattgcgctagcgtgcttgatctggtcaaatgttccctcgagctcgatgtttttatgg 778

                                                                       
Query: 438 ttggggtctgcctcattatcccggatggccagcttggccccagtcattcgggatatgtgc 497
           ||||| || ||||| || ||||||||||| | |||||||||||||| ||||||||| |||
Sbjct: 777 ttgggatcagcctcgttgtcccggatggctaacttggccccagtcactcgggatatatgc 718

                                                                       
Query: 498 tttgtgttgactccacccttcccaataatggcgccagcaagggatgcatcaacactgatc 557
           |||||||||   |||||||||||||| ||||| ||||||||||||||||| || ||||||
Sbjct: 717 tttgtgttggtaccacccttcccaatgatggcaccagcaagggatgcatcgacgctgatc 658

                                                                       
Query: 558 ttggctgtggccgaagcgccaaaggttgagggaggaaccatgtcagggccaggcatcggt 617
           ||||||||||| ||||| || || || ||||||||||||||||| |||  |||||| || 
Sbjct: 657 ttggctgtggcggaagcaccgaatgtggagggaggaaccatgtctgggaaaggcattggc 598

                                                    
Query: 618 gggggctggaagtgaccattgggtcttggtcccattggagg 658
           || |||  |||||| || ||||| | ||| |||||||||||
Sbjct: 597 ggtggcatgaagtgcccgttgggccctggccccattggagg 557



 Score = 97.6 bits (49), Expect = 5e-17
 Identities = 88/101 (87%)
 Strand = Plus / Minus

                                                                        
Query: 198  ttgcgcagttcactctcaccatgggcaaagtggcatctgtctccaaatgtgcaagagcct 257
            |||||||| ||||  || |||||||| |||||||| ||||||||||| ||||| ||||||
Sbjct: 1029 ttgcgcagctcaccttcgccatgggcgaagtggcacctgtctccaaaggtgcaggagcct 970

                                                     
Query: 258  ttgttgaagttgtcacacagcttggtcttgaagttgcttcc 298
            ||||||||||| || ||||  ||||| ||||||||||||||
Sbjct: 969  ttgttgaagttctcgcacaatttggttttgaagttgcttcc 929



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  212 bits (107), Expect = 1e-51
 Identities = 215/251 (85%)
 Strand = Plus / Plus

                                                                            
Query: 369      agctccttcaccattgcactggcatggttgacctgatcaaacgatccctcgagctcaatg 428
                |||||| | ||||| ||||| ||||| |||| ||| ||||| |  ||||| ||||| || 
Sbjct: 24425676 agctccgtgaccatagcactagcatgtttgatctggtcaaatgtaccctcaagctcgata 24425735

                                                                            
Query: 429      tttttatggttggggtctgcctcattatcccggatggccagcttggccccagtcattcgg 488
                || ||  |||||||||  | ||| |||||||||||||| ||||||||||||||||| |||
Sbjct: 24425736 ttcttgaggttggggttggactcgttatcccggatggctagcttggccccagtcatccgg 24425795

                                                                            
Query: 489      gatatgtgctttgtgttgactccacccttcccaataatggcgccagcaagggatgcatca 548
                ||||| ||||||||||||  ||||||||||||||| ||  ||||||| ||||||||||||
Sbjct: 24425796 gatatatgctttgtgttggttccacccttcccaatgataccgccagccagggatgcatca 24425855

                                                                            
Query: 549      acactgatcttggctgtggccgaagcgccaaaggttgagggaggaaccatgtcagggcca 608
                ||||||||||| |||||||| || || |||||||||||||||||||| ||||| ||||||
Sbjct: 24425856 acactgatctttgctgtggctgaggcaccaaaggttgagggaggaacgatgtccgggcca 24425915

                           
Query: 609      ggcatcggtgg 619
                ||||| |||||
Sbjct: 24425916 ggcattggtgg 24425926



 Score =  131 bits (66), Expect = 3e-27
 Identities = 93/102 (91%)
 Strand = Plus / Plus

                                                                            
Query: 197      cttgcgcagttcactctcaccatgggcaaagtggcatctgtctccaaatgtgcaagagcc 256
                ||||||||| ||||| ||||||||||| || || || ||||||||||| ||||| |||||
Sbjct: 24425504 cttgcgcagctcactttcaccatgggcgaaatgacacctgtctccaaacgtgcaggagcc 24425563

