>gb|AC160942.1| Pan troglodytes BAC clone CH251-443J9 from chromosome unknown, complete
             sequence
          Length = 182340

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 478   tgaccggaagagataggcatctaat 502
             ||||||| |||||||||||||||||
Sbjct: 99448 tgaccgggagagataggcatctaat 99424

>gb|AC163758.3| Pan troglodytes BAC clone CH251-221N15 from chromosome 7, complete
              sequence
          Length = 157318

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 478    tgaccggaagagataggcatctaat 502
              ||||||| |||||||||||||||||
Sbjct: 154450 tgaccgggagagataggcatctaat 154474

>emb|AL929533.12| Zebrafish DNA sequence from clone DKEY-18E17 in linkage group 5, complete
              sequence
          Length = 251370

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 154    ttcctctgcaaaatatgctct 174
              |||||||||||||||||||||
Sbjct: 139807 ttcctctgcaaaatatgctct 139827

>emb|AJ401333.1|SHY401333 Saccharum hybrid cultivar R570 microsatellite DNA, clone mSSCIR56
          Length = 838

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 58  catcaaaataattttacatgt 78
           |||||||||||||||||||||
Sbjct: 288 catcaaaataattttacatgt 268

>ref|XM_414265.1| PREDICTED: Gallus gallus similar to KIAA0800 protein (LOC415921),
           mRNA
          Length = 4845

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 626 atatggagatttcctttcatcttg 649
           |||||||||| |||||||||||||
Sbjct: 706 atatggagatctcctttcatcttg 729

>gb|AC118540.15| Mus musculus strain 129/SvJ clone mgs1-169d12 map 3, complete sequence
          Length = 191014

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   aggttcatcctcttcctctg 161
             ||||||||||||||||||||
Sbjct: 14809 aggttcatcctcttcctctg 14790

>gb|AC127414.4| Mus musculus BAC clone RP23-246P24 from chromosome 7, complete sequence
          Length = 218222

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 60     tcaaaataattttacatgta 79
              ||||||||||||||||||||
Sbjct: 193097 tcaaaataattttacatgta 193078

>gb|AC127283.2| Mus musculus BAC clone RP23-323E20 from chromosome 3, complete sequence
          Length = 210014

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 142   aggttcatcctcttcctctg 161
             ||||||||||||||||||||
Sbjct: 43174 aggttcatcctcttcctctg 43155

>gb|AC122248.5| Mus musculus BAC clone RP23-156N18 from 7, complete sequence
          Length = 198901

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 60     tcaaaataattttacatgta 79
              ||||||||||||||||||||
Sbjct: 170017 tcaaaataattttacatgta 170036

>gb|AC146192.2| Pan troglodytes BAC clone RP43-35D13 from 7, complete sequence
          Length = 178260

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 634   atttcctttcatcttgtaatcacagccc 661
             |||||||||||| | |||||||||||||
Sbjct: 50808 atttcctttcatttagtaatcacagccc 50781

>emb|AL023875.2|HS1044O17 Human DNA sequence from clone RP5-1044O17 on chromosome Xp11.3-11.4
             Contains the 5' end of a novel gene and a CpG island,
             complete sequence
          Length = 122325

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 503   tgacagcaagcactgacattgttt 526
             ||||| ||||||||||||||||||
Sbjct: 43429 tgacatcaagcactgacattgttt 43452

>ref|XM_970293.1| PREDICTED: Tribolium castaneum similar to CG8542-PA (LOC664286), mRNA
          Length = 2073

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 340  aagaagatggcagcagaccg 359
            ||||||||||||||||||||
Sbjct: 1972 aagaagatggcagcagaccg 1991

>emb|AL929272.10| Mouse DNA sequence from clone RP23-69H10 on chromosome 11 Contains the 5'
              end of the Vrk2 gene for vaccinia related kinase 2 and a
              CpG island, complete sequence
          Length = 196753

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 68     attttacatgtacacaacataata 91
              ||||||||||||||||| ||||||
Sbjct: 104249 attttacatgtacacaaaataata 104226

