ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd18h03 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AB029935.1| Triticum aestivum mRNA for chitinase 2, complete cds Length = 1163 Score = 500 bits (252), Expect = e-138 Identities = 332/360 (92%) Strand = Plus / Minus Query: 216 atctcactgcaccgcgagcccgatgttgaacgacaattggttgtagcagtcgaggttatt 275 ||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||| Sbjct: 983 atctcactgtgccgcgagcccaacgttgaacgacaattggttgtagcagtcgaggttatt 924 Query: 276 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccac 335 |||||||||||||||||| |||||||| ||||||||||||||||||||||| || ||||| Sbjct: 923 cccgtagccgatgccgaaaatgtcacaatagcgcttgtagaacccgatccgatccgccac 864 Query: 336 cttgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgcc 395 |||||||||||||||| ||||||||||||||||||| ||||||||||||||||| || || Sbjct: 863 cttgtcgttctgccccatgccgcattcgatcccgccgttgatgacgttggtgatgacacc 804 Query: 396 gtatccgggtacccgtccggccgcgctgtccctggccgtcggcctccacaaccccgtgat 455 || ||||||||||||||||| ||||| |||||||||||||| |||||| ||||||||| Sbjct: 803 atacccgggtacccgtccggctgcgctatccctggccgtcggagtccacagccccgtgat 744 Query: 456 cacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtctt 515 |||||| ||||||||||||||||||||||||||||||||||||||||| |||| |||||| Sbjct: 743 cacgtcatggcacgacggcttgttggactgcgtcgtcatccagaaccatatcgccgtctt 684 Query: 516 gaacgccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggtccaccccgat 575 ||||||||| |||||||||| |||||||||| ||| |||||||| |||||||||||||| Sbjct: 683 gaacgccactgtcgggtccgtggccaccaggtccggattgttcagcaggtccaccccgat 624 Score = 89.7 bits (45), Expect = 9e-15 Identities = 60/65 (92%) Strand = Plus / Minus Query: 105 aggtctggacatccatttatttggtcataaaatacttaccaagattatttatttgtgggt 164 |||||||| |||||||||||||||||||||| ||||| |||||||||||||||| || || Sbjct: 1085 aggtctggtcatccatttatttggtcataaagtacttcccaagattatttatttatgtgt 1026 Query: 165 gatca 169 ||||| Sbjct: 1025 gatca 1021
>gb|AC132492.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0605G01, complete sequence Length = 146303 Score = 204 bits (103), Expect = 2e-49 Identities = 261/315 (82%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||| ||||||||||||||| |||||||||||||||||| | ||| |||||||||| | Sbjct: 96288 tggtcgtagcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctgg 96229 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||||| |||||||||| |||||| ||||| | || ||||| || | |||||| Sbjct: 96228 tagaagccgatccggttcgccacccggtcgtcggggccgaacccgcactccaacccgccg 96169 Query: 373 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 432 ||||||| |||||||||||||||||| || || ||||| ||||||||| |||||| | Sbjct: 96168 ttgatgatgttggtgatcacgccgtaccccggcacccgcccggccgcgatgtcccccgag 96109 Query: 433 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtc 492 ||||| ||||| |||||||||||||||||||||||||||||| ||||||| |||| Sbjct: 96108 ctcggcgtccactgccccgtgatcacgtcgtggcacgacggcttcggcgactgcggcgtc 96049 Query: 493 atccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncggn 552 ||||||||||| | || ||||||||||| |||| |||||||||||||||||| | ||| Sbjct: 96048 atccagaaccacagcgccgtcttgaacgacaccaccgggtccgacgccaccagctccggg 95989 Query: 553 ttgttcagnaggtcc 567 |||||||| |||||| Sbjct: 95988 ttgttcaggaggtcc 95974 Score = 147 bits (74), Expect = 5e-32 Identities = 115/130 (88%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaat 506 |||||||||||||||||||| |||||||||||| ||||| ||||||||||||||| | Sbjct: 87182 ccccgtgatcacgtcgtggctcgacggcttgttcccctgcggcgtcatccagaaccacag 87123 Query: 507 cgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggtc 566 || ||||||||||| |||||||| ||||| ||||||||||| ||| ||| |||| ||||| Sbjct: 87122 cgccgtcttgaacgacaccgtcgcgtccgtcgccaccaggtccgggttgctcagcaggtc 87063 Query: 567 caccccgatc 576 |||||||||| Sbjct: 87062 caccccgatc 87053 Score = 61.9 bits (31), Expect = 2e-06 Identities = 72/87 (82%) Strand = Plus / Minus Query: 490 gtcatccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtnc 549 |||||||| | ||| | || |||||||||||||||||||||||||| |||||||| | | Sbjct: 106831 gtcatccacagccacagcgccgtcttgaacgccaccgtcgggtccgttgccaccagctcc 106772 Query: 550 ggnttgttcagnaggtccaccccgatc 576 || ||| ||| |||||| | |||||| Sbjct: 106771 gggttgcccagcaggtccgcgccgatc 106745 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 276 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 107042 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 106986 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| ||| |||||||||||| | |||||||||||| | Sbjct: 87376 tggttgtagcagtcgaggttgccgccggtgccgatgccgaacgcgccacagtagcgctgg 87317 Query: 313 tagaacccgatccggt 328 ||||| |||||||||| Sbjct: 87316 tagaagccgatccggt 87301
>gb|AY444342.1| Oryza sativa chitinase gene, complete cds Length = 1101 Score = 204 bits (103), Expect = 2e-49 Identities = 261/315 (82%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||| ||||||||||||||| |||||||||||||||||| | ||| |||||||||| | Sbjct: 1064 tggtcgtagcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctgg 1005 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||||| |||||||||| |||||| ||||| | || ||||| || | |||||| Sbjct: 1004 tagaagccgatccggttcgccacccggtcgtcggggccgaacccgcactccaacccgccg 945 Query: 373 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 432 ||||||| |||||||||||||||||| || || ||||| ||||||||| |||||| | Sbjct: 944 ttgatgatgttggtgatcacgccgtaccccggcacccgcccggccgcgatgtcccccgag 885 Query: 433 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtc 492 ||||| ||||| |||||||||||||||||||||||||||||| ||||||| |||| Sbjct: 884 ctcggcgtccactgccccgtgatcacgtcgtggcacgacggcttcggcgactgcggcgtc 825 Query: 493 atccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncggn 552 ||||||||||| | || ||||||||||| |||| |||||||||||||||||| | ||| Sbjct: 824 atccagaaccacagcgccgtcttgaacgacaccaccgggtccgacgccaccagctccggg 765 Query: 553 ttgttcagnaggtcc 567 |||||||| |||||| Sbjct: 764 ttgttcaggaggtcc 750
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 204 bits (103), Expect = 2e-49 Identities = 261/315 (82%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||| ||||||||||||||| |||||||||||||||||| | ||| |||||||||| | Sbjct: 19292213 tggtcgtagcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctgg 19292154 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||||| |||||||||| |||||| ||||| | || ||||| || | |||||| Sbjct: 19292153 tagaagccgatccggttcgccacccggtcgtcggggccgaacccgcactccaacccgccg 19292094 Query: 373 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 432 ||||||| |||||||||||||||||| || || ||||| ||||||||| |||||| | Sbjct: 19292093 ttgatgatgttggtgatcacgccgtaccccggcacccgcccggccgcgatgtcccccgag 19292034 Query: 433 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtc 492 ||||| ||||| |||||||||||||||||||||||||||||| ||||||| |||| Sbjct: 19292033 ctcggcgtccactgccccgtgatcacgtcgtggcacgacggcttcggcgactgcggcgtc 19291974 Query: 493 atccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncggn 552 ||||||||||| | || ||||||||||| |||| |||||||||||||||||| | ||| Sbjct: 19291973 atccagaaccacagcgccgtcttgaacgacaccaccgggtccgacgccaccagctccggg 19291914 Query: 553 ttgttcagnaggtcc 567 |||||||| |||||| Sbjct: 19291913 ttgttcaggaggtcc 19291899 Score = 147 bits (74), Expect = 5e-32 Identities = 115/130 (88%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaat 506 |||||||||||||||||||| |||||||||||| ||||| ||||||||||||||| | Sbjct: 19283107 ccccgtgatcacgtcgtggctcgacggcttgttcccctgcggcgtcatccagaaccacag 19283048 Query: 507 cgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggtc 566 || ||||||||||| |||||||| ||||| ||||||||||| ||| ||| |||| ||||| Sbjct: 19283047 cgccgtcttgaacgacaccgtcgcgtccgtcgccaccaggtccgggttgctcagcaggtc 19282988 Query: 567 caccccgatc 576 |||||||||| Sbjct: 19282987 caccccgatc 19282978 Score = 61.9 bits (31), Expect = 2e-06 Identities = 72/87 (82%) Strand = Plus / Minus Query: 490 gtcatccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtnc 549 |||||||| | ||| | || |||||||||||||||||||||||||| |||||||| | | Sbjct: 19302756 gtcatccacagccacagcgccgtcttgaacgccaccgtcgggtccgttgccaccagctcc 19302697 Query: 550 ggnttgttcagnaggtccaccccgatc 576 || ||| ||| |||||| | |||||| Sbjct: 19302696 gggttgcccagcaggtccgcgccgatc 19302670 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 276 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 19302967 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 19302911 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| ||| |||||||||||| | |||||||||||| | Sbjct: 19283301 tggttgtagcagtcgaggttgccgccggtgccgatgccgaacgcgccacagtagcgctgg 19283242 Query: 313 tagaacccgatccggt 328 ||||| |||||||||| Sbjct: 19283241 tagaagccgatccggt 19283226 Score = 52.0 bits (26), Expect = 0.002 Identities = 34/37 (91%) Strand = Plus / Minus Query: 489 cgtcatccagaaccaaatcgncgtcttgaacgccacc 525 ||||||||||||||| | || |||||||||||||||| Sbjct: 2157802 cgtcatccagaaccacagcgccgtcttgaacgccacc 2157766 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacga 470 |||||| ||||||||||||||||| Sbjct: 2157850 ccccgtcatcacgtcgtggcacga 2157827
>gb|L37289.1|RICCHITA Oryza sativa chitinase mRNA, complete cds Length = 1291 Score = 204 bits (103), Expect = 2e-49 Identities = 261/315 (82%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||| ||||||||||||||| |||||||||||||||||| | ||| |||||||||| | Sbjct: 1007 tggtcgtagcagtcgaggttgctcccgtagccgatgccgagcacgtcgcagtagcgctgg 948 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||||| |||||||||| |||||| ||||| | || ||||| || | |||||| Sbjct: 947 tagaagccgatccggttcgccacccggtcgtcggggccgaacccgcactccaacccgccg 888 Query: 373 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 432 ||||||| |||||||||||||||||| || || ||||| ||||||||| |||||| | Sbjct: 887 ttgatgatgttggtgatcacgccgtaccccggcacccgcccggccgcgatgtcccccgag 828 Query: 433 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtc 492 ||||| ||||| |||||||||||||||||||||||||||||| ||||||| |||| Sbjct: 827 ctcggcgtccactgccccgtgatcacgtcgtggcacgacggcttcggcgactgcggcgtc 768 Query: 493 atccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncggn 552 ||||||||||| | || ||||||||||| |||| |||||||||||||||||| | ||| Sbjct: 767 atccagaaccacagcgccgtcttgaacgacaccaccgggtccgacgccaccagctccggg 708 Query: 553 ttgttcagnaggtcc 567 |||||||| |||||| Sbjct: 707 ttgttcaggaggtcc 693
>gb|L40337.1|RICRCH1 Oryza sativa chitinase (Rcht1) mRNA, complete cds Length = 1204 Score = 196 bits (99), Expect = 6e-47 Identities = 260/315 (82%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||| ||||||||||||||| |||||||||||||||||| | || |||||||||| | Sbjct: 971 tggtcgtagcagtcgaggttgctcccgtagccgatgccgagcacgttgcagtagcgctgg 912 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||||| |||||||||| |||||| ||||| | || ||||| || | |||||| Sbjct: 911 tagaagccgatccggttcgccacccggtcgtcggggccgaacccgcactccaacccgccg 852 Query: 373 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 432 ||||||| |||||||||||||||||| || || ||||| ||||||||| |||||| | Sbjct: 851 ttgatgatgttggtgatcacgccgtaccccggcacccgcccggccgcgatgtcccccgag 792 Query: 433 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtc 492 ||||| ||||| |||||||||||||||||||||||||||||| ||||||| |||| Sbjct: 791 ctcggcgtccactgccccgtgatcacgtcgtggcacgacggcttcggcgactgcggcgtc 732 Query: 493 atccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncggn 552 ||||||||||| | || ||||||||||| |||| |||||||||||||||||| | ||| Sbjct: 731 atccagaaccacagcgccgtcttgaacgacaccaccgggtccgacgccaccagctccggg 672 Query: 553 ttgttcagnaggtcc 567 |||||||| |||||| Sbjct: 671 ttgttcaggaggtcc 657
>emb|X56787.1|OSLMRNAC O.sativa L. mRNA for endochitinase Length = 1186 Score = 147 bits (74), Expect = 5e-32 Identities = 115/130 (88%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaat 506 |||||||||||||||||||| |||||||||||| ||||| ||||||||||||||| | Sbjct: 792 ccccgtgatcacgtcgtggctcgacggcttgttcccctgcggcgtcatccagaaccacag 733 Query: 507 cgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggtc 566 || ||||||||||| |||||||| ||||| ||||||||||| ||| ||| |||| ||||| Sbjct: 732 cgccgtcttgaacgacaccgtcgcgtccgtcgccaccaggtccgggttgctcagcaggtc 673 Query: 567 caccccgatc 576 |||||||||| Sbjct: 672 caccccgatc 663 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| ||| |||||||||||| | |||||||||||| | Sbjct: 986 tggttgtagcagtcgaggttgccgccggtgccgatgccgaacgcgccacagtagcgctgg 927 Query: 313 tagaacccgatccggt 328 ||||| |||||||||| Sbjct: 926 tagaagccgatccggt 911
>dbj|AK108949.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-C03, full insert sequence Length = 979 Score = 147 bits (74), Expect = 5e-32 Identities = 115/130 (88%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaat 506 |||||||||||||||||||| |||||||||||| ||||| ||||||||||||||| | Sbjct: 457 ccccgtgatcacgtcgtggctcgacggcttgttcccctgcggcgtcatccagaaccacag 398 Query: 507 cgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggtc 566 || ||||||||||| |||||||| ||||| ||||||||||| ||| ||| |||| ||||| Sbjct: 397 cgccgtcttgaacgacaccgtcgcgtccgtcgccaccaggtccgggttgctcagcaggtc 338 Query: 567 caccccgatc 576 |||||||||| Sbjct: 337 caccccgatc 328 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| ||| |||||||||||| | |||||||||||| | Sbjct: 651 tggttgtagcagtcgaggttgccgccggtgccgatgccgaacgcgccacagtagcgctgg 592 Query: 313 tagaacccgatccggt 328 ||||| |||||||||| Sbjct: 591 tagaagccgatccggt 576
>dbj|D16222.1|RICCHT2 Oryza sativa (japonica cultivar-group) Cht-2 gene for endochitinase, complete cds Length = 2986 Score = 147 bits (74), Expect = 5e-32 Identities = 115/130 (88%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaat 506 |||||||||||||||||||| |||||||||||| ||||| ||||||||||||||| | Sbjct: 2227 ccccgtgatcacgtcgtggctcgacggcttgttcccctgcggcgtcatccagaaccacag 2168 Query: 507 cgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggtc 566 || ||||||||||| |||||||| ||||| ||||||||||| ||| ||| |||| ||||| Sbjct: 2167 cgccgtcttgaacgacaccgtcgcgtccgtcgccaccaggtccgggttgctcagcaggtc 2108 Query: 567 caccccgatc 576 |||||||||| Sbjct: 2107 caccccgatc 2098 Score = 56.0 bits (28), Expect = 1e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| ||| |||||||||||| | |||||||||||| | Sbjct: 2421 tggttgtagcagtcgaggttgccgccggtgccgatgccgaacgcgccacagtagcgctgg 2362 Query: 313 tagaacccgatccggt 328 ||||| |||||||||| Sbjct: 2361 tagaagccgatccggt 2346
>gb|L34211.1|BLYCHI33A Hordeum vulgare chitinase (CHI33) gene, complete cds Length = 1779 Score = 141 bits (71), Expect = 3e-30 Identities = 259/323 (80%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| ||||||||||| ||| | ||||| |||||||||| | Sbjct: 1634 tggttgtagcagtcgaggttgcccccgtagccgacgccaaggatgttgcagtagcgctgg 1575 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||||| |||||||||||||| || | || | |||| | ||||| |||| |||||| Sbjct: 1574 tagaagccgatccggtcggcaacacggctgtccgcccccctaccgcactcgagcccgccg 1515 Query: 373 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 432 ||||||| ||||||||| |||||||| ||||| |||| || |||||| |||| |||| Sbjct: 1514 ttgatgatgttggtgatgacgccgtagccgggcaccctccccgccgcggtgtctgcggcc 1455 Query: 433 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtc 492 |||||| |||| |||||||||||| |||| | ||||||||||||| ||||| |||| Sbjct: 1454 gtcggcgtccattggcccgtgatcacggcgtgagaggacggcttgttggcctgcggcgtc 1395 Query: 493 atccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncggn 552 ||||||||||| | | |||| |||| | ||| || | |||| |||||||||| ||| Sbjct: 1394 atccagaaccatagtgccgtcctgaaggacacggtggcatccgtggccaccaggtccggg 1335 Query: 553 ttgttcagnaggtccaccccgat 575 ||||| || |||||||| ||||| Sbjct: 1334 ttgttgagcaggtccacgccgat 1312