                                                          
Query: 257      tttgttgaagttgtcacacagcttggtcttgaagttgcttcc 298
                |||||||||||| |||||||||||||||||||||||||||||
Sbjct: 24425564 tttgttgaagttctcacacagcttggtcttgaagttgcttcc 24425605



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                          
Query: 647      tcccattggaggtgccattgagttgttcaacagcatgggctt 688
                |||||||||| ||| ||||||||||| || |||||| |||||
Sbjct: 24425945 tcccattggatgtggcattgagttgtccagcagcatcggctt 24425986



to top

>dbj|AP003609.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0012B02
          Length = 149807

 Score =  212 bits (107), Expect = 1e-51
 Identities = 215/251 (85%)
 Strand = Plus / Plus

                                                                         
Query: 369   agctccttcaccattgcactggcatggttgacctgatcaaacgatccctcgagctcaatg 428
             |||||| | ||||| ||||| ||||| |||| ||| ||||| |  ||||| ||||| || 
Sbjct: 37149 agctccgtgaccatagcactagcatgtttgatctggtcaaatgtaccctcaagctcgata 37208

                                                                         
Query: 429   tttttatggttggggtctgcctcattatcccggatggccagcttggccccagtcattcgg 488
             || ||  |||||||||  | ||| |||||||||||||| ||||||||||||||||| |||
Sbjct: 37209 ttcttgaggttggggttggactcgttatcccggatggctagcttggccccagtcatccgg 37268

                                                                         
Query: 489   gatatgtgctttgtgttgactccacccttcccaataatggcgccagcaagggatgcatca 548
             ||||| ||||||||||||  ||||||||||||||| ||  ||||||| ||||||||||||
Sbjct: 37269 gatatatgctttgtgttggttccacccttcccaatgataccgccagccagggatgcatca 37328

                                                                         
Query: 549   acactgatcttggctgtggccgaagcgccaaaggttgagggaggaaccatgtcagggcca 608
             ||||||||||| |||||||| || || |||||||||||||||||||| ||||| ||||||
Sbjct: 37329 acactgatctttgctgtggctgaggcaccaaaggttgagggaggaacgatgtccgggcca 37388

                        
Query: 609   ggcatcggtgg 619
             ||||| |||||
Sbjct: 37389 ggcattggtgg 37399



 Score =  131 bits (66), Expect = 3e-27
 Identities = 93/102 (91%)
 Strand = Plus / Plus

                                                                         
Query: 197   cttgcgcagttcactctcaccatgggcaaagtggcatctgtctccaaatgtgcaagagcc 256
             ||||||||| ||||| ||||||||||| || || || ||||||||||| ||||| |||||
Sbjct: 36977 cttgcgcagctcactttcaccatgggcgaaatgacacctgtctccaaacgtgcaggagcc 37036

                                                       
Query: 257   tttgttgaagttgtcacacagcttggtcttgaagttgcttcc 298
             |||||||||||| |||||||||||||||||||||||||||||
Sbjct: 37037 tttgttgaagttctcacacagcttggtcttgaagttgcttcc 37078



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 647   tcccattggaggtgccattgagttgttcaacagcatgggctt 688
             |||||||||| ||| ||||||||||| || |||||| |||||
Sbjct: 37418 tcccattggatgtggcattgagttgtccagcagcatcggctt 37459



to top

>dbj|AK103787.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033145I17, full
            insert sequence
          Length = 3135

 Score =  212 bits (107), Expect = 1e-51
 Identities = 215/251 (85%)
 Strand = Plus / Minus

                                                                        
Query: 369  agctccttcaccattgcactggcatggttgacctgatcaaacgatccctcgagctcaatg 428
            |||||| | ||||| ||||| ||||| |||| ||| ||||| |  ||||| ||||| || 
Sbjct: 2634 agctccgtgaccatagcactagcatgtttgatctggtcaaatgtaccctcaagctcgata 2575

                                                                        
Query: 429  tttttatggttggggtctgcctcattatcccggatggccagcttggccccagtcattcgg 488
            || ||  |||||||||  | ||| |||||||||||||| ||||||||||||||||| |||
Sbjct: 2574 ttcttgaggttggggttggactcgttatcccggatggctagcttggccccagtcatccgg 2515

