ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd18f06 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF427791.1| Hordeum vulgare Mla locus, complete sequence Length = 261265 Score = 815 bits (411), Expect = 0.0 Identities = 481/504 (95%), Gaps = 2/504 (0%) Strand = Plus / Plus Query: 1 aggtagcatgctggtggtc-gcatctatttattgatcc-tgcttattggaagtacttatt 58 ||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||| Sbjct: 220503 aggtagcatgctggtggtcagcatctatttattgatccatgcttattggaagtacttatt 220562 Query: 59 catcagcatccacaatgcatccatgttgcctttgcttgcaaagctagctagccaatgtgg 118 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 220563 catcagcatccacaatgcatccatgttgcctttgcttgcaaagctagctagccaatgtgg 220622 Query: 119 ggagtggacgcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtc 178 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 220623 ggaatggacgcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtc 220682 Query: 179 accggcgagccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatc 238 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 220683 accggcgagccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatc 220742 Query: 239 tccttggcctcctcgatggactttcccactacctccggccatgacgtcttcttctcctct 298 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 220743 tccttggcctcctcgatggactttcccactacctccggccatgacgtcttcttctcctct 220802 Query: 299 ccggcgggggcttttggggcggcgcagctcatcctcgattcggcaggctgcnnnnnnntt 358 ||||||||||||||||||||||||||||||||||||||||| || ||||| || Sbjct: 220803 ccggcgggggcttttggggcggcgcagctcatcctcgattccgcgagctgcaaaacaatt 220862 Query: 359 gatcgaaatagttcagttcagagactacagacgacaataacagttgaaccatagctcaga 418 |||||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||| Sbjct: 220863 gatcgaaatagttcagttcagagactccagatcacaataacagttgaaccataggtcaga 220922 Query: 419 ctacttaagactacaaatctttatgtacataaatcatatgggactgggaacttaagacta 478 ||||||||||||||||||||||||||||| ||| |||||| |||| ||||||||| |||| Sbjct: 220923 ctacttaagactacaaatctttatgtacaaaaagcatatgtgactaggaacttaatacta 220982 Query: 479 atcaccagctaaatgggatcgagc 502 ||||||||||||||||||||||| Sbjct: 220983 ctcaccagctaaatgggatcgagc 221006 Score = 176 bits (89), Expect = 5e-41 Identities = 160/186 (86%) Strand = Plus / Plus Query: 204 cgatgtccgcttcaggcatgtccttaaggatgatctccttggcctcctcgatggactttc 263 |||||||| |||||||||||||||| ||||||| |||| |||| |||||||||||||| | Sbjct: 217638 cgatgtccacttcaggcatgtccttgaggatgacctccctggcgtcctcgatggacttcc 217697 Query: 264 ccactacctccggccatgacgtcttcttctcctctccggcgggggcttttggggcggcgc 323 |||||| |||||||||||||| |||||||||||| |||||||| ||||||||| | |||| Sbjct: 217698 ccactaactccggccatgacgacttcttctcctcaccggcgggtgcttttgggtcagcgc 217757 Query: 324 agctcatcctcgattcggcaggctgcnnnnnnnttgatcgaaatagttcagttcagagac 383 |||||||||||||||| ||||| ||||| |||||||||||||||| |||| Sbjct: 217758 agctcatcctcgattccttgagctgcaaaacaattgattgaaatagttcagttcaaagac 217817 Query: 384 tacaga 389 |||||| Sbjct: 217818 tacaga 217823 Score = 167 bits (84), Expect = 4e-38 Identities = 180/212 (84%) Strand = Plus / Plus Query: 96 gcaaagctagctagccaatgtggggagtggacgcgacagtgtcgacgaagatgcggacac 155 ||||| |||||||||| ||||| ||||||| ||||||||||||||| | || |||||||| Sbjct: 223765 gcaaatctagctagccgatgtgaggagtggtcgcgacagtgtcgaccaggacgcggacac 223824 Query: 156 ggttggtcctgaagtcgagggtcaccggcgagccggctgggaggacgacgatgtccgctt 215 ||||| |||| |||| || |||| ||| ||| |||||||| ||||||||||| Sbjct: 223825 ggttgctcctccagtctgcggccaccacggagttggcggggaggactttgatgtccgctt 223884 Query: 216 caggcatgtccttaaggatgatctccttggcctcctcgatggactttcccactacctccg 275 ||||||| ||||| ||||||| |||| |||| |||||||||||||| ||||||| ||||| Sbjct: 223885 caggcatatccttgaggatgacctccctggcgtcctcgatggacttccccactaactccg 223944 Query: 276 gccatgacgtcttcttctcctctccggcgggg 307 ||||||||| |||||||||||| ||||||||| Sbjct: 223945 gccatgacgacttcttctcctcaccggcgggg 223976 Score = 123 bits (62), Expect = 6e-25 Identities = 131/154 (85%) Strand = Plus / Minus Query: 138 cgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgagccggctggga 197 |||||||||||||||||||||||| ||||||||| |||||||| ||||| | || | Sbjct: 207140 cgacgaagatgcggacacggttgggcctgaagtcttcggtcaccgctgagccaaccggca 