>gb|U02286.1|OSU02286 Oryza sativa IR58 chitinase mRNA, complete cds Length = 1051 Score = 139 bits (70), Expect = 1e-29 Identities = 114/130 (87%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaat 506 |||||||| ||||||||||| |||||||||||| ||||| ||||||||||||||| | Sbjct: 787 ccccgtgaccacgtcgtggctcgacggcttgttcccctgcggcgtcatccagaaccacag 728 Query: 507 cgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggtc 566 || ||||||||||| |||||||| ||||| ||||||||||| ||| ||| |||| ||||| Sbjct: 727 cgccgtcttgaacgacaccgtcgcgtccgtcgccaccaggtccgggttgctcagcaggtc 668 Query: 567 caccccgatc 576 |||||||||| Sbjct: 667 caccccgatc 658 Score = 42.1 bits (21), Expect = 2.0 Identities = 30/33 (90%) Strand = Plus / Minus Query: 366 cccgccattgatgacgttggtgatcacgccgta 398 |||||| |||| || |||||||||||||||||| Sbjct: 862 cccgccgttgacgatgttggtgatcacgccgta 830 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggtt 272 |||||||||||||||||||| Sbjct: 975 tggttgtagcagtcgaggtt 956
>gb|AF000966.1|AF000966 Poa pratensis chitinase (Chi2) gene, complete cds Length = 1080 Score = 137 bits (69), Expect = 4e-29 Identities = 132/153 (86%) Strand = Plus / Minus Query: 257 tgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtaga 316 |||||||||| ||||| || ||||||| || ||||| || ||| |||||||||||||||| Sbjct: 967 tgtagcagtccaggttgtttccgtagctgacgccgaggaggtcgcagtagcgcttgtaga 908 Query: 317 acccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattga 376 ||||||||||||| || || || || |||||| |||||||| |||| ||||||||||| Sbjct: 907 acccgatccggtctgcgacgcggttgtcctgccctttgccgcactcgagcccgccattga 848 Query: 377 tgacgttggtgatcacgccgtatccgggtaccc 409 ||| |||||||||||||||||| ||||| |||| Sbjct: 847 tgatgttggtgatcacgccgtacccgggcaccc 815 Score = 79.8 bits (40), Expect = 9e-12 Identities = 96/116 (82%) Strand = Plus / Minus Query: 451 gtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgnc 510 ||||||||| |||||| |||||||||| ||||| | ||||||||||||||| | || | Sbjct: 773 gtgatcacggcgtggctcgacggcttgggcgactgagccgtcatccagaaccacagcgcc 714 Query: 511 gtcttgaacgccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggtc 566 |||||||||| ||| |||||||| | ||||| |||| ||| ||||| || ||||| Sbjct: 713 gtcttgaacgacacggtcgggtctgtggccacaaggtccgggttgttgagcaggtc 658
>gb|AF000965.1|AF000965 Poa pratensis chitinase (Chi3) pseudogene sequence Length = 1173 Score = 137 bits (69), Expect = 4e-29 Identities = 135/157 (85%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| ||||| | |||||||| || ||||| || ||| |||||||||||| Sbjct: 1134 tggttgtagcagtccaggttgtccccgtagctgacgccgaggaggtcgcagtagcgcttg 1075 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||||||||||||| |||||| || || || ||||||||||||||| |||| |||||| Sbjct: 1074 tagaacccgatcctgtcggcgacgcggttgtcctgccccttgccgcactcgagcccgccg 1015 Query: 373 ttgatgacgttggtgatcacgccgtatccgggtaccc 409 ||||||| ||| |||||||||||||| ||||| |||| Sbjct: 1014 ttgatgatgttagtgatcacgccgtacccgggcaccc 978 Score = 71.9 bits (36), Expect = 2e-09 Identities = 95/116 (81%) Strand = Plus / Minus Query: 451 gtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgnc 510 ||||||||| |||||| ||| |||||| ||||| | ||||||||||||||| | || | Sbjct: 936 gtgatcacggcgtggctcgaaggcttgggagactgagccgtcatccagaaccacagcgcc 877 Query: 511 gtcttgaacgccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggtc 566 |||||||||| ||| |||||||| || | ||| |||| ||| ||||| || ||||| Sbjct: 876 gtcttgaacgacacggtcgggtctgaggtcacaaggtccgggttgttgagcaggtc 821
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 133 bits (67), Expect = 7e-28 Identities = 254/315 (80%), Gaps = 2/315 (0%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 30372331 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 30372272 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttg-ccgcattcgatcccgcc 371 |||||||||||||||||||||||||||||| || || || || ||||| || | ||||| Sbjct: 30372271 tagaacccgatccggtcggccaccttgtcg-tccgcgccgtgcccgcactccacaccgcc 30372213 Query: 372 attgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggc 431 ||||||| |||||||||| ||||||| || || || || || ||||| ||| ||| Sbjct: 30372212 gttgatgatgttggtgatctcgccgtagcccggaacgcgccccgccgcctggtcgtcggc 30372153 Query: 432 cgtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgt 491 | |||| ||||| || |||||||| ||||||||||||||||| ||||||| ||| Sbjct: 30372152 ggacggcgtccactggccggtgatcaccgcgtggcacgacggcttgggcgactgcggcgt 30372093 Query: 492 catccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncgg 551 |||||||||||| | || ||||||||| | || || | ||||||||||||||||| ||| Sbjct: 30372092 catccagaaccagaacgccgtcttgaaggagacggtggcgtccgacgccaccaggtccgg 30372033 Query: 552 nttgttcagnaggtc 566 ||||| || ||||| Sbjct: 30372032 gttgttgagcaggtc 30372018 Score = 81.8 bits (41), Expect = 2e-12 Identities = 88/105 (83%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacg 520 ||||||||||||||||| ||||||| ||||||||||||||| | || ||||||||| | Sbjct: 30375732 cgtggcacgacggcttgggcgactgcggcgtcatccagaaccagaacgccgtcttgaagg 30375673 Query: 521 ccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggt 565 || || | ||||||||||||||||| ||| ||| |||| |||| Sbjct: 30375672 agacggtggcgtccgacgccaccaggtccgggttgctcagcaggt 30375628 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 30375940 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 30375881 Query: 313 tagaacccgatccggtcggc 332 |||||||| ||||||||||| Sbjct: 30375880 tagaacccaatccggtcggc 30375861
>dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0017G10 Length = 166700 Score = 133 bits (67), Expect = 7e-28 Identities = 254/315 (80%), Gaps = 2/315 (0%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 9692 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 9633 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttg-ccgcattcgatcccgcc 371 |||||||||||||||||||||||||||||| || || || || ||||| || | ||||| Sbjct: 9632 tagaacccgatccggtcggccaccttgtcg-tccgcgccgtgcccgcactccacaccgcc 9574 Query: 372 attgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggc 431 ||||||| |||||||||| ||||||| || || || || || ||||| ||| ||| Sbjct: 9573 gttgatgatgttggtgatctcgccgtagcccggaacgcgccccgccgcctggtcgtcggc 9514 Query: 432 cgtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgt 491 | |||| ||||| || |||||||| ||||||||||||||||| ||||||| ||| Sbjct: 9513 ggacggcgtccactggccggtgatcaccgcgtggcacgacggcttgggcgactgcggcgt 9454 Query: 492 catccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncgg 551 |||||||||||| | || ||||||||| | || || | ||||||||||||||||| ||| Sbjct: 9453 catccagaaccagaacgccgtcttgaaggagacggtggcgtccgacgccaccaggtccgg 9394 Query: 552 nttgttcagnaggtc 566 ||||| || ||||| Sbjct: 9393 gttgttgagcaggtc 9379 Score = 81.8 bits (41), Expect = 2e-12 Identities = 88/105 (83%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacg 520 ||||||||||||||||| ||||||| ||||||||||||||| | || ||||||||| | Sbjct: 13093 cgtggcacgacggcttgggcgactgcggcgtcatccagaaccagaacgccgtcttgaagg 13034 Query: 521 ccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggt 565 || || | ||||||||||||||||| ||| ||| |||| |||| Sbjct: 13033 agacggtggcgtccgacgccaccaggtccgggttgctcagcaggt 12989 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 13301 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 13242 Query: 313 tagaacccgatccggtcggc 332 |||||||| ||||||||||| Sbjct: 13241 tagaacccaatccggtcggc 13222
>dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0548E04 Length = 138037 Score = 133 bits (67), Expect = 7e-28 Identities = 254/315 (80%), Gaps = 2/315 (0%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 118926 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 118867 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttg-ccgcattcgatcccgcc 371 |||||||||||||||||||||||||||||| || || || || ||||| || | ||||| Sbjct: 118866 tagaacccgatccggtcggccaccttgtcg-tccgcgccgtgcccgcactccacaccgcc 118808 Query: 372 attgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggc 431 ||||||| |||||||||| ||||||| || || || || || ||||| ||| ||| Sbjct: 118807 gttgatgatgttggtgatctcgccgtagcccggaacgcgccccgccgcctggtcgtcggc 118748 Query: 432 cgtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgt 491 | |||| ||||| || |||||||| ||||||||||||||||| ||||||| ||| Sbjct: 118747 ggacggcgtccactggccggtgatcaccgcgtggcacgacggcttgggcgactgcggcgt 118688 Query: 492 catccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncgg 551 |||||||||||| | || ||||||||| | || || | ||||||||||||||||| ||| Sbjct: 118687 catccagaaccagaacgccgtcttgaaggagacggtggcgtccgacgccaccaggtccgg 118628 Query: 552 nttgttcagnaggtc 566 ||||| || ||||| Sbjct: 118627 gttgttgagcaggtc 118613 Score = 81.8 bits (41), Expect = 2e-12 Identities = 88/105 (83%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacg 520 ||||||||||||||||| ||||||| ||||||||||||||| | || ||||||||| | Sbjct: 122327 cgtggcacgacggcttgggcgactgcggcgtcatccagaaccagaacgccgtcttgaagg 122268 Query: 521 ccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggt 565 || || | ||||||||||||||||| ||| ||| |||| |||| Sbjct: 122267 agacggtggcgtccgacgccaccaggtccgggttgctcagcaggt 122223 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 122535 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 122476 Query: 313 tagaacccgatccggtcggc 332 |||||||| ||||||||||| Sbjct: 122475 tagaacccaatccggtcggc 122456
>dbj|AK061280.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-F06, full insert sequence Length = 1169 Score = 133 bits (67), Expect = 7e-28 Identities = 254/315 (80%), Gaps = 2/315 (0%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 1018 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 959 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttg-ccgcattcgatcccgcc 371 |||||||||||||||||||||||||||||| || || || || ||||| || | ||||| Sbjct: 958 tagaacccgatccggtcggccaccttgtcg-tccgcgccgtgcccgcactccacaccgcc 900 Query: 372 attgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggc 431 ||||||| |||||||||| ||||||| || || || || || ||||| ||| ||| Sbjct: 899 gttgatgatgttggtgatctcgccgtagcccggaacgcgccccgccgcctggtcgtcggc 840 Query: 432 cgtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgt 491 | |||| ||||| || |||||||| ||||||||||||||||| ||||||| ||| Sbjct: 839 ggacggcgtccactggccggtgatcaccgcgtggcacgacggcttgggcgactgcggcgt 780 Query: 492 catccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncgg 551 |||||||||||| | || ||||||||| | || || | ||||||||||||||||| ||| Sbjct: 779 catccagaaccagaacgccgtcttgaaggagacggtggcgtccgacgccaccaggtccgg 720 Query: 552 nttgttcagnaggtc 566 ||||| || ||||| Sbjct: 719 gttgttgagcaggtc 705
>dbj|D16223.1|RICCHT3 Oryza sativa (japonica cultivar-group) Cht-3 gene for endochitinase, complete cds Length = 2808 Score = 133 bits (67), Expect = 7e-28 Identities = 254/315 (80%), Gaps = 2/315 (0%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 2773 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 2714 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttg-ccgcattcgatcccgcc 371 |||||||||||||||||||||||||||||| || || || || ||||| || | ||||| Sbjct: 2713 tagaacccgatccggtcggccaccttgtcg-tccgcgccgtgcccgcactccacaccgcc 2655 Query: 372 attgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggc 431 ||||||| |||||||||| ||||||| || || || || || ||||| ||| ||| Sbjct: 2654 gttgatgatgttggtgatctcgccgtagcccggaacgcgccccgccgcctggtcgtcggc 2595 Query: 432 cgtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgt 491 | |||| ||||| || |||||||| ||||||||||||||||| ||||||| ||| Sbjct: 2594 ggacggcgtccactggccggtgatcaccgcgtggcacgacggcttgggcgactgcggcgt 2535 Query: 492 catccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncgg 551 |||||||||||| | || ||||||||| | || || | ||||||||||||||||| ||| Sbjct: 2534 catccagaaccagaacgccgtcttgaaggagacggtggcgtccgacgccaccaggtccgg 2475 Query: 552 nttgttcagnaggtc 566 ||||| || ||||| Sbjct: 2474 gttgttgagcaggtc 2460
>emb|X54367.1|OSCHIT Oryza sativa (rice) gene for endochitinase Length = 1237 Score = 113 bits (57), Expect = 7e-22 Identities = 252/315 (80%), Gaps = 5/315 (1%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 ||||||||||| || ||||||| || |||| || ||| | ||||| |||||||||||| Sbjct: 1080 tggttgtagcaatccaggttatcgccatagctgacgcccagcatgtcgcagtagcgcttg 1021 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttg-ccgcattcgatcccgcc 371 |||||||||||||||||||||||||||||| || || || || ||||| || | ||||| Sbjct: 1020 tagaacccgatccggtcggccaccttgtcg-tccgcgccgtgcccgcactccacaccgcc 962 Query: 372 attgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggc 431 ||||||| |||||||||| ||||||| || || || || || ||||| ||| ||| Sbjct: 961 gttgatgatgttggtgatctcgccgtagcccggaacgcgccccgccgcctggtcgtcggc 902 Query: 432 cgtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgt 491 | |||| ||||| || |||||||| ||||||||||||||||| ||||||| ||| Sbjct: 901 ggacggcgtccactggccggtgatcaccgcgtggcacgacggcttgggcgactgcggcgt 842 Query: 492 catccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtncgg 551 |||||||||||| | || ||||||||| | || | ||||||||||||||||| ||| Sbjct: 841 catccagaaccagaacgccgtcttgaaggagac---tgcgtccgacgccaccaggtccgg 785 Query: 552 nttgttcagnaggtc 566 ||||| || ||||| Sbjct: 784 gttgttgagcaggtc 770
>ref|NM_197596.1| Oryza sativa (japonica cultivar-group) chitinase (OSJNBb0015I11.14), mRNA Length = 924 Score = 101 bits (51), Expect = 2e-18 Identities = 212/266 (79%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 767 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 708 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 707 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 648 Query: 373 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 432 ||||||| ||||||||| ||||| || ||||| || || ||||| ||| ||||| ||| Sbjct: 647 ttgatgatgttggtgatgacgccatacccggggacgcggccggcggcggtgtccgccgcc 588 Query: 433 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtc 492 | |||| ||||| || ||| ||||||||||||||||||||||| ||||| |||| Sbjct: 587 gacggcgtccaccggccgaggatgacgtcgtggcacgacggcttgttcccctgcgccgtc 528 Query: 493 atccagaaccaaatcgncgtcttgaa 518 ||||||||||| || | ||||||||| Sbjct: 527 atccagaaccagatggccgtcttgaa 502
>gb|AC051633.7| Oryza sativa chromosome 10 BAC OSJNBb0015I11 genomic sequence, complete sequence Length = 138824 Score = 101 bits (51), Expect = 2e-18 Identities = 212/266 (79%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 89608 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 89549 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 89548 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 89489 Query: 373 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 432 ||||||| ||||||||| ||||| || ||||| || || ||||| ||| ||||| ||| Sbjct: 89488 ttgatgatgttggtgatgacgccatacccggggacgcggccggcggcggtgtccgccgcc 89429 Query: 433 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtc 492 | |||| ||||| || ||| ||||||||||||||||||||||| ||||| |||| Sbjct: 89428 gacggcgtccaccggccgaggatgacgtcgtggcacgacggcttgttcccctgcgccgtc 89369 Query: 493 atccagaaccaaatcgncgtcttgaa 518 ||||||||||| || | ||||||||| Sbjct: 89368 atccagaaccagatggccgtcttgaa 89343 Score = 69.9 bits (35), Expect = 9e-09 Identities = 55/62 (88%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttg 516 |||||||||| ||||||||||||| ||||| ||||||||||||||| || | ||||||| Sbjct: 104130 acgtcgtggctcgacggcttgttgtactgccccgtcatccagaaccagatggccgtcttg 104071 Query: 517 aa 518 || Sbjct: 104070 aa 104069 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggtt 272 |||||||||||||||||||| Sbjct: 104334 tggttgtagcagtcgaggtt 104315 Score = 40.1 bits (20), Expect = 7.8 Identities = 32/36 (88%) Strand = Plus / Minus Query: 295 atgtcacagtagcgcttgtagaacccgatccggtcg 330 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 104292 atgtcgcagtagcgcttgtagtagccgatgcggtcg 104257