                                                                        
Query: 489  gatatgtgctttgtgttgactccacccttcccaataatggcgccagcaagggatgcatca 548
            ||||| ||||||||||||  ||||||||||||||| ||  ||||||| ||||||||||||
Sbjct: 2514 gatatatgctttgtgttggttccacccttcccaatgataccgccagccagggatgcatca 2455

                                                                        
Query: 549  acactgatcttggctgtggccgaagcgccaaaggttgagggaggaaccatgtcagggcca 608
            ||||||||||| |||||||| || || |||||||||||||||||||| ||||| ||||||
Sbjct: 2454 acactgatctttgctgtggctgaggcaccaaaggttgagggaggaacgatgtccgggcca 2395

                       
Query: 609  ggcatcggtgg 619
            ||||| |||||
Sbjct: 2394 ggcattggtgg 2384



 Score =  123 bits (62), Expect = 8e-25
 Identities = 92/102 (90%)
 Strand = Plus / Minus

                                                                        
Query: 197  cttgcgcagttcactctcaccatgggcaaagtggcatctgtctccaaatgtgcaagagcc 256
            ||||||||| ||||| ||||||||||| || || || ||||||||||| ||||| |||||
Sbjct: 2806 cttgcgcagctcactttcaccatgggcgaaatgacacctgtctccaaacgtgcaggagcc 2747

                                                      
Query: 257  tttgttgaagttgtcacacagcttggtcttgaagttgcttcc 298
            | |||||||||| |||||||||||||||||||||||||||||
Sbjct: 2746 tctgttgaagttctcacacagcttggtcttgaagttgcttcc 2705



 Score = 44.1 bits (22), Expect = 0.61
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                      
Query: 647  tcccattggaggtgccattgagttgttcaacagcatgggctt 688
            |||||||||| ||| ||||||||||| || |||||| |||||
Sbjct: 2365 tcccattggatgtggcattgagttgtccagcagcatcggctt 2324



to top

>ref|XM_464444.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 903

 Score =  190 bits (96), Expect = 4e-45
 Identities = 252/304 (82%)
 Strand = Plus / Minus

                                                                       
Query: 365 aatcagctccttcaccattgcactggcatggttgacctgatcaaacgatccctcgagctc 424
           |||||||||| ||||||||||||| || |  |||| ||||||||| |  ||||| |||||
Sbjct: 714 aatcagctccctcaccattgcactagcgttcttgatctgatcaaatgtgccctcaagctc 655

                                                                       
Query: 425 aatgtttttatggttggggtctgcctcattatcccggatggccagcttggccccagtcat 484
           |||||||||   ||||| |||||  |||| ||| |||||||||||||||||||| || | 
Sbjct: 654 aatgtttttcaagttggtgtctgattcatgatcacggatggccagcttggcccctgtgac 595

                                                                       
Query: 485 tcgggatatgtgctttgtgttgactccacccttcccaataatggcgccagcaagggatgc 544
           || |||||| ||||||||||| || |||||| |||| || ||| | || ||||| |||||
Sbjct: 594 tctggatatctgctttgtgttaaccccacccctcccgattatgccacctgcaagagatgc 535

                                                                       
Query: 545 atcaacactgatcttggctgtggccgaagcgccaaaggttgagggaggaaccatgtcagg 604
           ||||||||||||||||||||||||||||||||||||| |||  ||||    |||| ||||
Sbjct: 534 atcaacactgatcttggctgtggccgaagcgccaaagcttgctggagtggacatggcagg 475

                                                                       
Query: 605 gccaggcatcggtgggggctggaagtgaccattgggtcttggtcccattggaggtgccat 664
           || |||||| ||||| ||    ||||||||| |||| |||||||||||||| || | |||
Sbjct: 474 gctaggcattggtggaggtgcaaagtgaccagtgggccttggtcccattgggggaggcat 415

               
Query: 665 tgag 668
           ||||
Sbjct: 414 tgag 411



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 213 tcaccatgggcaaagtggcatctgtctccaaatgtgcaagagcctttgttgaagttgtca 272
           |||||||||||||| ||||| ||||| ||||| ||||| || |||||| ||||||| || 
Sbjct: 872 tcaccatgggcaaaatggcacctgtcgccaaaagtgcacgaccctttggtgaagttctcg 813