207081 Query: 198 ggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcctcctcgatgg 257 |||||||||||| ||||||||| ||||||| || ||||||||||||||||||| ||||| Sbjct: 207080 cgacgacgatgtcggcttcaggcttgtccttgagaatgatctccttggcctccttgatgg 207021 Query: 258 actttcccactacctccggccatgacgtcttctt 291 | || || ||||||||||| ||||||||||| Sbjct: 207020 tcaggccgaccacctccggccaagacgtcttctt 206987 Score = 119 bits (60), Expect = 9e-24 Identities = 102/116 (87%) Strand = Plus / Plus Query: 192 ctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcctcct 251 |||||||||| |||||||||||||||||||||||| ||||||| || | |||| |||| Sbjct: 225002 ctgggaggactttgatgtccgcttcaggcatgtccttgaggatgaccttcctggcgtcct 225061 Query: 252 cgatggactttcccactacctccggccatgacgtcttcttctcctctccggcgggg 307 |||||||||| ||||||| ||||| ||| |||| |||||||||||| ||||||||| Sbjct: 225062 cgatggacttccccactaactccgcccaggacgacttcttctcctcaccggcgggg 225117 Score = 115 bits (58), Expect = 1e-22 Identities = 61/62 (98%) Strand = Plus / Plus Query: 441 atgtacataaatcatatgggactgggaacttaagactaatcaccagctaaatgggatcga 500 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct: 218404 atgtacataaatcatatgggactgggaacttaagactactcaccagctaaatgggatcga 218463 Query: 501 gc 502 || Sbjct: 218464 gc 218465 Score = 83.8 bits (42), Expect = 5e-13 Identities = 60/66 (90%) Strand = Plus / Plus Query: 100 agctagctagccaatgtggggagtggacgcgacagtgtcgacgaagatgcggacacggtt 159 |||||||||||| ||||| ||||||| |||||||||||| |||| ||||||||||||||| Sbjct: 217534 agctagctagccgatgtgaggagtggtcgcgacagtgtcaacgaggatgcggacacggtt 217593 Query: 160 ggtcct 165 | |||| Sbjct: 217594 gctcct 217599
>emb|AJ250663.2|HVU250663 Hordeum vulgare partial mRNA for putative proteinase inhibitor (bci-7 gene) Length = 306 Score = 577 bits (291), Expect = e-161 Identities = 294/295 (99%) Strand = Plus / Minus Query: 52 acttattcatcagcatccacaatgcatccatgttgcctttgcttgcaaagctagctagcc 111 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 306 acttattcatcagcatccacaatgcatccatgttgcctttgcttgcaaagctagctagcc 247 Query: 112 aatgtggggagtggacgcgacagtgtcgacgaagatgcggacacggttggtcctgaagtc 171 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 246 aatgtggggagtggacgcgacagtgtcgacgaagatgcggacacggttggtcctgaagtc 187 Query: 172 gagggtcaccggcgagccggctgggaggacgacgatgtccgcttcaggcatgtccttaag 231 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 186 gagggtcaccggcgagccggctgggaggacgacgatgtccgcttcaggcatgtccttaag 127 Query: 232 gatgatctccttggcctcctcgatggactttcccactacctccggccatgacgtcttctt 291 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 126 gatgatctccttggcctcctcgatggactttcccgctacctccggccatgacgtcttctt 67 Query: 292 ctcctctccggcgggggcttttggggcggcgcagctcatcctcgattcggcaggc 346 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 66 ctcctctccggcgggggcttttggggcggcgcagctcatcctcgattcggcaggc 12
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 99.6 bits (50), Expect = 9e-18 Identities = 134/162 (82%) Strand = Plus / Plus Query: 128 gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgag 187 ||||| ||||| |||||||||||||| ||||||| | ||||||||||||||||||||| Sbjct: 22227277 gcgacggtgtcaacgaagatgcggacgcggttggagcggaagtcgagggtcaccggcgac 22227336 Query: 188 ccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcc 247 || || || || ||||||||||| || || ||||||||||| ||||| | || ||| ||| Sbjct: 22227337 cccgccggaagcacgacgatgtcggcgtcgggcatgtccttgaggatcaccttcttcgcc 22227396 Query: 248 tcctcgatggactttcccactacctccggccatgacgtcttc 289 ||||| ||| ||||| ||||||||||| ||||||||| Sbjct: 22227397 tcctccgccgacagccccaccacctccggccacgacgtcttc 22227438 Score = 65.9 bits (33), Expect = 1e-07 Identities = 102/125 (81%) Strand = Plus / Plus Query: 128 gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgag 187 ||||| |||||||||||||||||||| ||||||| | |||||| | ||||||||||| Sbjct: 22236610 gcgacggtgtcgacgaagatgcggacgcggttggggcggaagtccatggtcaccggcgtc 22236669 Query: 188 ccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcc 247 || | || | ||||||||||| || || ||||||||||| ||||| | || ||| ||| Sbjct: 22236670 cccaccggaaccacgacgatgtcggcgtcgggcatgtccttgaggatcaccttcttcgcc 