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 101 bits (51), Expect = 2e-18 Identities = 212/266 (79%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 20688156 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 20688097 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 20688096 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 20688037 Query: 373 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 432 ||||||| ||||||||| ||||| || ||||| || || ||||| ||| ||||| ||| Sbjct: 20688036 ttgatgatgttggtgatgacgccatacccggggacgcggccggcggcggtgtccgccgcc 20687977 Query: 433 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtc 492 | |||| ||||| || ||| ||||||||||||||||||||||| ||||| |||| Sbjct: 20687976 gacggcgtccaccggccgaggatgacgtcgtggcacgacggcttgttcccctgcgccgtc 20687917 Query: 493 atccagaaccaaatcgncgtcttgaa 518 ||||||||||| || | ||||||||| Sbjct: 20687916 atccagaaccagatggccgtcttgaa 20687891 Score = 69.9 bits (35), Expect = 9e-09 Identities = 55/62 (88%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttg 516 |||||||||| ||||||||||||| ||||| ||||||||||||||| || | ||||||| Sbjct: 20702678 acgtcgtggctcgacggcttgttgtactgccccgtcatccagaaccagatggccgtcttg 20702619 Query: 517 aa 518 || Sbjct: 20702618 aa 20702617 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggtt 272 |||||||||||||||||||| Sbjct: 20702882 tggttgtagcagtcgaggtt 20702863 Score = 40.1 bits (20), Expect = 7.8 Identities = 32/36 (88%) Strand = Plus / Minus Query: 295 atgtcacagtagcgcttgtagaacccgatccggtcg 330 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 20702840 atgtcgcagtagcgcttgtagtagccgatgcggtcg 20702805
>dbj|AK070067.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042L15, full insert sequence Length = 1073 Score = 101 bits (51), Expect = 2e-18 Identities = 212/266 (79%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 793 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 734 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 733 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 674 Query: 373 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 432 ||||||| ||||||||| ||||| || ||||| || || ||||| ||| ||||| ||| Sbjct: 673 ttgatgatgttggtgatgacgccatacccggggacgcggccggcggcggtgtccgccgcc 614 Query: 433 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtc 492 | |||| ||||| || ||| ||||||||||||||||||||||| ||||| |||| Sbjct: 613 gacggcgtccaccggccgaggatgacgtcgtggcacgacggcttgttcccctgcgccgtc 554 Query: 493 atccagaaccaaatcgncgtcttgaa 518 ||||||||||| || | ||||||||| Sbjct: 553 atccagaaccagatggccgtcttgaa 528
>gb|AY106654.1| Zea mays PCO078819 mRNA sequence Length = 574 Score = 101 bits (51), Expect = 2e-18 Identities = 170/209 (81%), Gaps = 3/209 (1%) Strand = Plus / Plus Query: 275 tcccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggcca 334 ||||||||||||||| ||||| || ||||||||||||||||| || |||||||||| | Sbjct: 229 tcccgtagccgatgcggaagacatcgcagtagcgcttgtagaagccaatccggtcggtga 288 Query: 335 ccttgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgc 394 || | || | ||| | ||||| |||||||| || ||||||| |||||||||||||| Sbjct: 289 cccgggggtccgtcccgtgcccgcactcgatcccaccgttgatgatgttggtgatcacgc 348 Query: 395 cgtatccgggtac---ccgtccggccgcgctgtccctggccgtcggcctccacaaccccg 451 |||| || || | ||| |||||||| |||||| ||||| ||| ||||| ||||| Sbjct: 349 cgtaccctggcgcgccccggccggccgccctgtccgcagccgtgggcgtccactgccccg 408 Query: 452 tgatcacgtcgtggcacgacggcttgttg 480 |||||||| |||||||||||||||||||| Sbjct: 409 tgatcacggcgtggcacgacggcttgttg 437
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 101 bits (51), Expect = 2e-18 Identities = 212/266 (79%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 20699428 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 20699369 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 20699368 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 20699309 Query: 373 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 432 ||||||| ||||||||| ||||| || ||||| || || ||||| ||| ||||| ||| Sbjct: 20699308 ttgatgatgttggtgatgacgccatacccggggacgcggccggcggcggtgtccgccgcc 20699249 Query: 433 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtc 492 | |||| ||||| || ||| ||||||||||||||||||||||| ||||| |||| Sbjct: 20699248 gacggcgtccaccggccgaggatgacgtcgtggcacgacggcttgttcccctgcgccgtc 20699189 Query: 493 atccagaaccaaatcgncgtcttgaa 518 ||||||||||| || | ||||||||| Sbjct: 20699188 atccagaaccagatggccgtcttgaa 20699163 Score = 69.9 bits (35), Expect = 9e-09 Identities = 55/62 (88%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttg 516 |||||||||| ||||||||||||| ||||| ||||||||||||||| || | ||||||| Sbjct: 20713950 acgtcgtggctcgacggcttgttgtactgccccgtcatccagaaccagatggccgtcttg 20713891 Query: 517 aa 518 || Sbjct: 20713890 aa 20713889 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggtt 272 |||||||||||||||||||| Sbjct: 20714154 tggttgtagcagtcgaggtt 20714135 Score = 40.1 bits (20), Expect = 7.8 Identities = 32/36 (88%) Strand = Plus / Minus Query: 295 atgtcacagtagcgcttgtagaacccgatccggtcg 330 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 20714112 atgtcgcagtagcgcttgtagtagccgatgcggtcg 20714077
>emb|X15349.1|HVENDCHT Barley (H.vulgare) mRNA for endochitinase Length = 556 Score = 95.6 bits (48), Expect = 2e-16 Identities = 119/140 (85%), Gaps = 2/140 (1%) Strand = Plus / Minus Query: 257 tgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtaga 316 |||||||||||||||| || |||||||| | ||||| |||||| |||||||||||||| | Sbjct: 517 tgtagcagtcgaggttgttgccgtagccaacgccgaggatgtcgcagtagcgcttgtaaa 458 Query: 317 acccgatccggtcggccaccttgtc-gttctgccccttgccgcattcgatcccgccattg 375 |||||||||| ||||| | || | | || |||||| | ||||| ||||||||||| ||| Sbjct: 457 acccgatccgatcggcga-ctcgactgtcctgcccatgcccgcactcgatcccgccgttg 399 Query: 376 atgacgttggtgatcacgcc 395 | || ||||||||||||||| Sbjct: 398 acgatgttggtgatcacgcc 379
>gb|L34210.1|BLYCHI26A Hordeum vulgare chitinase (CHI26) gene, complete cds Length = 3169 Score = 95.6 bits (48), Expect = 2e-16 Identities = 114/136 (83%) Strand = Plus / Minus Query: 257 tgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtaga 316 ||||||| |||||||| || |||||||| | ||||| ||||||||||||||||||||| | Sbjct: 2478 tgtagcaatcgaggttgttgccgtagccaacgccgaggatgtcacagtagcgcttgtaaa 2419 Query: 317 acccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattga 376 ||||||| || ||||| || | || |||||| | ||||| ||||||||||| |||| Sbjct: 2418 acccgattcgatcggcgacgcggctgtcctgcccgtgaccgcactcgatcccgccgttga 2359 Query: 377 tgacgttggtgatcac 392 ||| |||||||||||| Sbjct: 2358 tgatgttggtgatcac 2343 Score = 42.1 bits (21), Expect = 2.0 Identities = 74/93 (79%) Strand = Plus / Minus Query: 483 ctgcgtcgtcatccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccac 542 ||||| ||||||||||||||| || | |||||| || |||| || | ||||| ||||| Sbjct: 2252 ctgcgccgtcatccagaaccagatggccgtcttaaagcccacagtggcgtccgtggccac 2193 Query: 543 caggtncggnttgttcagnaggtccaccccgat 575 ||||| ||| ||| ||| || || |||||||| Sbjct: 2192 caggtccgggttggccagcagatcgaccccgat 2160
>gb|M62904.1|BLYCHI H.vulgare L. 26kD chitinase mRNA, complete cds Length = 998 Score = 95.6 bits (48), Expect = 2e-16 Identities = 114/136 (83%) Strand = Plus / Minus Query: 257 tgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtaga 316 ||||||| |||||||| || |||||||| | ||||| ||||||||||||||||||||| | Sbjct: 841 tgtagcaatcgaggttgttgccgtagccaacgccgaggatgtcacagtagcgcttgtaaa 782 Query: 317 acccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattga 376 ||||||| || ||||| || | || |||||| | ||||| ||||||||||| |||| Sbjct: 781 acccgattcgatcggcgacgcggctgtcctgcccgtgaccgcactcgatcccgccgttga 722 Query: 377 tgacgttggtgatcac 392 ||| |||||||||||| Sbjct: 721 tgatgttggtgatcac 706 Score = 42.1 bits (21), Expect = 2.0 Identities = 74/93 (79%) Strand = Plus / Minus Query: 483 ctgcgtcgtcatccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccac 542 ||||| ||||||||||||||| || | |||||| || |||| || | ||||| ||||| Sbjct: 615 ctgcgccgtcatccagaaccagatggccgtcttaaagcccacagtggcgtccgtggccac 556 Query: 543 caggtncggnttgttcagnaggtccaccccgat 575 ||||| ||| ||| ||| || || |||||||| Sbjct: 555 caggtccgggttggccagcagatcgaccccgat 523
>gb|U02287.1|HVU02287 Hordeum vulgare cultivar NK1558 chitinase gene, complete cds Length = 1684 Score = 95.6 bits (48), Expect = 2e-16 Identities = 119/140 (85%), Gaps = 2/140 (1%) Strand = Plus / Minus Query: 257 tgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtaga 316 |||||||||||||||| || |||||||| | ||||| |||||| |||||||||||||| | Sbjct: 1536 tgtagcagtcgaggttgttgccgtagccaacgccgaggatgtcgcagtagcgcttgtaaa 1477 Query: 317 acccgatccggtcggccaccttgtc-gttctgccccttgccgcattcgatcccgccattg 375 |||||||||| ||||| | || | | || |||||| | ||||| ||||||||||| ||| Sbjct: 1476 acccgatccgatcggcga-ctcgactgtcctgcccatgcccgcactcgatcccgccgttg 1418 Query: 376 atgacgttggtgatcacgcc 395 | || ||||||||||||||| Sbjct: 1417 acgatgttggtgatcacgcc 1398
>dbj|AB029936.1| Triticum aestivum Chi 3 mRNA for chitinase 3, complete cds Length = 1148 Score = 93.7 bits (47), Expect = 6e-16 Identities = 100/119 (84%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||||||||||||||||| ||| |||||| || |||| ||||||||||||||| | | Sbjct: 800 cccgtgatcacgtcgtggctcgaaggcttgggtgattgcggcgtcatccagaaccacaac 741 Query: 508 gncgtcttgaacgccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggtc 566 | |||||| |||| ||| |||| |||||||||||| |||| ||| ||||| || ||||| Sbjct: 740 gccgtcttaaacgacacggtcgcgtccgacgccacaaggtccgggttgttgagcaggtc 682 Score = 85.7 bits (43), Expect = 1e-13 Identities = 121/147 (82%) Strand = Plus / Minus Query: 252 ttggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgctt 311 ||||||||||||||| ||||| | ||||||| || ||| | || ||| ||||||||||| Sbjct: 996 ttggttgtagcagtccaggttgtcaccgtagctgacgccaaggaggtcgcagtagcgctt 937 Query: 312 gtagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcc 371 ||||||||||||||||||||| || | ||| |||||| ||||| |||| ||| || Sbjct: 936 gtagaacccgatccggtcggcgacacggccgtcctgcccgcgcccgcactcgagcccacc 877 Query: 372 attgatgacgttggtgatcacgccgta 398 ||||||| |||||||||||| ||||| Sbjct: 876 gttgatgatgttggtgatcacaccgta 850
>gb|AF013580.1|AF013580 Oryza sativa clone RGCH8 chitinase gene, complete cds Length = 2730 Score = 87.7 bits (44), Expect = 4e-14 Identities = 125/152 (82%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| |||||||||| |||||| ||||| |||||||||||| Sbjct: 2296 tggttgtagcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttg 2237 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 2236 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 2177 Query: 373 ttgatgacgttggtgatcacgccgtatccggg 404 ||||||| ||||||||| |||||||| ||||| Sbjct: 2176 ttgatgatgttggtgatgacgccgtacccggg 2145 Score = 61.9 bits (31), Expect = 2e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttg 516 |||||||||||||||| |||||| ||||| ||||||||||||||| || | ||||||| Sbjct: 2092 acgtcgtggcacgacgccttgttcccctgcgccgtcatccagaaccagatggccgtcttg 2033 Query: 517 aa 518 || Sbjct: 2032 aa 2031
>gb|AF001500.1|OSAF001500 Oryza sativa clone MIRCH1 chitinase mRNA, partial cds Length = 913 Score = 87.7 bits (44), Expect = 4e-14 Identities = 125/152 (82%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| |||||||||| |||||| ||||| |||||||||||| Sbjct: 756 tggttgtagcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttg 697 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 696 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 637 Query: 373 ttgatgacgttggtgatcacgccgtatccggg 404 ||||||| ||||||||| |||||||| ||||| Sbjct: 636 ttgatgatgttggtgatgacgccgtacccggg 605 Score = 61.9 bits (31), Expect = 2e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttg 516 |||||||||||||||| |||||| ||||| ||||||||||||||| || | ||||||| Sbjct: 552 acgtcgtggcacgacgccttgttcccctgcgccgtcatccagaaccagatggccgtcttg 493 Query: 517 aa 518 || Sbjct: 492 aa 491
>emb|Z29962.1|OSCHITIB O.sativa (PCH6) mRNA for chitinase class I Length = 1100 Score = 85.7 bits (43), Expect = 1e-13 Identities = 43/43 (100%) Strand = Plus / Minus Query: 301 cagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 343 ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 902 cagtagcgcttgtagaacccgatccggtcggccaccttgtcgt 860 Score = 67.9 bits (34), Expect = 3e-08 Identities = 95/116 (81%), Gaps = 3/116 (2%) Strand = Plus / Minus Query: 451 gtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgnc 510 |||||||| ||||||||||||||||| ||||||| ||||||||||||||| | || | Sbjct: 761 gtgatcaccgcgtggcacgacggcttgggcgactgcggcgtcatccagaaccagaacgcc 702 Query: 511 gtcttgaacgccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggtc 566 |||||||| | || |||||||||||||||||| ||| ||||| || ||||| Sbjct: 701 gtcttgaaggagac---taggtccgacgccaccaggtccgggttgttgagcaggtc 649
>gb|AY437443.1| Triticum aestivum cultivar Ning 7840 class I chitinase mRNA, complete cds Length = 1121 Score = 85.7 bits (43), Expect = 1e-13 Identities = 99/119 (83%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| ||||||||||||| ||| |||||| || |||| ||||||||||||||| | | Sbjct: 814 cccgtaatcacgtcgtggctcgaaggcttgggtgattgcggcgtcatccagaaccacaac 755 Query: 508 gncgtcttgaacgccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggtc 566 | |||||| |||| ||| |||| |||||||||||| |||| ||| ||||| || ||||| Sbjct: 754 gccgtcttaaacgacacggtcgcgtccgacgccacaaggtccgggttgttgagcaggtc 696 Score = 83.8 bits (42), Expect = 6e-13 Identities = 120/146 (82%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| ||||| | ||||||| || ||||| | ||| |||||||||||| Sbjct: 1009 tggttgtagcagtccaggttgtcgccgtagctgacgccgagtaggtcgcagtagcgcttg 950 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 |||||||||||||||||||| || | ||| |||||| ||||| |||| ||| || Sbjct: 949 tagaacccgatccggtcggcaacacgggcgtcctgcccgcgcccgcactcgagcccaccg 890 Query: 373 ttgatgacgttggtgatcacgccgta 398 ||||||| |||||||||||| ||||| Sbjct: 889 ttgatgatgttggtgatcacaccgta 864
>dbj|AB016497.1| Oryza sativa mRNA for chitinase, complete cds Length = 923 Score = 85.7 bits (43), Expect = 1e-13 Identities = 210/266 (78%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| | |||||||| ||||| ||||| |||||||||||| Sbjct: 773 tggttgtagcagtcgaggttgctgccgtagcctgcgccgagcatgtcgcagtagcgcttg 714 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||| | ||||| |||||| | ||||||||| || |||||| ||||| ||||| Sbjct: 713 tagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactcgatgccgccg 654 Query: 373 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggccgcgctgtccctggcc 432 ||||||| ||||||||| ||||| || ||||| || || ||||| ||| ||| ||| Sbjct: 653 ttgatgatgttggtgatgacgccatacccggggacgcggccggcggcgtgttccgccgcc 594 Query: 433 gtcggcctccacaaccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtc 492 | |||| ||||| || ||| ||||||||||||||||||||||| ||||| |||| Sbjct: 593 gacggcgtccaccggccgaggatgacgtcgtggcacgacggcttgttcccctgcgccgtc 534 Query: 493 atccagaaccaaatcgncgtcttgaa 518 ||||||||||| || | ||||||||| Sbjct: 533 atccagaaccagatggccgtcttgaa 508