                                     
Query: 273 cacagcttggtcttgaagttgcttcc 298
           ||||||||||||||||||||||||||
Sbjct: 812 cacagcttggtcttgaagttgcttcc 787



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  190 bits (96), Expect = 4e-45
 Identities = 252/304 (82%)
 Strand = Plus / Minus

                                                                           
Query: 365     aatcagctccttcaccattgcactggcatggttgacctgatcaaacgatccctcgagctc 424
               |||||||||| ||||||||||||| || |  |||| ||||||||| |  ||||| |||||
Sbjct: 5253365 aatcagctccctcaccattgcactagcgttcttgatctgatcaaatgtgccctcaagctc 5253306

                                                                           
Query: 425     aatgtttttatggttggggtctgcctcattatcccggatggccagcttggccccagtcat 484
               |||||||||   ||||| |||||  |||| ||| |||||||||||||||||||| || | 
Sbjct: 5253305 aatgtttttcaagttggtgtctgattcatgatcacggatggccagcttggcccctgtgac 5253246

                                                                           
Query: 485     tcgggatatgtgctttgtgttgactccacccttcccaataatggcgccagcaagggatgc 544
               || |||||| ||||||||||| || |||||| |||| || ||| | || ||||| |||||
Sbjct: 5253245 tctggatatctgctttgtgttaaccccacccctcccgattatgccacctgcaagagatgc 5253186

                                                                           
Query: 545     atcaacactgatcttggctgtggccgaagcgccaaaggttgagggaggaaccatgtcagg 604
               ||||||||||||||||||||||||||||||||||||| |||  ||||    |||| ||||
Sbjct: 5253185 atcaacactgatcttggctgtggccgaagcgccaaagcttgctggagtggacatggcagg 5253126

                                                                           
Query: 605     gccaggcatcggtgggggctggaagtgaccattgggtcttggtcccattggaggtgccat 664
               || |||||| ||||| ||    ||||||||| |||| |||||||||||||| || | |||
Sbjct: 5253125 gctaggcattggtggaggtgcaaagtgaccagtgggccttggtcccattgggggaggcat 5253066

                   
Query: 665     tgag 668
               ||||
Sbjct: 5253065 tgag 5253062



 Score =  101 bits (51), Expect = 3e-18
 Identities = 102/119 (85%)
 Strand = Plus / Minus

                                                                           
Query: 180     tctcaagccgcagccgacttgcgcagttcactctcaccatgggcaaagtggcatctgtct 239
               |||||||| ||||| || || || || ||| | |||||||||||||| ||||| ||||| 
Sbjct: 5253556 tctcaagcagcagctgatttccgaagctcattttcaccatgggcaaaatggcacctgtcg 5253497

                                                                          
Query: 240     ccaaatgtgcaagagcctttgttgaagttgtcacacagcttggtcttgaagttgcttcc 298
               ||||| ||||| || |||||| ||||||| || ||||||||||||||||||||||||||
Sbjct: 5253496 ccaaaagtgcacgaccctttggtgaagttctcgcacagcttggtcttgaagttgcttcc 5253438



to top

>dbj|AP000366.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0437H03
          Length = 170173

 Score =  190 bits (96), Expect = 4e-45
 Identities = 252/304 (82%)
 Strand = Plus / Minus

                                                                          
Query: 365    aatcagctccttcaccattgcactggcatggttgacctgatcaaacgatccctcgagctc 424
              |||||||||| ||||||||||||| || |  |||| ||||||||| |  ||||| |||||
Sbjct: 146818 aatcagctccctcaccattgcactagcgttcttgatctgatcaaatgtgccctcaagctc 146759

                                                                          
Query: 425    aatgtttttatggttggggtctgcctcattatcccggatggccagcttggccccagtcat 484
              |||||||||   ||||| |||||  |||| ||| |||||||||||||||||||| || | 
Sbjct: 146758 aatgtttttcaagttggtgtctgattcatgatcacggatggccagcttggcccctgtgac 146699

                                                                          
Query: 485    tcgggatatgtgctttgtgttgactccacccttcccaataatggcgccagcaagggatgc 544
              || |||||| ||||||||||| || |||||| |||| || ||| | || ||||| |||||
Sbjct: 146698 tctggatatctgctttgtgttaaccccacccctcccgattatgccacctgcaagagatgc 146639