22236729 Query: 248 tcctc 252 ||||| Sbjct: 22236730 tcctc 22236734 Score = 58.0 bits (29), Expect = 3e-05 Identities = 132/166 (79%), Gaps = 4/166 (2%) Strand = Plus / Plus Query: 128 gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtca----ccgg 183 ||||| |||||||||||||||||||| ||||||| | |||||| ||||| |||| Sbjct: 22231902 gcgacggtgtcgacgaagatgcggacgcggttggggcggaagtccttggtcaccggccgg 22231961 Query: 184 cgagccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctcctt 243 ||| || || || || ||||||||||| || || ||||||||||| ||||| | || ||| Sbjct: 22231962 cgaccccgccggaagcacgacgatgtcggcgtcgggcatgtccttgaggatcaccttctt 22232021 Query: 244 ggcctcctcgatggactttcccactacctccggccatgacgtcttc 289 |||||||| | | | ||||| ||||||||||| ||||||||| Sbjct: 22232022 cgcctcctccaccggcagccccaccacctccggccacgacgtcttc 22232067 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 128 gcgacagtgtcgacgaagatgcggacacggttg 160 ||||| |||||||||||||| |||||||||||| Sbjct: 14455880 gcgacggtgtcgacgaagattcggacacggttg 14455912
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 99.6 bits (50), Expect = 9e-18 Identities = 134/162 (82%) Strand = Plus / Plus Query: 128 gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgag 187 ||||| ||||| |||||||||||||| ||||||| | ||||||||||||||||||||| Sbjct: 22155622 gcgacggtgtcaacgaagatgcggacgcggttggagcggaagtcgagggtcaccggcgac 22155681 Query: 188 ccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcc 247 || || || || ||||||||||| || || ||||||||||| ||||| | || ||| ||| Sbjct: 22155682 cccgccggaagcacgacgatgtcggcgtcgggcatgtccttgaggatcaccttcttcgcc 22155741 Query: 248 tcctcgatggactttcccactacctccggccatgacgtcttc 289 ||||| ||| ||||| ||||||||||| ||||||||| Sbjct: 22155742 tcctccgccgacagccccaccacctccggccacgacgtcttc 22155783 Score = 65.9 bits (33), Expect = 1e-07 Identities = 102/125 (81%) Strand = Plus / Plus Query: 128 gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgag 187 ||||| |||||||||||||||||||| ||||||| | |||||| | ||||||||||| Sbjct: 22164955 gcgacggtgtcgacgaagatgcggacgcggttggggcggaagtccatggtcaccggcgtc 22165014 Query: 188 ccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcc 247 || | || | ||||||||||| || || ||||||||||| ||||| | || ||| ||| Sbjct: 22165015 cccaccggaaccacgacgatgtcggcgtcgggcatgtccttgaggatcaccttcttcgcc 22165074 Query: 248 tcctc 252 ||||| Sbjct: 22165075 tcctc 22165079 Score = 58.0 bits (29), Expect = 3e-05 Identities = 132/166 (79%), Gaps = 4/166 (2%) Strand = Plus / Plus Query: 128 gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtca----ccgg 183 ||||| |||||||||||||||||||| ||||||| | |||||| ||||| |||| Sbjct: 22160247 gcgacggtgtcgacgaagatgcggacgcggttggggcggaagtccttggtcaccggccgg 22160306 Query: 184 cgagccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctcctt 243 ||| || || || || ||||||||||| || || ||||||||||| ||||| | || ||| Sbjct: 22160307 cgaccccgccggaagcacgacgatgtcggcgtcgggcatgtccttgaggatcaccttctt 22160366 Query: 244 ggcctcctcgatggactttcccactacctccggccatgacgtcttc 289 |||||||| | | | ||||| ||||||||||| ||||||||| Sbjct: 22160367 cgcctcctccaccggcagccccaccacctccggccacgacgtcttc 22160412 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Plus Query: 128 gcgacagtgtcgacgaagatgcggacacggttg 160 ||||| |||||||||||||| |||||||||||| Sbjct: 14410164 gcgacggtgtcgacgaagattcggacacggttg 14410196
>emb|AL731742.3|CNS08C7R Oryza sativa chromosome 12, . BAC OJ1123_B09 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 155585 Score = 99.6 bits (50), Expect = 9e-18 Identities = 134/162 (82%) Strand = Plus / Minus Query: 128 gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgag 187 ||||| ||||| |||||||||||||| ||||||| | ||||||||||||||||||||| Sbjct: 25733 gcgacggtgtcaacgaagatgcggacgcggttggagcggaagtcgagggtcaccggcgac 25674 Query: 188 ccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcc 247 || || || || ||||||||||| || || ||||||||||| ||||| | || ||| ||| Sbjct: 25673 cccgccggaagcacgacgatgtcggcgtcgggcatgtccttgaggatcaccttcttcgcc 25614 Query: 248 tcctcgatggactttcccactacctccggccatgacgtcttc 289 ||||| ||| ||||| ||||||||||| ||||||||| Sbjct: 25613 tcctccgccgacagccccaccacctccggccacgacgtcttc 25572 Score = 65.9 bits (33), Expect = 1e-07 Identities = 102/125 (81%) Strand = Plus / Minus Query: 128 gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgag 187 ||||| |||||||||||||||||||| ||||||| | |||||| | ||||||||||| Sbjct: 16400 gcgacggtgtcgacgaagatgcggacgcggttggggcggaagtccatggtcaccggcgtc 16341 Query: 188 ccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcc 247 || | || | ||||||||||| || || ||||||||||| ||||| | || ||| ||| Sbjct: 16340 cccaccggaaccacgacgatgtcggcgtcgggcatgtccttgaggatcaccttcttcgcc 16281 Query: 248 tcctc 252 ||||| Sbjct: 16280 tcctc 16276 Score = 58.0 bits (29), Expect = 3e-05 Identities = 132/166 (79%), Gaps = 4/166 (2%) Strand = Plus / Minus Query: 128 gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtca----ccgg 183 ||||| |||||||||||||||||||| ||||||| | |||||| ||||| |||| Sbjct: 21108 gcgacggtgtcgacgaagatgcggacgcggttggggcggaagtccttggtcaccggccgg 21049 Query: 184 cgagccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctcctt 243 ||| || || || || ||||||||||| || || ||||||||||| ||||| | || ||| Sbjct: 21048 cgaccccgccggaagcacgacgatgtcggcgtcgggcatgtccttgaggatcaccttctt 20989 Query: 244 ggcctcctcgatggactttcccactacctccggccatgacgtcttc 289 |||||||| | | | ||||| ||||||||||| ||||||||| Sbjct: 20988 cgcctcctccaccggcagccccaccacctccggccacgacgtcttc 20943
>gb|BT017006.1| Zea mays clone EK07D2310C10.c mRNA sequence Length = 531 Score = 73.8 bits (37), Expect = 5e-10 Identities = 67/77 (87%) Strand = Plus / Minus Query: 218 ggcatgtccttaaggatgatctccttggcctcctcgatggactttcccactacctccggc 277 ||||||||||| || ||| ||||| | ||||||| ||||||| | ||||| ||||||||| Sbjct: 191 ggcatgtccttgagaatggtctccgtcgcctccttgatggacatgcccaccacctccggc 132 Query: 278 catgacgtcttcttctc 294 || |||||||||||||| Sbjct: 131 cacgacgtcttcttctc 115
>dbj|AK058739.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-G06, full insert sequence Length = 451 Score = 65.9 bits (33), Expect = 1e-07 Identities = 102/125 (81%) Strand = Plus / Minus Query: 128 gcgacagtgtcgacgaagatgcggacacggttggtcctgaagtcgagggtcaccggcgag 187 ||||| |||||||||||||||||||| ||||||| | |||||| | ||||||||||| Sbjct: 293 gcgacggtgtcgacgaagatgcggacgcggttggggcggaagtccatggtcaccggcgtc 234 Query: 188 ccggctgggaggacgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcc 247 || | || | ||||||||||| || || ||||||||||| ||||| | || ||| ||| Sbjct: 233 cccaccggaaccacgacgatgtcggcgtcgggcatgtccttgaggatcaccttcttcgcc 174 Query: 248 tcctc 252 ||||| Sbjct: 173 tcctc 169
>gb|BT018918.1| Zea mays clone Contig12.F mRNA sequence Length = 1058 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 380 tgtcgacgaagatgcggacacggtt 356
>gb|AY549626.1| Zea perennis isolate per7b MPI (mpi) gene, complete cds Length = 584 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 500 tgtcgacgaagatgcggacacggtt 476
>gb|AY549625.1| Zea perennis isolate per7a MPI (mpi) gene, complete cds Length = 592 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 508 tgtcgacgaagatgcggacacggtt 484
>gb|AY549624.1| Zea perennis isolate per6 MPI (mpi) gene, complete cds Length = 593 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 509 tgtcgacgaagatgcggacacggtt 485
>gb|AY549623.1| Zea perennis isolate per4d MPI (mpi) gene, complete cds Length = 578 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 494 tgtcgacgaagatgcggacacggtt 470
>gb|AY549622.1| Zea perennis isolate per4c MPI (mpi) gene, complete cds Length = 571 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 501 tgtcgacgaagatgcggacacggtt 477
>gb|AY549621.1| Zea perennis isolate per4b MPI (mpi) gene, complete cds Length = 585 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 501 tgtcgacgaagatgcggacacggtt 477
>gb|AY549619.1| Zea perennis isolate per3c MPI (mpi) gene, complete cds Length = 580 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 496 tgtcgacgaagatgcggacacggtt 472
>gb|AY549618.1| Zea perennis isolate per3b MPI (mpi) gene, complete cds Length = 586 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 502 tgtcgacgaagatgcggacacggtt 478
>gb|AY549617.1| Zea perennis isolate per3a MPI (mpi) gene, complete cds Length = 594 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 510 tgtcgacgaagatgcggacacggtt 486
