ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd18j12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_196917.1| Oryza sativa (japonica cultivar-group) 60S ribo... 607 e-170
2gb|AF093630.1|AF093630 Oryza sativa 60S ribosomal protein L21 (R... 599 e-168
3gb|BT016206.1| Zea mays clone Contig39 mRNA sequence 535 e-149
4gb|AY105020.1| Zea mays PCO098402 mRNA sequence 535 e-149
5gb|AF475114.1| Triticum aestivum 60s ribosomal protein L21 mRNA,... 505 e-140
6gb|AY107603.1| Zea mays PCO098394 mRNA sequence 488 e-134
7gb|AF457939.1| Zea mays clone cho1c.pk003.g2, mRNA sequence 361 2e-96
8gb|AC022457.8| Oryza sativa chromosome 10 BAC OSJNBa0006L06 geno... 335 1e-88
9dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 335 1e-88
10gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 335 1e-88
11gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 319 7e-84
12gb|AC137930.3| Oryza sativa (japonica cultivar-group) chromosome... 319 7e-84
13gb|AC137697.2| Genomic sequence for Oryza sativa, Nipponbare str... 319 7e-84
14dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 319 7e-84
15dbj|AK120267.1| Oryza sativa (japonica cultivar-group) cDNA clon... 319 7e-84
16ref|NM_100841.2| Arabidopsis thaliana structural constituent of ... 194 3e-46
17gb|AY081656.1| Arabidopsis thaliana similar to ribosomal protein... 194 3e-46
18gb|AY059923.1| Arabidopsis thaliana Similar to ribosomal protein... 194 3e-46
19dbj|AP004496.1| Lotus japonicus genomic DNA, chromosome 1, clone... 188 2e-44
20emb|BX814291.1|CNS0ADUZ Arabidopsis thaliana Full-length cDNA Co... 178 2e-41
21ref|NM_100831.2| Arabidopsis thaliana structural constituent of ... 159 1e-35
22gb|BT000775.1| Arabidopsis thaliana clone RAFL04-10-C15 (R11681)... 159 1e-35
23gb|AY059119.1| Arabidopsis thaliana putative 60S ribosomal prote... 159 1e-35
24gb|AF370227.1| Arabidopsis thaliana putative 60S ribosomal prote... 159 1e-35
25emb|BX816463.1|CNS0AANS Arabidopsis thaliana Full-length cDNA Co... 159 1e-35
26ref|NM_104563.3| Arabidopsis thaliana structural constituent of ... 125 2e-25
27gb|AY091167.1| Arabidopsis thaliana putative 60S ribosomal prote... 125 2e-25
28gb|AY050840.1| Arabidopsis thaliana putative 60S ribosomal prote... 125 2e-25
29gb|AY086851.1| Arabidopsis thaliana clone 28545 mRNA, complete s... 125 2e-25
30ref|NM_104579.3| Arabidopsis thaliana structural constituent of ... 117 5e-23
31gb|BT004794.1| Arabidopsis thaliana At1g57860 gene, complete cds 117 5e-23
32gb|AC003970.1| Arabidopsis thaliana chromosome I BAC F14J9 genom... 111 3e-21
33gb|AC000132.1|F21M12 Sequence of BAC F21M12 from Arabidopsis tha... 111 3e-21
34emb|BX814226.1|CNS0AC0R Arabidopsis thaliana Full-length cDNA Co... 109 1e-20
35gb|AC079733.1| Arabidopsis thaliana chromosome 1 BAC T8L23 genom... 96 2e-16
36emb|BX841874.1|CNS09Y44 Arabidopsis thaliana Full-length cDNA Co... 96 2e-16
37gb|AC079732.4|AC079732 Arabidopsis thaliana chromosome 1 BAC F12... 88 4e-14
38emb|AJ131099.1|PAB131099 Picea abies microsatellite RNA, clone P... 86 2e-13
39gb|AF092950.1|AF092950 Cyanophora paradoxa ribosomal protein L21... 86 2e-13
40ref|XM_505036.1| Yarrowia lipolytica CLIB122, YALI0F05522g predi... 56 2e-04
41emb|AJ718457.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC1-11-43... 56 2e-04
42emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 56 2e-04
43gb|DQ066307.1| Ixodes scapularis isolate IS-6-12L-52 ribosomal p... 54 6e-04
44gb|AC156448.2| Volvox carteri clone JGIAOBO-33O24, complete sequ... 54 6e-04
45ref|XM_959139.1| Neurospora crassa OR74A hypothetical protein (N... 52 0.002
46ref|XM_329137.1| Neurospora crassa OR74A hypothetical protein (N... 52 0.002
47gb|DQ191668.1| Solanum tuberosum 60S ribosomal protein L21-like ... 52 0.002
48ref|XM_753406.1| Ustilago maydis 521 hypothetical protein (UM023... 52 0.002
49ref|XM_570887.1| Cryptococcus neoformans var. neoformans JEC21 6... 52 0.002
50emb|AL132977.1|ATT10K17 Arabidopsis thaliana DNA chromosome 3, B... 52 0.002
51gb|AC007654.2|AC007654 Genomic sequence for Arabidopsis thaliana... 52 0.002
52gb|AY292616.1| Oikopleura dioica 60S ribosomal protein L21 (RL21... 50 0.010
53ref|XM_455019.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E23727g ... 50 0.010
54emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 50 0.010
55gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 50 0.010
56ref|NM_209960.1| Eremothecium gossypii AEL254Wp (AEL254W), mRNA 50 0.010
57ref|XM_799307.1| Trypanosoma cruzi strain CL Brener ribosomal pr... 48 0.038
58ref|XM_807657.1| Trypanosoma cruzi strain CL Brener ribosomal pr... 48 0.038
59gb|AY310808.1| Nicotiana benthamiana clone 12-130 unknown mRNA 48 0.038
60ref|XM_774277.1| Giardia lamblia ATCC 50803 ribosomal protein rp... 46 0.15
61ref|XM_449631.1| Candida glabrata CBS138 hypothetical protein (C... 44 0.60
62gb|AC121238.17| Medicago truncatula clone mth2-34p9, complete se... 44 0.60
63emb|CR380959.1| Candida glabrata strain CBS138 chromosome M comp... 44 0.60
64gb|DQ333017.1| Synthetic construct Saccharomyces cerevisiae clon... 44 0.60
65gb|U41849.1|SCU41849 Saccharomyces cerevisiae chromosome XVI, le... 44 0.60
66ref|XM_636632.1| Dictyostelium discoideum 60S ribosomal protein ... 42 2.4
67gb|DQ207854.1| Solanum tuberosum clone 076C12 unknown mRNA 42 2.4
68gb|AC163337.2| Mus musculus chromosome 5, clone RP23-297I15, com... 42 2.4
69gb|AY618092.1| Sterkiella histriomuscorum clone UGC1O0004_K15_R ... 42 2.4
70gb|BC013343.1| Mus musculus 4-hydroxyphenylpyruvic acid dioxygen... 42 2.4
71ref|NM_008277.1| Mus musculus 4-hydroxyphenylpyruvic acid dioxyg... 42 2.4
72emb|AL008630.1|HS282F2 Human DNA sequence from clone CTA-282F2 o... 42 2.4
73emb|BX072250.1|CNS09RWU Single read from an extremity of a full-... 42 2.4
74emb|BX066618.1|CNS09NKE Single read from an extremity of a full-... 42 2.4
75emb|BX055386.1|CNS09EWE Single read from an extremity of a full-... 42 2.4
76emb|BX051028.1|CNS09BJC Single read from an extremity of a full-... 42 2.4
77emb|BX049569.1|CNS09AET Single read from an extremity of a full-... 42 2.4
78emb|BX047565.1|CNS098V5 Single read from an extremity of a full-... 42 2.4
79emb|BX038998.1|CNS09296 Single read from an extremity of a full-... 42 2.4
80emb|BX038997.1|CNS09295 Single read from an extremity of a full-... 42 2.4
81emb|BX038604.1|CNS091Y8 Single read from an extremity of a full-... 42 2.4
82emb|BX038486.1|CNS091UY Single read from an extremity of a full-... 42 2.4
83emb|BX038410.1|CNS091SU Single read from an extremity of a full-... 42 2.4
84emb|BX038409.1|CNS091ST Single read from an extremity of a full-... 42 2.4
85emb|BX038404.1|CNS091SO Single read from an extremity of a full-... 42 2.4
86emb|BX038403.1|CNS091SN Single read from an extremity of a full-... 42 2.4
87emb|BX038349.1|CNS091R5 Single read from an extremity of a full-... 42 2.4
88emb|BX038348.1|CNS091R4 Single read from an extremity of a full-... 42 2.4
89emb|BX037985.1|CNS091H1 Single read from an extremity of a full-... 42 2.4
90emb|BX037984.1|CNS091H0 Single read from an extremity of a full-... 42 2.4
91emb|BX034995.1|CNS08Z5Z Single read from an extremity of a full-... 42 2.4
92emb|BX034994.1|CNS08Z5Y Single read from an extremity of a full-... 42 2.4
93emb|BX034575.1|CNS08YUB Single read from an extremity of a full-... 42 2.4
94emb|BX034293.1|CNS08YMH Single read from an extremity of a full-... 42 2.4
95emb|BX034039.1|CNS08YFF Single read from an extremity of a full-... 42 2.4
96emb|BX031754.1|CNS08WNY Single read from an extremity of a full-... 42 2.4
97emb|BX031276.1|CNS08WAO Single read from an extremity of a full-... 42 2.4
98emb|BX028974.1|CNS08UIQ Single read from an extremity of a full-... 42 2.4
99emb|BX028747.1|CNS08UCF Single read from an extremity of a full-... 42 2.4
100emb|BX025908.1|CNS08S5K Single read from an extremity of a full-... 42 2.4
101emb|BX021458.1|CNS08OPY Single read from an extremity of a full-... 42 2.4
102emb|BX019519.1|CNS08N83 Single read from an extremity of a full-... 42 2.4
103emb|BX019518.1|CNS08N82 Single read from an extremity of a full-... 42 2.4
104emb|BX017157.1|CNS08LEH Single read from an extremity of a full-... 42 2.4
105emb|BX017156.1|CNS08LEG Single read from an extremity of a full-... 42 2.4
106gb|AF526223.1| Argopecten irradians isolate iolsaicl245ct282cn30... 42 2.4
107emb|AJ507398.1|HSA507398 Homo sapiens RINZFC gene for putative R... 42 2.4
108gb|AC009812.17| Homo sapiens chromosome 8, clone RP11-48B3, comp... 42 2.4
109gb|AC005552.3| Homo sapiens chromosome 17, clone RP11-212E8, com... 42 2.4
110dbj|AK149416.1| Mus musculus adult male liver tumor cDNA, RIKEN ... 42 2.4
111gb|AF197814.1| Peperomia obtusifolia maturase (matR) gene, parti... 42 2.4
112gb|AF197799.1| Atherosperma moschatum maturase (matR) gene, part... 42 2.4
113gb|AF197728.1| Brasenia schreberi maturase (matR) gene, partial ... 42 2.4
114gb|AC110605.5| Homo sapiens chromosome 17, clone CTD-2317L23, co... 42 2.4
115ref|XM_320389.2| Anopheles gambiae str. PEST ENSANGP00000014054 ... 42 2.4
116dbj|D29987.1|MUS4HD Mus musculus mRNA for 4-hydroxyphenylpyruvat... 42 2.4
117emb|X59530.1|MMFPROT M.musculus mRNA for F protein 42 2.4
118gb|BC088139.1| Rattus norvegicus GABA(A) receptor-associated pro... 40 9.3
119ref|XM_511114.1| PREDICTED: Pan troglodytes similar to GABA(A) r... 40 9.3
120ref|NM_190560.1| Oryza sativa (japonica cultivar-group), predic... 40 9.3
121gb|AC118010.11| Mus musculus chromosome 5, clone RP23-451E8, com... 40 9.3
122gb|BC005985.1| Homo sapiens GABA(A) receptor-associated protein-... 40 9.3
123ref|NM_026693.2| Mus musculus gamma-aminobutyric acid (GABA-A) r... 40 9.3
124ref|XM_657314.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 9.3
125gb|AY302590.1| Sclerotinia sclerotiorum ribosomal protein Srp1 (... 40 9.3
126gb|BC026798.1| Mus musculus gamma-aminobutyric acid (GABA-A) rec... 40 9.3
127gb|AY422180.1| Mus musculus GABA(A) receptor-associated protein-... 40 9.3
128ref|XM_749817.1| Aspergillus fumigatus Af293 60s ribosomal prote... 40 9.3
129ref|XM_389071.1| Gibberella zeae PH-1 chromosome 2 hypothetical ... 40 9.3
130emb|CR394556.10| Zebrafish DNA sequence from clone DKEY-79P17 in... 40 9.3
131ref|XM_536778.2| PREDICTED: Canis familiaris similar to GABA(A) ... 40 9.3
132ref|NM_007285.6| Homo sapiens GABA(A) receptor-associated protei... 40 9.3
133emb|AL591501.7| Human DNA sequence from clone RP11-305F18 on chr... 40 9.3
134emb|AL160155.19| Human DNA sequence from clone RP11-461N23 on ch... 40 9.3
135gb|DQ115823.1| Cyanobacteria phage AS-1 contig_16 genomic sequence 40 9.3
136gb|AF535728.1| HIV-1 isolate 95USMA950911sa from USA envelope gl... 40 9.3
137gb|AF535724.1| HIV-1 isolate 95USMA950911s2 from USA envelope gl... 40 9.3
138gb|AF535645.1| HIV-1 isolate 95USMA950828pc from USA envelope gl... 40 9.3
139gb|AF535643.1| HIV-1 isolate 95USMA950828p9 from USA envelope gl... 40 9.3
140gb|AF535622.1| HIV-1 isolate 95USMA950821sf from USA envelope gl... 40 9.3
141gb|AF535621.1| HIV-1 isolate 95USMA950821sc from USA envelope gl... 40 9.3
142gb|AF535599.1| HIV-1 isolate 95USMA950821p3 from USA envelope gl... 40 9.3
143gb|AF535556.1| HIV-1 isolate 95USMA950731s3 from USA envelope gl... 40 9.3
144gb|AF535539.1| HIV-1 isolate 95USMA950731p5 from USA envelope gl... 40 9.3
145gb|AF535829.1| HIV-1 isolate 95USMA951129c1 from USA envelope gl... 40 9.3
146gb|AF535803.1| HIV-1 isolate 95USMA951101c7 from USA envelope gl... 40 9.3
147gb|AF535770.1| HIV-1 isolate 95USMA950925c3 from USA envelope gl... 40 9.3
148gb|AF535732.1| HIV-1 isolate 95USMA950920c1 from USA envelope gl... 40 9.3
149gb|AF535697.1| HIV-1 isolate 95USMA950911c6 from USA envelope gl... 40 9.3
150gb|AF535631.1| HIV-1 isolate 95USMA950828c8 from USA envelope gl... 40 9.3
151gb|AF535585.1| HIV-1 isolate 95USMA950821c2 from USA envelope gl... 40 9.3
152gb|AF535531.1| HIV-1 isolate 95USMA950731c9 from USA envelope gl... 40 9.3
153emb|BX572607.1| Rhodopseudomonas palustris CGA009 complete genom... 40 9.3
154gb|BC029601.1| Homo sapiens GABA(A) receptor-associated protein-... 40 9.3
155gb|BC014594.2| Homo sapiens GABA(A) receptor-associated protein-... 40 9.3
156gb|BC081436.1| Mus musculus gamma-aminobutyric acid (GABA-A) rec... 40 9.3
157emb|AJ010569.1|HSA010569 Homo sapiens mRNA for GEF-2 protein 40 9.3
158emb|CR376848.7| Zebrafish DNA sequence from clone CH211-197K23 i... 40 9.3
159gb|AC092309.3| Homo sapiens chromosome 19 clone LLNLR-276F4, com... 40 9.3
160gb|AC092323.3| Homo sapiens chromosome 16 clone RP11-133B5, comp... 40 9.3
161gb|BC102902.1| Bos taurus GABA(A) receptor-associated protein-li... 40 9.3
162emb|CR624907.1| full-length cDNA clone CS0DA011YJ15 of Neuroblas... 40 9.3
163emb|CR621062.1| full-length cDNA clone CS0DI066YH02 of Placenta ... 40 9.3
164emb|CR603478.1| full-length cDNA clone CS0DF013YB20 of Fetal bra... 40 9.3
165emb|CR592344.1| full-length cDNA clone CS0DI020YN18 of Placenta ... 40 9.3
166dbj|AB226224.1| Aspergillus oryzae cDNA, contig sequence: AoEST3083 40 9.3
167dbj|AK134873.1| Mus musculus adult male olfactory brain cDNA, RI... 40 9.3
168gb|AC104260.5| Homo sapiens chromosome 15, clone CTD-2536I1, com... 40 9.3
169gb|AC025287.8| Homo sapiens chromosome 16 clone RP11-490B18, com... 40 9.3
170emb|CR542217.1| Homo sapiens full open reading frame cDNA clone ... 40 9.3
171gb|AC009109.9| Homo sapiens chromosome 16 clone RP11-467L24, com... 40 9.3
172dbj|AK013563.1| Mus musculus adult male hippocampus cDNA, RIKEN ... 40 9.3
173dbj|AK049819.1| Mus musculus adult male hippocampus cDNA, RIKEN ... 40 9.3
174dbj|AK002596.1| Mus musculus adult male kidney cDNA, RIKEN full-... 40 9.3
175gb|AF190644.1|AF190644 Mus musculus GABA(A) receptor-associated ... 40 9.3
176gb|AF087848.1|AF087848 Homo sapiens GABA-A receptor-associated p... 40 9.3
177ref|NG_005250.1| Mus musculus GABA(A) receptor-associated protei... 40 9.3
178emb|AL116566.1|CNS01DA6 Botrytis cinerea strain T4 cDNA library 40 9.3
179emb|AL116420.1|CNS01D64 Botrytis cinerea strain T4 cDNA library 40 9.3
180emb|AL115400.1|CNS01CDS Botrytis cinerea strain T4 cDNA library 40 9.3
181emb|AL115058.1|CNS01C4A Botrytis cinerea strain T4 cDNA library 40 9.3
182emb|AL113789.1|CNS01B51 Botrytis cinerea strain T4 cDNA library 40 9.3
183emb|AL112271.1|CNS019YV Botrytis cinerea strain T4 cDNA library 40 9.3
184gb|AC115914.6| Mus musculus chromosome 8, clone RP24-487J5, comp... 40 9.3
185ref|NM_174675.2| Bos taurus GABA(A) receptor-associated protein-... 40 9.3
186ref|NM_022706.2| Rattus norvegicus GABA(A) receptor-associated p... 40 9.3
187ref|XM_345534.2| PREDICTED: Rattus norvegicus similar to GABA(A)... 40 9.3
188gb|AY117145.1| Bovine viral diarrhea virus-1 isolate CP 721 poly... 40 9.3
189gb|AY117147.1| Bos taurus cell-line MDBK 16 kDa golgi-associated... 40 9.3
190gb|AF077046.1| Homo sapiens ganglioside expression factor 2 homo... 40 9.3
191gb|AF020262.1|AF020262 Bos taurus general protein transport fact... 40 9.3
192dbj|AB003515.1| Rattus norvegicus mRNA for GEF-2, complete cds 40 9.3
193gb|AC124615.11| Mus musculus chromosome 5, clone RP24-445F15, co... 40 9.3
194gb|AY893581.1| Synthetic construct Homo sapiens clone FLH131145.... 40 9.3
195gb|AY893550.1| Synthetic construct Homo sapiens clone FLH131140.... 40 9.3
196dbj|AK104044.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.3
197gb|AC154533.2| Mus musculus BAC clone RP23-469N16 from 16, compl... 40 9.3
198dbj|AK059120.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 9.3
199gb|BT020958.1| Bos taurus GABA(A) receptor-associated protein-li... 40 9.3
200gb|AC115763.10| Mus musculus chromosome 15, clone RP23-64J7, com... 40 9.3
201emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome 40 9.3
202gb|DQ314886.1| Homo sapiens protein phosphatase 1, regulatory (i... 40 9.3
203gb|BC058145.1| Rattus norvegicus GABA(A) receptor-associated pro... 40 9.3
204emb|AL583885.17| Mouse DNA sequence from clone RP23-323K24 on ch... 40 9.3
205emb|AL773531.6| Mouse DNA sequence from clone RP23-179F21 on chr... 40 9.3
206emb|AL928797.6| Mouse DNA sequence from clone RP23-178B19 on chr... 40 9.3
207dbj|AB030710.1| Homo sapiens FLC3A mRNA for MAP1 light chain 3 r... 40 9.3

