>dbj|AB234511.1| Uncultured Clostridiales bacterium gene for 16S rRNA, partial
           sequence, clone: MgMjW-48
          Length = 1362

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 45  ggccagctgcggaaagccta 64
           ||||||||||||||||||||
Sbjct: 195 ggccagctgcggaaagccta 214

>gb|AC058822.6| Homo sapiens BAC clone RP11-809N18 from 4, complete sequence
          Length = 170212

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 186   tgccatgtacagctgtgtag 205
             ||||||||||||||||||||
Sbjct: 91013 tgccatgtacagctgtgtag 90994

>gb|AC177808.2| Pan troglodytes BAC clone CH251-703A9 from chromosome unknown,
            complete sequence
          Length = 207792

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 186  tgccatgtacagctgtgtag 205
            ||||||||||||||||||||
Sbjct: 3022 tgccatgtacagctgtgtag 3003

>emb|BX470116.5| Zebrafish DNA sequence from clone DKEY-244B23 in linkage group 4,
              complete sequence
          Length = 195795

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 121    tgattcatacagtttttact 140
              ||||||||||||||||||||
Sbjct: 131134 tgattcatacagtttttact 131115

>gb|AC169792.2| Rhesus Macaque  BAC CH250-117K11 (Children's Hospital Oakland Research
             Institute Rhesus macaque Adult Male BAC Library) complete
             sequence
          Length = 186393

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 186   tgccatgtacagctgtgtag 205
             ||||||||||||||||||||
Sbjct: 20044 tgccatgtacagctgtgtag 20063


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,254,845
Number of Sequences: 3902068
Number of extensions: 1254845
Number of successful extensions: 102523
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 102517
Number of HSP's gapped (non-prelim): 6
length of query: 207
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 185
effective length of database: 17,147,199,772
effective search space: 3172231957820
effective search space used: 3172231957820
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)