>gb|AY549616.1| Zea perennis isolate per2c MPI (mpi) gene, complete cds Length = 593 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 509 tgtcgacgaagatgcggacacggtt 485
>gb|AY549614.1| Zea perennis isolate per2a MPI (mpi) gene, complete cds Length = 585 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 501 tgtcgacgaagatgcggacacggtt 477
>gb|AY549612.1| Zea perennis isolate per1b MPI (mpi) gene, complete cds Length = 585 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 501 tgtcgacgaagatgcggacacggtt 477
>gb|AY549599.1| Zea diploperennis isolate d1b MPI (mpi) gene, complete cds Length = 585 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 501 tgtcgacgaagatgcggacacggtt 477
>emb|X82187.1|ZMPIS7 Z.mays mRNA for pis7 Length = 386 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 262 tgtcgacgaagatgcggacacggtt 238
>emb|X78988.2|ZMMPI Zea mays MPI gene Length = 1262 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 1087 tgtcgacgaagatgcggacacggtt 1063
>emb|X69972.1|ZMCIMS Z.mays mRNA for subtilisin-chymotrypsin inhibitor Length = 457 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 282 tgtcgacgaagatgcggacacggtt 258
>dbj|AK121693.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033072A19, full insert sequence Length = 436 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 128 gcgacagtgtcgacgaagatgcggacacggttg 160 ||||| |||||||||||||| |||||||||||| Sbjct: 251 gcgacggtgtcgacgaagattcggacacggttg 219
>dbj|AK063833.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-122-B05, full insert sequence Length = 452 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 128 gcgacagtgtcgacgaagatgcggacacggttg 160 ||||| |||||||||||||| |||||||||||| Sbjct: 252 gcgacggtgtcgacgaagattcggacacggttg 220
>gb|AY104061.1| Zea mays PCO087322 mRNA sequence Length = 745 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 471 tgtcgacgaagatgcggacacggtt 447
>gb|AY878693.1| Oryza sativa (japonica cultivar-group) subitilisin-chymotrypsin inhibitor (Sci1) mRNA, complete cds Length = 435 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 128 gcgacagtgtcgacgaagatgcggacacggttg 160 ||||| |||||||||||||| |||||||||||| Sbjct: 228 gcgacggtgtcgacgaagattcggacacggttg 196
>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118101 Score = 50.1 bits (25), Expect = 0.007 Identities = 31/33 (93%) Strand = Plus / Minus Query: 128 gcgacagtgtcgacgaagatgcggacacggttg 160 ||||| |||||||||||||| |||||||||||| Sbjct: 61412 gcgacggtgtcgacgaagattcggacacggttg 61380
>gb|DQ147231.1| Zea mays subsp. parviglumis isolate 11c maize protease inhibitor (mpi) gene, complete cds Length = 566 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 480 tgtcgacgaagatgcggacacggtt 456
>gb|DQ147230.1| Zea mays subsp. parviglumis isolate 11b maize protease inhibitor (mpi) gene, complete cds Length = 565 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 480 tgtcgacgaagatgcggacacggtt 456
>gb|DQ147229.1| Zea mays subsp. parviglumis isolate 10a maize protease inhibitor (mpi) gene, complete cds Length = 566 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 480 tgtcgacgaagatgcggacacggtt 456
>gb|DQ147228.1| Zea mays subsp. parviglumis isolate 10b maize protease inhibitor (mpi) gene, complete cds Length = 566 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 480 tgtcgacgaagatgcggacacggtt 456
>gb|DQ147227.1| Zea mays subsp. parviglumis isolate 9b maize protease inhibitor (mpi) gene, complete cds Length = 558 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 472 tgtcgacgaagatgcggacacggtt 448
>gb|DQ147226.1| Zea mays subsp. parviglumis isolate 9a maize protease inhibitor (mpi) gene, complete cds Length = 554 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 469 tgtcgacgaagatgcggacacggtt 445
>gb|DQ147225.1| Zea mays subsp. parviglumis isolate 8b maize protease inhibitor (mpi) gene, complete cds Length = 564 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 478 tgtcgacgaagatgcggacacggtt 454