>ref|NM_196917.1| Oryza sativa (japonica cultivar-group) 60S ribosomal protein L21
           (OSJNBa0006L06.3), mRNA
          Length = 783

 Score =  607 bits (306), Expect = e-170
 Identities = 426/466 (91%)
 Strand = Plus / Minus

                                                                       
Query: 216 cctagtaaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcga 275
           |||||||||||||||||||||||||||||||||| || || ||||| ||||| ||||| |
Sbjct: 573 cctagtaaccacccttgagatcattgaccacatcgtacgggatgggggtgacagtctcca 514

                                                                       
Query: 276 ttgtggtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctga 335
            ||| | |||||| |||||||| ||||| ||||| ||  | ||||||||||| |||||||
Sbjct: 513 gtgttgcaccctcaaccatgaagccgggcttaggaccctgcggctgcctcttcgtgctga 454

                                                                       
Query: 336 tgacctcaccacgtgccttggcttccgccttgagctggtcattcttcactttcctcaggc 395
           ||||||||||||| |||||||| || |||||||||||||| ||||| |  ||||||||||
Sbjct: 453 tgacctcaccacgagccttggcatctgccttgagctggtcgttcttgatcttcctcaggc 394

                                                                       
Query: 396 ggaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcc 455
           ||||||||||||  ||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 393 ggaactcctcagtgcacctggatggctgcacatgctccacacggacatggatcctcttcc 334

                                                                       
Query: 456 tgatgatgcggtttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgt 515
           |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 333 tgataatgcggttcccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgt 274

                                                                       
Query: 516 tccacacgcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgc 575
           |||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 273 tccagacgcggccggtgcggccgtggtagaacttgtgcggcatccccttgtgcacggcgc 214

                                                                       
Query: 576 cgttcaccttgacgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcg 635
           ||||||||||||||||||||| |||||||| |||||||||||| ||||||||||||||||
Sbjct: 213 cgttcaccttgacgtcgacgtgctcgccgatcttgtaggtgcggaggtaggtggtgagcg 154

                                                         
Query: 636 ggatgtaacccttcttccggaaggggcgcgcgaacaggtcgcgcgt 681
           ||||||| |||||||||| ||| || ||||||||||||||||||||
Sbjct: 153 ggatgtaccccttcttcctgaacggccgcgcgaacaggtcgcgcgt 108



to top

>gb|AF093630.1|AF093630 Oryza sativa 60S ribosomal protein L21 (RPL21) mRNA, complete cds
          Length = 753

 Score =  599 bits (302), Expect = e-168
 Identities = 425/466 (91%)
 Strand = Plus / Minus

                                                                       
Query: 216 cctagtaaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcga 275
           |||||||||||||||||||||||||||||||||| || || ||||| ||||| ||||| |
Sbjct: 512 cctagtaaccacccttgagatcattgaccacatcgtacgggatgggggtgacagtctcca 453

                                                                       
Query: 276 ttgtggtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctga 335
            ||| | |||||| |||||||| || || ||||| ||  | ||||||||||| |||||||
Sbjct: 452 gtgttgcaccctcaaccatgaagccaggcttaggaccctgcggctgcctcttcgtgctga 393

                                                                       
Query: 336 tgacctcaccacgtgccttggcttccgccttgagctggtcattcttcactttcctcaggc 395
           ||||||||||||| |||||||| || |||||||||||||| ||||| |  ||||||||||
Sbjct: 392 tgacctcaccacgagccttggcatctgccttgagctggtcgttcttgatcttcctcaggc 333

                                                                       
Query: 396 ggaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcc 455
           ||||||||||||  ||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 332 ggaactcctcagtgcacctggatggctgcacatgctccacacggacatggatcctcttcc 273

                                                                       
Query: 456 tgatgatgcggtttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgt 515
           |||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 272 tgataatgcggttcccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgt 213

                                                                       
Query: 516 tccacacgcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgc 575
           |||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 212 tccagacgcggccggtgcggccgtggtagaacttgtgcggcatccccttgtgcacggcgc 153

                                                                       
Query: 576 cgttcaccttgacgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcg 635
           ||||||||||||||||||||| |||||||| |||||||||||| ||||||||||||||||
Sbjct: 152 cgttcaccttgacgtcgacgtgctcgccgatcttgtaggtgcggaggtaggtggtgagcg 93

                                                         
Query: 636 ggatgtaacccttcttccggaaggggcgcgcgaacaggtcgcgcgt 681
           ||||||| |||||||||| ||| || ||||||||||||||||||||
Sbjct: 92  ggatgtaccccttcttcctgaacggccgcgcgaacaggtcgcgcgt 47



to top

>gb|BT016206.1| Zea mays clone Contig39 mRNA sequence
          Length = 748

 Score =  535 bits (270), Expect = e-149
 Identities = 414/462 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctagtaaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgat 276
           ||||||||| ||||||||||| |||||||||||||||||||| |||||||| ||||||| 
Sbjct: 558 ctagtaaccgcccttgagatcgttgaccacatcataaggaataggagtgactgtctcgag 499

                                                                       
Query: 277 tgtggtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
           ||| | |||||| |||||||| || ||||| || || |  ||||||||||||||||||||
Sbjct: 498 tgtagcaccctcaaccatgaagccaggtttgggtcccacgggctgcctcttggtgctgat 439

                                                                       
Query: 337 gacctcaccacgtgccttggcttccgccttgagctggtcattcttcactttcctcaggcg 396
            |||||||| ||   |||||| |||||||||||||||||||||||  |||||||||||||
Sbjct: 438 cacctcaccgcggagcttggcatccgccttgagctggtcattcttggctttcctcaggcg 379

                                                                       
Query: 397 gaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcct 456
           ||||||||| |  || | ||| |||||||||||||| ||||||||||||||||  |||||
Sbjct: 378 gaactcctctgtgcaacgggagggctgcacatgctccacacggacatggatccgcttcct 319

                                                                       
Query: 457 gatgatgcggtttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgtt 516
           ||||||||||     |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 318 gatgatgcggccattaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgtt 259

                                                                       
Query: 517 ccacacgcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgcc 576
           ||| ||||  |||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 258 ccagacgctcccggtgcggccgtggtagaacttgtgcggcatgcccttgtgcacggcgcc 199

                                                                       
Query: 577 gttcaccttgacgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgg 636
           ||| ||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||
Sbjct: 198 gttaaccttgacgtcgacgtagtcgccgatcttgtaggtgcgcaggtacgtggtgagcgg 139

                                                     
Query: 637 gatgtaacccttcttccggaaggggcgcgcgaacaggtcgcg 678
           |||||| |||||||| |||||||| |||||||||||||||||
Sbjct: 138 gatgtaccccttcttgcggaagggccgcgcgaacaggtcgcg 97



to top

>gb|AY105020.1| Zea mays PCO098402 mRNA sequence
          Length = 784

 Score =  535 bits (270), Expect = e-149
 Identities = 414/462 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctagtaaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgat 276
           ||||||||| ||||||||||| |||||||||||||||||||| |||||||| ||||||| 
Sbjct: 594 ctagtaaccgcccttgagatcgttgaccacatcataaggaataggagtgactgtctcgag 535

                                                                       
Query: 277 tgtggtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
           ||| | |||||| |||||||| || ||||| || || |  ||||||||||||||||||||
Sbjct: 534 tgtagcaccctcaaccatgaagccaggtttgggtcccacaggctgcctcttggtgctgat 475

                                                                       
Query: 337 gacctcaccacgtgccttggcttccgccttgagctggtcattcttcactttcctcaggcg 396
            |||||||| || |||||||| |||||||||||||||||||||||  |||||||||||||
Sbjct: 474 cacctcaccgcgggccttggcatccgccttgagctggtcattcttggctttcctcaggcg 415

                                                                       
Query: 397 gaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcct 456
           ||||||||| |  || | ||| |||||||||||||| || |||||||||||||  |||||
Sbjct: 414 gaactcctctgtgcaacgggagggctgcacatgctccacgcggacatggatccgcttcct 355

                                                                       
Query: 457 gatgatgcggtttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgtt 516
           ||||||||||     |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 354 gatgatgcggccattaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgtt 295

                                                                       
Query: 517 ccacacgcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgcc 576
           ||| ||||  |||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 294 ccagacgctcccggtgcggccgtggtagaacttgtgcggcatgcccttgtgcacggcgcc 235

                                                                       
Query: 577 gttcaccttgacgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgg 636
           ||| ||||||||||||||||| ||||||| |||||||||||||||||| |||||||| ||
Sbjct: 234 gttaaccttgacgtcgacgtagtcgccgatcttgtaggtgcgcaggtacgtggtgagtgg 175

                                                     
Query: 637 gatgtaacccttcttccggaaggggcgcgcgaacaggtcgcg 678
           |||||| |||||||| |||||||| |||||||||||||||||
Sbjct: 174 gatgtaccccttcttgcggaagggccgcgcgaacaggtcgcg 133



to top

>gb|AF475114.1| Triticum aestivum 60s ribosomal protein L21 mRNA, partial cds
          Length = 519

 Score =  505 bits (255), Expect = e-140
 Identities = 412/465 (88%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctagtaaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgat 276
           |||||||||||| |||||||| ||||| || || || || ||||| ||||| ||||||||
Sbjct: 519 ctagtaaccaccnttgagatcgttgacgacgtcgtacgggatgggggtgaccgtctcgat 460

                                                                       
Query: 277 tgtggtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
            ||||| ||||| ||||||||||| || || || ||   |||||||||||| ||||||||
Sbjct: 459 ggtggtgccctccaccatgaacccaggcttgggccctgctggctgcctcttcgtgctgat 400

                                                                       
Query: 337 gacctcaccacgtgccttggcttccgccttgagctggtcattcttcactttcctcaggcg 396
           |||||| ||||| |||||||| ||||| || |||| |||||| || | ||||||| || |
Sbjct: 399 gacctcgccacgcgccttggcctccgcnttcagcttgtcattgttgagtttcctctggag 340

                                                                       
Query: 397 gaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcct 456
           |||||||||    ||||||||||||||||| ||||| ||||| ||||||||||| ||| |
Sbjct: 339 gaactcctcgttgcacctggatggctgcacgtgctccacacgcacatggatcctcttctt 280

                                                                       
Query: 457 gatgatgcggtttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgtt 516
           |||||| | ||| || ||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 279 gatgatcctgttgccgacctgcttgttgatctcgacgccgatggcgcgcttggtgacgtt 220

                                                                       
Query: 517 ccacacgcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgcc 576
           ||| ||||| |||||||||||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 219 ccagacgcggccggtgcggccgtggtagaacttgtgcggcatgcccttgtggacggcgcc 160

                                                                       
Query: 577 gttcaccttgacgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgg 636
           |||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||
Sbjct: 159 gttcaccttgacgtcgacgtgctccccgaccttgtaggtgcgcaggtaggtggtgagcgg 100

                                                        
Query: 637 gatgtaacccttcttccggaaggggcgcgcgaacaggtcgcgcgt 681
           |||||| |||||||| |||||||| ||||||||||||||||||||
Sbjct: 99  gatgtaccccttcttacggaagggccgcgcgaacaggtcgcgcgt 55



to top

>gb|AY107603.1| Zea mays PCO098394 mRNA sequence
          Length = 965

 Score =  488 bits (246), Expect = e-134
 Identities = 408/462 (88%)
 Strand = Plus / Minus

                                                                       
Query: 217 ctagtaaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgat 276
           ||||||||| |||||||||||||| ||||||||||| ||||| ||||| |||||||| | 
Sbjct: 612 ctagtaaccccccttgagatcatttaccacatcatagggaataggagtaacggtctcaag 553

                                                                       
Query: 277 tgtggtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
           ||| | |||||| |||||||| || ||||| || || |  ||||||||||||||||||||
Sbjct: 552 tgtagcaccctcaaccatgaagccaggtttgggtcccacaggctgcctcttggtgctgat 493

                                                                       
Query: 337 gacctcaccacgtgccttggcttccgccttgagctggtcattcttcactttcctcaggcg 396
            ||||| |||||  ||||||| ||  |||||||||| || |||||  ||||||||| |||
Sbjct: 492 cacctcgccacggtccttggcatcaaccttgagctgatcgttcttggctttcctcaagcg 433

                                                                       
Query: 397 gaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcct 456
           ||||||||| |  || | ||| |||||||||||||| |||||||||||||| |  |||||
Sbjct: 432 gaactcctctgtgcaacgggagggctgcacatgctccacacggacatggatacgcttcct 373

                                                                       
Query: 457 gatgatgcggtttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgtt 516
           ||||||||||     |||||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 372 gatgatgcggccattaacctgcttgttgatctcaacgccgatggcgcgcttggtgacgtt 313

                                                                       
Query: 517 ccacacgcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgcc 576
           ||| ||||| |||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 312 ccagacgcgaccggtgcggccgtggtagaacttgtgcggcatgcccttgtgcacggcgcc 253

                                                                       
Query: 577 gttcaccttgacgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgg 636
           ||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||
Sbjct: 252 gttcaccttgacgtcgacgtagtcgccgatcttgtaggtgcgcaggtacgtggtgagcgg 193

                                                     
Query: 637 gatgtaacccttcttccggaaggggcgcgcgaacaggtcgcg 678
           ||||||||||||||| ||||| || |||||||||||||||||
Sbjct: 192 gatgtaacccttcttgcggaacggccgcgcgaacaggtcgcg 151



to top

>gb|AF457939.1| Zea mays clone cho1c.pk003.g2, mRNA sequence
          Length = 526

 Score =  361 bits (182), Expect = 2e-96
 Identities = 394/459 (85%), Gaps = 5/459 (1%)
 Strand = Plus / Minus

                                                                       
Query: 227 cccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtggta-cc 285
           |||||||||||||||||||||||||| || |||| ||| |||||||| | ||| ||  ||
Sbjct: 525 cccttgagatcattgaccacatcatatgggatgg-agttacggtctcaaatgttgttgcc 467

                                                                       
Query: 286 ctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgatgacctcacc 345
           |||||||||||| ||||| || || || | ||| ||| ||||||||||||| || |  ||
Sbjct: 466 ctcgaccatgaagccgggcttgggacccaatggttgcntcttggtgctgataacntngcc 407

                                                                       
Query: 346 acgtgccttggcttccgccttgagct-ggtcattcttcactttcctcaggcggaactcct 404
            ||    ||||  |||||||| || | ||||||||||| | ||||||||||||||||| |
Sbjct: 406 gcgctttttggaatccgccttcaggttggtcattcttcgccttcctcaggcggaactctt 347

                                                                       
Query: 405 cagcacacctggatggct-gcacatgctcaacacggacatggatccttttcctgatgatg 463
           | |  || | ||| |||| |||||||||| |||||||||||||| |  ||||||||||||
Sbjct: 346 ctgtgcagcgggacggcttgcacatgctccacacggacatggatacgcttcctgatgatg 287

                                                                       
Query: 464 cggtttccaacctgctt-gttgatctcgacgccgatggcgcgcttggtgacgttccacac 522
           ||       |||||||| ||||| ||||||||||||||||||||||||||||||||| ||
Sbjct: 286 cgcccattgacctgctttgttgacctcgacgccgatggcgcgcttggtgacgttccagac 227

                                                                       
Query: 523 gcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcac 582
           ||| |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 226 gcgaccggtgcggccgtggtagaacttgtgcggcatccccttgtggacggcgccgttcac 167

                                                                       
Query: 583 cttgacgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgta 642
           |||||| |||||||| ||||||| |||||||||||| |||||||||||||||||||||||
Sbjct: 166 cttgacatcgacgtaatcgccgatcttgtaggtgcggaggtaggtggtgagcgggatgta 107

                                                  
Query: 643 acccttcttccggaaggggcgcgcgaacaggtcgcgcgt 681
            |||||||| ||||||||||||||||| |||||||||||
Sbjct: 106 gcccttcttgcggaaggggcgcgcgaagaggtcgcgcgt 68



to top

>gb|AC022457.8| Oryza sativa chromosome 10 BAC OSJNBa0006L06 genomic sequence, complete
             sequence
          Length = 162339

 Score =  335 bits (169), Expect = 1e-88
 Identities = 199/209 (95%)
 Strand = Plus / Plus

                                                                         
Query: 473   acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgtccggtg 532
             ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 15073 acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccagacgcggccggtg 15132

                                                                         
Query: 533   cggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcg 592
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 15133 cggccgtggtagaacttgtgcggcatccccttgtgcacggcgccgttcaccttgacgtcg 15192

                                                                         
Query: 593   acgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaacccttcttc 652
             |||| |||||||| |||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 15193 acgtgctcgccgatcttgtaggtgcggaggtaggtggtgagcgggatgtaccccttcttc 15252

                                          
Query: 653   cggaaggggcgcgcgaacaggtcgcgcgt 681
             | ||| || ||||||||||||||||||||
Sbjct: 15253 ctgaacggccgcgcgaacaggtcgcgcgt 15281



 Score =  280 bits (141), Expect = 6e-72
 Identities = 231/261 (88%)
 Strand = Plus / Plus

                                                                         
Query: 216   cctagtaaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcga 275
             |||||||||||||||||||||||||||||||||| || || ||||| ||||| ||||| |
Sbjct: 14081 cctagtaaccacccttgagatcattgaccacatcgtacgggatgggggtgacagtctcca 14140