>dbj|AB051579.1| Secale cereale rscc mRNA for seed chitinase-c, complete cds Length = 1018 Score = 83.8 bits (42), Expect = 6e-13 Identities = 111/134 (82%) Strand = Plus / Minus Query: 256 ttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgtag 315 ||||||||||||||||| | |||||||| | ||||| |||||| |||||||||||||| Sbjct: 836 ttgtagcagtcgaggttgtcgccgtagccaacgccgaggatgtcgcagtagcgcttgtaa 777 Query: 316 aacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgccattg 375 ||||||||||| ||||| || | || |||||| | ||||| |||| ||| |||||| Sbjct: 776 aacccgatccgatcggcaacgcggctgtcctgcccgtgcccgcactcgagcccaccattg 717 Query: 376 atgacgttggtgat 389 |||| ||||||||| Sbjct: 716 atgatgttggtgat 703 Score = 58.0 bits (29), Expect = 3e-05 Identities = 76/93 (81%) Strand = Plus / Minus Query: 483 ctgcgtcgtcatccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccac 542 ||||| ||||||||||||||| | || ||||||||||| ||| || ||||||| ||||| Sbjct: 609 ctgcgccgtcatccagaaccacaacgccgtcttgaacgacacggtggggtccgtggccac 550 Query: 543 caggtncggnttgttcagnaggtccaccccgat 575 |||| ||| || |||| || || |||||||| Sbjct: 549 gaggtccggatttctcagcagatcgaccccgat 517
>gb|AY973230.1| Triticum aestivum cultivar Sumai 3 class II chitinase gene, complete cds Length = 811 Score = 83.8 bits (42), Expect = 6e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| | |||||||| | ||||| |||||| |||||||||||| Sbjct: 785 tggttgtagcagtcgaggttgtcgccgtagccaacgccgaggatgtcgcagtagcgcttg 726 Query: 313 tagaacccgatccg 326 || ||||||||||| Sbjct: 725 taaaacccgatccg 712 Score = 69.9 bits (35), Expect = 9e-09 Identities = 73/87 (83%) Strand = Plus / Minus Query: 489 cgtcatccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtn 548 ||||||||||||||| |||| |||||| |||| ||| || ||||| | ||||||||||| Sbjct: 549 cgtcatccagaaccacatcgccgtcttaaacgacactgtggggtcggtcgccaccaggtc 490 Query: 549 cggnttgttcagnaggtccaccccgat 575 ||| ||| |||| || || |||||||| Sbjct: 489 cgggttgctcagcagatcgaccccgat 463
>gb|AY973229.1| Triticum aestivum cultivar Gamenya class II chitinase gene, complete cds Length = 891 Score = 83.8 bits (42), Expect = 6e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| | |||||||| | ||||| |||||| |||||||||||| Sbjct: 785 tggttgtagcagtcgaggttgtcgccgtagccaacgccgaggatgtcgcagtagcgcttg 726 Query: 313 tagaacccgatccg 326 || ||||||||||| Sbjct: 725 taaaacccgatccg 712 Score = 61.9 bits (31), Expect = 2e-06 Identities = 72/87 (82%) Strand = Plus / Minus Query: 489 cgtcatccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtn 548 ||||||||||||||| |||| |||||| |||| ||| || ||||| | |||||||||| Sbjct: 549 cgtcatccagaaccacatcgccgtcttaaacgacactgtggggtcggttgccaccaggtc 490 Query: 549 cggnttgttcagnaggtccaccccgat 575 ||| ||| |||| || || |||||||| Sbjct: 489 cgggttgctcagcagatcgaccccgat 463
>gb|AY453406.1| Bambusa oldhamii chitinase mRNA, complete cds Length = 1232 Score = 81.8 bits (41), Expect = 2e-12 Identities = 169/213 (79%) Strand = Plus / Minus Query: 355 ccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccgtccg 414 ||||| |||| |||||||||||||| ||| ||||| |||||||| ||||| ||||| ||| Sbjct: 881 ccgcactcgagcccgccattgatgatgttcgtgatgacgccgtacccgggaacccggccg 822 Query: 415 gccgcgctgtccctggccgtcggcctccacaaccccgtgatcacgtcgtggcacgacggc 474 |||||| |||| | ||||| ||||| ||||||| ||||||||||||||||||| Sbjct: 821 gccgcgatgtctacgctactcggcgtccactgccccgtggccacgtcgtggcacgacggc 762 Query: 475 ttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacgccaccgtcgggtcc 534 || | ||| | ||||||||||||||| | || |||||||||| ||| |||||| Sbjct: 761 ttcggcgcctgtggcgtcatccagaaccacagcgcggtcttgaacgagaccacagggtcc 702 Query: 535 gacgccaccaggtncggnttgttcagnaggtcc 567 | || ||||| | ||| |||||||| |||||| Sbjct: 701 gctgcgaccagttccgggttgttcaggaggtcc 669
>emb|X56063.1|OSENDO O.sativa mRNA for endochitinase Length = 1160 Score = 81.8 bits (41), Expect = 2e-12 Identities = 88/105 (83%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacg 520 ||||||||||||||||| ||||||| ||||||||||||||| | || ||||||||| | Sbjct: 697 cgtggcacgacggcttgggcgactgcggcgtcatccagaaccagaacgccgtcttgaagg 638 Query: 521 ccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggt 565 || || | ||||||||||||||||| ||| ||| |||| |||| Sbjct: 637 agacggtggcgtccgacgccaccaggtccgggttgctcagcaggt 593 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 905 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 846 Query: 313 tagaacccgatccggtcggc 332 |||||||| ||||||||||| Sbjct: 845 tagaacccaatccggtcggc 826
>dbj|AK105798.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-A08, full insert sequence Length = 1141 Score = 81.8 bits (41), Expect = 2e-12 Identities = 88/105 (83%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacg 520 ||||||||||||||||| ||||||| ||||||||||||||| | || ||||||||| | Sbjct: 802 cgtggcacgacggcttgggcgactgcggcgtcatccagaaccagaacgccgtcttgaagg 743 Query: 521 ccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggt 565 || || | ||||||||||||||||| ||| ||| |||| |||| Sbjct: 742 agacggtggcgtccgacgccaccaggtccgggttgctcagcaggt 698 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 1010 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 951 Query: 313 tagaacccgatccggtcggc 332 |||||||| ||||||||||| Sbjct: 950 tagaacccaatccggtcggc 931
>dbj|AK104020.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-C04, full insert sequence Length = 1136 Score = 81.8 bits (41), Expect = 2e-12 Identities = 88/105 (83%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacg 520 ||||||||||||||||| ||||||| ||||||||||||||| | || ||||||||| | Sbjct: 797 cgtggcacgacggcttgggcgactgcggcgtcatccagaaccagaacgccgtcttgaagg 738 Query: 521 ccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggt 565 || || | ||||||||||||||||| ||| ||| |||| |||| Sbjct: 737 agacggtggcgtccgacgccaccaggtccgggttgctcagcaggt 693 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 1005 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 946 Query: 313 tagaacccgatccggtcggc 332 |||||||| ||||||||||| Sbjct: 945 tagaacccaatccggtcggc 926
>dbj|AK099339.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033028I21, full insert sequence Length = 1174 Score = 81.8 bits (41), Expect = 2e-12 Identities = 88/105 (83%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacg 520 ||||||||||||||||| ||||||| ||||||||||||||| | || ||||||||| | Sbjct: 778 cgtggcacgacggcttgggcgactgcggcgtcatccagaaccagaacgccgtcttgaagg 719 Query: 521 ccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggt 565 || || | ||||||||||||||||| ||| ||| |||| |||| Sbjct: 718 agacggtggcgtccgacgccaccaggtccgggttgctcagcaggt 674 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 986 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 927 Query: 313 tagaacccgatccggtcggc 332 |||||||| ||||||||||| Sbjct: 926 tagaacccaatccggtcggc 907
>gb|AF000964.1|AF000964 Poa pratensis chitinase (Chi1) gene, complete cds Length = 1252 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Minus Query: 345 ctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccggg 404 |||||| |||||||| |||| |||||||||||||| |||||||||||||||||| ||||| Sbjct: 879 ctgccctttgccgcactcgagcccgccattgatgatgttggtgatcacgccgtacccggg 820 Query: 405 taccc 409 |||| Sbjct: 819 caccc 815 Score = 77.8 bits (39), Expect = 4e-11 Identities = 66/75 (88%) Strand = Plus / Minus Query: 255 gttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttgta 314 |||||||||||| ||||| | ||||||| || ||||| || ||| |||||||||||||| Sbjct: 975 gttgtagcagtccaggttgtctccgtagctgacgccgaggaggtcgcagtagcgcttgta 916 Query: 315 gaacccgatccggtc 329 ||||||||||||||| Sbjct: 915 gaacccgatccggtc 901 Score = 71.9 bits (36), Expect = 2e-09 Identities = 95/116 (81%) Strand = Plus / Minus Query: 451 gtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgnc 510 ||||||||| |||||| |||||||||| ||||| | ||||||||||||||| | || | Sbjct: 773 gtgatcacggcgtggctcgacggcttgggcgactgagccgtcatccagaaccacagcgcc 714 Query: 511 gtcttgaacgccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggtc 566 ||| |||||| ||| |||| || ||| ||||| |||| ||| ||||| || ||||| Sbjct: 713 gtcctgaacgacacggtcgcgttcgaggccacaaggtccgggttgttgagcaggtc 658
>dbj|AK061042.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-D05, full insert sequence Length = 1217 Score = 81.8 bits (41), Expect = 2e-12 Identities = 88/105 (83%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacg 520 ||||||||||||||||| ||||||| ||||||||||||||| | || ||||||||| | Sbjct: 800 cgtggcacgacggcttgggcgactgcggcgtcatccagaaccagaacgccgtcttgaagg 741 Query: 521 ccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggt 565 || || | ||||||||||||||||| ||| ||| |||| |||| Sbjct: 740 agacggtggcgtccgacgccaccaggtccgggttgctcagcaggt 696 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 1008 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 949 Query: 313 tagaacccgatccggtcggc 332 |||||||| ||||||||||| Sbjct: 948 tagaacccaatccggtcggc 929
>dbj|D16221.1|RICCHT1 Oryza sativa (japonica cultivar-group) Cht-1 gene for endochitinase, complete cds Length = 2739 Score = 81.8 bits (41), Expect = 2e-12 Identities = 88/105 (83%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacg 520 ||||||||||||||||| ||||||| ||||||||||||||| | || ||||||||| | Sbjct: 2062 cgtggcacgacggcttgggcgactgcggcgtcatccagaaccagaacgccgtcttgaagg 2003 Query: 521 ccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggt 565 || || | ||||||||||||||||| ||| ||| |||| |||| Sbjct: 2002 agacggtggcgtccgacgccaccaggtccgggttgctcagcaggt 1958 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 2270 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 2211 Query: 313 tagaacccgatccggtcggc 332 |||||||| ||||||||||| Sbjct: 2210 tagaacccaatccggtcggc 2191
>gb|AC140005.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJA1004C08, complete sequence Length = 138054 Score = 79.8 bits (40), Expect = 9e-12 Identities = 66/75 (88%) Strand = Plus / Minus Query: 451 gtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgnc 510 ||||| ||||||||||||||||||||| ||||||| ||||||||||||||| || | | Sbjct: 66612 gtgattacgtcgtggcacgacggcttgggtgactgcgccgtcatccagaaccagatggcc 66553 Query: 511 gtcttgaacgccacc 525 ||| ||||||||||| Sbjct: 66552 gtcctgaacgccacc 66538
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 79.8 bits (40), Expect = 9e-12 Identities = 66/75 (88%) Strand = Plus / Minus Query: 451 gtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgnc 510 ||||| ||||||||||||||||||||| ||||||| ||||||||||||||| || | | Sbjct: 1841750 gtgattacgtcgtggcacgacggcttgggtgactgcgccgtcatccagaaccagatggcc 1841691 Query: 511 gtcttgaacgccacc 525 ||| ||||||||||| Sbjct: 1841690 gtcctgaacgccacc 1841676 Score = 73.8 bits (37), Expect = 6e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 278 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacct 337 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 17204043 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacgc 17203984 Query: 338 tgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgt 397 |||| || || | |||||| || | |||||| ||||||| ||||||||| ||||||| Sbjct: 17203983 gatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccgt 17203924 Query: 398 a 398 | Sbjct: 17203923 a 17203923 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 ||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 17203860 cgtggcacgacggcttgggcgactgcggcgtcatccagaacca 17203818
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 79.8 bits (40), Expect = 9e-12 Identities = 66/75 (88%) Strand = Plus / Minus Query: 451 gtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgnc 510 ||||| ||||||||||||||||||||| ||||||| ||||||||||||||| || | | Sbjct: 1841748 gtgattacgtcgtggcacgacggcttgggtgactgcgccgtcatccagaaccagatggcc 1841689 Query: 511 gtcttgaacgccacc 525 ||| ||||||||||| Sbjct: 1841688 gtcctgaacgccacc 1841674 Score = 73.8 bits (37), Expect = 6e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 278 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacct 337 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 17197612 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacgc 17197553 Query: 338 tgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgt 397 |||| || || | |||||| || | |||||| ||||||| ||||||||| ||||||| Sbjct: 17197552 gatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccgt 17197493 Query: 398 a 398 | Sbjct: 17197492 a 17197492 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 ||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 17197429 cgtggcacgacggcttgggcgactgcggcgtcatccagaacca 17197387
>gb|AF280437.1|AF280437 Secale cereale 31.7 kDa class I endochitinase-antifreeze protein precursor, mRNA, complete cds Length = 1192 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| || || | ||||||| || ||||| || |||||||||||||||| Sbjct: 989 tggttgtagcagtccagattgtggccgtagctgacgccgaggaggtcacagtagcgcttg 930 Query: 313 tagaacccgatccggtcggc 332 ||||||||||| |||||||| Sbjct: 929 tagaacccgattcggtcggc 910 Score = 48.1 bits (24), Expect = 0.032 Identities = 39/44 (88%) Strand = Plus / Minus Query: 355 ccgcattcgatcccgccattgatgacgttggtgatcacgccgta 398 ||||| |||| ||| || ||||||| |||||||||||||||||| Sbjct: 887 ccgcactcgagcccaccgttgatgatgttggtgatcacgccgta 844 Score = 48.1 bits (24), Expect = 0.032 Identities = 48/56 (85%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 ||||||||||||||||||| ||| || || ||||||| ||||||||||||||| Sbjct: 794 cccgtgatcacgtcgtggctcgaaggttttggtgactgcggcgtcatccagaacca 739
>dbj|AK099355.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044P19, full insert sequence Length = 1097 Score = 79.8 bits (40), Expect = 9e-12 Identities = 66/75 (88%) Strand = Plus / Minus Query: 451 gtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgnc 510 ||||| ||||||||||||||||||||| ||||||| ||||||||||||||| || | | Sbjct: 610 gtgattacgtcgtggcacgacggcttgggtgactgcgccgtcatccagaaccagatggcc 551 Query: 511 gtcttgaacgccacc 525 ||| ||||||||||| Sbjct: 550 gtcctgaacgccacc 536
>dbj|AK059871.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-207-E11, full insert sequence Length = 1086 Score = 79.8 bits (40), Expect = 9e-12 Identities = 66/75 (88%) Strand = Plus / Minus Query: 451 gtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgnc 510 ||||| ||||||||||||||||||||| ||||||| ||||||||||||||| || | | Sbjct: 613 gtgattacgtcgtggcacgacggcttgggtgactgcgccgtcatccagaaccagatggcc 554 Query: 511 gtcttgaacgccacc 525 ||| ||||||||||| Sbjct: 553 gtcctgaacgccacc 539
>gb|L40336.1|RICCHITB Oryza sativa chitinase (Rcht2) gene, complete cds Length = 5595 Score = 75.8 bits (38), Expect = 1e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| |||||||||| |||||| ||||| |||||||||||| Sbjct: 4846 tggttgtagcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttg 4787 Query: 313 tagaacccgatccggtcg 330 ||| | ||||| |||||| Sbjct: 4786 tagtagccgatgcggtcg 4769 Score = 61.9 bits (31), Expect = 2e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttg 516 ||||||||||||||||||||||| |||| ||||||||||||||| || | ||||||| Sbjct: 4642 acgtcgtggcacgacggcttgttcccctgccccgtcatccagaaccagatggccgtcttg 4583 Query: 517 aa 518 || Sbjct: 4582 aa 4581
