>gb|AC154314.2| Mus musculus BAC clone RP23-347J22 from chromosome 13, complete sequence
          Length = 189556

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 101    ttcattgacatgtgatgct 119
              |||||||||||||||||||
Sbjct: 189059 ttcattgacatgtgatgct 189041

>gb|AC024897.23| Homo sapiens 3 BAC RP11-505J9 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 204794

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 98   ttattcattgacatgtgat 116
            |||||||||||||||||||
Sbjct: 3113 ttattcattgacatgtgat 3131

>gb|AF191329.1|AF191329 Capra hircus pregnancy-associated glycoprotein-4 (PAG-4) mRNA,
           complete cds
          Length = 1143

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 76  tattgaccactgttcttgggcct 98
           ||||||||| |||||||||||||
Sbjct: 853 tattgaccagtgttcttgggcct 831

>gb|AC140231.3| Mus musculus BAC clone RP24-493L15 from 6, complete sequence
          Length = 185517

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 101   ttcattgacatgtgatgct 119
             |||||||||||||||||||
Sbjct: 12784 ttcattgacatgtgatgct 12802

>gb|AC152962.1| Mus musculus 6 BAC RP23-465F11 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 187047

 Score = 38.2 bits (19), Expect = 6.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 101    ttcattgacatgtgatgct 119
              |||||||||||||||||||
Sbjct: 140147 ttcattgacatgtgatgct 140165


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 512,283
Number of Sequences: 3902068
Number of extensions: 512283
Number of successful extensions: 31066
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31061
Number of HSP's gapped (non-prelim): 5
length of query: 131
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 110
effective length of database: 17,151,101,840
effective search space: 1886621202400
effective search space used: 1886621202400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)