                                                                         
Query: 276   ttgtggtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctga 335
              ||| | |||||| |||||||| ||||| ||||| ||  | ||||||||||| |||||||
Sbjct: 14141 gtgttgcaccctcaaccatgaagccgggcttaggaccctgcggctgcctcttcgtgctga 14200

                                                                         
Query: 336   tgacctcaccacgtgccttggcttccgccttgagctggtcattcttcactttcctcaggc 395
             ||||||||||||| |||||||| || |||||||||||||| ||||| |  ||||||||||
Sbjct: 14201 tgacctcaccacgagccttggcatctgccttgagctggtcgttcttgatcttcctcaggc 14260

                                                                         
Query: 396   ggaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcc 455
             ||||||||||||  ||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 14261 ggaactcctcagtgcacctggatggctgcacatgctccacacggacatggatcctcttcc 14320

                                  
Query: 456   tgatgatgcggtttccaacct 476
             |||| |||||||| |||||||
Sbjct: 14321 tgataatgcggttcccaacct 14341



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  335 bits (169), Expect = 1e-88
 Identities = 199/209 (95%)
 Strand = Plus / Plus

                                                                            
Query: 473      acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgtccggtg 532
                ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 16670556 acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccagacgcggccggtg 16670615

                                                                            
Query: 533      cggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcg 592
                |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 16670616 cggccgtggtagaacttgtgcggcatccccttgtgcacggcgccgttcaccttgacgtcg 16670675

                                                                            
Query: 593      acgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaacccttcttc 652
                |||| |||||||| |||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 16670676 acgtgctcgccgatcttgtaggtgcggaggtaggtggtgagcgggatgtaccccttcttc 16670735

                                             
Query: 653      cggaaggggcgcgcgaacaggtcgcgcgt 681
                | ||| || ||||||||||||||||||||
Sbjct: 16670736 ctgaacggccgcgcgaacaggtcgcgcgt 16670764



 Score =  280 bits (141), Expect = 6e-72
 Identities = 231/261 (88%)
 Strand = Plus / Plus

                                                                            
Query: 216      cctagtaaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcga 275
                |||||||||||||||||||||||||||||||||| || || ||||| ||||| ||||| |
Sbjct: 16669564 cctagtaaccacccttgagatcattgaccacatcgtacgggatgggggtgacagtctcca 16669623

                                                                            
Query: 276      ttgtggtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctga 335
                 ||| | |||||| |||||||| ||||| ||||| ||  | ||||||||||| |||||||
Sbjct: 16669624 gtgttgcaccctcaaccatgaagccgggcttaggaccctgcggctgcctcttcgtgctga 16669683

                                                                            
Query: 336      tgacctcaccacgtgccttggcttccgccttgagctggtcattcttcactttcctcaggc 395
                ||||||||||||| |||||||| || |||||||||||||| ||||| |  ||||||||||
Sbjct: 16669684 tgacctcaccacgagccttggcatctgccttgagctggtcgttcttgatcttcctcaggc 16669743

                                                                            
Query: 396      ggaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcc 455
                ||||||||||||  ||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 16669744 ggaactcctcagtgcacctggatggctgcacatgctccacacggacatggatcctcttcc 16669803

                                     
Query: 456      tgatgatgcggtttccaacct 476
                |||| |||||||| |||||||
Sbjct: 16669804 tgataatgcggttcccaacct 16669824



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  335 bits (169), Expect = 1e-88
 Identities = 199/209 (95%)
 Strand = Plus / Plus

                                                                            
Query: 473      acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgtccggtg 532
                ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 16679596 acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccagacgcggccggtg 16679655

                                                                            
Query: 533      cggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcg 592
                |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 16679656 cggccgtggtagaacttgtgcggcatccccttgtgcacggcgccgttcaccttgacgtcg 16679715

                                                                            
Query: 593      acgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaacccttcttc 652
                |||| |||||||| |||||||||||| ||||||||||||||||||||||| |||||||||
Sbjct: 16679716 acgtgctcgccgatcttgtaggtgcggaggtaggtggtgagcgggatgtaccccttcttc 16679775

                                             
Query: 653      cggaaggggcgcgcgaacaggtcgcgcgt 681
                | ||| || ||||||||||||||||||||
Sbjct: 16679776 ctgaacggccgcgcgaacaggtcgcgcgt 16679804



 Score =  280 bits (141), Expect = 6e-72
 Identities = 231/261 (88%)
 Strand = Plus / Plus

                                                                            
Query: 216      cctagtaaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcga 275
                |||||||||||||||||||||||||||||||||| || || ||||| ||||| ||||| |
Sbjct: 16678604 cctagtaaccacccttgagatcattgaccacatcgtacgggatgggggtgacagtctcca 16678663

                                                                            
Query: 276      ttgtggtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctga 335
                 ||| | |||||| |||||||| ||||| ||||| ||  | ||||||||||| |||||||
Sbjct: 16678664 gtgttgcaccctcaaccatgaagccgggcttaggaccctgcggctgcctcttcgtgctga 16678723

                                                                            
Query: 336      tgacctcaccacgtgccttggcttccgccttgagctggtcattcttcactttcctcaggc 395
                ||||||||||||| |||||||| || |||||||||||||| ||||| |  ||||||||||
Sbjct: 16678724 tgacctcaccacgagccttggcatctgccttgagctggtcgttcttgatcttcctcaggc 16678783

                                                                            
Query: 396      ggaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcc 455
                ||||||||||||  ||||||||||||||||||||||| ||||||||||||||||| ||||
Sbjct: 16678784 ggaactcctcagtgcacctggatggctgcacatgctccacacggacatggatcctcttcc 16678843

                                     
Query: 456      tgatgatgcggtttccaacct 476
                |||| |||||||| |||||||
Sbjct: 16678844 tgataatgcggttcccaacct 16678864



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  319 bits (161), Expect = 7e-84
 Identities = 197/209 (94%)
 Strand = Plus / Minus

                                                                           
Query: 473     acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgtccggtg 532
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 2247017 acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccagacgcggccggtg 2246958

                                                                           
Query: 533     cggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcg 592
               |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 2246957 cggccgtggtagaacttgtgcggcatgcccttgtgcacggcgccgttcaccttgacgtcg 2246898

                                                                           
Query: 593     acgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaacccttcttc 652
               ||||| ||||||| |||||| || | ||||||||||||||||||||||||||||||||| 
Sbjct: 2246897 acgtaatcgccgatcttgtacgtcctcaggtaggtggtgagcgggatgtaacccttcttg 2246838

                                            
Query: 653     cggaaggggcgcgcgaacaggtcgcgcgt 681
               ||||| || |||||||| |||||||||||
Sbjct: 2246837 cggaacggccgcgcgaagaggtcgcgcgt 2246809



 Score =  232 bits (117), Expect = 1e-57
 Identities = 225/261 (86%)
 Strand = Plus / Minus

                                                                           
Query: 217     ctagtaaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgat 276
               |||||||||||||||||||||||||||||||||||| |||||||| || || ||||| | 
Sbjct: 2248334 ctagtaaccacccttgagatcattgaccacatcatacggaatgggggtaacagtctccag 2248275

                                                                           
Query: 277     tgtggtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
                || | |||||| |||||||| || ||||| || ||    ||||| ||||||||||||||
Sbjct: 2248274 cgtagcaccctcaaccatgaaaccaggtttgggtccctcgggctgtctcttggtgctgat 2248215

                                                                           
Query: 337     gacctcaccacgtgccttggcttccgccttgagctggtcattcttcactttcctcaggcg 396
                ||||||||||| |||||||| || ||||||||||| || ||||| | ||||||||||||
Sbjct: 2248214 aacctcaccacgggccttggcatcagccttgagctgatcgttcttgattttcctcaggcg 2248155

                                                                           
Query: 397     gaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcct 456
               || |||||| |  |||||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 2248154 gagctcctcggtgcacctggatggctggacatgctccacacggacatggatcctcttcct 2248095

                                    
Query: 457     gatgatgcggtttccaacctg 477
               |||||||||||| || |||||
Sbjct: 2248094 gatgatgcggttaccgacctg 2248074



to top

>gb|AC137930.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0030C11,
              complete sequence
          Length = 156647

 Score =  319 bits (161), Expect = 7e-84
 Identities = 197/209 (94%)
 Strand = Plus / Minus

                                                                          
Query: 473    acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgtccggtg 532
              ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 137311 acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccagacgcggccggtg 137252

                                                                          
Query: 533    cggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcg 592
              |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 137251 cggccgtggtagaacttgtgcggcatgcccttgtgcacggcgccgttcaccttgacgtcg 137192

                                                                          
Query: 593    acgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaacccttcttc 652
              ||||| ||||||| |||||| || | ||||||||||||||||||||||||||||||||| 
Sbjct: 137191 acgtaatcgccgatcttgtacgtcctcaggtaggtggtgagcgggatgtaacccttcttg 137132

                                           
Query: 653    cggaaggggcgcgcgaacaggtcgcgcgt 681
              ||||| || |||||||| |||||||||||
Sbjct: 137131 cggaacggccgcgcgaagaggtcgcgcgt 137103



 Score =  232 bits (117), Expect = 1e-57
 Identities = 225/261 (86%)
 Strand = Plus / Minus

                                                                          
Query: 217    ctagtaaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgat 276
              |||||||||||||||||||||||||||||||||||| |||||||| || || ||||| | 
Sbjct: 138628 ctagtaaccacccttgagatcattgaccacatcatacggaatgggggtaacagtctccag 138569

                                                                          
Query: 277    tgtggtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
               || | |||||| |||||||| || ||||| || ||    ||||| ||||||||||||||
Sbjct: 138568 cgtagcaccctcaaccatgaaaccaggtttgggtccctcgggctgtctcttggtgctgat 138509

                                                                          
Query: 337    gacctcaccacgtgccttggcttccgccttgagctggtcattcttcactttcctcaggcg 396
               ||||||||||| |||||||| || ||||||||||| || ||||| | ||||||||||||
Sbjct: 138508 aacctcaccacgggccttggcatcagccttgagctgatcgttcttgattttcctcaggcg 138449

                                                                          
Query: 397    gaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcct 456
              || |||||| |  |||||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 138448 gagctcctcggtgcacctggatggctggacatgctccacacggacatggatcctcttcct 138389

                                   
Query: 457    gatgatgcggtttccaacctg 477
              |||||||||||| || |||||
Sbjct: 138388 gatgatgcggttaccgacctg 138368



to top

>gb|AC137697.2| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBb0081A17, from chromosome 3, complete sequence
          Length = 134821

 Score =  319 bits (161), Expect = 7e-84
 Identities = 197/209 (94%)
 Strand = Plus / Plus

                                                                         
Query: 473   acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgtccggtg 532
             ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 79039 acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccagacgcggccggtg 79098

                                                                         
Query: 533   cggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcg 592
             |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 79099 cggccgtggtagaacttgtgcggcatgcccttgtgcacggcgccgttcaccttgacgtcg 79158

                                                                         
Query: 593   acgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaacccttcttc 652
             ||||| ||||||| |||||| || | ||||||||||||||||||||||||||||||||| 
Sbjct: 79159 acgtaatcgccgatcttgtacgtcctcaggtaggtggtgagcgggatgtaacccttcttg 79218

                                          
Query: 653   cggaaggggcgcgcgaacaggtcgcgcgt 681
             ||||| || |||||||| |||||||||||
Sbjct: 79219 cggaacggccgcgcgaagaggtcgcgcgt 79247



 Score =  232 bits (117), Expect = 1e-57
 Identities = 225/261 (86%)
 Strand = Plus / Plus

                                                                         
Query: 217   ctagtaaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgat 276
             |||||||||||||||||||||||||||||||||||| |||||||| || || ||||| | 
Sbjct: 77722 ctagtaaccacccttgagatcattgaccacatcatacggaatgggggtaacagtctccag 77781

                                                                         
Query: 277   tgtggtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
              || | |||||| |||||||| || ||||| || ||    ||||| ||||||||||||||
Sbjct: 77782 cgtagcaccctcaaccatgaaaccaggtttgggtccctcgggctgtctcttggtgctgat 77841

                                                                         
Query: 337   gacctcaccacgtgccttggcttccgccttgagctggtcattcttcactttcctcaggcg 396
              ||||||||||| |||||||| || ||||||||||| || ||||| | ||||||||||||
Sbjct: 77842 aacctcaccacgggccttggcatcagccttgagctgatcgttcttgattttcctcaggcg 77901

                                                                         
Query: 397   gaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcct 456
             || |||||| |  |||||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 77902 gagctcctcggtgcacctggatggctggacatgctccacacggacatggatcctcttcct 77961

                                  
Query: 457   gatgatgcggtttccaacctg 477
             |||||||||||| || |||||
Sbjct: 77962 gatgatgcggttaccgacctg 77982



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  319 bits (161), Expect = 7e-84
 Identities = 197/209 (94%)
 Strand = Plus / Minus

                                                                           
Query: 473     acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgtccggtg 532
               ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 2247029 acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccagacgcggccggtg 2246970

                                                                           
Query: 533     cggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcg 592
               |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 2246969 cggccgtggtagaacttgtgcggcatgcccttgtgcacggcgccgttcaccttgacgtcg 2246910

                                                                           
Query: 593     acgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaacccttcttc 652
               ||||| ||||||| |||||| || | ||||||||||||||||||||||||||||||||| 
Sbjct: 2246909 acgtaatcgccgatcttgtacgtcctcaggtaggtggtgagcgggatgtaacccttcttg 2246850

                                            
Query: 653     cggaaggggcgcgcgaacaggtcgcgcgt 681
               ||||| || |||||||| |||||||||||
Sbjct: 2246849 cggaacggccgcgcgaagaggtcgcgcgt 2246821



 Score =  232 bits (117), Expect = 1e-57
 Identities = 225/261 (86%)
 Strand = Plus / Minus

                                                                           
Query: 217     ctagtaaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgat 276
               |||||||||||||||||||||||||||||||||||| |||||||| || || ||||| | 
Sbjct: 2248346 ctagtaaccacccttgagatcattgaccacatcatacggaatgggggtaacagtctccag 2248287

                                                                           
Query: 277     tgtggtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
                || | |||||| |||||||| || ||||| || ||    ||||| ||||||||||||||
Sbjct: 2248286 cgtagcaccctcaaccatgaaaccaggtttgggtccctcgggctgtctcttggtgctgat 2248227

                                                                           
Query: 337     gacctcaccacgtgccttggcttccgccttgagctggtcattcttcactttcctcaggcg 396
                ||||||||||| |||||||| || ||||||||||| || ||||| | ||||||||||||
Sbjct: 2248226 aacctcaccacgggccttggcatcagccttgagctgatcgttcttgattttcctcaggcg 2248167

                                                                           
Query: 397     gaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcct 456
               || |||||| |  |||||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 2248166 gagctcctcggtgcacctggatggctggacatgctccacacggacatggatcctcttcct 2248107

                                    
Query: 457     gatgatgcggtttccaacctg 477
               |||||||||||| || |||||
Sbjct: 2248106 gatgatgcggttaccgacctg 2248086



to top

>dbj|AK120267.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013047I10, full
           insert sequence
          Length = 2007

 Score =  319 bits (161), Expect = 7e-84
 Identities = 197/209 (94%)
 Strand = Plus / Minus

                                                                       
Query: 473 acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgtccggtg 532
           ||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||
Sbjct: 319 acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccagacgcggccggtg 260

                                                                       
Query: 533 cggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcg 592
           |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 259 cggccgtggtagaacttgtgcggcatgcccttgtgcacggcgccgttcaccttgacgtcg 200

                                                                       
Query: 593 acgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaacccttcttc 652
           ||||| ||||||| |||||| || | ||||||||||||||||||||||||||||||||| 
Sbjct: 199 acgtaatcgccgatcttgtacgtcctcaggtaggtggtgagcgggatgtaacccttcttg 140

                                        
Query: 653 cggaaggggcgcgcgaacaggtcgcgcgt 681
           ||||| || |||||||| |||||||||||
Sbjct: 139 cggaacggccgcgcgaagaggtcgcgcgt 111



 Score =  232 bits (117), Expect = 1e-57
 Identities = 225/261 (86%)
 Strand = Plus / Minus

                                                                        
Query: 217  ctagtaaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgat 276
            |||||||||||||||||||||||||||||||||||| |||||||| || || ||||| | 
Sbjct: 1636 ctagtaaccacccttgagatcattgaccacatcatacggaatgggggtaacagtctccag 1577

                                                                        
Query: 277  tgtggtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
             || | |||||| |||||||| || ||||| || ||    ||||| ||||||||||||||
Sbjct: 1576 cgtagcaccctcaaccatgaaaccaggtttgggtccctcgggctgtctcttggtgctgat 1517

                                                                        
Query: 337  gacctcaccacgtgccttggcttccgccttgagctggtcattcttcactttcctcaggcg 396
             ||||||||||| |||||||| || ||||||||||| || ||||| | ||||||||||||
Sbjct: 1516 aacctcaccacgggccttggcatcagccttgagctgatcgttcttgattttcctcaggcg 1457

                                                                        
Query: 397  gaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcct 456
            || |||||| |  |||||||||||||| |||||||| ||||||||||||||||| |||||
Sbjct: 1456 gagctcctcggtgcacctggatggctggacatgctccacacggacatggatcctcttcct 1397

                                 
Query: 457  gatgatgcggtttccaacctg 477
            |||||||||||| || |||||
Sbjct: 1396 gatgatgcggttaccgacctg 1376



to top

>ref|NM_100841.2| Arabidopsis thaliana structural constituent of ribosome AT1G09690
           mRNA, complete cds
          Length = 755

 Score =  194 bits (98), Expect = 3e-46
 Identities = 359/446 (80%)
 Strand = Plus / Minus

                                                                       
Query: 227 cccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtggtaccc 286
           ||||||||||| ||||| ||||| || || || |||||||| ||||| |  ||  | || 
Sbjct: 526 cccttgagatcgttgacgacatcgtacgggattggagtgacagtctccaaggtcattcct 467

                                                                       
Query: 287 tcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgatgacctcacca 346
           ||||||||||| || ||||| || ||    ||||| |||||||||||||||  |||||||
Sbjct: 466 tcgaccatgaatcctggtttgggtcctttaggctgtctcttggtgctgatggtctcacca 407

                                                                       
Query: 347 cgtgccttggcttccgccttgagctggtcattcttcactttcctcaggcggaactcctca 406
              || |||||| | ||||||||||  |||||||||   ||||||||   ||||||||||
Sbjct: 406 ttggctttggctgcagccttgagctcatcattcttcttcttcctcagcttgaactcctca 347

                                                                       
Query: 407 gcacacctggatggctgcacatgctcaacacggacatggatccttttcctgatgatgcgg 466
           ||||| || ||| ||||||||||||| ||||| ||||| ||||| ||||| ||||| | |
Sbjct: 346 gcacatcttgattgctgcacatgctccacacgcacatgaatcctcttccttatgatcctg 287