>gb|L40338.1|RICRCH0 Oryza sativa (clone RCH08) chitinase (Rcht2) mRNA, 3' end of cds Length = 652 Score = 75.8 bits (38), Expect = 1e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||||||||| |||||||||| |||||| ||||| |||||||||||| Sbjct: 509 tggttgtagcagtcgaggttgctcccgtagcctgtgccgagcatgtcgcagtagcgcttg 450 Query: 313 tagaacccgatccggtcg 330 ||| | ||||| |||||| Sbjct: 449 tagtagccgatgcggtcg 432 Score = 69.9 bits (35), Expect = 9e-09 Identities = 55/62 (88%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttg 516 ||||||||||||||||||||||| ||||| ||||||||||||||| || | ||||||| Sbjct: 305 acgtcgtggcacgacggcttgttcccctgcgccgtcatccagaaccagatggccgtcttg 246 Query: 517 aa 518 || Sbjct: 245 aa 244
>gb|AC148763.14| Medicago truncatula clone mth2-29o24, complete sequence Length = 104879 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Plus Query: 355 ccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccgtccg 414 |||||||||| ||| || ||||| | |||||||||||||||||||||||| ||||||||| Sbjct: 25093 ccgcattcgagcccaccgttgattatgttggtgatcacgccgtatccggggacccgtccg 25152 Query: 415 gc 416 || Sbjct: 25153 gc 25154 Score = 71.9 bits (36), Expect = 2e-09 Identities = 51/56 (91%) Strand = Plus / Plus Query: 355 ccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccg 410 |||||||||| |||||| ||||| | |||||||||||||||||||||||| ||||| Sbjct: 29219 ccgcattcgagcccgccgttgattatgttggtgatcacgccgtatccggggacccg 29274 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 366 cccgccattgatgacgttggtgatcacgccgtatccgggtaccc 409 |||||| ||||| | ||||||||||||||| ||||||||||||| Sbjct: 14909 cccgccgttgattatgttggtgatcacgccatatccgggtaccc 14952
>gb|AY997529.2| Musa x paradisiaca chitinase (Chi-1) mRNA, complete cds Length = 1082 Score = 75.8 bits (38), Expect = 1e-10 Identities = 101/122 (82%) Strand = Plus / Minus Query: 277 ccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacc 336 ||||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 981 ccgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacg 922 Query: 337 ttgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccg 396 |||| || || | |||||| || | |||||| ||||||| ||||||||| |||||| Sbjct: 921 cgatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccg 862 Query: 397 ta 398 || Sbjct: 861 ta 860 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 ||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 797 cgtggcacgacggcttgggcgactgcggcgtcatccagaacca 755
>gb|AF167323.1|AF167323 Medicago truncatula clone T130002g putative chitinase gene, partial cds Length = 260 Score = 75.8 bits (38), Expect = 1e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 355 ccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccgtccg 414 |||||||||| ||| || ||||| | |||||||||||||||||||||||| ||||||||| Sbjct: 177 ccgcattcgagcccaccgttgattatgttggtgatcacgccgtatccggggacccgtccg 118 Query: 415 gc 416 || Sbjct: 117 gc 116
>dbj|AB096607.1| Taxodium distichum Chi1 gene for putative class I chitinase, partial cds, isolate:St. Mark01 Length = 1470 Score = 75.8 bits (38), Expect = 1e-10 Identities = 64/73 (87%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||| ||| |||||||| |||||||||||||| ||| Sbjct: 1253 cccgtcatgacgtcgtggcacgacggtttgggggactgcgcagtcatccagaaccagatc 1194 Query: 508 gncgtcttgaacg 520 | ||||||||||| Sbjct: 1193 gccgtcttgaacg 1181
>dbj|AB077023.1| Thujopsis dolabrata Chi1 gene for chitinase class I partial cds, exon 3 Length = 273 Score = 75.8 bits (38), Expect = 1e-10 Identities = 64/73 (87%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| |||||||| ||||||||||| ||| ||||||| ||||||||||||||| ||| Sbjct: 98 cccgtcatcacgtcatggcacgacggtttgggagactgcgccgtcatccagaaccagatc 39 Query: 508 gncgtcttgaacg 520 | ||||||||||| Sbjct: 38 gccgtcttgaacg 26
>dbj|AB077021.1| Taxodium distichum Chi1 gene for chitinase class I partial cds, exon 3 Length = 273 Score = 75.8 bits (38), Expect = 1e-10 Identities = 64/73 (87%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||| ||| |||||||| |||||||||||||| ||| Sbjct: 98 cccgtcatgacgtcgtggcacgacggtttgggggactgcgcagtcatccagaaccagatc 39 Query: 508 gncgtcttgaacg 520 | ||||||||||| Sbjct: 38 gccgtcttgaacg 26
>dbj|AB077020.1| Glyptostrobus lineatus Chi1 gene for chitinase class I partial cds, exon 3 Length = 273 Score = 75.8 bits (38), Expect = 1e-10 Identities = 64/73 (87%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||| ||| |||||||| |||||||||||||| ||| Sbjct: 98 cccgtcatgacgtcgtggcacgacggtttgggggactgcgcagtcatccagaaccagatc 39 Query: 508 gncgtcttgaacg 520 | ||||||||||| Sbjct: 38 gccgtcttgaacg 26
>ref|XM_468715.1| Oryza sativa (japonica cultivar-group), mRNA Length = 981 Score = 73.8 bits (37), Expect = 6e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 278 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacct 337 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 937 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacgc 878 Query: 338 tgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgt 397 |||| || || | |||||| || | |||||| ||||||| ||||||||| ||||||| Sbjct: 877 gatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccgt 818 Query: 398 a 398 | Sbjct: 817 a 817 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 ||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 754 cgtggcacgacggcttgggcgactgcggcgtcatccagaacca 712
>gb|AC145386.1| Oryza sativa chromosome 3 BAC OSJNBb0028K20 genomic sequence, complete sequence Length = 115326 Score = 73.8 bits (37), Expect = 6e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 278 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacct 337 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 36787 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacgc 36728 Query: 338 tgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgt 397 |||| || || | |||||| || | |||||| ||||||| ||||||||| ||||||| Sbjct: 36727 gatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccgt 36668 Query: 398 a 398 | Sbjct: 36667 a 36667 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 ||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 36604 cgtggcacgacggcttgggcgactgcggcgtcatccagaacca 36562
>emb|Z78202.1|PACHI1 Persea americana mRNA for endochitinase Length = 1120 Score = 73.8 bits (37), Expect = 6e-10 Identities = 79/93 (84%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggccaccttgtcgttctgccccttgcc 356 ||||||||| | ||||||||| || || ||||| ||||||||||| || |||||||| Sbjct: 922 gtcacagtacctcttgtagaagccaatgcggtctgccaccttgtcattgaatcccttgcc 863 Query: 357 gcattcgatcccgccattgatgacgttggtgat 389 |||||||||||| || ||||||| ||||||||| Sbjct: 862 gcattcgatcccaccgttgatgatgttggtgat 830
>gb|AC137992.2| Oryza sativa chromosome 3 BAC OSJNBb0056B16 genomic sequence, complete sequence Length = 153247 Score = 73.8 bits (37), Expect = 6e-10 Identities = 100/121 (82%) Strand = Plus / Minus Query: 278 cgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggccacct 337 |||||| || ||||| |||||| ||||||||||||||||| |||||||||||||| || Sbjct: 95436 cgtagctgacgccgaggatgtcgcagtagcgcttgtagaagccgatccggtcggcgacgc 95377 Query: 338 tgtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgt 397 |||| || || | |||||| || | |||||| ||||||| ||||||||| ||||||| Sbjct: 95376 gatcgtcctcgccatggccgcactccagcccgccgttgatgatgttggtgatgacgccgt 95317 Query: 398 a 398 | Sbjct: 95316 a 95316 Score = 54.0 bits (27), Expect = 5e-04 Identities = 39/43 (90%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 ||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 95253 cgtggcacgacggcttgggcgactgcggcgtcatccagaacca 95211
>dbj|AB161939.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS104 Length = 1172 Score = 71.9 bits (36), Expect = 2e-09 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatsacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>ref|NM_197598.1| Oryza sativa (japonica cultivar-group) putative chitinase (OSJNBb0015I11.16), mRNA Length = 891 Score = 69.9 bits (35), Expect = 9e-09 Identities = 55/62 (88%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttg 516 |||||||||| ||||||||||||| ||||| ||||||||||||||| || | ||||||| Sbjct: 659 acgtcgtggctcgacggcttgttgtactgccccgtcatccagaaccagatggccgtcttg 600 Query: 517 aa 518 || Sbjct: 599 aa 598 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggtt 272 |||||||||||||||||||| Sbjct: 863 tggttgtagcagtcgaggtt 844 Score = 40.1 bits (20), Expect = 7.8 Identities = 32/36 (88%) Strand = Plus / Minus Query: 295 atgtcacagtagcgcttgtagaacccgatccggtcg 330 ||||| ||||||||||||||| | ||||| |||||| Sbjct: 821 atgtcgcagtagcgcttgtagtagccgatgcggtcg 786
>dbj|AB051578.1| Secale cereale rsca mRNA for seed chitinase-a, complete cds Length = 1191 Score = 69.9 bits (35), Expect = 9e-09 Identities = 116/143 (81%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||| ||||||||||| || || ||||| | | | |||||| |||||||||||| Sbjct: 1007 tggttgtaacagtcgaggttgttgccatagccaacacgaaggatgtcgcagtagcgcttg 948 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 || |||||||| || ||||| || | || |||||| | ||||| |||||||||||| Sbjct: 947 taaaacccgattcgatcggcgactcggctgtcctgcccatgcccgcactcgatcccgcca 888 Query: 373 ttgatgacgttggtgatcacgcc 395 |||| || ||||||||||||||| Sbjct: 887 ttgacgatgttggtgatcacgcc 865 Score = 48.1 bits (24), Expect = 0.032 Identities = 50/59 (84%) Strand = Plus / Minus Query: 489 cgtcatccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggt 547 ||||||||| ||||| || | ||||| |||| |||||||||||||| |||||||||| Sbjct: 771 cgtcatccaaaaccacatggctgtcttaaacgacaccgtcgggtccgtggccaccaggt 713
>gb|U57410.1|PSU57410 Pinus strobus chitinase (Pschi4) gene, complete cds Length = 2092 Score = 69.9 bits (35), Expect = 9e-09 Identities = 64/74 (86%) Strand = Plus / Minus Query: 454 atcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtc 513 ||||||||||||||||| ||||| ||||||| ||||||||||||||||| || |||| Sbjct: 1533 atcacgtcgtggcacgaaggcttcggagactgcgccgtcatccagaaccaaaccgccgtc 1474 Query: 514 ttgaacgccaccgt 527 || |||| |||||| Sbjct: 1473 ttaaacgacaccgt 1460
>dbj|AB161943.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS110 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161942.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS109 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161941.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS108 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161940.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS107 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161938.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS103 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161937.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS102 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161936.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: YNS101 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161935.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY10 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161934.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY09 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161933.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY07 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161932.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY05 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161931.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY04 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161930.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY03 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161929.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY02 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161928.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TTY01 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161927.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS10 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161926.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS09 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161925.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS08 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161924.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS06 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161923.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS05 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161922.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS04 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161921.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS03 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161920.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: TDS02 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161919.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: FUJ31 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161918.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: FUJ30 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161917.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: FUJ23 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161916.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: FUJ18 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161914.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: FUJ15 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161913.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: FUJ11 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB161912.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: FUJ10 Length = 1172 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>dbj|AB096365.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Nishi-iwai1 Length = 1468 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1251 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1192 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1191 cccgtcttgaacg 1179
>dbj|AB096364.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-iwai2 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096363.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-iwai1 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096362.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Iwateken12 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096361.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Iwateken10 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096360.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Iwateken9 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096359.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Iwateken1 Length = 1467 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1191 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1190 cccgtcttgaacg 1178