>gb|DQ147224.1| Zea mays subsp. parviglumis isolate 7a maize protease inhibitor (mpi) gene, complete cds Length = 574 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 488 tgtcgacgaagatgcggacacggtt 464
>gb|DQ147223.1| Zea mays subsp. parviglumis isolate 6b maize protease inhibitor (mpi) gene, complete cds Length = 564 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 478 tgtcgacgaagatgcggacacggtt 454
>gb|DQ147222.1| Zea mays subsp. parviglumis isolate 5a maize protease inhibitor (mpi) gene, complete cds Length = 558 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 472 tgtcgacgaagatgcggacacggtt 448
>gb|DQ147221.1| Zea mays subsp. parviglumis isolate 5b maize protease inhibitor (mpi) gene, complete cds Length = 566 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 480 tgtcgacgaagatgcggacacggtt 456
>gb|DQ147220.1| Zea mays subsp. parviglumis isolate 4b maize protease inhibitor (mpi) gene, complete cds Length = 566 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 480 tgtcgacgaagatgcggacacggtt 456
>gb|DQ147219.1| Zea mays subsp. parviglumis isolate 4c maize protease inhibitor (mpi) gene, complete cds Length = 596 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 510 tgtcgacgaagatgcggacacggtt 486
>gb|DQ147218.1| Zea mays subsp. parviglumis isolate 3c maize protease inhibitor (mpi) gene, complete cds Length = 580 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 494 tgtcgacgaagatgcggacacggtt 470
>gb|DQ147217.1| Zea mays subsp. parviglumis isolate 3a maize protease inhibitor (mpi) gene, complete cds Length = 587 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 501 tgtcgacgaagatgcggacacggtt 477
>gb|DQ147216.1| Zea mays subsp. parviglumis isolate 2a maize protease inhibitor (mpi) gene, complete cds Length = 580 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 494 tgtcgacgaagatgcggacacggtt 470
>gb|DQ147215.1| Zea mays subsp. parviglumis isolate 1b maize protease inhibitor (mpi) gene, complete cds Length = 564 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 ||||||||||||||||||||||||| Sbjct: 478 tgtcgacgaagatgcggacacggtt 454
>gb|AY549627.1| Tripsacum dactyloides MPI (mpi) gene, complete cds Length = 379 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggt 158 |||||||||||||||||||||||| Sbjct: 350 tgtcgacgaagatgcggacacggt 327
>gb|AY424272.1| Brachypodium distachyon ecotype ABR5 serine proteinase inhibitor (PIN1) mRNA, complete cds Length = 440 Score = 48.1 bits (24), Expect = 0.028 Identities = 27/28 (96%) Strand = Plus / Minus Query: 134 gtgtcgacgaagatgcggacacggttgg 161 |||||||||||||| ||||||||||||| Sbjct: 264 gtgtcgacgaagattcggacacggttgg 237 Score = 46.1 bits (23), Expect = 0.11 Identities = 65/79 (82%) Strand = Plus / Minus Query: 201 cgacgatgtccgcttcaggcatgtccttaaggatgatctccttggcctcctcgatggact 260 |||||||||| || |||||| ||||||| ||||| | || ||| ||||||| ||||||| Sbjct: 197 cgacgatgtcggcgtcaggcttgtccttgaggatcaccttctttgcctccttgatggaca 138 Query: 261 ttcccactacctccggcca 279 || || ||||||||||| Sbjct: 137 gcccgaccacctccggcca 119
>gb|AY112541.1| Zea mays CL44946_1 mRNA sequence Length = 509 Score = 48.1 bits (24), Expect = 0.028 Identities = 57/68 (83%) Strand = Plus / Plus Query: 218 ggcatgtccttaaggatgatctccttggcctcctcgatggactttcccactacctccggc 277 ||||||||||| || || ||||| | ||||||| ||||||| | ||||| ||||||||| Sbjct: 291 ggcatgtccttgagaatagtctccgtcgcctccttgatggacatgcccaccacctccggc 350 Query: 278 catgacgt 285 || ||||| Sbjct: 351 cacgacgt 358
>gb|M21400.1|BLYCI1A Barley chymotrypsin inhibitor (CI-1A) mRNA, complete cds Length = 446 Score = 44.1 bits (22), Expect = 0.44 Identities = 46/54 (85%) Strand = Plus / Minus Query: 229 aaggatgatctccttggcctcctcgatggactttcccactacctccggccatga 282 |||||||||||| ||||||| |||| |||| | || || |||||||||||||| Sbjct: 193 aaggatgatctctttggccttctcggcggacatcccgaccacctccggccatga 140
>gb|AY549620.1| Zea perennis MPI (mpi) gene, complete cds Length = 591 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 |||||||||||||||| |||||||| Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
