>gb|AC134530.3| Mus musculus BAC clone RP24-507K16 from chromosome 5, complete sequence
          Length = 215112

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 52     atagatagatagttgtaaaat 72
              |||||||||||||||||||||
Sbjct: 178628 atagatagatagttgtaaaat 178648

>gb|AC124193.2| Mus musculus BAC clone RP23-277F3 from 16, complete sequence
          Length = 190347

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 120    catatcctaaatggccataatgta 143
              ||||||| ||||||||||||||||
Sbjct: 173552 catatcccaaatggccataatgta 173575

>emb|CR751230.4| Human DNA sequence from clone RP6-169C19 on chromosome 1, complete
            sequence
          Length = 19782

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 73   gcacagatgcacccatagtc 92
            ||||||||||||||||||||
Sbjct: 8108 gcacagatgcacccatagtc 8089

>gb|AC154770.2| Mus musculus BAC clone RP24-448C20 from chromosome 16, complete
             sequence
          Length = 196851

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 120   catatcctaaatggccataatgta 143
             ||||||| ||||||||||||||||
Sbjct: 56363 catatcccaaatggccataatgta 56386

>gb|AC173211.3| Gallus gallus BAC clone CH261-2F13 from chromosome ul, complete
            sequence
          Length = 204791

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 7    aaggtgaaaagcaaagtaaa 26
            ||||||||||||||||||||
Sbjct: 3607 aaggtgaaaagcaaagtaaa 3588

>gb|AC161469.3| Gallus gallus BAC clone CH261-69M17 from chromosome ul, complete sequence
          Length = 186443

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 7      aaggtgaaaagcaaagtaaa 26
              ||||||||||||||||||||
Sbjct: 105244 aaggtgaaaagcaaagtaaa 105263

>dbj|AP006634.1| Lotus japonicus genomic DNA, chromosome 5, clone:LjT15O18, TM0086,
              complete sequence
          Length = 133572

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 170    ttttacaacttacaacaaca 189
              ||||||||||||||||||||
Sbjct: 107441 ttttacaacttacaacaaca 107422


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,225,071
Number of Sequences: 3902068
Number of extensions: 3225071
Number of successful extensions: 68324
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68310
Number of HSP's gapped (non-prelim): 14
length of query: 346
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 324
effective length of database: 17,147,199,772
effective search space: 5555692726128
effective search space used: 5555692726128
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)