>dbj|AB096358.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Ninohe1 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096357.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kesen6 Length = 1467 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1191 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1190 cccgtcttgaacg 1178
>dbj|AB096356.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kesen5 Length = 1467 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1191 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1190 cccgtcttgaacg 1178
>dbj|AB096354.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kami-hei11 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096353.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kami-hei8 Length = 1467 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1191 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1190 cccgtcttgaacg 1178
>dbj|AB096352.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kami-hei5 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096351.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kami-hei4 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096350.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kami-hei2 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096349.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kamiichi3 Length = 1467 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1191 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1190 cccgtcttgaacg 1178
>dbj|AB096348.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Hayatsuki17 Length = 1467 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1191 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1190 cccgtcttgaacg 1178
>dbj|AB096347.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Ohyama1 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096346.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Isurugi2 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096345.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Johana1 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096344.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Ohara504 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096343.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Ohara15 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096342.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Ohara7 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096341.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Iwafune5 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096340.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Naoetsu1 Length = 1468 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1251 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1192 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1191 cccgtcttgaacg 1179
>dbj|AB096339.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kashiwazaki-shi2 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096338.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Nagaoka-shi2 Length = 1467 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1191 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1190 cccgtcttgaacg 1178
>dbj|AB096337.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-kubiki2 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096336.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-kabahara1 Length = 1467 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1191 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1190 cccgtcttgaacg 1178
>dbj|AB096335.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kita-kabahara2 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096334.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kita-kabahara1 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096333.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Senzu2 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096332.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Nishikawa7 Length = 1467 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1191 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1190 cccgtcttgaacg 1178
>dbj|AB096331.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Tenryu10 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096330.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Keta4 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096329.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kanra1 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096328.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-kamo7 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096327.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-kamo6 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096326.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-kamo3 Length = 1467 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1191 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1190 cccgtcttgaacg 1178
>dbj|AB096325.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Higashi-kamo2 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096324.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Amagi7 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096323.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Amagi6 Length = 1467 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1191 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1190 cccgtcttgaacg 1178
>dbj|AB096322.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Amagi3 Length = 1467 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1250 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1191 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1190 cccgtcttgaacg 1178
>dbj|AB096321.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Amagi1 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096320.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Minami-shitara6 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096319.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Minami-shitara2 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>dbj|AB096318.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Kita-shitara2 Length = 1466 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 1249 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 1190 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 1189 cccgtcttgaacg 1177
>gb|AY103739.1| Zea mays PCO142303 mRNA sequence Length = 1077 Score = 67.9 bits (34), Expect = 3e-08 Identities = 57/65 (87%) Strand = Plus / Minus Query: 454 atcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtc 513 |||||| ||||||||||||||||| ||||||| ||||||||||||||| || | |||| Sbjct: 603 atcacggcgtggcacgacggcttgggcgactgcggcgtcatccagaaccagatggccgtc 544 Query: 514 ttgaa 518 ||||| Sbjct: 543 ttgaa 539
>dbj|AB077024.1| Thuja standishii Chi1 gene for chitinase class I partial cds, exon 3 Length = 273 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||| ||||||||||| ||| ||||||| ||||||||||||||| ||| Sbjct: 98 cccgtcatgacgtcatggcacgacggtttgggagactgcgccgtcatccagaaccagatc 39 Query: 508 gncgtcttgaacg 520 | ||||||||||| Sbjct: 38 gccgtcttgaacg 26
>dbj|AB077022.1| Cryptomeria japonica Chi1 gene for chitinase class I partial cds, exon 3 Length = 273 Score = 67.9 bits (34), Expect = 3e-08 Identities = 63/73 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 98 cccgtcatgacgtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 39 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 38 cccgtcttgaacg 26
>gb|AY532766.1| Zea diploperennis isolate d8 chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532765.1| Zea diploperennis isolate d7 chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532764.1| Zea diploperennis isolate d6 chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532763.1| Zea diploperennis isolate d5 chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532762.1| Zea diploperennis isolate d5b chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532761.1| Zea diploperennis isolate d4 chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532760.1| Zea diploperennis isolate d3 chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532759.1| Zea diploperennis isolate d2 chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532758.1| Zea diploperennis isolate d1 chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532757.1| Zea mays subsp. parviglumis isolate p15 chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532756.1| Zea mays subsp. parviglumis isolate p14b chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532755.1| Zea mays subsp. parviglumis isolate p14 chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532754.1| Zea mays subsp. parviglumis isolate p13b chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532753.1| Zea mays subsp. parviglumis isolate p13 chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532752.1| Zea mays subsp. parviglumis isolate p12 chitinase (chiI) gene, complete cds Length = 1082 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532751.1| Zea mays subsp. parviglumis isolate p11 chitinase (chiI) gene, complete cds Length = 1081 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 756 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 700 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871
>gb|AY532750.1| Zea mays subsp. parviglumis isolate p9 chitinase (chiI) gene, complete cds Length = 1084 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 759 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 703 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 909 gtcacagtatcgtttgtagaagccgatccggtcggc 874
>gb|AY532749.1| Zea mays subsp. parviglumis isolate p8 chitinase (chiI) gene, complete cds Length = 1081 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 756 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 700 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871
>gb|AY532748.1| Zea mays subsp. parviglumis isolate p6 chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532747.1| Zea mays subsp. parviglumis isolate p5 chitinase (chiI) gene, complete cds Length = 1089 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 756 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 700 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871
>gb|AY532746.1| Zea mays subsp. parviglumis isolate p4 chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532745.1| Zea mays subsp. parviglumis isolate p3 chitinase (chiI) gene, complete cds Length = 1078 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532744.1| Zea mays subsp. parviglumis isolate p2 chitinase (chiI) gene, complete cds Length = 1087 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 753 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 697 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 903 gtcacagtatcgtttgtagaagccgatccggtcggc 868
>gb|AY532743.1| Zea mays subsp. parviglumis isolate p1 chitinase (chiI) gene, complete cds Length = 1081 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||| || ||||||||||||||||||||| ||||||| ||||||||||||||| Sbjct: 756 ccccgtcatgacgtcgtggcacgacggcttgggcgactgcggcgtcatccagaacca 700 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 906 gtcacagtatcgtttgtagaagccgatccggtcggc 871
>gb|AY378172.1| Oryza sativa (japonica cultivar-group) OsmChiI-34 mRNA, partial cds Length = 894 Score = 65.9 bits (33), Expect = 1e-07 Identities = 86/105 (81%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacg 520 ||||||||||||||||| ||||||| |||||||||||||| | || |||||||| | Sbjct: 682 cgtggcacgacggcttgggcgactgcggggtcatccagaaccagaacgccgtcttgaggg 623 Query: 521 ccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggt 565 || || | ||||||||||||||||| ||| ||| |||| |||| Sbjct: 622 agacggtggcgtccgacgccaccaggtccgggttgctcagcaggt 578 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 890 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 831 Query: 313 tagaacccgatccggtcggc 332 |||||||| ||||||||||| Sbjct: 830 tagaacccaatccggtcggc 811
>emb|X63899.1|PSCHITIN P.sativum mRNA for chitinase Length = 1143 Score = 65.9 bits (33), Expect = 1e-07 Identities = 51/57 (89%) Strand = Plus / Minus Query: 354 gccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccg 410 ||||||||| |||||||||||||| | |||||||||||| || |||||||| ||||| Sbjct: 879 gccgcattcaatcccgccattgattatgttggtgatcacaccatatccggggacccg 823
>dbj|AB029934.1| Triticum aestivum Chi 1 mRNA for chitinase 1, complete cds Length = 979 Score = 65.9 bits (33), Expect = 1e-07 Identities = 75/89 (84%) Strand = Plus / Minus Query: 355 ccgcattcgatcccgccattgatgacgttggtgatcacgccgtatccgggtacccgtccg 414 ||||| |||| |||||| ||||||| ||||||||||| |||||||||||||||| ||| Sbjct: 726 ccgcactcgagcccgccgttgatgatattggtgatcactccgtatccgggtaccctgccg 667 Query: 415 gccgcgctgtccctggccgtcggcctcca 443 || ||| |||| |||||||||| |||| Sbjct: 666 gcagcggtgtcggcggccgtcggcgtcca 638 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||| |||||||||||||||||| ||||| ||||||||||||||| Sbjct: 624 acgttgtggcacgacggcttgtttccctgcgccgtcatccagaacca 578
>emb|Z29961.1|OSCHITIA O.sativa (PCH16) mRNA for chitinase class I Length = 1159 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 1073 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 1014 Query: 313 tagaacccgatccggtcggc 332 |||||||| ||||||||||| Sbjct: 1013 tagaacccaatccggtcggc 994 Score = 61.9 bits (31), Expect = 2e-06 Identities = 86/105 (81%), Gaps = 3/105 (2%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacg 520 ||||||||||||||||| ||||||| ||||||||||||||| | || ||||||||| | Sbjct: 865 cgtggcacgacggcttgggcgactgcggcgtcatccagaaccagaacgccgtcttgaagg 806 Query: 521 ccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggt 565 | | | ||||||||||||||||| ||| ||| |||| |||| Sbjct: 805 aga---tggcgtccgacgccaccaggtccgggttgctcagcaggt 764
>emb|X87109.1|OSDNARC24 O.sativa RC24 gene Length = 2048 Score = 63.9 bits (32), Expect = 5e-07 Identities = 68/80 (85%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| | ||| ||||||| || ||| || ||||| |||||||||||| Sbjct: 2006 tggttgtagcagtccaagttggcgccgtagctgacgcccaacatgtcgcagtagcgcttg 1947 Query: 313 tagaacccgatccggtcggc 332 |||||||| ||||||||||| Sbjct: 1946 tagaacccaatccggtcggc 1927 Score = 61.9 bits (31), Expect = 2e-06 Identities = 51/58 (87%) Strand = Plus / Minus Query: 461 cgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaa 518 ||||||||||||||||| ||||||| ||||||||||||||| | || ||||||||| Sbjct: 1798 cgtggcacgacggcttgggcgactgcggcgtcatccagaaccagaacgccgtcttgaa 1741
>emb|X78672.1|HVCHT2B H.vulgare mRNA for chitinase 2b Length = 1013 Score = 63.9 bits (32), Expect = 5e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 339 gtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgta 398 ||||||||| ||| ||||||| |||| |||||| ||||||| |||||||| |||||||| Sbjct: 709 gtcgttctggcccatgccgcactcgagcccgccgttgatgatattggtgattacgccgta 650 Query: 399 tccgggtacccg 410 ||| || ||||| Sbjct: 649 tccaggcacccg 638 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaat 506 |||||||||| ||||||||||||| |||| |||||||||||||||||| Sbjct: 591 acgtcgtggctcgacggcttgttgccttgcgccgtcatccagaaccaaat 542