                                                                       
Query: 467 tttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgt 526
           || |||| ||| |||||||  || || |||| |||||| || ||||||||||| |  || 
Sbjct: 286 ttgccaatctgtttgttgacttcaacaccgacggcgcgtttagtgacgttccagatacga 227

                                                                       
Query: 527 ccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttg 586
           || || || ||||||||||||||||| |||||||||||||| |  || || |||||||| 
Sbjct: 226 ccagtacgaccgtggtagaacttgtgaggcatacccttgtggatcgcaccattcaccttc 167

                                                                       
Query: 587 acgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaaccc 646
           || |||||||| |||||||||||| |||| | |||||| || | ||| || |||||||||
Sbjct: 166 acatcgacgtaatcgccgaccttgaaggttctcaggtaagtcgagagtggaatgtaaccc 107

                                     
Query: 647 ttcttccggaaggggcgcgcgaacag 672
           ||||||| ||| || | |||||||||
Sbjct: 106 ttcttcctgaatggcctcgcgaacag 81



to top

>gb|AY081656.1| Arabidopsis thaliana similar to ribosomal protein L21 (At1g09690)
           mRNA, complete cds
          Length = 538

 Score =  194 bits (98), Expect = 3e-46
 Identities = 359/446 (80%)
 Strand = Plus / Minus

                                                                       
Query: 227 cccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtggtaccc 286
           ||||||||||| ||||| ||||| || || || |||||||| ||||| |  ||  | || 
Sbjct: 485 cccttgagatcgttgacgacatcgtacgggattggagtgacagtctccaaggtcattcct 426

                                                                       
Query: 287 tcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgatgacctcacca 346
           ||||||||||| || ||||| || ||    ||||| |||||||||||||||  |||||||
Sbjct: 425 tcgaccatgaatcctggtttgggtcctttaggctgtctcttggtgctgatggtctcacca 366

                                                                       
Query: 347 cgtgccttggcttccgccttgagctggtcattcttcactttcctcaggcggaactcctca 406
              || |||||| | ||||||||||  |||||||||   ||||||||   ||||||||||
Sbjct: 365 ttggctttggctgcagccttgagctcatcattcttcttcttcctcagcttgaactcctca 306

                                                                       
Query: 407 gcacacctggatggctgcacatgctcaacacggacatggatccttttcctgatgatgcgg 466
           ||||| || ||| ||||||||||||| ||||| ||||| ||||| ||||| ||||| | |
Sbjct: 305 gcacatcttgattgctgcacatgctccacacgcacatgaatcctcttccttatgatcctg 246

                                                                       
Query: 467 tttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgt 526
           || |||| ||| |||||||  || || |||| |||||| || ||||||||||| |  || 
Sbjct: 245 ttgccaatctgtttgttgacttcaacaccgacggcgcgtttagtgacgttccagatacga 186

                                                                       
Query: 527 ccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttg 586
           || || || ||||||||||||||||| |||||||||||||| |  || || |||||||| 
Sbjct: 185 ccagtacgaccgtggtagaacttgtgaggcatacccttgtggatcgcaccattcaccttc 126

                                                                       
Query: 587 acgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaaccc 646
           || |||||||| |||||||||||| |||| | |||||| || | ||| || |||||||||
Sbjct: 125 acatcgacgtaatcgccgaccttgaaggttctcaggtaagtcgagagtggaatgtaaccc 66

                                     
Query: 647 ttcttccggaaggggcgcgcgaacag 672
           ||||||| ||| || | |||||||||
Sbjct: 65  ttcttcctgaatggcctcgcgaacag 40



to top

>gb|AY059923.1| Arabidopsis thaliana Similar to ribosomal protein L21 (At1g09690;
           F21M12.8) mRNA, complete cds
          Length = 665

 Score =  194 bits (98), Expect = 3e-46
 Identities = 359/446 (80%)
 Strand = Plus / Minus

                                                                       
Query: 227 cccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtggtaccc 286
           ||||||||||| ||||| ||||| || || || |||||||| ||||| |  ||  | || 
Sbjct: 526 cccttgagatcgttgacgacatcgtacgggattggagtgacagtctccaaggtcattcct 467

                                                                       
Query: 287 tcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgatgacctcacca 346
           ||||||||||| || ||||| || ||    ||||| |||||||||||||||  |||||||
Sbjct: 466 tcgaccatgaatcctggtttgggtcctttaggctgtctcttggtgctgatggtctcacca 407

                                                                       
Query: 347 cgtgccttggcttccgccttgagctggtcattcttcactttcctcaggcggaactcctca 406
              || |||||| | ||||||||||  |||||||||   ||||||||   ||||||||||
Sbjct: 406 ttggctttggctgcagccttgagctcatcattcttcttcttcctcagcttgaactcctca 347

                                                                       
Query: 407 gcacacctggatggctgcacatgctcaacacggacatggatccttttcctgatgatgcgg 466
           ||||| || ||| ||||||||||||| ||||| ||||| ||||| ||||| ||||| | |
Sbjct: 346 gcacatcttgattgctgcacatgctccacacgcacatgaatcctcttccttatgatcctg 287

                                                                       
Query: 467 tttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgt 526
           || |||| ||| |||||||  || || |||| |||||| || ||||||||||| |  || 
Sbjct: 286 ttgccaatctgtttgttgacttcaacaccgacggcgcgtttagtgacgttccagatacga 227

                                                                       
Query: 527 ccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttg 586
           || || || ||||||||||||||||| |||||||||||||| |  || || |||||||| 
Sbjct: 226 ccagtacgaccgtggtagaacttgtgaggcatacccttgtggatcgcaccattcaccttc 167

                                                                       
Query: 587 acgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaaccc 646
           || |||||||| |||||||||||| |||| | |||||| || | ||| || |||||||||
Sbjct: 166 acatcgacgtaatcgccgaccttgaaggttctcaggtaagtcgagagtggaatgtaaccc 107

                                     
Query: 647 ttcttccggaaggggcgcgcgaacag 672
           ||||||| ||| || | |||||||||
Sbjct: 106 ttcttcctgaatggcctcgcgaacag 81



to top

>dbj|AP004496.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT11C13, TM0029a,
             complete sequence
          Length = 53909

 Score =  188 bits (95), Expect = 2e-44
 Identities = 167/191 (87%)
 Strand = Plus / Minus

                                                                         
Query: 473   acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgtccggtg 532
             ||||||||||||| ||||||||||||||||||||||||||| ||||| || || ||||||
Sbjct: 14959 acctgcttgttgacctcgacgccgatggcgcgcttggtgacattccagacacgaccggtg 14900

                                                                         
Query: 533   cggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcg 592
             ||||| |||||||||||||| |||||||||||||| ||||||||||| ||  ||||||||
Sbjct: 14899 cggccatggtagaacttgtgaggcatacccttgtggacggcgccgttaactctgacgtcg 14840

                                                                         
Query: 593   acgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaacccttcttc 652
             ||||| |||||||    ||| || || |||||||||||||| ||||||   |||||||||
Sbjct: 14839 acgtagtcgccgatgcggtacgtacggaggtaggtggtgagggggatggttcccttcttc 14780

                        
Query: 653   cggaaggggcg 663
             | |||||||||
Sbjct: 14779 ctgaaggggcg 14769



 Score =  125 bits (63), Expect = 2e-25
 Identities = 215/263 (81%), Gaps = 2/263 (0%)
 Strand = Plus / Minus

                                                                         
Query: 216   cctagtaaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcga 275
             ||||||| || || ||||| ||||| ||||||||||| ||||| |||||||| ||||| |
Sbjct: 15872 cctagtagccccctttgaggtcattaaccacatcatatggaataggagtgacagtctcca 15813

                                                                         
Query: 276   ttgtggtaccctcgaccatgaacccgggtttagggccgag-tggctgcctcttggtgctg 334
              |||||  || || |||||||| || ||||| ||||| ||  ||||||||||||||||||
Sbjct: 15812 atgtggcgccttcaaccatgaaacctggttt-gggcccagcaggctgcctcttggtgctg 15754

                                                                         
Query: 335   atgacctcaccacgtgccttggcttccgccttgagctggtcattcttcactttcctcagg 394
             || ||||||||    ||||| || || ||||| ||||| |||||||| || ||||| || 
Sbjct: 15753 atcacctcacccttggccttagcctcggccttcagctgatcattcttaaccttcctgaga 15694

                                                                         
Query: 395   cggaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttc 454
             |||||||||||||  || | |||||||  ||||||||| ||||| ||||| || || |||
Sbjct: 15693 cggaactcctcagtgcaacgggatggcatcacatgctccacacgcacatgaattctcttc 15634

                                    
Query: 455   ctgatgatgcggtttccaacctg 477
             ||||| || |||||||| |||||
Sbjct: 15633 ctgataatccggtttcccacctg 15611



to top

>emb|BX814291.1|CNS0ADUZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB66ZE01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 660

 Score =  178 bits (90), Expect = 2e-41
 Identities = 357/446 (80%)
 Strand = Plus / Minus

                                                                       
Query: 227 cccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtggtaccc 286
           ||||||||||| ||||| ||||| || || || |||||||| ||||| |  ||  | || 
Sbjct: 513 cccttgagatcgttgacgacatcgtacgggattggagtgacagtctccaaggtcattcct 454

                                                                       
Query: 287 tcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgatgacctcacca 346
           ||||||||||| || ||||| || ||    ||||| |||||||||||||||  |||||||
Sbjct: 453 tcgaccatgaatcctggtttgggtcctttaggctgtctcttggtgctgatggtctcacca 394

                                                                       
Query: 347 cgtgccttggcttccgccttgagctggtcattcttcactttcctcaggcggaactcctca 406
              || |||||| | ||||||||||  |||||||||   ||||||||   ||||||||||
Sbjct: 393 ttggctttggctgcagccttgagctcatcattcttcttcttcctcagcttgaactcctca 334

                                                                       
Query: 407 gcacacctggatggctgcacatgctcaacacggacatggatccttttcctgatgatgcgg 466
           ||||| || ||  ||||||||||||| ||||| ||||| ||||| ||||| ||||| | |
Sbjct: 333 gcacatcttgactgctgcacatgctccacacgcacatgaatcctcttccttatgatcctg 274

                                                                       
Query: 467 tttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgt 526
           || |||| ||| |||| ||  || || |||| |||||| || ||||||||||| |  || 
Sbjct: 273 ttgccaatctgtttgtcgacttcaacaccgacggcgcgtttagtgacgttccagatacga 214

                                                                       
Query: 527 ccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttg 586
           || || || ||||||||||||||||| |||||||||||||| |  || || |||||||| 
Sbjct: 213 ccagtacgaccgtggtagaacttgtgaggcatacccttgtggatcgcaccattcaccttc 154

                                                                       
Query: 587 acgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaaccc 646
           || |||||||| |||||||||||| |||| | |||||| || | ||| || |||||||||
Sbjct: 153 acatcgacgtaatcgccgaccttgaaggttctcaggtaagtcgagagtggaatgtaaccc 94

                                     
Query: 647 ttcttccggaaggggcgcgcgaacag 672
           ||||||| ||| || | |||||||||
Sbjct: 93  ttcttcctgaatggcctcgcgaacag 68



to top

>ref|NM_100831.2| Arabidopsis thaliana structural constituent of ribosome AT1G09590
           mRNA, complete cds
          Length = 675

 Score =  159 bits (80), Expect = 1e-35
 Identities = 287/356 (80%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggctgcctcttggtgctgatgacctcaccacgtgccttggcttccgccttgagctggtca 376
           ||||| |||||||||||||||  |||||||   || |||||| | ||||||||||  || 
Sbjct: 409 ggctgtctcttggtgctgatggtctcaccattggctttggctgcagccttgagctcatcg 350

                                                                       
Query: 377 ttcttcactttcctcaggcggaactcctcagcacacctggatggctgcacatgctcaaca 436
           || |||   ||||||||   ||||||||| ||||| || ||  ||||||||||||| |||
Sbjct: 349 tttttcttcttcctcagcttgaactcctcggcacatcttgactgctgcacatgctccaca 290

                                                                       
Query: 437 cggacatggatccttttcctgatgatgcggtttccaacctgcttgttgatctcgacgccg 496
           || ||||| ||||| ||||| ||||| | ||| |||| ||| |||||||  || || |||
Sbjct: 289 cgaacatgaatcctcttccttatgatcctgttcccaatctgtttgttgacttcaacaccg 230

                                                                       
Query: 497 atggcgcgcttggtgacgttccacacgcgtccggtgcggccgtggtagaacttgtgcggc 556
           | ||||||||||||||||||||| |  || || || || || |||||||||||||| |||
Sbjct: 229 acggcgcgcttggtgacgttccagatacgaccagtacgaccatggtagaacttgtgaggc 170

                                                                       
Query: 557 atacccttgtgcacggcgccgttcaccttgacgtcgacgtactcgccgaccttgtaggtg 616
           ||||||||||| |  || || |||||||| || |||||||| |||||||||||| |||| 
Sbjct: 169 atacccttgtggatcgcaccattcaccttcacatcgacgtaatcgccgaccttgaaggtc 110

                                                                   
Query: 617 cgcaggtaggtggtgagcgggatgtaacccttcttccggaaggggcgcgcgaacag 672
           | |||||| || |  || || |||||||||||||||| ||| || | |||||||||
Sbjct: 109 ctcaggtaagtcgatagaggaatgtaacccttcttcctgaaaggcctcgcgaacag 54



to top

>gb|BT000775.1| Arabidopsis thaliana clone RAFL04-10-C15 (R11681) putative 60S
           ribosomal protein L21 (At1g09590) mRNA, complete cds
          Length = 672

 Score =  159 bits (80), Expect = 1e-35
 Identities = 287/356 (80%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggctgcctcttggtgctgatgacctcaccacgtgccttggcttccgccttgagctggtca 376
           ||||| |||||||||||||||  |||||||   || |||||| | ||||||||||  || 
Sbjct: 409 ggctgtctcttggtgctgatggtctcaccattggctttggctgcagccttgagctcatcg 350

                                                                       
Query: 377 ttcttcactttcctcaggcggaactcctcagcacacctggatggctgcacatgctcaaca 436
           || |||   ||||||||   ||||||||| ||||| || ||  ||||||||||||| |||
Sbjct: 349 tttttcttcttcctcagcttgaactcctcggcacatcttgactgctgcacatgctccaca 290

                                                                       
Query: 437 cggacatggatccttttcctgatgatgcggtttccaacctgcttgttgatctcgacgccg 496
           || ||||| ||||| ||||| ||||| | ||| |||| ||| |||||||  || || |||
Sbjct: 289 cgaacatgaatcctcttccttatgatcctgttcccaatctgtttgttgacttcaacaccg 230

                                                                       
Query: 497 atggcgcgcttggtgacgttccacacgcgtccggtgcggccgtggtagaacttgtgcggc 556
           | ||||||||||||||||||||| |  || || || || || |||||||||||||| |||
Sbjct: 229 acggcgcgcttggtgacgttccagatacgaccagtacgaccatggtagaacttgtgaggc 170

                                                                       
Query: 557 atacccttgtgcacggcgccgttcaccttgacgtcgacgtactcgccgaccttgtaggtg 616
           ||||||||||| |  || || |||||||| || |||||||| |||||||||||| |||| 
Sbjct: 169 atacccttgtggatcgcaccattcaccttcacatcgacgtaatcgccgaccttgaaggtc 110

                                                                   
Query: 617 cgcaggtaggtggtgagcgggatgtaacccttcttccggaaggggcgcgcgaacag 672
           | |||||| || |  || || |||||||||||||||| ||| || | |||||||||
Sbjct: 109 ctcaggtaagtcgatagaggaatgtaacccttcttcctgaaaggcctcgcgaacag 54



to top

>gb|AY059119.1| Arabidopsis thaliana putative 60S ribosomal protein L21 (At1g09590)
           mRNA, complete cds
          Length = 526

 Score =  159 bits (80), Expect = 1e-35
 Identities = 287/356 (80%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggctgcctcttggtgctgatgacctcaccacgtgccttggcttccgccttgagctggtca 376
           ||||| |||||||||||||||  |||||||   || |||||| | ||||||||||  || 
Sbjct: 395 ggctgtctcttggtgctgatggtctcaccattggctttggctgcagccttgagctcatcg 336

                                                                       
Query: 377 ttcttcactttcctcaggcggaactcctcagcacacctggatggctgcacatgctcaaca 436
           || |||   ||||||||   ||||||||| ||||| || ||  ||||||||||||| |||
Sbjct: 335 tttttcttcttcctcagcttgaactcctcggcacatcttgactgctgcacatgctccaca 276

                                                                       
Query: 437 cggacatggatccttttcctgatgatgcggtttccaacctgcttgttgatctcgacgccg 496
           || ||||| ||||| ||||| ||||| | ||| |||| ||| |||||||  || || |||
Sbjct: 275 cgaacatgaatcctcttccttatgatcctgttcccaatctgtttgttgacttcaacaccg 216

                                                                       
Query: 497 atggcgcgcttggtgacgttccacacgcgtccggtgcggccgtggtagaacttgtgcggc 556
           | ||||||||||||||||||||| |  || || || || || |||||||||||||| |||
Sbjct: 215 acggcgcgcttggtgacgttccagatacgaccagtacgaccatggtagaacttgtgaggc 156

                                                                       
Query: 557 atacccttgtgcacggcgccgttcaccttgacgtcgacgtactcgccgaccttgtaggtg 616
           ||||||||||| |  || || |||||||| || |||||||| |||||||||||| |||| 
Sbjct: 155 atacccttgtggatcgcaccattcaccttcacatcgacgtaatcgccgaccttgaaggtc 96

                                                                   
Query: 617 cgcaggtaggtggtgagcgggatgtaacccttcttccggaaggggcgcgcgaacag 672
           | |||||| || |  || || |||||||||||||||| ||| || | |||||||||
Sbjct: 95  ctcaggtaagtcgatagaggaatgtaacccttcttcctgaaaggcctcgcgaacag 40



to top

>gb|AF370227.1| Arabidopsis thaliana putative 60S ribosomal protein L21 (At1g09590)
           mRNA, complete cds
          Length = 674

 Score =  159 bits (80), Expect = 1e-35
 Identities = 287/356 (80%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggctgcctcttggtgctgatgacctcaccacgtgccttggcttccgccttgagctggtca 376
           ||||| |||||||||||||||  |||||||   || |||||| | ||||||||||  || 
Sbjct: 409 ggctgtctcttggtgctgatggtctcaccattggctttggctgcagccttgagctcatcg 350

                                                                       
Query: 377 ttcttcactttcctcaggcggaactcctcagcacacctggatggctgcacatgctcaaca 436
           || |||   ||||||||   ||||||||| ||||| || ||  ||||||||||||| |||
Sbjct: 349 tttttcttcttcctcagcttgaactcctcggcacatcttgactgctgcacatgctccaca 290

