Clone Name | rbasd17p15 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold | 40 | 1.6 | 2 | gb|AC146881.3| Otolemur garnettii clone CH256-571D18, complete s... | 40 | 1.6 | 3 | gb|AC006836.7| Arabidopsis thaliana chromosome 2 clone F19B11 ma... | 38 | 6.4 | 4 | dbj|AB013393.2| Arabidopsis thaliana genomic DNA, chromosome 5, ... | 38 | 6.4 |
---|
>gb|DP000013.1| Otolemur garnettii target 1 genomic scaffold Length = 1743090 Score = 40.1 bits (20), Expect = 1.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 tattgttcttcaccatctct 107 |||||||||||||||||||| Sbjct: 483183 tattgttcttcaccatctct 483202
>gb|AC146881.3| Otolemur garnettii clone CH256-571D18, complete sequence Length = 240447 Score = 40.1 bits (20), Expect = 1.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 88 tattgttcttcaccatctct 107 |||||||||||||||||||| Sbjct: 159906 tattgttcttcaccatctct 159925
>gb|AC006836.7| Arabidopsis thaliana chromosome 2 clone F19B11 map RNSI, complete sequence Length = 87543 Score = 38.2 bits (19), Expect = 6.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 90 ttgttcttcaccatctctt 108 ||||||||||||||||||| Sbjct: 6518 ttgttcttcaccatctctt 6536
>dbj|AB013393.2| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJE4 Length = 63989 Score = 38.2 bits (19), Expect = 6.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 90 ttgttcttcaccatctctt 108 ||||||||||||||||||| Sbjct: 25920 ttgttcttcaccatctctt 25938 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 458,269 Number of Sequences: 3902068 Number of extensions: 458269 Number of successful extensions: 24127 Number of sequences better than 10.0: 4 Number of HSP's better than 10.0 without gapping: 4 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 24122 Number of HSP's gapped (non-prelim): 5 length of query: 136 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 115 effective length of database: 17,151,101,840 effective search space: 1972376711600 effective search space used: 1972376711600 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)