>emb|BX942820.7| Zebrafish DNA sequence from clone CH211-222L23 in linkage group 18,
             complete sequence
          Length = 114084

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 61    caaaataattttacatgtac 80
             ||||||||||||||||||||
Sbjct: 81820 caaaataattttacatgtac 81839

>gb|AC105350.2| Drosophila melanogaster X BAC RP98-30C13 (Roswell Park Cancer
            Institute Drosophila BAC Library) complete sequence
          Length = 184334

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 166  atatgctcttgccattgccgcaac 189
            |||||| |||||||||||||||||
Sbjct: 9753 atatgcacttgccattgccgcaac 9730

>ref|NM_132335.2| Drosophila melanogaster CG12139-RB (CG12139), mRNA
          Length = 14127

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 166   atatgctcttgccattgccgcaac 189
             |||||| |||||||||||||||||
Sbjct: 11113 atatgcacttgccattgccgcaac 11090

>gb|AC023738.3| Drosophila melanogaster X BAC RP98-6F4 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 103196

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 166    atatgctcttgccattgccgcaac 189
              |||||| |||||||||||||||||
Sbjct: 101674 atatgcacttgccattgccgcaac 101651

>gb|AY060689.1| Drosophila melanogaster GH12891 full length cDNA
          Length = 6516

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 166  atatgctcttgccattgccgcaac 189
            |||||| |||||||||||||||||
Sbjct: 3502 atatgcacttgccattgccgcaac 3479

>emb|CR389527.1| Gallus gallus finished cDNA, clone ChEST299m20
          Length = 888

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 626 atatggagatttcctttcatcttg 649
           |||||||||| |||||||||||||
Sbjct: 20  atatggagatctcctttcatcttg 43

>ref|XM_623792.1| PREDICTED: Apis mellifera similar to ENSANGP00000014184 (LOC551398),
            mRNA
          Length = 3417

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 520  attgtttttagcctgcttgt 539
            ||||||||||||||||||||
Sbjct: 1998 attgtttttagcctgcttgt 1979

>emb|X82087.1|ZDGRANDE1 Z.diploperennis Grande1 gene
          Length = 8449

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 461  tgagatctcttttttattga 480
            ||||||||||||||||||||
Sbjct: 7861 tgagatctcttttttattga 7880

>emb|BX000697.7| Zebrafish DNA sequence from clone CH211-120M13 in linkage group 18,
              complete sequence
          Length = 186826

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 61     caaaataattttacatgtac 80
              ||||||||||||||||||||
Sbjct: 129369 caaaataattttacatgtac 129388

>gb|AE003447.5| Drosophila melanogaster chromosome X, section 31 of 74 of the complete
             sequence
          Length = 288721

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 166   atatgctcttgccattgccgcaac 189
             |||||| |||||||||||||||||
Sbjct: 23058 atatgcacttgccattgccgcaac 23081

>emb|AL773560.9| Pig DNA sequence from clone XX-514B12, complete sequence
          Length = 107413

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 141   aaggttcatcctcttcctct 160
             ||||||||||||||||||||
Sbjct: 52145 aaggttcatcctcttcctct 52126

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 387     ggtggccggcgagcatgaca 406
               ||||||||||||||||||||
Sbjct: 1389478 ggtggccggcgagcatgaca 1389497

>gb|AC145116.3| Mus musculus BAC clone RP23-434H14 from 6, complete sequence
          Length = 204134

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 381   agcttgggtggccggcgagc 400
             ||||||||||||||||||||
Sbjct: 76841 agcttgggtggccggcgagc 76860

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 286    ttacttgacattaattgtac 305
              ||||||||||||||||||||
Sbjct: 567175 ttacttgacattaattgtac 567194


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,411,967
Number of Sequences: 3902068
Number of extensions: 6411967
Number of successful extensions: 117859
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 117757
Number of HSP's gapped (non-prelim): 102
length of query: 666
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 643
effective length of database: 17,143,297,704
effective search space: 11023140423672
effective search space used: 11023140423672
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)