>gb|AY549615.1| Zea perennis isolate per2b MPI (mpi) gene, complete cds Length = 591 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 |||||||||||||||| |||||||| Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
>gb|AY549613.1| Zea perennis isolate per1c MPI (mpi) gene, complete cds Length = 591 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 |||||||||||||||| |||||||| Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
>gb|AY549610.1| Zea diploperennis isolate d8b MPI (mpi) gene, complete cds Length = 591 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 |||||||||||||||| |||||||| Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
>gb|AY549609.1| Zea diploperennis isolate d8a MPI (mpi) gene, complete cds Length = 586 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 |||||||||||||||| |||||||| Sbjct: 502 tgtcgacgaagatgcgaacacggtt 478
>gb|AY549608.1| Zea diploperennis isolate d7b MPI (mpi) gene, complete cds Length = 591 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 |||||||||||||||| |||||||| Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
>gb|AY549607.1| Zea diploperennis isolate d7a MPI (mpi) gene, complete cds Length = 588 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 |||||||||||||||| |||||||| Sbjct: 500 tgtcgacgaagatgcgaacacggtt 476
>gb|AY549606.1| Zea diploperennis isolate d6b MPI (mpi) gene, complete cds Length = 587 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 |||||||||||||||| |||||||| Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
>gb|AY549605.1| Zea diploperennis isolate d6a MPI (mpi) gene, complete cds Length = 591 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 |||||||||||||||| |||||||| Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
>gb|AY549604.1| Zea diploperennis isolate d5b MPI (mpi) gene, complete cds Length = 562 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 |||||||||||||||| |||||||| Sbjct: 474 tgtcgacgaagatgcgaacacggtt 450
>gb|AY549603.1| Zea diploperennis isolate d5a MPI (mpi) gene, complete cds Length = 562 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 |||||||||||||||| |||||||| Sbjct: 474 tgtcgacgaagatgcgaacacggtt 450
>gb|AY549602.1| Zea diploperennis isolate d4a MPI (mpi) gene, complete cds Length = 591 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 |||||||||||||||| |||||||| Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
>gb|AY549601.1| Zea diploperennis isolate d3a MPI (mpi) gene, complete cds Length = 562 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 |||||||||||||||| |||||||| Sbjct: 474 tgtcgacgaagatgcgaacacggtt 450
>gb|AY549600.1| Zea diploperennis isolate d2a MPI (mpi) gene, complete cds Length = 569 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 |||||||||||||||| |||||||| Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
>gb|AY549598.1| Zea diploperennis isolate d1a MPI (mpi) gene, complete cds Length = 591 Score = 42.1 bits (21), Expect = 1.7 Identities = 24/25 (96%) Strand = Plus / Minus Query: 135 tgtcgacgaagatgcggacacggtt 159 |||||||||||||||| |||||||| Sbjct: 503 tgtcgacgaagatgcgaacacggtt 479
>gb|AC166039.6| Mus musculus chromosome 8, clone RP23-285M10, complete sequence Length = 168321 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 421 acttaagactacaaatcttt 440 |||||||||||||||||||| Sbjct: 168115 acttaagactacaaatcttt 168134 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 421 acttaagactacaaatcttt 440 |||||||||||||||||||| Sbjct: 31381 acttaagactacaaatcttt 31400
>ref|XM_369944.1| Magnaporthe grisea 70-15 hypothetical protein (MG06459.4) partial mRNA Length = 2781 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 236 atctccttggcctcctcgat 255 |||||||||||||||||||| Sbjct: 869 atctccttggcctcctcgat 850
>emb|CT009509.7| Mouse DNA sequence from clone RP23-140C10 on chromosome 13, complete sequence Length = 218144 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 98 aaagctagctagccaatgtg 117 |||||||||||||||||||| Sbjct: 209034 aaagctagctagccaatgtg 209015
>gb|AC161189.11| Mus musculus chromosome 8, clone RP23-337N9, complete sequence Length = 186769 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 421 acttaagactacaaatcttt 440 |||||||||||||||||||| Sbjct: 56939 acttaagactacaaatcttt 56958