                                                                       
Query: 437 cggacatggatccttttcctgatgatgcggtttccaacctgcttgttgatctcgacgccg 496
           || ||||| ||||| ||||| ||||| | ||| |||| ||| |||||||  || || |||
Sbjct: 289 cgaacatgaatcctcttccttatgatcctgttcccaatctgtttgttgacttcaacaccg 230

                                                                       
Query: 497 atggcgcgcttggtgacgttccacacgcgtccggtgcggccgtggtagaacttgtgcggc 556
           | ||||||||||||||||||||| |  || || || || || |||||||||||||| |||
Sbjct: 229 acggcgcgcttggtgacgttccagatacgaccagtacgaccatggtagaacttgtgaggc 170

                                                                       
Query: 557 atacccttgtgcacggcgccgttcaccttgacgtcgacgtactcgccgaccttgtaggtg 616
           ||||||||||| |  || || |||||||| || |||||||| |||||||||||| |||| 
Sbjct: 169 atacccttgtggatcgcaccattcaccttcacatcgacgtaatcgccgaccttgaaggtc 110

                                                                   
Query: 617 cgcaggtaggtggtgagcgggatgtaacccttcttccggaaggggcgcgcgaacag 672
           | |||||| || |  || || |||||||||||||||| ||| || | |||||||||
Sbjct: 109 ctcaggtaagtcgatagaggaatgtaacccttcttcctgaaaggcctcgcgaacag 54



to top

>emb|BX816463.1|CNS0AANS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH4ZD12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 569

 Score =  159 bits (80), Expect = 1e-35
 Identities = 287/356 (80%)
 Strand = Plus / Minus

                                                                       
Query: 317 ggctgcctcttggtgctgatgacctcaccacgtgccttggcttccgccttgagctggtca 376
           ||||| |||||||||||||||  |||||||   || |||||| | ||||||||||  || 
Sbjct: 377 ggctgtctcttggtgctgatggtctcaccattggctttggctgcagccttgagctcatcg 318

                                                                       
Query: 377 ttcttcactttcctcaggcggaactcctcagcacacctggatggctgcacatgctcaaca 436
           || |||   ||||||||   ||||||||| ||||| || ||  ||||||||||||| |||
Sbjct: 317 tttttcttcttcctcagcttgaactcctcggcacatcttgactgctgcacatgctccaca 258

                                                                       
Query: 437 cggacatggatccttttcctgatgatgcggtttccaacctgcttgttgatctcgacgccg 496
           || ||||| ||||| ||||| ||||| | ||| |||| ||| |||||||  || || |||
Sbjct: 257 cgaacatgaatcctcttccttatgatcctgttcccaatctgtttgttgacttcaacaccg 198

                                                                       
Query: 497 atggcgcgcttggtgacgttccacacgcgtccggtgcggccgtggtagaacttgtgcggc 556
           | ||||||||||||||||||||| |  || || || || || |||||||||||||| |||
Sbjct: 197 acggcgcgcttggtgacgttccagatacgaccagtacgaccatggtagaacttgtgaggc 138

                                                                       
Query: 557 atacccttgtgcacggcgccgttcaccttgacgtcgacgtactcgccgaccttgtaggtg 616
           ||||||||||| |  || || |||||||| || |||||||| |||||||||||| |||| 
Sbjct: 137 atacccttgtggatcgcaccattcaccttcacatcgacgtaatcgccgaccttgaaggtc 78

                                                                   
Query: 617 cgcaggtaggtggtgagcgggatgtaacccttcttccggaaggggcgcgcgaacag 672
           | |||||| || |  || || |||||||||||||||| ||| || | |||||||||
Sbjct: 77  ctcaggtaagtcgatagaggaatgtaacccttcttcctgaaaggcctcgcgaacag 22



to top

>ref|NM_104563.3| Arabidopsis thaliana structural constituent of ribosome AT1G57660
           mRNA, complete cds
          Length = 715

 Score =  125 bits (63), Expect = 2e-25
 Identities = 222/275 (80%)
 Strand = Plus / Minus

                                                                       
Query: 398 aactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcctg 457
           ||||||||||||||||| ||  | ||||||||||| ||||| ||||| ||||| ||||| 
Sbjct: 361 aactcctcagcacaccttgactgttgcacatgctccacacgcacatgtatcctcttcctt 302

                                                                       
Query: 458 atgatgcggtttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgttc 517
           ||||| | ||| |||| ||| |||||||  || || || | ||| ||||| ||||| |||
Sbjct: 301 atgattctgttcccaatctgtttgttgacttcaacaccaacggcacgcttagtgacattc 242

                                                                       
Query: 518 cacacgcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgccg 577
           || | ||| || || || || ||||||||||| || |||||||||||||| |  || || 
Sbjct: 241 cagatgcgaccagtacgaccatggtagaacttatgaggcatacccttgtggatagctcca 182

                                                                       
Query: 578 ttcaccttgacgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcggg 637
           || |||||||| |||||||| |||||||||||| |||| |  ||||| |||| ||| || 
Sbjct: 181 ttaaccttgacatcgacgtaatcgccgaccttgaaggttctgaggtaagtggagagtgga 122

                                              
Query: 638 atgtaacccttcttccggaaggggcgcgcgaacag 672
           || ||||||||||||| ||| || | |||||||||
Sbjct: 121 atataacccttcttcctgaatggtctcgcgaacag 87



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 99/116 (85%)
 Strand = Plus / Minus

                                                                       
Query: 221 taaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtg 280
           ||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||| | ||| 
Sbjct: 538 taaccacccttgagatcgttgacaacatcgtaaggaatgggagtgacagtctccaatgtc 479

                                                                   
Query: 281 gtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
            |||| ||||||||||| || |||||||| ||    ||||| ||||||||||||||
Sbjct: 478 ataccttcgaccatgaaacccggtttaggacctttaggctgtctcttggtgctgat 423



to top

>gb|AY091167.1| Arabidopsis thaliana putative 60S ribosomal protein L21 (At1g57660)
           mRNA, complete cds
          Length = 526

 Score =  125 bits (63), Expect = 2e-25
 Identities = 222/275 (80%)
 Strand = Plus / Minus

                                                                       
Query: 398 aactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcctg 457
           ||||||||||||||||| ||  | ||||||||||| ||||| ||||| ||||| ||||| 
Sbjct: 314 aactcctcagcacaccttgactgttgcacatgctccacacgcacatgtatcctcttcctt 255

                                                                       
Query: 458 atgatgcggtttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgttc 517
           ||||| | ||| |||| ||| |||||||  || || || | ||| ||||| ||||| |||
Sbjct: 254 atgattctgttcccaatctgtttgttgacttcaacaccaacggcacgcttagtgacattc 195

                                                                       
Query: 518 cacacgcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgccg 577
           || | ||| || || || || ||||||||||| || |||||||||||||| |  || || 
Sbjct: 194 cagatgcgaccagtacgaccatggtagaacttatgaggcatacccttgtggatagctcca 135

                                                                       
Query: 578 ttcaccttgacgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcggg 637
           || |||||||| |||||||| |||||||||||| |||| |  ||||| |||| ||| || 
Sbjct: 134 ttaaccttgacatcgacgtaatcgccgaccttgaaggttctgaggtaagtggagagtgga 75

                                              
Query: 638 atgtaacccttcttccggaaggggcgcgcgaacag 672
           || ||||||||||||| ||| || | |||||||||
Sbjct: 74  atataacccttcttcctgaatggtctcgcgaacag 40



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 99/116 (85%)
 Strand = Plus / Minus

                                                                       
Query: 221 taaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtg 280
           ||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||| | ||| 
Sbjct: 491 taaccacccttgagatcgttgacaacatcgtaaggaatgggagtgacagtctccaatgtc 432

                                                                   
Query: 281 gtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
            |||| ||||||||||| || |||||||| ||    ||||| ||||||||||||||
Sbjct: 431 ataccttcgaccatgaaacccggtttaggacctttaggctgtctcttggtgctgat 376



to top

>gb|AY050840.1| Arabidopsis thaliana putative 60S ribosomal protein L21 (At1g57660)
           mRNA, complete cds
          Length = 681

 Score =  125 bits (63), Expect = 2e-25
 Identities = 222/275 (80%)
 Strand = Plus / Minus

                                                                       
Query: 398 aactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcctg 457
           ||||||||||||||||| ||  | ||||||||||| ||||| ||||| ||||| ||||| 
Sbjct: 361 aactcctcagcacaccttgactgttgcacatgctccacacgcacatgtatcctcttcctt 302

                                                                       
Query: 458 atgatgcggtttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgttc 517
           ||||| | ||| |||| ||| |||||||  || || || | ||| ||||| ||||| |||
Sbjct: 301 atgattctgttcccaatctgtttgttgacttcaacaccaacggcacgcttagtgacattc 242

                                                                       
Query: 518 cacacgcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgccg 577
           || | ||| || || || || ||||||||||| || |||||||||||||| |  || || 
Sbjct: 241 cagatgcgaccagtacgaccatggtagaacttatgaggcatacccttgtggatagctcca 182

                                                                       
Query: 578 ttcaccttgacgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcggg 637
           || |||||||| |||||||| |||||||||||| |||| |  ||||| |||| ||| || 
Sbjct: 181 ttaaccttgacatcgacgtaatcgccgaccttgaaggttctgaggtaagtggagagtgga 122

                                              
Query: 638 atgtaacccttcttccggaaggggcgcgcgaacag 672
           || ||||||||||||| ||| || | |||||||||
Sbjct: 121 atataacccttcttcctgaatggtctcgcgaacag 87



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 99/116 (85%)
 Strand = Plus / Minus

                                                                       
Query: 221 taaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtg 280
           ||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||| | ||| 
Sbjct: 538 taaccacccttgagatcgttgacaacatcgtaaggaatgggagtgacagtctccaatgtc 479

                                                                   
Query: 281 gtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
            |||| ||||||||||| || |||||||| ||    ||||| ||||||||||||||
Sbjct: 478 ataccttcgaccatgaaacccggtttaggacctttaggctgtctcttggtgctgat 423



to top

>gb|AY086851.1| Arabidopsis thaliana clone 28545 mRNA, complete sequence
          Length = 627

 Score =  125 bits (63), Expect = 2e-25
 Identities = 222/275 (80%)
 Strand = Plus / Minus

                                                                       
Query: 398 aactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcctg 457
           ||||||||||||||||| ||  | ||||||||||| ||||| ||||| ||||| ||||| 
Sbjct: 358 aactcctcagcacaccttgactgttgcacatgctccacacgcacatgtatcctcttcctt 299

                                                                       
Query: 458 atgatgcggtttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgttc 517
           ||||| | ||| |||| ||| |||||||  || || || | ||| ||||| ||||| |||
Sbjct: 298 atgattctgttcccaatctgtttgttgacttcaacaccaacggcacgcttagtgacattc 239

                                                                       
Query: 518 cacacgcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgccg 577
           || | ||| || || || || ||||||||||| || |||||||||||||| |  || || 
Sbjct: 238 cagatgcgaccagtacgaccatggtagaacttatgaggcatacccttgtggatagctcca 179

                                                                       
Query: 578 ttcaccttgacgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcggg 637
           || |||||||| |||||||| |||||||||||| |||| |  ||||| |||| ||| || 
Sbjct: 178 ttaaccttgacatcgacgtaatcgccgaccttgaaggttctgaggtaagtggagagtgga 119

                                              
Query: 638 atgtaacccttcttccggaaggggcgcgcgaacag 672
           || ||||||||||||| ||| || | |||||||||
Sbjct: 118 atataacccttcttcctgaatggtctcgcgaacag 84



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 99/116 (85%)
 Strand = Plus / Minus

                                                                       
Query: 221 taaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtg 280
           ||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||| | ||| 
Sbjct: 535 taaccacccttgagatcgttgacaacatcgtaaggaatgggagtgacagtctccaatgtc 476

                                                                   
Query: 281 gtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
            |||| ||||||||||| || |||||||| ||    ||||| ||||||||||||||
Sbjct: 475 ataccttcgaccatgaaacccggtttaggacctttaggctgtctcttggtgctgat 420



to top

>ref|NM_104579.3| Arabidopsis thaliana structural constituent of ribosome AT1G57860
           mRNA, complete cds
          Length = 669

 Score =  117 bits (59), Expect = 5e-23
 Identities = 221/275 (80%)
 Strand = Plus / Minus

                                                                       
Query: 398 aactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcctg 457
           ||||||||||||||||| ||  | ||||||||||| ||||| ||||| ||||| ||||| 
Sbjct: 352 aactcctcagcacaccttgactgttgcacatgctccacacgcacatgtatcctcttcctt 293

                                                                       
Query: 458 atgatgcggtttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgttc 517
           ||||| | ||| |||| ||| |||||||  || || || | ||| || || ||||| |||
Sbjct: 292 atgattctgttcccaatctgtttgttgacttcaacaccaacggcacgtttagtgacattc 233

                                                                       
Query: 518 cacacgcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgccg 577
           || | ||| || || || || ||||||||||| || |||||||||||||| |  || || 
Sbjct: 232 cagatgcgaccagtacgaccatggtagaacttatgaggcatacccttgtggatagctcca 173

                                                                       
Query: 578 ttcaccttgacgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcggg 637
           || |||||||| |||||||| |||||||||||| |||| |  ||||| |||| ||| || 
Sbjct: 172 ttaaccttgacatcgacgtaatcgccgaccttgaaggttctgaggtaagtggagagtgga 113

                                              
Query: 638 atgtaacccttcttccggaaggggcgcgcgaacag 672
           || ||||||||||||| ||| || | |||||||||
Sbjct: 112 atataacccttcttcctgaatggtctcgcgaacag 78



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 98/116 (84%)
 Strand = Plus / Minus

                                                                       
Query: 221 taaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtg 280
           ||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||| | ||| 
Sbjct: 529 taaccacccttgagatcgttgacaacatcgtaaggaatgggagtgacagtctccaatgtc 470

                                                                   
Query: 281 gtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
            |||| || |||||||| || |||||||| ||    ||||| ||||||||||||||
Sbjct: 469 ataccttcaaccatgaaacccggtttaggacctttaggctgtctcttggtgctgat 414



to top

>gb|BT004794.1| Arabidopsis thaliana At1g57860 gene, complete cds
          Length = 495

 Score =  117 bits (59), Expect = 5e-23
 Identities = 221/275 (80%)
 Strand = Plus / Minus

                                                                       
Query: 398 aactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcctg 457
           ||||||||||||||||| ||  | ||||||||||| ||||| ||||| ||||| ||||| 
Sbjct: 314 aactcctcagcacaccttgactgttgcacatgctccacacgcacatgtatcctcttcctt 255

                                                                       
Query: 458 atgatgcggtttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgttc 517
           ||||| | ||| |||| ||| |||||||  || || || | ||| || || ||||| |||
Sbjct: 254 atgattctgttcccaatctgtttgttgacttcaacaccaacggcacgtttagtgacattc 195

                                                                       
Query: 518 cacacgcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgccg 577
           || | ||| || || || || ||||||||||| || |||||||||||||| |  || || 
Sbjct: 194 cagatgcgaccagtacgaccatggtagaacttatgaggcatacccttgtggatagctcca 135

                                                                       
Query: 578 ttcaccttgacgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcggg 637
           || |||||||| |||||||| |||||||||||| |||| |  ||||| |||| ||| || 
Sbjct: 134 ttaaccttgacatcgacgtaatcgccgaccttgaaggttctgaggtaagtggagagtgga 75

                                              
Query: 638 atgtaacccttcttccggaaggggcgcgcgaacag 672
           || ||||||||||||| ||| || | |||||||||
Sbjct: 74  atataacccttcttcctgaatggtctcgcgaacag 40



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 98/116 (84%)
 Strand = Plus / Minus

                                                                       
Query: 221 taaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtg 280
           ||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||| | ||| 
Sbjct: 491 taaccacccttgagatcgttgacaacatcgtaaggaatgggagtgacagtctccaatgtc 432

                                                                   
Query: 281 gtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
            |||| || |||||||| || |||||||| ||    ||||| ||||||||||||||
Sbjct: 431 ataccttcaaccatgaaacccggtttaggacctttaggctgtctcttggtgctgat 376



to top

>gb|AC003970.1| Arabidopsis thaliana chromosome I BAC F14J9 genomic sequence contains
             phyA marker, complete sequence
          Length = 95865

 Score =  111 bits (56), Expect = 3e-21
 Identities = 164/200 (82%)
 Strand = Plus / Minus

                                                                         
Query: 473   acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgtccggtg 532
             ||||| |||||||  || || |||| ||||||||||||||||||||| |  || || || 
Sbjct: 88390 acctgtttgttgacttcaacaccgacggcgcgcttggtgacgttccagatacgaccagta 88331

                                                                         
Query: 533   cggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcg 592
             || || |||||||||||||| |||||||||||||| |  || || |||||||| || |||
Sbjct: 88330 cgaccatggtagaacttgtgaggcatacccttgtggatcgcaccattcaccttcacatcg 88271

                                                                         
Query: 593   acgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaacccttcttc 652
             ||||| |||||||||||| |||| | |||||| || |  || || |||||||||||||||
Sbjct: 88270 acgtaatcgccgaccttgaaggtcctcaggtaagtcgatagaggaatgtaacccttcttc 88211

                                 
Query: 653   cggaaggggcgcgcgaacag 672
             | ||| || | |||||||||
Sbjct: 88210 ctgaaaggcctcgcgaacag 88191



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 109/134 (81%)
 Strand = Plus / Plus

                                                                         
Query: 539   tggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcgacgtac 598
             ||||||||||| || || ||||||||||| |  || || || |||||||| |||||||| 
Sbjct: 44727 tggtagaacttatgaggaatacccttgtgaatagctccattaaccttgacatcgacgtaa 44786

                                                                         
Query: 599   tcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaacccttcttccggaag 658
             |||||||||||| ||||    ||||| |||| ||| || || ||||||||||||| ||| 
Sbjct: 44787 tcgccgaccttgaaggttatgaggtaagtggagagtggaatataacccttcttcctgaat 44846

                           
Query: 659   gggcgcgcgaacag 672
             || | |||||||||
Sbjct: 44847 ggtctcgcgaacag 44860



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 117/146 (80%)
 Strand = Plus / Minus

                                                                         
Query: 317   ggctgcctcttggtgctgatgacctcaccacgtgccttggcttccgccttgagctggtca 376
             ||||| |||||||||||||||  |||||||   || |||||| | ||||||||||  || 
Sbjct: 89109 ggctgtctcttggtgctgatggtctcaccattggctttggctgcagccttgagctcatcg 89050

                                                                         
Query: 377   ttcttcactttcctcaggcggaactcctcagcacacctggatggctgcacatgctcaaca 436
             || |||   ||||||||   ||||||||| ||||| || ||  ||||||||||||| |||
Sbjct: 89049 tttttcttcttcctcagcttgaactcctcggcacatcttgactgctgcacatgctccaca 88990

                                       
Query: 437   cggacatggatccttttcctgatgat 462
             || ||||| ||||| ||||| |||||
Sbjct: 88989 cgaacatgaatcctcttccttatgat 88964