                                                                          
Query: 545    atcaacactgatcttggctgtggccgaagcgccaaaggttgagggaggaaccatgtcagg 604
              ||||||||||||||||||||||||||||||||||||| |||  ||||    |||| ||||
Sbjct: 146638 atcaacactgatcttggctgtggccgaagcgccaaagcttgctggagtggacatggcagg 146579

                                                                          
Query: 605    gccaggcatcggtgggggctggaagtgaccattgggtcttggtcccattggaggtgccat 664
              || |||||| ||||| ||    ||||||||| |||| |||||||||||||| || | |||
Sbjct: 146578 gctaggcattggtggaggtgcaaagtgaccagtgggccttggtcccattgggggaggcat 146519

                  
Query: 665    tgag 668
              ||||
Sbjct: 146518 tgag 146515



 Score =  101 bits (51), Expect = 3e-18
 Identities = 102/119 (85%)
 Strand = Plus / Minus

                                                                          
Query: 180    tctcaagccgcagccgacttgcgcagttcactctcaccatgggcaaagtggcatctgtct 239
              |||||||| ||||| || || || || ||| | |||||||||||||| ||||| ||||| 
Sbjct: 147009 tctcaagcagcagctgatttccgaagctcattttcaccatgggcaaaatggcacctgtcg 146950

                                                                         
Query: 240    ccaaatgtgcaagagcctttgttgaagttgtcacacagcttggtcttgaagttgcttcc 298
              ||||| ||||| || |||||| ||||||| || ||||||||||||||||||||||||||
Sbjct: 146949 ccaaaagtgcacgaccctttggtgaagttctcgcacagcttggtcttgaagttgcttcc 146891



to top

>ref|XM_474251.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 930

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                       
Query: 468 agcttggccccagtcattcgggatatgtgctttgtgttgactccacccttcccaataatg 527
           |||||| ||||||| | |||| |||| ||||| ||||||||||||||||||||||| |||
Sbjct: 626 agcttgaccccagttactcggcatatctgcttcgtgttgactccacccttcccaattatg 567

                                              
Query: 528 gcgccagcaagggatgcatcaacactgatcttggc 562
            | |||||||| || |||||||| |||||||||||
Sbjct: 566 ccaccagcaagcgaggcatcaacgctgatcttggc 532



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 263 gaagttgtcacacagcttggtcttgaagttgct 295
           |||||| || ||||||||||||||| |||||||
Sbjct: 852 gaagttctcgcacagcttggtcttgtagttgct 820



to top

>emb|AL606646.3|OSJN00091 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0087O24,
             complete sequence
          Length = 146168

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                         
Query: 468   agcttggccccagtcattcgggatatgtgctttgtgttgactccacccttcccaataatg 527
             |||||| ||||||| | |||| |||| ||||| ||||||||||||||||||||||| |||
Sbjct: 70320 agcttgaccccagttactcggcatatctgcttcgtgttgactccacccttcccaattatg 70261

                                                
Query: 528   gcgccagcaagggatgcatcaacactgatcttggc 562
              | |||||||| || |||||||| |||||||||||
Sbjct: 70260 ccaccagcaagcgaggcatcaacgctgatcttggc 70226



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 263   gaagttgtcacacagcttggtcttgaagttgct 295
             |||||| || ||||||||||||||| |||||||
Sbjct: 70546 gaagttctcgcacagcttggtcttgtagttgct 70514



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                            
Query: 468      agcttggccccagtcattcgggatatgtgctttgtgttgactccacccttcccaataatg 527
                |||||| ||||||| | |||| |||| ||||| ||||||||||||||||||||||| |||
Sbjct: 34019424 agcttgaccccagttactcggcatatctgcttcgtgttgactccacccttcccaattatg 34019365

                                                   
Query: 528      gcgccagcaagggatgcatcaacactgatcttggc 562
                 | |||||||| || |||||||| |||||||||||
Sbjct: 34019364 ccaccagcaagcgaggcatcaacgctgatcttggc 34019330



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                                 
Query: 263      gaagttgtcacacagcttggtcttgaagttgct 295
                |||||| || ||||||||||||||| |||||||
Sbjct: 34019650 gaagttctcgcacagcttggtcttgtagttgct 34019618



to top

>dbj|AK121951.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033107K04, full
           insert sequence
          Length = 1349