>emb|X76041.1|TACHIG T.aestivum (Chinese spring) chi gene for endochitinase Length = 1985 Score = 63.9 bits (32), Expect = 5e-07 Identities = 32/32 (100%) Strand = Plus / Minus Query: 301 cagtagcgcttgtagaacccgatccggtcggc 332 |||||||||||||||||||||||||||||||| Sbjct: 1531 cagtagcgcttgtagaacccgatccggtcggc 1500 Score = 61.9 bits (31), Expect = 2e-06 Identities = 96/119 (80%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| ||||||||||||| ||| || || ||||||| ||||||||||||||| | | Sbjct: 1384 cccgtaatcacgtcgtggctcgaaggtttaggtgactgcggcgtcatccagaaccacagc 1325 Query: 508 gncgtcttgaacgccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggtc 566 | |||||| |||| ||| |||| |||| |||||| |||| ||| ||||| || ||||| Sbjct: 1324 gccgtcttaaacgacacggtcgcatccgtcgccacgaggtccgggttgttgagcaggtc 1266
>emb|AJ276226.1|HVU276226 Hordeum vulgare mRNA for chitinase II (pathogenesis-related protein 3) (cht2 gene) Length = 890 Score = 63.9 bits (32), Expect = 5e-07 Identities = 62/72 (86%) Strand = Plus / Minus Query: 339 gtcgttctgccccttgccgcattcgatcccgccattgatgacgttggtgatcacgccgta 398 ||||||||| ||| ||||||| |||| |||||| ||||||| |||||||| |||||||| Sbjct: 715 gtcgttctggcccatgccgcactcgagcccgccgttgatgatattggtgattacgccgta 656 Query: 399 tccgggtacccg 410 ||| || ||||| Sbjct: 655 tccaggcacccg 644 Score = 60.0 bits (30), Expect = 8e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaat 506 |||||||||| ||||||||||||| |||| |||||||||||||||||| Sbjct: 597 acgtcgtggctcgacggcttgttgccttgcgccgtcatccagaaccaaat 548
>dbj|AB161915.1| Cryptomeria japonica gene for putative class I chitinase, partial cds, isolate: FUJ17 Length = 1172 Score = 63.9 bits (32), Expect = 5e-07 Identities = 62/73 (84%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || || |||||||||||||||||| || |||| ||||||||||||||| ||| Sbjct: 955 cccgtcatgacrtcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatc 896 Query: 508 gncgtcttgaacg 520 ||||||||||| Sbjct: 895 cccgtcttgaacg 883
>gb|AY111529.1| Zea mays CL2382_1 mRNA sequence Length = 990 Score = 63.9 bits (32), Expect = 5e-07 Identities = 55/63 (87%) Strand = Plus / Minus Query: 456 cacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtctt 515 |||||||||||||||||||||| | ||||| ||||||||||||||| || | |||||| Sbjct: 532 cacgtcgtggcacgacggcttgggcggctgcgccgtcatccagaaccagatggccgtctt 473 Query: 516 gaa 518 ||| Sbjct: 472 gaa 470 Score = 40.1 bits (20), Expect = 7.8 Identities = 74/92 (80%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| | ||| | ||||||| |||||| | |||||| ||||||| || Sbjct: 732 tggttgtagcagtccaagttgtcgccgtagctgatgccaaggatgtcgcagtagctggtg 673 Query: 313 tagaacccgatccggtcggccaccttgtcgtt 344 ||||| | |||||| ||||||||| ||||| Sbjct: 672 tagaagaaggtccggttggccaccttctcgtt 641
>gb|AC135418.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0035J16, complete sequence Length = 170233 Score = 61.9 bits (31), Expect = 2e-06 Identities = 72/87 (82%) Strand = Plus / Minus Query: 490 gtcatccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtnc 549 |||||||| | ||| | || |||||||||||||||||||||||||| |||||||| | | Sbjct: 6105 gtcatccacagccacagcgccgtcttgaacgccaccgtcgggtccgttgccaccagctcc 6046 Query: 550 ggnttgttcagnaggtccaccccgatc 576 || ||| ||| |||||| | |||||| Sbjct: 6045 gggttgcccagcaggtccgcgccgatc 6019 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 276 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 6316 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 6260
>gb|AY618884.1| Nepenthes khasiana basic chitinase 1-2 mRNA, complete cds Length = 1056 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 ||||| |||||||||||||||| | |||||| ||||||||||||||| Sbjct: 833 acgtcatggcacgacggcttgtcgtactgcggcgtcatccagaacca 787
>gb|AY618883.1| Nepenthes khasiana basic chitinase 1-2 gene, complete cds Length = 1717 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 ||||| |||||||||||||||| | |||||| ||||||||||||||| Sbjct: 1494 acgtcatggcacgacggcttgtcgtactgcggcgtcatccagaacca 1448
>gb|AY618882.1| Nepenthes khasiana basic chitinase 1-1 mRNA, complete cds Length = 1056 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 ||||| |||||||||||||||| | |||||| ||||||||||||||| Sbjct: 833 acgtcatggcacgacggcttgtcgtactgcggcgtcatccagaacca 787
>gb|AY618881.1| Nepenthes khasiana basic chitinase 1-1 gene, complete cds Length = 1572 Score = 61.9 bits (31), Expect = 2e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 ||||| |||||||||||||||| | |||||| ||||||||||||||| Sbjct: 1349 acgtcatggcacgacggcttgtcgtactgcggcgtcatccagaacca 1303
>emb|X78671.1|HVCHT2A H.vulgare mRNA for chitinase 2a Length = 1028 Score = 61.9 bits (31), Expect = 2e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttg 516 |||| ||||| ||||||||||||| ||||| ||||||||||||||| |||| |||| || Sbjct: 606 acgttgtggctcgacggcttgttgccctgcgccgtcatccagaaccacatcgccgtcctg 547 Query: 517 aa 518 || Sbjct: 546 aa 545
>dbj|AK071196.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086B11, full insert sequence Length = 1305 Score = 61.9 bits (31), Expect = 2e-06 Identities = 72/87 (82%) Strand = Plus / Minus Query: 490 gtcatccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtnc 549 |||||||| | ||| | || |||||||||||||||||||||||||| |||||||| | | Sbjct: 818 gtcatccacagccacagcgccgtcttgaacgccaccgtcgggtccgttgccaccagctcc 759 Query: 550 ggnttgttcagnaggtccaccccgatc 576 || ||| ||| |||||| | |||||| Sbjct: 758 gggttgcccagcaggtccgcgccgatc 732 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 276 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1029 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 973
>dbj|AB096139.1| Oryza sativa (japonica cultivar-group) Chia1d mRNA for chitinase, complete cds Length = 1285 Score = 61.9 bits (31), Expect = 2e-06 Identities = 72/87 (82%) Strand = Plus / Minus Query: 490 gtcatccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtnc 549 |||||||| | ||| | || |||||||||||||||||||||||||| |||||||| | | Sbjct: 805 gtcatccacagccacagcgccgtcttgaacgccaccgtcgggtccgttgccaccagctcc 746 Query: 550 ggnttgttcagnaggtccaccccgatc 576 || ||| ||| |||||| | |||||| Sbjct: 745 gggttgcccagcaggtccgcgccgatc 719 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 276 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1016 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 960
>dbj|AB012855.1| Oryza sativa mRNA for chitinase, complete cds Length = 1300 Score = 61.9 bits (31), Expect = 2e-06 Identities = 72/87 (82%) Strand = Plus / Minus Query: 490 gtcatccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtnc 549 |||||||| | ||| | || |||||||||||||||||||||||||| |||||||| | | Sbjct: 820 gtcatccacagccacagcgccgtcttgaacgccaccgtcgggtccgttgccaccagctcc 761 Query: 550 ggnttgttcagnaggtccaccccgatc 576 || ||| ||| |||||| | |||||| Sbjct: 760 gggttgcccagcaggtccgcgccgatc 734 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 276 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1031 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 975
>dbj|AB018248.1| Oryza sativa (indica cultivar-group) mRNA for chitinase, complete cds Length = 1280 Score = 61.9 bits (31), Expect = 2e-06 Identities = 72/87 (82%) Strand = Plus / Minus Query: 490 gtcatccagaaccaaatcgncgtcttgaacgccaccgtcgggtccgacgccaccaggtnc 549 |||||||| | ||| | || |||||||||||||||||||||||||| |||||||| | | Sbjct: 794 gtcatccacagccacagcgccgtcttgaacgccaccgtcgggtccgttgccaccagctcc 735 Query: 550 ggnttgttcagnaggtccaccccgatc 576 || ||| ||| |||||| | |||||| Sbjct: 734 gggttgcccagcaggtccgcgccgatc 708 Score = 58.0 bits (29), Expect = 3e-05 Identities = 50/57 (87%) Strand = Plus / Minus Query: 276 cccgtagccgatgccgaagatgtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||||| ||||| | ||| |||||||||||||||||| ||| ||||||||| Sbjct: 1005 cccgtagccgacgccgagcacgtcgcagtagcgcttgtagaacgcgacccggtcggc 949
>dbj|AB096355.1| Cryptomeria japonica Chi1 gene for putative class I chitinase, partial cds, isolate:Shimo-hei1 Length = 1466 Score = 60.0 bits (30), Expect = 8e-06 Identities = 53/61 (86%) Strand = Plus / Minus Query: 460 tcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaac 519 |||||||||||||||||| || |||| ||||||||||||||| ||| |||||||||| Sbjct: 1237 tcgtggcacgacggcttgggagattgcgccgtcatccagaaccagatccccgtcttgaac 1178 Query: 520 g 520 | Sbjct: 1177 g 1177
>dbj|AB077019.1| Metasequoia glyptostroboides Chi1 gene for chitinase class I partial cds, exon 3 Length = 273 Score = 60.0 bits (30), Expect = 8e-06 Identities = 62/73 (84%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 ||||| || ||||||||||||||||| ||| || |||| |||||||||||||| ||| Sbjct: 98 cccgtcatgacgtcgtggcacgacggtttgggagattgcgcagtcatccagaaccagatc 39 Query: 508 gncgtcttgaacg 520 | ||||||||||| Sbjct: 38 gccgtcttgaacg 26
>gb|AF135133.1|AF135133 Arabis blepharophylla country USA class I chitinase gene, partial cds Length = 1308 Score = 58.0 bits (29), Expect = 3e-05 Identities = 53/61 (86%) Strand = Plus / Minus Query: 448 cccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatc 507 |||||||||||||||||||||||||| || ||||| | |||||||||||||||||| Sbjct: 1098 cccgtgatcacgtcgtggcacgacggtttaggagactgaggagtcatccagaaccaaatc 1039 Query: 508 g 508 | Sbjct: 1038 g 1038
>emb|AJ277279.1|MAC277279 Musa acuminata mRNA for putative chitinase isoform 2 Length = 1129 Score = 56.0 bits (28), Expect = 1e-04 Identities = 57/67 (85%) Strand = Plus / Minus Query: 454 atcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtc 513 |||||||||||||||||||||||| ||||| | |||||||||||||| | | |||| Sbjct: 754 atcacgtcgtggcacgacggcttgggcgactgaggagtcatccagaaccacagagccgtc 695 Query: 514 ttgaacg 520 ||||||| Sbjct: 694 ttgaacg 688
>gb|AF416677.1|AF416677 Musa acuminata endochitinase (EndoChit1) mRNA, partial cds Length = 862 Score = 56.0 bits (28), Expect = 1e-04 Identities = 57/67 (85%) Strand = Plus / Minus Query: 454 atcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtc 513 |||||||||||||||||||||||| ||||| | |||||||||||||| | | |||| Sbjct: 473 atcacgtcgtggcacgacggcttgggcgactgaggagtcatccagaaccacagagccgtc 414 Query: 514 ttgaacg 520 ||||||| Sbjct: 413 ttgaacg 407
>gb|U57409.1|PSU57409 Pinus strobus chitinase (Pschi1) pseudogene Length = 2059 Score = 56.0 bits (28), Expect = 1e-04 Identities = 57/67 (85%) Strand = Plus / Minus Query: 454 atcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtc 513 ||||||||||||||||| ||||| ||||||| ||||||||||||||| | || |||| Sbjct: 1472 atcacgtcgtggcacgaaggcttcggagactgcgccgtcatccagaaccacaccgccgtc 1413 Query: 514 ttgaacg 520 || |||| Sbjct: 1412 ttaaacg 1406
>gb|L16798.1|MZECHITINA Zea mays class I acidic chitinase mRNA, partial cds Length = 1012 Score = 56.0 bits (28), Expect = 1e-04 Identities = 117/146 (80%), Gaps = 3/146 (2%) Strand = Plus / Minus Query: 253 tggttgtagcagtcgaggttattcccgtagccgatgccgaagatgtcacagtagcgcttg 312 |||||||||||||| | ||| | ||||||| |||||| | |||||| ||||||| || Sbjct: 776 tggttgtagcagtccaagttgtcgccgtagctgatgccaaggatgtcgcagtagctggtg 717 Query: 313 tagaacccgatccggtcggccaccttgtcgttctgccccttgccgcattcgatcccgcca 372 ||||| | |||||| ||||||||| ||||| | || |||||||| ||||| ||| Sbjct: 716 tagaagaaggtccggttggccaccttctcgttgtagcctttgccgcactcgat---gccg 660 Query: 373 ttgatgacgttggtgatcacgccgta 398 ||||||| ||||||||| |||||||| Sbjct: 659 ttgatgatgttggtgatgacgccgta 634 Score = 52.0 bits (26), Expect = 0.002 Identities = 90/112 (80%), Gaps = 3/112 (2%) Strand = Plus / Minus Query: 456 cacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtctt 515 ||||||||||||||||||| |||| ||||| |||||| ||||||| || | |||||| Sbjct: 576 cacgtcgtggcacgacggc---ttgggctgcgccgtcatggagaaccagatggccgtctt 520 Query: 516 gaacgccaccgtcgggtccgacgccaccaggtncggnttgttcagnaggtcc 567 ||| | | | || ||||||||||||||| | ||| ||| |||| |||||| Sbjct: 519 gaaggagatggacgcgtccgacgccaccagctccgggttgctcagcaggtcc 468
>gb|AF280438.1|AF280438 Secale cereale 24.8 kDa class II endochitinase-antifreeze protein precursor, mRNA, complete cds Length = 998 Score = 54.0 bits (27), Expect = 5e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 ||||||||| |||| ||||||||| ||||| ||||||||||||||| Sbjct: 614 acgtcgtgggacgatggcttgttgccctgcgccgtcatccagaacca 568
>gb|AC137616.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0069I13, complete sequence Length = 94252 Score = 52.0 bits (26), Expect = 0.002 Identities = 34/37 (91%) Strand = Plus / Minus Query: 489 cgtcatccagaaccaaatcgncgtcttgaacgccacc 525 ||||||||||||||| | || |||||||||||||||| Sbjct: 27031 cgtcatccagaaccacagcgccgtcttgaacgccacc 26995 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacga 470 |||||| ||||||||||||||||| Sbjct: 27079 ccccgtcatcacgtcgtggcacga 27056
>emb|AJ277278.1|MAC277278 Musa acuminata mRNA for putative chitinase isoform 1 Length = 1186 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 454 atcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||||||||||||||||||||| ||||| | |||||||||||||| Sbjct: 738 atcacgtcgtggcacgacggcttgggcgactgaggagtcatccagaacca 689
>dbj|AK110261.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-B04, full insert sequence Length = 1066 Score = 52.0 bits (26), Expect = 0.002 Identities = 34/37 (91%) Strand = Plus / Minus Query: 489 cgtcatccagaaccaaatcgncgtcttgaacgccacc 525 ||||||||||||||| | || |||||||||||||||| Sbjct: 642 cgtcatccagaaccacagcgccgtcttgaacgccacc 606 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacga 470 |||||| ||||||||||||||||| Sbjct: 690 ccccgtcatcacgtcgtggcacga 667
>dbj|AK101475.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033040N15, full insert sequence Length = 1026 Score = 52.0 bits (26), Expect = 0.002 Identities = 34/37 (91%) Strand = Plus / Minus Query: 489 cgtcatccagaaccaaatcgncgtcttgaacgccacc 525 ||||||||||||||| | || |||||||||||||||| Sbjct: 644 cgtcatccagaaccacagcgccgtcttgaacgccacc 608 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacga 470 |||||| ||||||||||||||||| Sbjct: 692 ccccgtcatcacgtcgtggcacga 669
>gb|AF513017.2| Leucaena leucocephala chitinase mRNA, complete cds; leucoplast gene for leucoplast product Length = 1080 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Minus Query: 447 ccccgtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 ||||||||| |||||||||||||| ||||| ||||||| |||||||||||||| Sbjct: 763 ccccgtgatgacgtcgtggcacgatggcttcggcgactgcgctgtcatccagaacca 707
>gb|AY643483.1| Drosera spathulata CHIT1 (chit1) gene, partial cds Length = 911 Score = 50.1 bits (25), Expect = 0.008 Identities = 46/53 (86%) Strand = Plus / Minus Query: 367 ccgccattgatgacgttggtgatcacgccgtatccgggtacccgtccggccgc 419 ||||| ||||||| |||||||||||| ||||| || ||||| ||||| ||||| Sbjct: 907 ccgccgttgatgatgttggtgatcaccccgtagcctggtactcgtccagccgc 855
>gb|AY253986.1| Galega orientalis class Ib chitinase mRNA, complete cds Length = 1149 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 381 gttggtgatcacgccgtatccgggtacccgtcc 413 |||||||||||||||||| ||||| |||||||| Sbjct: 855 gttggtgatcacgccgtagccgggaacccgtcc 823
>gb|DQ124037.1| Coffea arabica clone MN-SSH4-E01 mRNA sequence Length = 295 Score = 50.1 bits (25), Expect = 0.008 Identities = 57/68 (83%) Strand = Plus / Minus Query: 451 gtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgnc 510 ||||| ||||| ||||| || |||||||| ||||| | ||||||||||||||||| | Sbjct: 190 gtgatgacgtcatggcatgagggcttgtttgactgtggtgtcatccagaaccaaattgct 131 Query: 511 gtcttgaa 518 |||||||| Sbjct: 130 gtcttgaa 123