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                        
Query: 398   aactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcct 456
             ||||||||| ||||||| ||  | ||||||||||| ||||| ||||| ||||| |||||
Sbjct: 44275 aactcctcatcacaccttgactgttgcacatgctccacacgtacatgtatcctcttcct 44333



to top

>gb|AC000132.1|F21M12 Sequence of BAC F21M12 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 146505

 Score =  111 bits (56), Expect = 3e-21
 Identities = 164/200 (82%)
 Strand = Plus / Plus

                                                                         
Query: 473   acctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgtccggtg 532
             ||||| |||||||  || || |||| |||||| || ||||||||||| |  || || || 
Sbjct: 24078 acctgtttgttgacttcaacaccgacggcgcgtttagtgacgttccagatacgaccagta 24137

                                                                         
Query: 533   cggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcg 592
             || ||||||||||||||||| |||||||||||||| |  || || |||||||| || |||
Sbjct: 24138 cgaccgtggtagaacttgtgaggcatacccttgtggatcgcaccattcaccttcacatcg 24197

                                                                         
Query: 593   acgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaacccttcttc 652
             ||||| |||||||||||| |||| | |||||| || | ||| || |||||||||||||||
Sbjct: 24198 acgtaatcgccgaccttgaaggttctcaggtaagtcgagagtggaatgtaacccttcttc 24257

                                 
Query: 653   cggaaggggcgcgcgaacag 672
             | ||| || | |||||||||
Sbjct: 24258 ctgaatggcctcgcgaacag 24277



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 189/236 (80%)
 Strand = Plus / Plus

                                                                         
Query: 227   cccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtggtaccc 286
             ||||||||||| ||||| ||||| || || || |||||||| ||||| |  ||  | || 
Sbjct: 23303 cccttgagatcgttgacgacatcgtacgggattggagtgacagtctccaaggtcattcct 23362

                                                                         
Query: 287   tcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgatgacctcacca 346
             ||||||||||| || ||||| || ||    ||||| |||||||||||||||  |||||||
Sbjct: 23363 tcgaccatgaatcctggtttgggtcctttaggctgtctcttggtgctgatggtctcacca 23422

                                                                         
Query: 347   cgtgccttggcttccgccttgagctggtcattcttcactttcctcaggcggaactcctca 406
                || |||||| | ||||||||||  |||||||||   ||||||||   ||||||||||
Sbjct: 23423 ttggctttggctgcagccttgagctcatcattcttcttcttcctcagcttgaactcctca 23482

                                                                     
Query: 407   gcacacctggatggctgcacatgctcaacacggacatggatccttttcctgatgat 462
             ||||| || ||| ||||||||||||| ||||| ||||| ||||| ||||| |||||
Sbjct: 23483 gcacatcttgattgctgcacatgctccacacgcacatgaatcctcttccttatgat 23538



to top

>emb|BX814226.1|CNS0AC0R Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB62ZA08 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 674

 Score =  109 bits (55), Expect = 1e-20
 Identities = 220/275 (80%)
 Strand = Plus / Minus

                                                                       
Query: 398 aactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcctg 457
           ||||||||||||||||| ||  |  |||||||||| ||||| ||||| ||||| ||||| 
Sbjct: 320 aactcctcagcacaccttgactgtggcacatgctccacacgcacatgtatcctcttcctt 261

                                                                       
Query: 458 atgatgcggtttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgttc 517
           ||||| | ||| |||| ||| |||||||  || || || | ||| ||||| ||||| |||
Sbjct: 260 atgattctgttcccaatctgtttgttgacttcaacaccaacggcacgcttagtgacattc 201

                                                                       
Query: 518 cacacgcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtgcacggcgccg 577
           || | ||| || || || || ||||||||||| || |||||||||||||| |  || || 
Sbjct: 200 cagatgcgaccagtacgaccatggtagaacttatgaggcatacccttgtggatagctcca 141

                                                                       
Query: 578 ttcaccttgacgtcgacgtactcgccgaccttgtaggtgcgcaggtaggtggtgagcggg 637
           || |||||||| |||||||| |||||||||||| |||| |  ||||| |||| ||  || 
Sbjct: 140 ttaaccttgacatcgacgtaatcgccgaccttgaaggttctgaggtaagtggagattgga 81

                                              
Query: 638 atgtaacccttcttccggaaggggcgcgcgaacag 672
           || ||||||||||||| ||| || | |||||||||
Sbjct: 80  atataacccttcttcctgaatggtctcgcgaacag 46



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 99/116 (85%)
 Strand = Plus / Minus

                                                                       
Query: 221 taaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtg 280
           ||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||| | ||| 
Sbjct: 497 taaccacccttgagatcgttgacaacatcgtaaggaatgggagtgacagtctccaatgtc 438

                                                                   
Query: 281 gtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
            |||| ||||||||||| || |||||||| ||    ||||| ||||||||||||||
Sbjct: 437 ataccttcgaccatgaaacccggtttaggacctttaggctgtctcttggtgctgat 382



to top

>gb|AC079733.1| Arabidopsis thaliana chromosome 1 BAC T8L23 genomic sequence, complete
             sequence
          Length = 90448

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 99/116 (85%)
 Strand = Plus / Minus

                                                                         
Query: 221   taaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtg 280
             ||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||| | ||| 
Sbjct: 47003 taaccacccttgagatcgttgacaacatcgtaaggaatgggagtgacagtctccaatgtc 46944

                                                                     
Query: 281   gtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
              |||| ||||||||||| || |||||||| ||    ||||| ||||||||||||||
Sbjct: 46943 ataccttcgaccatgaaacccggtttaggacctttaggctgtctcttggtgctgat 46888



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                         
Query: 539   tggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcgacgtac 598
             ||||||||||| || |||||||||||||| |  || || || |||||||| |||||||| 
Sbjct: 46382 tggtagaacttatgaggcatacccttgtggatagctccattaaccttgacatcgacgtaa 46323

                                                                         
Query: 599   tcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaacccttcttccggaag 658
             |||||||||||| |||| |  ||||| |||| ||| || || ||||||||||||| ||| 
Sbjct: 46322 tcgccgaccttgaaggttctgaggtaagtggagagtggaatataacccttcttcctgaat 46263

                           
Query: 659   gggcgcgcgaacag 672
             || | |||||||||
Sbjct: 46262 ggtctcgcgaacag 46249



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                         
Query: 398   aactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcctg 457
             ||||||||||||||||| ||  | ||||||||||| ||||| ||||| ||||| ||||| 
Sbjct: 46826 aactcctcagcacaccttgactgttgcacatgctccacacgcacatgtatcctcttcctt 46767

                  
Query: 458   atgat 462
             |||||
Sbjct: 46766 atgat 46762



to top

>emb|BX841874.1|CNS09Y44 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH60ZG03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 658

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 99/116 (85%)
 Strand = Plus / Minus

                                                                       
Query: 221 taaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtg 280
           ||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||| | ||| 
Sbjct: 533 taaccacccttgagatcgttgacaacatcgtaaggaatgggagtgacagtctccaatgtc 474

                                                                   
Query: 281 gtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
            |||| ||||||||||| || |||||||| ||    ||||| ||||||||||||||
Sbjct: 473 ataccttcgaccatgaaacccggtttaggacctttaggctgtctcttggtgctgat 418



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 67/78 (85%), Gaps = 1/78 (1%)
 Strand = Plus / Minus

                                                                       
Query: 539 tggtagaacttgtgcggcatacccttgtgcacggcg-ccgttcaccttgacgtcgacgta 597
           ||||||||||| || |||||||||||||| |  ||| || || |||||||| ||||||||
Sbjct: 209 tggtagaacttatgaggcatacccttgtggatagcgtccattaaccttgacatcgacgta 150

                             
Query: 598 ctcgccgaccttgtaggt 615
            |||||||||||| ||||
Sbjct: 149 atcgccgaccttgaaggt 132



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                       
Query: 422 tgcacatgctcaacacggacatggatccttttcctgatgatgcggtttccaacctgcttg 481
           ||||||||||| ||||| ||||| ||||| ||||| ||||| | ||| |||| ||| |||
Sbjct: 329 tgcacatgctcgacacgcacatgtatcctcttccttatgattctgttcccaatctgtttg 270

               
Query: 482 ttga 485
           ||||
Sbjct: 269 ttga 266



to top

>gb|AC079732.4|AC079732 Arabidopsis thaliana chromosome 1 BAC F12K22 genomic sequence,
            complete sequence
          Length = 43985

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 98/116 (84%)
 Strand = Plus / Minus

                                                                        
Query: 221  taaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtg 280
            ||||||||||||||||| ||||| ||||| ||||||||||||||||| ||||| | ||| 
Sbjct: 6323 taaccacccttgagatcgttgacaacatcgtaaggaatgggagtgacagtctccaatgtc 6264

                                                                    
Query: 281  gtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgat 336
             |||| || |||||||| || |||||||| ||    ||||| ||||||||||||||
Sbjct: 6263 ataccttcaaccatgaaacccggtttaggacctttaggctgtctcttggtgctgat 6208



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                        
Query: 539  tggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcgacgtac 598
            ||||||||||| || |||||||||||||| |  || || || |||||||| |||||||| 
Sbjct: 5706 tggtagaacttatgaggcatacccttgtggatagctccattaaccttgacatcgacgtaa 5647

                                                                        
Query: 599  tcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaacccttcttccggaag 658
            |||||||||||| |||| |  ||||| |||| ||| || || ||||||||||||| ||| 
Sbjct: 5646 tcgccgaccttgaaggttctgaggtaagtggagagtggaatataacccttcttcctgaat 5587

                          
Query: 659  gggcgcgcgaacag 672
            || | |||||||||
Sbjct: 5586 ggtctcgcgaacag 5573



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                        
Query: 398  aactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcctg 457
            ||||||||||||||||| ||  | ||||||||||| ||||| ||||| ||||| ||||| 
Sbjct: 6146 aactcctcagcacaccttgactgttgcacatgctccacacgcacatgtatcctcttcctt 6087

                 
Query: 458  atgat 462
            |||||
Sbjct: 6086 atgat 6082



to top

>emb|AJ131099.1|PAB131099 Picea abies microsatellite RNA, clone PAAG5, 5' end
          Length = 1129

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 136/167 (81%)
 Strand = Plus / Minus

                                                                       
Query: 401 tcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcctgatg 460
           ||||| |||||||| || || |||||||||||||  || ||||| || || ||| |||| 
Sbjct: 353 tcctctgcacacctagacggttgcacatgctcaattcgtacatgaattctcttcttgata 294

                                                                       
Query: 461 atgcggtttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccac 520
           ||   ||| | |||||| ||||| || ||||||||||| || ||||||||||| ||||| 
Sbjct: 293 atcttgttacgaacctgtttgttcatttcgacgccgattgctcgcttggtgacattccag 234

                                                          
Query: 521 acgcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtg 567
           ||    |||||||| || |||||||||||||| ||||||||||||||
Sbjct: 233 acaacaccggtgcgaccatggtagaacttgtgaggcatacccttgtg 187



to top

>gb|AF092950.1|AF092950 Cyanophora paradoxa ribosomal protein L21E (rpl21) mRNA, complete
           cds
          Length = 486

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 97/115 (84%)
 Strand = Plus / Minus

                                                                       
Query: 456 tgatgatgcggtttccaacctgcttgttgatctcgacgccgatggcgcgcttggtgacgt 515
           ||||||||||||  |  ||| ||||||||||||| || ||||||||||||||||| ||||
Sbjct: 256 tgatgatgcggtggcggacccgcttgttgatctccacaccgatggcgcgcttggtcacgt 197

                                                                  
Query: 516 tccacacgcgtccggtgcggccgtggtagaacttgtgcggcatacccttgtgcac 570
           |||| |||   || ||||||||||||||| |||||   ||||| |||||||||||
Sbjct: 196 tccagacgatgccagtgcggccgtggtagtacttgaagggcatgcccttgtgcac 142



to top

>ref|XM_505036.1| Yarrowia lipolytica CLIB122, YALI0F05522g predicted mRNA
          Length = 486

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 533 cggccgtggtagaacttgtgcggcataccctt 564
           |||||||||||||||||||| |||||||||||
Sbjct: 179 cggccgtggtagaacttgtggggcataccctt 148



to top

>emb|AJ718457.1| Nicotiana tabacum cDNA-AFLP-fragment BSTC1-11-430, cultivar Bright
           Yellow 2
          Length = 384

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 115/144 (79%)
 Strand = Plus / Minus

                                                                       
Query: 239 ttgaccacatcataaggaatgggagtgacggtctcgattgtggtaccctcgaccatgaac 298
           |||||||||||||| || |||||||| || || || |  || | ||| || |||||||||
Sbjct: 197 ttgaccacatcatatggtatgggagtaacagtttccaaagtagcaccttcaaccatgaac 138

                                                                       
Query: 299 ccgggtttagggccgagtggctgcctcttggtgctgatgacctcaccacgtgccttggct 358
           || ||||| || ||  | || |||||||| ||||||||||||||||| |  ||||| || 
Sbjct: 137 cctggtttgggtccttgaggttgcctctttgtgctgatgacctcacccctagccttagcc 78

                                   
Query: 359 tccgccttgagctggtcattcttc 382
           |  ||||| ||||| |||||||||
Sbjct: 77  ttggcctttagctgatcattcttc 54



to top

>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica
          Length = 4003362

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                              
Query: 533    cggccgtggtagaacttgtgcggcataccctt 564
              |||||||||||||||||||| |||||||||||
Sbjct: 825780 cggccgtggtagaacttgtggggcataccctt 825811



to top

>gb|DQ066307.1| Ixodes scapularis isolate IS-6-12L-52 ribosomal protein L21 mRNA,
           complete cds
          Length = 486

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 535 gccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcgac 594
           |||||||||||| ||||||||||||||||| || | ||| |||||  |||| ||||| ||
Sbjct: 177 gccgtggtagaatttgtgcggcatacccttttggaaggctccgttgcccttaacgtcaac 118

              
Query: 595 gta 597
           |||
Sbjct: 117 gta 115



to top

>gb|AC156448.2| Volvox carteri clone JGIAOBO-33O24, complete sequence
          Length = 38975

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                       
Query: 477  gcttgttgatctcgacgccgatggcgcgcttggtgacgttcca 519
            ||||||| ||||| || |||||||||||||| |||||||||||
Sbjct: 5042 gcttgtttatctccacaccgatggcgcgcttagtgacgttcca 5000



to top

>ref|XM_959139.1| Neurospora crassa OR74A hypothetical protein (NCU01948.1) partial
           mRNA
          Length = 483

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 65/78 (83%)
 Strand = Plus / Minus

                                                                       
Query: 535 gccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcgac 594
           ||||||||||| |||||| | ||||||||| || || || ||||| ||||||| ||||||
Sbjct: 177 gccgtggtagaccttgtgggccatacccttctggacagcaccgttgaccttgatgtcgac 118

                             
Query: 595 gtactcgccgaccttgta 612
           |   ||||| ||||||||
Sbjct: 117 gatgtcgccaaccttgta 100



to top

>ref|XM_329137.1| Neurospora crassa OR74A hypothetical protein (NCU01948.1) partial
           mRNA
          Length = 483

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 65/78 (83%)
 Strand = Plus / Minus

                                                                       
Query: 535 gccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcgac 594
           ||||||||||| |||||| | ||||||||| || || || ||||| ||||||| ||||||
Sbjct: 177 gccgtggtagaccttgtgggccatacccttctggacagcaccgttgaccttgatgtcgac 118

                             
Query: 595 gtactcgccgaccttgta 612
           |   ||||| ||||||||
Sbjct: 117 gatgtcgccaaccttgta 100



to top

>gb|DQ191668.1| Solanum tuberosum 60S ribosomal protein L21-like protein mRNA,
           complete cds
          Length = 751

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 128/162 (79%)
 Strand = Plus / Minus

                                                                       
Query: 221 taaccacccttgagatcattgaccacatcataaggaatgggagtgacggtctcgattgtg 280
           ||||| ||||| | |||||| ||||||||||| || ||||| || || ||||| |  || 
Sbjct: 550 taacctcccttcaaatcattaaccacatcatatggtatgggggtaactgtctccaaagta 491

                                                                       
Query: 281 gtaccctcgaccatgaacccgggtttagggccgagtggctgcctcttggtgctgatgacc 340
           | |||  | ||||||||||| ||||| || |||||||| || || || ||||||||||| 
Sbjct: 490 gcacctccaaccatgaaccctggtttgggtccgagtggttgtctttttgtgctgatgact 431

                                                     
Query: 341 tcaccacgtgccttggcttccgccttgagctggtcattcttc 382
           || || |  |||||||| || ||||| || || |||||||||
Sbjct: 430 tctcctctagccttggcatcagcctttagttgatcattcttc 389



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 78/96 (81%)
 Strand = Plus / Minus

                                                                       
Query: 472 aacctgcttgttgatctcgacgccgatggcgcgcttggtgacgttccacacgcgtccggt 531
           ||||||||||||||  || || || | |||||| ||||| || ||||| || || || ||
Sbjct: 299 aacctgcttgttgacttcaacaccaacggcgcgtttggtaacattccaaacacgaccagt 240

                                               
Query: 532 gcggccgtggtagaacttgtgcggcatacccttgtg 567
            || || |||||||||||||| ||||| ||||||||
Sbjct: 239 acgtccatggtagaacttgtgaggcattcccttgtg 204



to top

>ref|XM_753406.1| Ustilago maydis 521 hypothetical protein (UM02352.1) partial mRNA
          Length = 516

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 533 cggccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcg 592
           |||||||||||| ||||||| ||||||||||| ||| ||||  ||||  |||||| ||||
Sbjct: 212 cggccgtggtagtacttgtggggcatacccttttgctcggcagcgttggccttgatgtcg 153

             
Query: 593 ac 594
           ||
Sbjct: 152 ac 151



to top

>ref|XM_570887.1| Cryptococcus neoformans var. neoformans JEC21 60s ribosomal protein
           l21-a (CNE02170) partial mRNA
          Length = 559

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 535 gccgtggtagaacttgtgcggcataccctt 564
           |||||||||||||||||| |||||||||||
Sbjct: 191 gccgtggtagaacttgtggggcataccctt 162



to top

>emb|AL132977.1|ATT10K17 Arabidopsis thaliana DNA chromosome 3, BAC clone T10K17
          Length = 109016

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Plus

                                                                         
Query: 397   gaactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcct 456
             ||||||| ||||||| || ||  ||||||||||||| ||| | ||||||||||| |||||
Sbjct: 13438 gaactccacagcacatcttgactgctgcacatgctccacaagaacatggatcctcttcct 13497

                   
Query: 457   gatgat 462
              |||||
Sbjct: 13498 tatgat 13503



to top

>gb|AC007654.2|AC007654 Genomic sequence for Arabidopsis thaliana BAC T19E23 from chromosome I,
             complete sequence
          Length = 87618

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 107/134 (79%)
 Strand = Plus / Minus