>ref|XM_537053.2| PREDICTED: Canis familiaris similar to Cofilin-1 (Cofilin, non-muscle isoform) (18 kDa phosphoprotein) (p18) (LOC479927), mRNA Length = 1046 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 235 gatctccttggcctcctcga 254 |||||||||||||||||||| Sbjct: 246 gatctccttggcctcctcga 227
>gb|AC129174.3| Mus musculus BAC clone RP23-63H3 from chromosome 8, complete sequence Length = 209360 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 421 acttaagactacaaatcttt 440 |||||||||||||||||||| Sbjct: 190547 acttaagactacaaatcttt 190566
>emb|AL939122.1|SCO939122 Streptomyces coelicolor A3(2) complete genome; segment 19/29 Length = 311000 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 235 gatctccttggcctcctcga 254 |||||||||||||||||||| Sbjct: 131103 gatctccttggcctcctcga 131084
>emb|AJ581527.1| Fowlpox virus (isolate HP-438[Munich]), passage 438 clone FP9, complete genome Length = 266145 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 432 caaatctttatgtacataaa 451 |||||||||||||||||||| Sbjct: 180708 caaatctttatgtacataaa 180689
>ref|XM_682322.1| PREDICTED: Danio rerio similar to papilin (LOC559025), mRNA Length = 3387 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 232 gatgatctccttggcctcct 251 |||||||||||||||||||| Sbjct: 198 gatgatctccttggcctcct 179
>gb|AC147918.2| Xenopus tropicalis clone CH216-8N16, complete sequence Length = 210128 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 429 ctacaaatctttatgtacat 448 |||||||||||||||||||| Sbjct: 175408 ctacaaatctttatgtacat 175427
>gb|AC129197.4| Mus musculus BAC clone RP24-166C17 from chromosome 8, complete sequence Length = 143796 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 421 acttaagactacaaatcttt 440 |||||||||||||||||||| Sbjct: 66098 acttaagactacaaatcttt 66079
>gb|AC159742.1| Ornithorhynchus anatinus chromosome UNK clone OABb-263A1, complete sequence Length = 150582 Score = 40.1 bits (20), Expect = 6.8 Identities = 26/28 (92%) Strand = Plus / Minus Query: 440 tatgtacataaatcatatgggactggga 467 ||||||||||||| ||||||||||||| Sbjct: 138959 tatgtacataaatgctatgggactggga 138932
>gb|AF198100.1|AF198100 Fowlpox virus, complete genome Length = 288539 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 432 caaatctttatgtacataaa 451 |||||||||||||||||||| Sbjct: 191552 caaatctttatgtacataaa 191533
>gb|AF152393.1|MMTSP4S2 Mus musculus thrombospondin 4 gene, partial cds Length = 18901 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 98 aaagctagctagccaatgtg 117 |||||||||||||||||||| Sbjct: 15524 aaagctagctagccaatgtg 15543
>emb|CT573019.12| Mouse DNA sequence from clone RP24-94G12 on chromosome 14, complete sequence Length = 136188 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 370 ttcagttcagagactacaga 389 |||||||||||||||||||| Sbjct: 110112 ttcagttcagagactacaga 110093
>gb|AF333038.2| Streptomyces viridochromogenes Avilamycin A biosynthetic gene cluster, complete sequence Length = 59816 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 235 gatctccttggcctcctcga 254 |||||||||||||||||||| Sbjct: 2099 gatctccttggcctcctcga 2080
>gb|AC166113.3| Mus musculus BAC clone RP23-23E6 from chromosome 14, complete sequence Length = 252394 Score = 40.1 bits (20), Expect = 6.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 222 tgtccttaaggatgatctccttggcctc 249 |||||||||||||| ||| ||||||||| Sbjct: 98490 tgtccttaaggatgttctgcttggcctc 98517 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,987,462 Number of Sequences: 3902068 Number of extensions: 3987462 Number of successful extensions: 74166 Number of sequences better than 10.0: 82 Number of HSP's better than 10.0 without gapping: 84 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 73826 Number of HSP's gapped (non-prelim): 336 length of query: 502 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 480 effective length of database: 17,147,199,772 effective search space: 8230655890560 effective search space used: 8230655890560 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