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                       
Query: 468 agcttggccccagtcattcgggatatgtgctttgtgttgactccacccttcccaataatg 527
           |||||| ||||||| | |||| |||| ||||| ||||||||||||||||||||||| |||
Sbjct: 748 agcttgaccccagttactcggcatatctgcttcgtgttgactccacccttcccaattatg 689

                                              
Query: 528 gcgccagcaagggatgcatcaacactgatcttggc 562
            | |||||||| || |||||||| |||||||||||
Sbjct: 688 ccaccagcaagcgaggcatcaacgctgatcttggc 654



 Score = 42.1 bits (21), Expect = 2.4
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 263 gaagttgtcacacagcttggtcttgaagttgct 295
           |||||| || ||||||||||||||| |||||||
Sbjct: 974 gaagttctcgcacagcttggtcttgtagttgct 942



to top

>gb|AC166091.3| Glycine max clone gmw1-11j16, complete sequence
          Length = 69947

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                        
Query: 216  ccatgggcaaagtggcatctgtctccaaatgtgcaagagcctttgttgaagttgtcacac 275
            ||||| |||||||| ||||| |||||||| |||||||| |||||  | || || ||||||
Sbjct: 1886 ccatgtgcaaagtgacatctatctccaaacgtgcaagacccttttgtaaaattctcacac 1827

                                   
Query: 276  agcttggtcttgaagttgcttcc 298
            ||||| ||||| || ||||||||
Sbjct: 1826 agcttcgtcttaaaattgcttcc 1804



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 510  ccacccttcccaataatggcgccagcaagggatgcatcaacactgatcttggctgtggc 568
            |||||||||||||| || || ||||| ||||| || || || |||||||||||||||||
Sbjct: 1592 ccacccttcccaatgatagctccagccagggaagcttctacgctgatcttggctgtggc 1534



to top

>gb|AY112248.1| Zea mays CL633_5 mRNA sequence
          Length = 1172

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 72/87 (82%)
 Strand = Plus / Minus

                                                                       
Query: 495 tgctttgtgttgactccacccttcccaataatggcgccagcaagggatgcatcaacactg 554
           ||||| |||||||| || ||||| ||||| ||| | || ||||| || ||||| ||||||
Sbjct: 640 tgcttagtgttgaccccgcccttaccaattatgccaccggcaagagacgcatccacactg 581

                                      
Query: 555 atcttggctgtggccgaagcgccaaag 581
           |||||||| || ||||| || ||||||
Sbjct: 580 atcttggcagtcgccgaggcaccaaag 554



to top

>dbj|AP006377.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT38A19, TM0221,
             complete sequence
          Length = 110900

 Score = 44.1 bits (22), Expect = 0.61
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 213   tcaccatgggcaaagtggcatctgtctccaaatgtgca 250
             |||||||||||||| |||||| |||| |||||| ||||
Sbjct: 78001 tcaccatgggcaaaatggcatttgtcaccaaatttgca 77964



 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 270   tcacacagcttggtcttgaagttg 293
             ||||||||||| ||||||||||||
Sbjct: 78439 tcacacagctttgtcttgaagttg 78416



to top

>gb|AC125233.4| Mus musculus BAC clone RP23-9D24 from chromosome 5, complete sequence
          Length = 212792

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 425   aatgtttttatggttggggtc 445
             |||||||||||||||||||||
Sbjct: 80532 aatgtttttatggttggggtc 80512



to top

>emb|AL035563.19|HS1068E13 Human DNA sequence from clone RP5-1068E13 on chromosome 20p11.21-12.3
             Contains a eukaryotic translation elongation factor 1
             alpha 1 (EEF1A1) pseudogene, a novel gene, the C20orf78
             gene for chromosome 20 open reading frame 78 and the
             C20orf79 gene for chromosome 20 open reading frame 79,
             complete sequence
          Length = 148177

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 619   ggggctggaagtgaccattgg 639
             |||||||||||||||||||||
Sbjct: 77922 ggggctggaagtgaccattgg 77942



to top

>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 519     ccaataatggcgccagcaagggatg 543
               |||||||||||||||||| ||||||
Sbjct: 1997382 ccaataatggcgccagcatgggatg 1997358



to top

>gb|AC121147.8| Mus musculus chromosome 3, clone RP24-369O15, complete sequence
          Length = 178352