                                                                         
Query: 539   tggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcgacgtac 598
             ||||||||||| || || ||||||||||| |  || || || |||||||| | |||||| 
Sbjct: 69637 tggtagaacttatgaggaatacccttgtgaatagctccattaaccttgacattgacgtaa 69578

                                                                         
Query: 599   tcgccgaccttgtaggtgcgcaggtaggtggtgagcgggatgtaacccttcttccggaag 658
             |||||||||||| ||||    ||||| |||| |||  | || ||||||||||||| ||| 
Sbjct: 69577 tcgccgaccttgaaggttatgaggtaagtggagagtagaatataacccttcttcctgaat 69518

                           
Query: 659   gggcgcgcgaacag 672
             || | |||||||||
Sbjct: 69517 ggtctcgcgaacag 69504



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                        
Query: 398   aactcctcagcacacctggatggctgcacatgctcaacacggacatggatccttttcct 456
             ||||||||| ||||||| ||  | ||||||||||| ||||| ||||| ||||| |||||
Sbjct: 70091 aactcctcatcacaccttgactgttgcacatgctccacacgtacatgtatcctcttcct 70033



to top

>gb|AY292616.1| Oikopleura dioica 60S ribosomal protein L21 (RL21) gene, complete
           cds
          Length = 578

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 536 ccgtggtagaacttgtgcggcataccctt 564
           |||||||||| ||||||||||||||||||
Sbjct: 229 ccgtggtagaccttgtgcggcataccctt 201



to top

>ref|XM_455019.1| Kluyveromyces lactis NRRL Y-1140, KLLA0E23727g predicted mRNA
          Length = 483

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 539 tggtagaacttgtgcggcatacccttgtg 567
           |||||||||||||| ||||||||||||||
Sbjct: 173 tggtagaacttgtgtggcatacccttgtg 145



to top

>emb|CR382125.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome E of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 2234072

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 539     tggtagaacttgtgcggcatacccttgtg 567
               |||||||||||||| ||||||||||||||
Sbjct: 2101952 tggtagaacttgtgtggcatacccttgtg 2101980



to top

>gb|AE016818.1| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome V,
              complete sequence
          Length = 1519138

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                           
Query: 539    tggtagaacttgtgcggcatacccttgtg 567
              |||||||||||||| ||||||||||||||
Sbjct: 163902 tggtagaacttgtgtggcatacccttgtg 163874



to top

>ref|NM_209960.1| Eremothecium gossypii AEL254Wp (AEL254W), mRNA
          Length = 483

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 539 tggtagaacttgtgcggcatacccttgtg 567
           |||||||||||||| ||||||||||||||
Sbjct: 173 tggtagaacttgtgtggcatacccttgtg 145



to top

>ref|XM_799307.1| Trypanosoma cruzi strain CL Brener ribosomal protein L21E (60S)
           (Tc00.1047053507251.20) partial mRNA
          Length = 480

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 530 gtgcggccgtggtagaacttgtgcggcatacc 561
           ||||||||||||||| ||||||| ||||||||
Sbjct: 182 gtgcggccgtggtagtacttgtgtggcatacc 151



to top

>ref|XM_807657.1| Trypanosoma cruzi strain CL Brener ribosomal protein L21E (60S)
           (Tc00.1047053506405.149) partial mRNA
          Length = 480

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 530 gtgcggccgtggtagaacttgtgcggcatacc 561
           ||||||||||||||| ||||||| ||||||||
Sbjct: 182 gtgcggccgtggtagtacttgtgtggcatacc 151



to top

>gb|AY310808.1| Nicotiana benthamiana clone 12-130 unknown mRNA
          Length = 388

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 290 accatgaacccgggtttagggccgagtggctgcctcttggtgctgatgacctcacc 345
           ||||||||||| ||||| || ||  | || |||||||| |||||||||||||||||
Sbjct: 195 accatgaaccctggtttgggtccttgaggttgcctctttgtgctgatgacctcacc 140



to top

>ref|XM_774277.1| Giardia lamblia ATCC 50803 ribosomal protein rpl21
           (GLP_165_41283_41762) partial mRNA
          Length = 480

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 575 ccgttcaccttgacgtcgacgtactcgccgaccttgtag 613
           ||||||||||||| || |||||||| ||||| |||||||
Sbjct: 137 ccgttcaccttgatgttgacgtactggccgagcttgtag 99



to top

>ref|XM_449631.1| Candida glabrata CBS138 hypothetical protein (CAGL0M06523g) partial
           mRNA
          Length = 483

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 539 tggtagaacttgtgcggcataccctt 564
           |||||||||||||| |||||||||||
Sbjct: 173 tggtagaacttgtgtggcataccctt 148



to top

>gb|AC121238.17| Medicago truncatula clone mth2-34p9, complete sequence
          Length = 104878

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 540   ggtagaacttgtgcggcatacccttg 565
             ||||||||||||| ||||||||||||
Sbjct: 83530 ggtagaacttgtgaggcatacccttg 83505



to top

>emb|CR380959.1| Candida glabrata strain CBS138 chromosome M complete sequence
          Length = 1400893

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 539    tggtagaacttgtgcggcataccctt 564
              |||||||||||||| |||||||||||
Sbjct: 676169 tggtagaacttgtgtggcataccctt 676144



to top

>gb|DQ333017.1| Synthetic construct Saccharomyces cerevisiae clone FLH006698.01X
           RPL21B gene, complete sequence
          Length = 904

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 539 tggtagaacttgtgcggcataccctt 564
           |||||||||||||| |||||||||||
Sbjct: 594 tggtagaacttgtgtggcataccctt 569



to top

>gb|U41849.1|SCU41849 Saccharomyces cerevisiae chromosome XVI, left arm, cosmid 8204
          Length = 35868

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 539   tggtagaacttgtgcggcataccctt 564
             |||||||||||||| |||||||||||
Sbjct: 20213 tggtagaacttgtgtggcataccctt 20188



to top

>ref|XM_636632.1| Dictyostelium discoideum 60S ribosomal protein L21 (DDB0229962),
           partial mRNA
          Length = 483

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 527 ccggtgcggccgtggtagaacttgtgcggcatacccttgtg 567
           ||||| || ||||||||||| ||||| |||||||| |||||
Sbjct: 185 ccggtacgaccgtggtagaatttgtgtggcatacctttgtg 145



to top

>gb|DQ207854.1| Solanum tuberosum clone 076C12 unknown mRNA
          Length = 725

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 539 tggtagaacttgtgcggcatacccttgtg 567
           |||||||||||||| ||||| ||||||||
Sbjct: 199 tggtagaacttgtgaggcattcccttgtg 171



to top

>gb|AC163337.2| Mus musculus chromosome 5, clone RP23-297I15, complete sequence
          Length = 154578

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 228    ccttgagatcattgaccacat 248
              |||||||||||||||||||||
Sbjct: 145540 ccttgagatcattgaccacat 145560



to top

>gb|AY618092.1| Sterkiella histriomuscorum clone UGC1O0004_K15_R genomic sequence
          Length = 742

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 539 tggtagaacttgtgcggcatacccttgtg 567
           |||||||| ||||| ||||||||||||||
Sbjct: 290 tggtagaatttgtgtggcatacccttgtg 262



to top

>gb|BC013343.1| Mus musculus 4-hydroxyphenylpyruvic acid dioxygenase, mRNA (cDNA
           clone MGC:14040 IMAGE:4193670), complete cds
          Length = 1432

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 228 ccttgagatcattgaccacat 248
           |||||||||||||||||||||
Sbjct: 565 ccttgagatcattgaccacat 585



to top

>ref|NM_008277.1| Mus musculus 4-hydroxyphenylpyruvic acid dioxygenase (Hpd), mRNA
          Length = 1432

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 228 ccttgagatcattgaccacat 248
           |||||||||||||||||||||
Sbjct: 565 ccttgagatcattgaccacat 585



to top

>emb|AL008630.1|HS282F2 Human DNA sequence from clone CTA-282F2 on chromosome 22, complete
             sequence
          Length = 60579

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 439   gacatggatccttttcctgat 459
             |||||||||||||||||||||
Sbjct: 45550 gacatggatccttttcctgat 45530



to top

>emb|BX072250.1|CNS09RWU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 683

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 242 ggcatacccttgtgcacggcaccgt 218



to top

>emb|BX066618.1|CNS09NKE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 686

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 391 ggcatacccttgtgcacggcaccgt 415



to top

>emb|BX055386.1|CNS09EWE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 790

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 198 ggcatacccttgtgcacggcaccgt 174



to top

>emb|BX051028.1|CNS09BJC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC28AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 471

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 206 ggcatacccttgtgcacggcaccgt 182



to top

>emb|BX049569.1|CNS09AET Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC25CD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 325

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 240 ggcatacccttgtgcacggcaccgt 216



to top

>emb|BX047565.1|CNS098V5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC22AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 737

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 158 ggcatacccttgtgcacggcaccgt 134



to top

>emb|BX038998.1|CNS09296 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 591

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 551 ggcatacccttgtgcacggcaccgt 575



to top

>emb|BX038997.1|CNS09295 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3CF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 592

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 238 ggcatacccttgtgcacggcaccgt 214



to top

>emb|BX038604.1|CNS091Y8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 619

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 214 ggcatacccttgtgcacggcaccgt 190



to top

>emb|BX038486.1|CNS091UY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 605

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 215 ggcatacccttgtgcacggcaccgt 191



to top

>emb|BX038410.1|CNS091SU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 654

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 558 ggcatacccttgtgcacggcaccgt 582



to top

>emb|BX038409.1|CNS091ST Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2DC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 723

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 249 ggcatacccttgtgcacggcaccgt 225



to top

>emb|BX038404.1|CNS091SO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 672

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 560 ggcatacccttgtgcacggcaccgt 584



to top

>emb|BX038403.1|CNS091SN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 245 ggcatacccttgtgcacggcaccgt 221



to top

>emb|BX038349.1|CNS091R5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 693

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 556 ggcatacccttgtgcacggcaccgt 580



to top

>emb|BX038348.1|CNS091R4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 741

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 264 ggcatacccttgtgcacggcaccgt 240



to top

>emb|BX037985.1|CNS091H1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 671

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 560 ggcatacccttgtgcacggcaccgt 584



to top

>emb|BX037984.1|CNS091H0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 766

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 245 ggcatacccttgtgcacggcaccgt 221



to top

>emb|BX034995.1|CNS08Z5Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA6AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 671

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 392 ggcatacccttgtgcacggcaccgt 416



to top

>emb|BX034994.1|CNS08Z5Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6AE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 817

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 239 ggcatacccttgtgcacggcaccgt 215



to top

>emb|BX034575.1|CNS08YUB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 782

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 206 ggcatacccttgtgcacggcaccgt 182



to top

>emb|BX034293.1|CNS08YMH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA50AF02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 789

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 211 ggcatacccttgtgcacggcaccgt 187



to top

>emb|BX034039.1|CNS08YFF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 214 ggcatacccttgtgcacggcaccgt 190



to top

>emb|BX031754.1|CNS08WNY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 221 ggcatacccttgtgcacggcaccgt 197



to top

>emb|BX031276.1|CNS08WAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 222 ggcatacccttgtgcacggcaccgt 198



to top

>emb|BX028974.1|CNS08UIQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA43BC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 562

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 215 ggcatacccttgtgcacggcaccgt 191



to top

>emb|BX028747.1|CNS08UCF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 226 ggcatacccttgtgcacggcaccgt 202



to top

>emb|BX025908.1|CNS08S5K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 181 ggcatacccttgtgcacggcaccgt 157



to top

>emb|BX021458.1|CNS08OPY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 237 ggcatacccttgtgcacggcaccgt 213



to top

>emb|BX019519.1|CNS08N83 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA29DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 760

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 490 ggcatacccttgtgcacggcaccgt 514



to top

>emb|BX019518.1|CNS08N82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 235 ggcatacccttgtgcacggcaccgt 211



to top

>emb|BX017157.1|CNS08LEH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 575

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 392 ggcatacccttgtgcacggcaccgt 416



to top

>emb|BX017156.1|CNS08LEG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 660

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 214 ggcatacccttgtgcacggcaccgt 190



to top

>gb|AF526223.1| Argopecten irradians isolate iolsaicl245ct282cn301 ribosomal
           protein L21 mRNA, complete cds
          Length = 542

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 536 ccgtggtagaacttgtgcggcataccctt 564
           |||||||||| |||||| |||||||||||
Sbjct: 207 ccgtggtagaccttgtggggcataccctt 179



to top

>emb|AJ507398.1|HSA507398 Homo sapiens RINZFC gene for putative RIN zinc finger protein, exons
            1-6
          Length = 39160

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 375  cattcttcactttcctcaggc 395
            |||||||||||||||||||||
Sbjct: 8860 cattcttcactttcctcaggc 8840



to top

>gb|AC009812.17| Homo sapiens chromosome 8, clone RP11-48B3, complete sequence
          Length = 155405

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 375   cattcttcactttcctcaggc 395
             |||||||||||||||||||||
Sbjct: 80795 cattcttcactttcctcaggc 80815



to top

>gb|AC005552.3| Homo sapiens chromosome 17, clone RP11-212E8, complete sequence
          Length = 165837

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 47     aaggaaatagcacagtatagcattt 71
              ||||||||||||||||| |||||||
Sbjct: 160411 aaggaaatagcacagtaaagcattt 160435



to top

>dbj|AK149416.1| Mus musculus adult male liver tumor cDNA, RIKEN full-length
           enriched library, clone:C730007B19
           product:4-hydroxyphenylpyruvic acid dioxygenase, full
           insert sequence
          Length = 1400

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 228 ccttgagatcattgaccacat 248
           |||||||||||||||||||||
Sbjct: 579 ccttgagatcattgaccacat 599



to top

>gb|AF197814.1| Peperomia obtusifolia maturase (matR) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 1811

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 305 ttagggccgagtggctgcctc 325
           |||||||||||||||||||||
Sbjct: 125 ttagggccgagtggctgcctc 105



to top

>gb|AF197799.1| Atherosperma moschatum maturase (matR) gene, partial cds;
           mitochondrial gene for mitochondrial product
          Length = 1832

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 305 ttagggccgagtggctgcctc 325
           |||||||||||||||||||||
Sbjct: 125 ttagggccgagtggctgcctc 105



to top

>gb|AF197728.1| Brasenia schreberi maturase (matR) gene, partial cds; mitochondrial
           gene for mitochondrial product
          Length = 1746

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 305 ttagggccgagtggctgcctc 325
           |||||||||||||||||||||
Sbjct: 92  ttagggccgagtggctgcctc 72



to top

>gb|AC110605.5| Homo sapiens chromosome 17, clone CTD-2317L23, complete sequence
          Length = 60418

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 47    aaggaaatagcacagtatagcattt 71
             ||||||||||||||||| |||||||
Sbjct: 23566 aaggaaatagcacagtaaagcattt 23590



to top

>ref|XM_320389.2| Anopheles gambiae str. PEST ENSANGP00000014054
           (ENSANGG00000011565), mRNA
          Length = 794

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 554 ggcatacccttgtgcacggcgccgt 578
           |||||||||||||||||||| ||||
Sbjct: 265 ggcatacccttgtgcacggcaccgt 241



to top

>dbj|D29987.1|MUS4HD Mus musculus mRNA for 4-hydroxyphenylpyruvate dioxygenase, complete
           cds
          Length = 1399

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 228 ccttgagatcattgaccacat 248
           |||||||||||||||||||||
Sbjct: 579 ccttgagatcattgaccacat 599



to top

>emb|X59530.1|MMFPROT M.musculus mRNA for F protein
          Length = 1176

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 228 ccttgagatcattgaccacat 248
           |||||||||||||||||||||
Sbjct: 531 ccttgagatcattgaccacat 551



to top

>gb|BC088139.1| Rattus norvegicus GABA(A) receptor-associated protein like 2, mRNA
           (cDNA clone MGC:108686 IMAGE:7323806), complete cds
          Length = 1619

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 274 tggatccttttcctgatgat 255



to top

>ref|XM_511114.1| PREDICTED: Pan troglodytes similar to GABA(A) receptor-associated
           protein like 2; ganglioside expression factor 2
           (LOC454251), mRNA
          Length = 1093

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 929 tggatccttttcctgatgat 910



to top

>ref|NM_190560.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 303

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 530 gtgcggccgtggtagaacttgtgc 553
           |||||||||||| |||||||||||
Sbjct: 69  gtgcggccgtggcagaacttgtgc 46



to top

>gb|AC118010.11| Mus musculus chromosome 5, clone RP23-451E8, complete sequence
          Length = 184672

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 443   tggatccttttcctgatgat 462
             ||||||||||||||||||||
Sbjct: 46741 tggatccttttcctgatgat 46760



to top

>gb|BC005985.1| Homo sapiens GABA(A) receptor-associated protein-like 2, mRNA (cDNA
           clone MGC:14752 IMAGE:4282114), complete cds
          Length = 973

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 283 tggatccttttcctgatgat 264



to top

>ref|NM_026693.2| Mus musculus gamma-aminobutyric acid (GABA-A) receptor-associated
           protein-like 2 (Gabarapl2), mRNA
          Length = 2500

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 304 tggatccttttcctgatgat 285



to top

>ref|XM_657314.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4802.2), mRNA
          Length = 477

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 536 ccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttga 587
           |||| ||||| |||||  ||||||||||| || ||||| ||||| |||||||
Sbjct: 176 ccgttgtagaccttgtagggcatacccttctgaacggcaccgttgaccttga 125



to top

>gb|AY302590.1| Sclerotinia sclerotiorum ribosomal protein Srp1 (srp1) mRNA,
           complete cds
          Length = 653

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 536 ccgtggtagaacttgtgcggcatacccttgtgcacggcgccgtt 579
           |||||||| | |||||| ||||||||||| || ||||| |||||
Sbjct: 208 ccgtggtaaaccttgtggggcatacccttttggacggcaccgtt 165



to top

>gb|BC026798.1| Mus musculus gamma-aminobutyric acid (GABA-A) receptor-associated
           protein-like 2, mRNA (cDNA clone MGC:25802
           IMAGE:4036425), complete cds
          Length = 976

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 282 tggatccttttcctgatgat 263



to top

>gb|AY422180.1| Mus musculus GABA(A) receptor-associated protein-like 2 (Gabarapl2)
           pseudogene, complete sequence
          Length = 902

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 244 tggatccttttcctgatgat 225



to top

>ref|XM_749817.1| Aspergillus fumigatus Af293 60s ribosomal protein l21 (Afu3g06960)
           partial mRNA
          Length = 477

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 536 ccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttga 587
           |||| ||||| |||||  ||||||||||| || ||||| ||||| |||||||
Sbjct: 176 ccgttgtagaccttgtagggcatacccttctgaacggcaccgttgaccttga 125



to top

>ref|XM_389071.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG08895.1)
           partial mRNA
          Length = 483