>gb|DQ078282.1| Ulmus pumila chitinase (CHT) mRNA, complete cds Length = 954 Score = 48.1 bits (24), Expect = 0.032 Identities = 39/44 (88%) Strand = Plus / Minus Query: 355 ccgcattcgatcccgccattgatgacgttggtgatcacgccgta 398 |||||||| ||||| || ||||||| ||||||||||| |||||| Sbjct: 812 ccgcattctatcccaccgttgatgatgttggtgatcatgccgta 769
>gb|L00973.1|MZECHITC Zea mays acidic class I chitinase mRNA, complete cds Length = 1128 Score = 48.1 bits (24), Expect = 0.032 Identities = 33/36 (91%) Strand = Plus / Minus Query: 297 gtcacagtagcgcttgtagaacccgatccggtcggc 332 ||||||||| || |||||||| |||||||||||||| Sbjct: 921 gtcacagtatcgtttgtagaagccgatccggtcggc 886
>gb|AC167968.5| Culex pipiens quinquefasciatus, clone Culex pipiens quinquefasciatus-3940121D9, complete sequence Length = 108830 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Plus Query: 354 gccgcattcgatcccgccattgatgacgttg 384 |||||| ||||| |||||||||||||||||| Sbjct: 73169 gccgcactcgatgccgccattgatgacgttg 73199
>gb|AC019306.10| Homo sapiens chromosome 18, clone RP11-326M20, complete sequence Length = 175840 Score = 46.1 bits (23), Expect = 0.13 Identities = 25/26 (96%) Strand = Plus / Plus Query: 171 cacatncacacacgcacatgcataaa 196 ||||| |||||||||||||||||||| Sbjct: 137699 cacatacacacacgcacatgcataaa 137724
>gb|M94106.1|ALCCHINTIA Allium sativum chitinase mRNA, 3' end Length = 1007 Score = 46.1 bits (23), Expect = 0.13 Identities = 49/58 (84%) Strand = Plus / Minus Query: 463 tggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacg 520 ||||||||||| || |||||| | ||||||||||||||| |||| |||||||||| Sbjct: 686 tggcacgacggttttggggactgtgccgtcatccagaaccatatcgctgtcttgaacg 629
>emb|CR733892.2|CNS0GT1V Tetraodon nigroviridis full-length cDNA Length = 1579 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 363 gatcccgccattgatgacgttg 384 |||||||||||||||||||||| Sbjct: 553 gatcccgccattgatgacgttg 532
>emb|BX322565.11| Zebrafish DNA sequence from clone CH211-262K18 in linkage group 24, complete sequence Length = 158981 Score = 44.1 bits (22), Expect = 0.50 Identities = 24/25 (96%) Strand = Plus / Minus Query: 170 tcacatncacacacgcacatgcata 194 |||||| |||||||||||||||||| Sbjct: 125189 tcacatacacacacgcacatgcata 125165
>emb|BX294098.11| Zebrafish DNA sequence from clone CH211-254P12 in linkage group 24, complete sequence Length = 152545 Score = 44.1 bits (22), Expect = 0.50 Identities = 24/25 (96%) Strand = Plus / Plus Query: 170 tcacatncacacacgcacatgcata 194 |||||| |||||||||||||||||| Sbjct: 66156 tcacatacacacacgcacatgcata 66180
>gb|AC084760.2| Gallus gallus clone WAG-65N20, complete sequence Length = 109569 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 122 tatttggtcataaaatacttac 143 |||||||||||||||||||||| Sbjct: 23660 tatttggtcataaaatacttac 23639
>emb|BX294095.13| Zebrafish DNA sequence from clone CH211-248L17 in linkage group 24, complete sequence Length = 147604 Score = 44.1 bits (22), Expect = 0.50 Identities = 24/25 (96%) Strand = Plus / Minus Query: 170 tcacatncacacacgcacatgcata 194 |||||| |||||||||||||||||| Sbjct: 105496 tcacatacacacacgcacatgcata 105472
>gb|AF147497.1|AF147497 Humulus lupulus endochitinase precursor (HCH1) gene, complete cds Length = 2102 Score = 44.1 bits (22), Expect = 0.50 Identities = 57/69 (82%) Strand = Plus / Minus Query: 452 tgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncg 511 |||| |||||||||| ||| |||||||| | ||| | |||||||||||||| || | | Sbjct: 1719 tgataacgtcgtggctcgatggcttgttagcctgtggagtcatccagaaccatatggctg 1660 Query: 512 tcttgaacg 520 ||||||||| Sbjct: 1659 tcttgaacg 1651
>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome Length = 7215267 Score = 44.1 bits (22), Expect = 0.50 Identities = 25/26 (96%) Strand = Plus / Minus Query: 354 gccgcattcgatcccgccattgatga 379 |||||||||||| ||||||||||||| Sbjct: 1140779 gccgcattcgatgccgccattgatga 1140754
>ref|NM_183568.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1086 Score = 42.1 bits (21), Expect = 2.0 Identities = 50/60 (83%) Strand = Plus / Minus Query: 462 gtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacgc 521 |||||||||||||||| || | || ||||||||||||||| | || ||||| |||||| Sbjct: 864 gtggcacgacggcttggtgtccctcggcgtcatccagaaccacagcgccgtctggaacgc 805
>gb|AC131725.2| Mus musculus BAC clone RP23-129H16 from chromosome 5, complete sequence Length = 203437 Score = 42.1 bits (21), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 171 cacatncacacacgcacatgcata 194 ||||| |||||||||||||||||| Sbjct: 10245 cacatacacacacgcacatgcata 10268
>gb|AY643484.1| Dionaea muscipula CHIT1 (chit1) gene, partial cds Length = 234 Score = 42.1 bits (21), Expect = 2.0 Identities = 45/53 (84%) Strand = Plus / Minus Query: 451 gtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 |||||||| ||||||| ||| |||||||| | || | ||||||||||||||| Sbjct: 155 gtgatcacatcgtggctcgatggcttgttccattgaggcgtcatccagaacca 103 Score = 40.1 bits (20), Expect = 7.8 Identities = 38/44 (86%) Strand = Plus / Minus Query: 373 ttgatgacgttggtgatcacgccgtatccgggtacccgtccggc 416 ||||||| |||||||||||| || || ||||| | ||||||||| Sbjct: 233 ttgatgatgttggtgatcactccatagccgggaagccgtccggc 190
>gb|AC124374.5| Mus musculus BAC clone RP24-567K8 from chromosome 5, complete sequence Length = 181395 Score = 42.1 bits (21), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 171 cacatncacacacgcacatgcata 194 ||||| |||||||||||||||||| Sbjct: 177006 cacatacacacacgcacatgcata 176983
>emb|CR933541.6| Mouse DNA sequence from clone DN-97M20 on chromosome 11, complete sequence Length = 176646 Score = 42.1 bits (21), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 171 cacatncacacacgcacatgcata 194 ||||| |||||||||||||||||| Sbjct: 66957 cacatgcacacacgcacatgcata 66934
>gb|AC158914.4| Mus musculus chromosome 5, clone RP24-249F11, complete sequence Length = 155216 Score = 42.1 bits (21), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 171 cacatncacacacgcacatgcata 194 ||||| |||||||||||||||||| Sbjct: 147813 cacatacacacacgcacatgcata 147836
>emb|AL591393.10| Human DNA sequence from clone RP11-224J22 on chromosome 9 Contains a novel gene (FLJ33868) and 2 CpG islands, complete sequence Length = 174911 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 134 aaatacttaccaagattatttattt 158 |||||||||||||| |||||||||| Sbjct: 80594 aaatacttaccaagtttatttattt 80570
>emb|X88800.1|VURNACHI1 V.unguiculata mRNA for chitinase clase 1 (partial) Length = 1146 Score = 42.1 bits (21), Expect = 2.0 Identities = 45/53 (84%) Strand = Plus / Minus Query: 451 gtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 ||||| ||||||||| | || |||||| |||||||| |||||||||||||| Sbjct: 723 gtgatgacgtcgtgggaggaaggcttgggggactgcggggtcatccagaacca 671
>emb|AL596185.12| Mouse DNA sequence from clone RP23-172M21 on chromosome 11 Contains the 5' end of the Centb1 gene for centaurin beta 1, the gene for a novel protein similar to protein phosphatase 1 regulatory (inhibitor) subunit 2 Ppp1r2, a novel gene, the Gps2 gene for G protein pathway suppressor 2, the Eif5a gene for eukaryotic translation initiation factor 5A, the Ybx2 gene for Y box protein 2, the Slc2a4 gene for solute carrier family 2 (facilitated glucose transporter) member 4, a non-muscle cofilin 1 (Cfl1) pseudogene, the Cldn7 gene for claudin 7, the Rai12 gene for retinoic acid induced 12, the Dullard gene for Dullard homolog (Xenopus laevis) (novel NLI interacting factor-like phosphatase), the gene for novel PHD-finger protein JUNE1, the Dvl2 gene for dishevelled 2 dsh homolog (Drosophila), the Acadvl gene for acyl-Coenzyme A dehydrogenase very long chain, the Dlgh4 gene for discs large homolog 4 (Drosophila), the Asgr1 and Asgr2 genes for asialoglycoprotein receptor 1 and 2, a ribosomal protein L26 (Rpl26) pseudogene, the 5' end of the Mgl2 gene for macrophage galactose N-acetyl-galactosamine specific lectin 2 and nine CpG islands, complete sequence Length = 248203 Score = 42.1 bits (21), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 171 cacatncacacacgcacatgcata 194 ||||| |||||||||||||||||| Sbjct: 74107 cacatgcacacacgcacatgcata 74084
>gb|AC013701.6| Homo sapiens, clone RP11-22C8, complete sequence Length = 160275 Score = 42.1 bits (21), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 171 cacatncacacacgcacatgcata 194 ||||| |||||||||||||||||| Sbjct: 85595 cacatgcacacacgcacatgcata 85572
>gb|AC161378.2| Mus musculus BAC clone RP23-202A6 from chromosome 16, complete sequence Length = 219298 Score = 42.1 bits (21), Expect = 2.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 166 atcatcacatncacacacgcacatgcat 193 |||| ||||| ||||||||||||||||| Sbjct: 192642 atcaacacatacacacacgcacatgcat 192615
>gb|AC154429.4| Mus musculus BAC clone RP24-202G18 from chromosome 16, complete sequence Length = 170875 Score = 42.1 bits (21), Expect = 2.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 166 atcatcacatncacacacgcacatgcat 193 |||| ||||| ||||||||||||||||| Sbjct: 147179 atcaacacatacacacacgcacatgcat 147152
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 2.0 Identities = 50/60 (83%) Strand = Plus / Plus Query: 462 gtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacgc 521 |||||||||||||||| || | || ||||||||||||||| | || ||||| |||||| Sbjct: 10340475 gtggcacgacggcttggtgtccctcggcgtcatccagaaccacagcgccgtctggaacgc 10340534
>gb|AF307511.1|AF307511 Vigna sesquipedalis class I chitinase gene, partial cds Length = 892 Score = 42.1 bits (21), Expect = 2.0 Identities = 45/53 (84%) Strand = Plus / Minus Query: 451 gtgatcacgtcgtggcacgacggcttgttggactgcgtcgtcatccagaacca 503 ||||| ||||||||| | || |||||| |||||||| |||||||||||||| Sbjct: 651 gtgatgacgtcgtgggaggaaggcttgggggactgcggggtcatccagaacca 599
>gb|AF494397.1| Malus x domestica class II chitinase (CHT-3) mRNA, partial cds Length = 667 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Minus Query: 352 ttgccgcattcgatcccgccattgatgacgttggtgatcac 392 ||||||||||| | || |||||||||| |||||||||||| Sbjct: 431 ttgccgcattcaagacctccattgatgatgttggtgatcac 391
>dbj|AP002070.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0511C01 Length = 170402 Score = 42.1 bits (21), Expect = 2.0 Identities = 50/60 (83%) Strand = Plus / Plus Query: 462 gtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacgc 521 |||||||||||||||| || | || ||||||||||||||| | || ||||| |||||| Sbjct: 47195 gtggcacgacggcttggtgtccctcggcgtcatccagaaccacagcgccgtctggaacgc 47254
>emb|BX649239.1| Sminthopsis DNA sequence from clone RZPD668-232B10, complete sequence Length = 40274 Score = 42.1 bits (21), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 171 cacatncacacacgcacatgcata 194 ||||| |||||||||||||||||| Sbjct: 25008 cacatacacacacgcacatgcata 24985
>dbj|AK063062.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-110-F11, full insert sequence Length = 1055 Score = 42.1 bits (21), Expect = 2.0 Identities = 50/60 (83%) Strand = Plus / Minus Query: 462 gtggcacgacggcttgttggactgcgtcgtcatccagaaccaaatcgncgtcttgaacgc 521 |||||||||||||||| || | || ||||||||||||||| | || ||||| |||||| Sbjct: 682 gtggcacgacggcttggtgtccctcggcgtcatccagaaccacagcgccgtctggaacgc 623
>gb|AY107475.1| Zea mays PCO104428 mRNA sequence Length = 686 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 457 acgtcgtggcacgacggcttg 477 ||||||||||||||||||||| Sbjct: 602 acgtcgtggcacgacggcttg 582
>gb|AC124225.13| Mus musculus chromosome 16, clone RP23-83P23, complete sequence Length = 157891 Score = 42.1 bits (21), Expect = 2.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 166 atcatcacatncacacacgcacatgcat 193 |||| ||||| ||||||||||||||||| Sbjct: 147018 atcaacacatacacacacgcacatgcat 147045
>emb|AL671901.14| Mouse DNA sequence from clone RP23-238B14 on chromosome X, complete sequence Length = 201821 Score = 42.1 bits (21), Expect = 2.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 170 tcacatncacacacgcacatgcataaac 197 |||||| ||||||| ||||||||||||| Sbjct: 108892 tcacatgcacacacacacatgcataaac 108865
>gb|M94105.1|ALCCHITIN Allium sativum chitinase mRNA, 3' end Length = 1085 Score = 42.1 bits (21), Expect = 2.0 Identities = 35/40 (87%) Strand = Plus / Minus Query: 481 gactgcgtcgtcatccagaaccaaatcgncgtcttgaacg 520 ||||||| |||||||||||||| |||| |||||||||| Sbjct: 716 gactgcgcggtcatccagaaccatatcgctgtcttgaacg 677
>gb|BT016363.1| Zea mays clone Contig196 mRNA sequence Length = 1079 Score = 40.1 bits (20), Expect = 7.8 Identities = 31/35 (88%) Strand = Plus / Minus Query: 491 tcatccagaaccaaatcgncgtcttgaacgccacc 525 ||||||||||||| | || || ||||||||||||| Sbjct: 705 tcatccagaaccagagcgccgccttgaacgccacc 671
>gb|BT016338.1| Zea mays clone Contig171 mRNA sequence Length = 1186 Score = 40.1 bits (20), Expect = 7.8 Identities = 31/35 (88%) Strand = Plus / Minus Query: 491 tcatccagaaccaaatcgncgtcttgaacgccacc 525 ||||||||||||| | || || ||||||||||||| Sbjct: 697 tcatccagaaccagagcgccgccttgaacgccacc 663
>gb|AC166486.5| Mus musculus chromosome 1, clone RP23-187M9, complete sequence Length = 187098 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 117 ccatttatttggtcataaaa 136 |||||||||||||||||||| Sbjct: 13104 ccatttatttggtcataaaa 13085
>gb|AY532788.1| Zea diploperennis isolate d8 chitinase (chiA) gene, complete cds Length = 1110 Score = 40.1 bits (20), Expect = 7.8 Identities = 28/31 (90%) Strand = Plus / Minus Query: 491 tcatccagaaccaaatcgncgtcttgaacgc 521 ||||||||||||| | || |||||||||||| Sbjct: 783 tcatccagaaccagagcgccgtcttgaacgc 753
>gb|AY532787.1| Zea diploperennis isolate d7 chitinase (chiA) gene, complete cds Length = 1110 Score = 40.1 bits (20), Expect = 7.8 Identities = 28/31 (90%) Strand = Plus / Minus Query: 491 tcatccagaaccaaatcgncgtcttgaacgc 521 ||||||||||||| | || |||||||||||| Sbjct: 783 tcatccagaaccagagcgccgtcttgaacgc 753
>gb|AY532786.1| Zea diploperennis isolate d6 chitinase (chiA) gene, complete cds Length = 1110 Score = 40.1 bits (20), Expect = 7.8 Identities = 28/31 (90%) Strand = Plus / Minus Query: 491 tcatccagaaccaaatcgncgtcttgaacgc 521 ||||||||||||| | || |||||||||||| Sbjct: 783 tcatccagaaccagagcgccgtcttgaacgc 753
>gb|AY532785.1| Zea diploperennis isolate d5 chitinase (chiA) gene, complete cds Length = 1110 Score = 40.1 bits (20), Expect = 7.8 Identities = 28/31 (90%) Strand = Plus / Minus Query: 491 tcatccagaaccaaatcgncgtcttgaacgc 521 ||||||||||||| | || |||||||||||| Sbjct: 783 tcatccagaaccagagcgccgtcttgaacgc 753 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,943,754 Number of Sequences: 3902068 Number of extensions: 3943754 Number of successful extensions: 81379 Number of sequences better than 10.0: 908 Number of HSP's better than 10.0 without gapping: 906 Number of HSP's successfully gapped in prelim test: 5 Number of HSP's that attempted gapping in prelim test: 79173 Number of HSP's gapped (non-prelim): 2158 length of query: 576 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 553 effective length of database: 17,143,297,704 effective search space: 9480243630312 effective search space used: 9480243630312 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