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 210    ctctcaccatgggcaaagtggcat 233
              ||||||||||| ||||||||||||
Sbjct: 118848 ctctcaccatgtgcaaagtggcat 118825



to top

>gb|AC116776.12| Mus musculus chromosome 3, clone RP24-472H5, complete sequence
          Length = 170076

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 210    ctctcaccatgggcaaagtggcat 233
              ||||||||||| ||||||||||||
Sbjct: 140480 ctctcaccatgtgcaaagtggcat 140503



to top

>gb|AC146396.5| Pan troglodytes BAC clone RP43-55A22 from 7, complete sequence
          Length = 145292

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 366    atcagctccttcaccattgc 385
              ||||||||||||||||||||
Sbjct: 127189 atcagctccttcaccattgc 127170



to top

>gb|AC111010.5| Mus musculus BAC clone RP23-419L21 from chromosome 14, complete
             sequence
          Length = 205141

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 390   gcatggttgacctgatcaaa 409
             ||||||||||||||||||||
Sbjct: 41239 gcatggttgacctgatcaaa 41258



to top

>gb|AC128571.4| Rattus norvegicus 6 BAC CH230-424O13 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 194127

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 621    ggctggaagtgaccattggg 640
              ||||||||||||||||||||
Sbjct: 109390 ggctggaagtgaccattggg 109409



to top

>gb|AC026898.8| Homo sapiens chromosome 18, clone RP11-767C4, complete sequence
          Length = 187295

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 245   tgtgcaagagcctttgttgaagtt 268
             ||||||||||||||||||| ||||
Sbjct: 73353 tgtgcaagagcctttgttgcagtt 73330



to top

>gb|AC022138.5| Homo sapiens chromosome 5 clone CTD-2252A20, complete sequence
          Length = 174627

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 261   ttgaagttgtcacacagctt 280
             ||||||||||||||||||||
Sbjct: 71169 ttgaagttgtcacacagctt 71150



to top

>gb|AC004922.2| Homo sapiens PAC clone RP5-900K19 from 7, complete sequence
          Length = 82359

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 366  atcagctccttcaccattgc 385
            ||||||||||||||||||||
Sbjct: 8029 atcagctccttcaccattgc 8048



to top

>gb|AC026796.5| Homo sapiens chromosome 5 clone CTD-2292M14, complete sequence
          Length = 151019

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 261    ttgaagttgtcacacagctt 280
              ||||||||||||||||||||
Sbjct: 145306 ttgaagttgtcacacagctt 145287



to top

>ref|NM_060388.1| Caenorhabditis elegans B0511.2 (B0511.2) mRNA, complete cds
          Length = 1377

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 369  agctccttcaccattgcact 388
            ||||||||||||||||||||
Sbjct: 1236 agctccttcaccattgcact 1217



to top

>gb|AC146422.4| Pan troglodytes BAC clone RP43-27K9 from chromosome 7, complete sequence
          Length = 189507

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 366    atcagctccttcaccattgc 385
              ||||||||||||||||||||
Sbjct: 113510 atcagctccttcaccattgc 113491



to top

>gb|AY171761.1| Oryctolagus cuniculus clone mp072VL antibody variable domain mRNA,
           partial cds
          Length = 324

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 200 gcgcagttcactctcaccat 219
           ||||||||||||||||||||
Sbjct: 205 gcgcagttcactctcaccat 224



to top

>emb|AJ331519.1|HSA331519 Homo sapiens genomic sequence surrounding NotI site, clone
           NR1-EJ17RS
          Length = 764

 Score = 40.1 bits (20), Expect = 9.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 424 caatgtttttatggttgggg 443
           ||||||||||||||||||||
Sbjct: 539 caatgtttttatggttgggg 520


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,481,446
Number of Sequences: 3902068
Number of extensions: 5481446
Number of successful extensions: 106658
Number of sequences better than 10.0: 30
Number of HSP's better than 10.0 without gapping: 30
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 106467
Number of HSP's gapped (non-prelim): 188
length of query: 691
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 668
effective length of database: 17,143,297,704
effective search space: 11451722866272
effective search space used: 11451722866272
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top