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 536 ccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcgacg 595
           |||||||||| ||||   ||||||||||| || ||||| |||||| |||| | |||||||
Sbjct: 176 ccgtggtagaccttgaagggcatacccttctggacggcaccgttcgccttaatgtcgacg 117



to top

>emb|CR394556.10| Zebrafish DNA sequence from clone DKEY-79P17 in linkage group 9,
             complete sequence
          Length = 136863

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 125   gacccaacccagactactgc 144
             ||||||||||||||||||||
Sbjct: 22434 gacccaacccagactactgc 22415



to top

>ref|XM_536778.2| PREDICTED: Canis familiaris similar to GABA(A) receptor-associated
           protein like 2 (LOC479646), mRNA
          Length = 1341

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 685 tggatccttttcctgatgat 666



to top

>ref|NM_007285.6| Homo sapiens GABA(A) receptor-associated protein-like 2
           (GABARAPL2), mRNA
          Length = 1031

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 342 tggatccttttcctgatgat 323



to top

>emb|AL591501.7| Human DNA sequence from clone RP11-305F18 on chromosome X Contains the
             3' end of a novel gene, complete sequence
          Length = 174803

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 138   ctactgctcagagagcaaat 157
             ||||||||||||||||||||
Sbjct: 40588 ctactgctcagagagcaaat 40607



to top

>emb|AL160155.19| Human DNA sequence from clone RP11-461N23 on chromosome 13 Contains part
              of a novel gene (FLJ30001), a H2A histone family,
              pseudogene, the GPR18 gene for G protein-coupled receptor
              18, the EBI2 gene for Epstein-Barr virus induced gene 2
              (lymphocyte-specific G protein-coupled receptor), two novel
              genes and a CpG island, complete sequence
          Length = 149478

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 151    agcaaatcctactcataaga 170
              ||||||||||||||||||||
Sbjct: 112618 agcaaatcctactcataaga 112599



to top

>gb|DQ115823.1| Cyanobacteria phage AS-1 contig_16 genomic sequence
          Length = 1641

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 661  gcgcgcgaacaggtcgcgcg 680
            ||||||||||||||||||||
Sbjct: 1041 gcgcgcgaacaggtcgcgcg 1022



to top

>gb|AF535728.1| HIV-1 isolate 95USMA950911sa from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 614

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 414 ctgaaggaaatagcacagta 433



to top

>gb|AF535724.1| HIV-1 isolate 95USMA950911s2 from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 617

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 411 ctgaaggaaatagcacagta 430



to top

>gb|AF535645.1| HIV-1 isolate 95USMA950828pc from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 611

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 411 ctgaaggaaatagcacagta 430



to top

>gb|AF535643.1| HIV-1 isolate 95USMA950828p9 from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 611

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 411 ctgaaggaaatagcacagta 430



to top

>gb|AF535622.1| HIV-1 isolate 95USMA950821sf from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 611

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 411 ctgaaggaaatagcacagta 430



to top

>gb|AF535621.1| HIV-1 isolate 95USMA950821sc from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 617

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 411 ctgaaggaaatagcacagta 430



to top

>gb|AF535599.1| HIV-1 isolate 95USMA950821p3 from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 605

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 405 ctgaaggaaatagcacagta 424



to top

>gb|AF535556.1| HIV-1 isolate 95USMA950731s3 from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 611

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 411 ctgaaggaaatagcacagta 430



to top

>gb|AF535539.1| HIV-1 isolate 95USMA950731p5 from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 611

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 411 ctgaaggaaatagcacagta 430



to top

>gb|AF535829.1| HIV-1 isolate 95USMA951129c1 from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 611

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 411 ctgaaggaaatagcacagta 430



to top

>gb|AF535803.1| HIV-1 isolate 95USMA951101c7 from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 614

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 414 ctgaaggaaatagcacagta 433



to top

>gb|AF535770.1| HIV-1 isolate 95USMA950925c3 from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 614

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 405 ctgaaggaaatagcacagta 424



to top

>gb|AF535732.1| HIV-1 isolate 95USMA950920c1 from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 653

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 447 ctgaaggaaatagcacagta 466



to top

>gb|AF535697.1| HIV-1 isolate 95USMA950911c6 from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 611

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 402 ctgaaggaaatagcacagta 421



to top

>gb|AF535631.1| HIV-1 isolate 95USMA950828c8 from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 623

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 414 ctgaaggaaatagcacagta 433



to top

>gb|AF535585.1| HIV-1 isolate 95USMA950821c2 from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 614

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 414 ctgaaggaaatagcacagta 433



to top

>gb|AF535531.1| HIV-1 isolate 95USMA950731c9 from USA envelope glycoprotein (env)
           gene, partial cds
          Length = 611

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 44  ctgaaggaaatagcacagta 63
           ||||||||||||||||||||
Sbjct: 402 ctgaaggaaatagcacagta 421



to top

>emb|BX572607.1| Rhodopseudomonas palustris CGA009 complete genome; segment 15/16
          Length = 345012

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 492    cgccgatggcgcgcttggtgacgt 515
              ||||| ||||||||||||||||||
Sbjct: 249841 cgccgttggcgcgcttggtgacgt 249864



to top

>gb|BC029601.1| Homo sapiens GABA(A) receptor-associated protein-like 2, mRNA (cDNA
           clone MGC:39783 IMAGE:5296075), complete cds
          Length = 1007

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 332 tggatccttttcctgatgat 313



to top

>gb|BC014594.2| Homo sapiens GABA(A) receptor-associated protein-like 2, mRNA (cDNA
           clone MGC:26328 IMAGE:4821535), complete cds
          Length = 976

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 301 tggatccttttcctgatgat 282



to top

>gb|BC081436.1| Mus musculus gamma-aminobutyric acid (GABA-A) receptor-associated
           protein-like 2, mRNA (cDNA clone MGC:102013
           IMAGE:6814986), complete cds
          Length = 651

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 307 tggatccttttcctgatgat 288



to top

>emb|AJ010569.1|HSA010569 Homo sapiens mRNA for GEF-2 protein
          Length = 450

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 302 tggatccttttcctgatgat 283



to top

>emb|CR376848.7| Zebrafish DNA sequence from clone CH211-197K23 in linkage group 24,
              complete sequence
          Length = 218909

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 211    aacaccctagtaaccaccct 230
              ||||||||||||||||||||
Sbjct: 182905 aacaccctagtaaccaccct 182924



to top

>gb|AC092309.3| Homo sapiens chromosome 19 clone LLNLR-276F4, complete sequence
          Length = 44430

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 50    gaaatagcacagtatagcatttctgcaa 77
             ||||||||||||  ||||||||||||||
Sbjct: 21096 gaaatagcacagcctagcatttctgcaa 21069



to top

>gb|AC092323.3| Homo sapiens chromosome 16 clone RP11-133B5, complete sequence
          Length = 173189

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 440    acatggatccttttcctgat 459
              ||||||||||||||||||||
Sbjct: 168775 acatggatccttttcctgat 168794



to top

>gb|BC102902.1| Bos taurus GABA(A) receptor-associated protein-like 2, mRNA (cDNA
           clone IMAGE:7985087), partial cds
          Length = 981

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 306 tggatccttttcctgatgat 287



to top

>emb|CR624907.1| full-length cDNA clone CS0DA011YJ15 of Neuroblastoma of Homo
           sapiens (human)
          Length = 990

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 330 tggatccttttcctgatgat 311



to top

>emb|CR621062.1| full-length cDNA clone CS0DI066YH02 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 975

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 320 tggatccttttcctgatgat 301



to top

>emb|CR603478.1| full-length cDNA clone CS0DF013YB20 of Fetal brain of Homo sapiens
           (human)
          Length = 917

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 279 tggatccttttcctgatgat 260



to top

>emb|CR592344.1| full-length cDNA clone CS0DI020YN18 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 908

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 277 tggatccttttcctgatgat 258



to top

>dbj|AB226224.1| Aspergillus oryzae cDNA, contig sequence: AoEST3083
          Length = 981

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 536 ccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttga 587
           |||| ||||| |||||  ||||||||||| || ||||| ||||| |||||||
Sbjct: 247 ccgttgtagaccttgtagggcatacccttctgaacggcaccgttgaccttga 196



to top

>dbj|AK134873.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length
           enriched library, clone:6430501B01 product:GABA(A)
           receptor-associated protein like 2, full insert sequence
          Length = 1678

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 323 tggatccttttcctgatgat 304



to top

>gb|AC104260.5| Homo sapiens chromosome 15, clone CTD-2536I1, complete sequence
          Length = 191528

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 407   gcacacctggatggctgcacatgc 430
             ||||| ||||||||||||||||||
Sbjct: 59766 gcacagctggatggctgcacatgc 59743



to top

>gb|AC025287.8| Homo sapiens chromosome 16 clone RP11-490B18, complete sequence
          Length = 194832

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 443    tggatccttttcctgatgat 462
              ||||||||||||||||||||
Sbjct: 149718 tggatccttttcctgatgat 149737



to top

>emb|CR542217.1| Homo sapiens full open reading frame cDNA clone RZPDo834A0725D for
           gene GABARAPL2, GABA(A) receptor-associated protein-like
           2; complete cds, incl. stopcodon
          Length = 354

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 206 tggatccttttcctgatgat 187



to top

>gb|AC009109.9| Homo sapiens chromosome 16 clone RP11-467L24, complete sequence
          Length = 150086

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 440    acatggatccttttcctgat 459
              ||||||||||||||||||||
Sbjct: 149395 acatggatccttttcctgat 149376



to top

>dbj|AK013563.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length
           enriched library, clone:2900019O08 product:similar to
           GANGLIOSIDE EXPRESSION FACTOR 2 (GEF-2) (GENERAL PROTEIN
           TRANSPORT FACTOR P16) (GATE-16) [Homo sapiens], full
           insert sequence
          Length = 977

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 320 tggatccttttcctgatgat 301



to top

>dbj|AK049819.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length
           enriched library, clone:C630001N14 product:GABA(A)
           receptor-associated protein like 2, full insert sequence
          Length = 2500

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 304 tggatccttttcctgatgat 285



to top

>dbj|AK002596.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched
           library, clone:0610012F20 product:GABA(A)
           receptor-associated protein like 2, full insert sequence
          Length = 959

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 302 tggatccttttcctgatgat 283



to top

>gb|AF190644.1|AF190644 Mus musculus GABA(A) receptor-associated protein-like 2 (Gabaralp2)
           mRNA, complete cds
          Length = 1012

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 321 tggatccttttcctgatgat 302



to top

>gb|AF087848.1|AF087848 Homo sapiens GABA-A receptor-associated protein like 2 (GABARAPL2)
           mRNA, complete cds
          Length = 972

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 313 tggatccttttcctgatgat 294



to top

>ref|NG_005250.1| Mus musculus GABA(A) receptor-associated protein-like 2 pseudogene
           5_758.1 (Gabarapl2-ps5_758.1) on chromosome 5
          Length = 902

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 244 tggatccttttcctgatgat 225



to top

>emb|AL116566.1|CNS01DA6 Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 536 ccgtggtagaacttgtgcggcatacccttgtgcacggcgccgtt 579
           |||||||| | |||||| ||||||||||| || ||||| |||||
Sbjct: 183 ccgtggtaaaccttgtgtggcatacccttttgaacggcaccgtt 140



to top

>emb|AL116420.1|CNS01D64 Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 536 ccgtggtagaacttgtgcggcatacccttgtgcacggcgccgtt 579
           |||||||| | |||||| ||||||||||| || ||||| |||||
Sbjct: 200 ccgtggtaaaccttgtgtggcatacccttttgaacggcaccgtt 157



to top

>emb|AL115400.1|CNS01CDS Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 536 ccgtggtagaacttgtgcggcatacccttgtgcacggcgccgtt 579
           |||||||| | |||||| ||||||||||| || ||||| |||||
Sbjct: 194 ccgtggtaaaccttgtgtggcatacccttttgaacggcaccgtt 151



to top

>emb|AL115058.1|CNS01C4A Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 536 ccgtggtagaacttgtgcggcatacccttgtgcacggcgccgtt 579
           |||||||| | |||||| ||||||||||| || ||||| |||||
Sbjct: 216 ccgtggtaaaccttgtgtggcatacccttttgaacggcaccgtt 173



to top

>emb|AL113789.1|CNS01B51 Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 536 ccgtggtagaacttgtgcggcatacccttgtgcacggcgccgtt 579
           |||||||| | |||||| ||||||||||| || ||||| |||||
Sbjct: 192 ccgtggtaaaccttgtgtggcatacccttttgaacggcaccgtt 149



to top

>emb|AL112271.1|CNS019YV Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 536 ccgtggtagaacttgtgcggcatacccttgtgcacggcgccgtt 579
           |||||||| | |||||| ||||||||||| || ||||| |||||
Sbjct: 193 ccgtggtaaaccttgtgtggcatacccttttgaacggcaccgtt 150



to top

>gb|AC115914.6| Mus musculus chromosome 8, clone RP24-487J5, complete sequence
          Length = 163170

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 443   tggatccttttcctgatgat 462
             ||||||||||||||||||||
Sbjct: 29546 tggatccttttcctgatgat 29565



to top

>ref|NM_174675.2| Bos taurus GABA(A) receptor-associated protein-like 2 (GABARAPL2),
           mRNA
          Length = 950

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 285 tggatccttttcctgatgat 266



to top

>ref|NM_022706.2| Rattus norvegicus GABA(A) receptor-associated protein like 2
           (Gabarapl2), mRNA
          Length = 1619

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 274 tggatccttttcctgatgat 255



to top

>ref|XM_345534.2| PREDICTED: Rattus norvegicus similar to GABA(A) receptor-associated
           protein like 2 (LOC366374), mRNA
          Length = 1146

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 998 tggatccttttcctgatgat 979



to top

>gb|AY117145.1| Bovine viral diarrhea virus-1 isolate CP 721 polyprotein mRNA,
           partial cds
          Length = 1018

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 758 tggatccttttcctgatgat 739



to top

>gb|AY117147.1| Bos taurus cell-line MDBK 16 kDa golgi-associated ATPase enhancer
           mRNA, complete cds
          Length = 514

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 245 tggatccttttcctgatgat 226



to top

>gb|AF077046.1| Homo sapiens ganglioside expression factor 2 homolog mRNA, complete
           cds
          Length = 1003

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 315 tggatccttttcctgatgat 296



to top

>gb|AF020262.1|AF020262 Bos taurus general protein transport factor p16 mRNA, complete cds
          Length = 950

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 285 tggatccttttcctgatgat 266



to top

>dbj|AB003515.1| Rattus norvegicus mRNA for GEF-2, complete cds
          Length = 975

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 312 tggatccttttcctgatgat 293



to top

>gb|AC124615.11| Mus musculus chromosome 5, clone RP24-445F15, complete sequence
          Length = 128560

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 443    tggatccttttcctgatgat 462
              ||||||||||||||||||||
Sbjct: 107263 tggatccttttcctgatgat 107282



to top

>gb|AY893581.1| Synthetic construct Homo sapiens clone FLH131145.01X GABA(A)
           receptor-associated protein-like 2 (GABARAPL2) mRNA,
           complete cds
          Length = 354

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 206 tggatccttttcctgatgat 187



to top

>gb|AY893550.1| Synthetic construct Homo sapiens clone FLH131140.01X GABA(A)
           receptor-associated protein-like 2 (GABARAPL2) mRNA,
           complete cds
          Length = 354

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 206 tggatccttttcctgatgat 187



to top

>dbj|AK104044.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-022-F04, full
           insert sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 536 ccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcgacg 595
           |||||||||| ||||   ||||||||||| || ||||| |||||| |||| | |||||||
Sbjct: 226 ccgtggtagaccttgaagggcatacccttctggacggcaccgttcgccttaatgtcgacg 167



to top

>gb|AC154533.2| Mus musculus BAC clone RP23-469N16 from 16, complete sequence
          Length = 187213

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 45     tgaaggaaatagcacagtat 64
              ||||||||||||||||||||
Sbjct: 105710 tgaaggaaatagcacagtat 105729



to top

>dbj|AK059120.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-022-F02, full
           insert sequence
          Length = 680

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 536 ccgtggtagaacttgtgcggcatacccttgtgcacggcgccgttcaccttgacgtcgacg 595
           |||||||||| ||||   ||||||||||| || ||||| |||||| |||| | |||||||
Sbjct: 226 ccgtggtagaccttgaagggcatacccttctggacggcaccgttcgccttaatgtcgacg 167



to top

>gb|BT020958.1| Bos taurus GABA(A) receptor-associated protein-like 2 (GABARAPL2),
           mRNA, complete cds
          Length = 953

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 294 tggatccttttcctgatgat 275



to top

>gb|AC115763.10| Mus musculus chromosome 15, clone RP23-64J7, complete sequence
          Length = 243676

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 54     tagcacagtatagcatttct 73
              ||||||||||||||||||||
Sbjct: 224831 tagcacagtatagcatttct 224812



to top

>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome
          Length = 2595221

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 591     cgacgtactcgccgaccttg 610
               ||||||||||||||||||||
Sbjct: 2067324 cgacgtactcgccgaccttg 2067343



to top

>gb|DQ314886.1| Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 13
             like (PPP1R13L) gene, complete cds
          Length = 27899

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 50    gaaatagcacagtatagcatttctgcaa 77
             ||||||||||||  ||||||||||||||
Sbjct: 19557 gaaatagcacagcctagcatttctgcaa 19584



to top

>gb|BC058145.1| Rattus norvegicus GABA(A) receptor-associated protein like 2, mRNA
           (cDNA clone MGC:72812 IMAGE:6921109), complete cds
          Length = 627

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 277 tggatccttttcctgatgat 258



to top

>emb|AL583885.17| Mouse DNA sequence from clone RP23-323K24 on chromosome 15, complete
              sequence
          Length = 136387

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 54     tagcacagtatagcatttct 73
              ||||||||||||||||||||
Sbjct: 114227 tagcacagtatagcatttct 114246



to top

>emb|AL773531.6| Mouse DNA sequence from clone RP23-179F21 on chromosome 2, complete
             sequence
          Length = 202065

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 36    tcatcattctgaaggaaata 55
             ||||||||||||||||||||
Sbjct: 37284 tcatcattctgaaggaaata 37303



to top

>emb|AL928797.6| Mouse DNA sequence from clone RP23-178B19 on chromosome 2, complete
              sequence
          Length = 166185

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 69     tttctgcaaaactcatgata 88
              ||||||||||||||||||||
Sbjct: 100531 tttctgcaaaactcatgata 100550



to top

>dbj|AB030710.1| Homo sapiens FLC3A mRNA for MAP1 light chain 3 related protein,
           complete cds
          Length = 1031

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 443 tggatccttttcctgatgat 462
           ||||||||||||||||||||
Sbjct: 342 tggatccttttcctgatgat 323


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,671,556
Number of Sequences: 3902068
Number of extensions: 4671556
Number of successful extensions: 95429
Number of sequences better than 10.0: 207
Number of HSP's better than 10.0 without gapping: 207
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 94868
Number of HSP's gapped (non-prelim): 511
length of query: 681
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 658
effective length of database: 17,143,297,704
effective search space: 11280289889232
effective search space used: 11280289889232
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top