>emb|AL391650.18| Human DNA sequence from clone RP11-96L14 on chromosome 1 Contains the
              EXTL1 gene for exostoses (multiple)-like 1, the SLC30A2
              gene for solute carrier family 30 (zinc transporter) member
              2, the RNF28 gene for ring finger protein 28, a novel gene,
              a novel gene (FLJ14050), the gene for zinc finger protein
              (ZT86), a novel gene, the 5' end of the gene for connector
              enhancer of KSR-like (Drosophila kinase suppressor of ras)
              (CNK1) and four CpG islands, complete sequence
          Length = 176006

 Score = 42.1 bits (21), Expect = 0.42
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 76     gtacattccatccacctttca 96
              |||||||||||||||||||||
Sbjct: 116720 gtacattccatccacctttca 116740

>ref|NM_201866.1| Arabidopsis thaliana unknown protein AT2G34090 transcript variant
           AT2G34090.2 mRNA, complete cds
          Length = 1577

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 32  caccatcccacagagaatga 51
           ||||||||||||||||||||
Sbjct: 522 caccatcccacagagaatga 503

>ref|NM_128960.2| Arabidopsis thaliana unknown protein AT2G34090 transcript variant
           AT2G34090.1 mRNA, complete cds
          Length = 1524

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 32  caccatcccacagagaatga 51
           ||||||||||||||||||||
Sbjct: 490 caccatcccacagagaatga 471

>gb|BT015789.1| Arabidopsis thaliana At2g34090 mRNA, complete cds
          Length = 1338

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 32  caccatcccacagagaatga 51
           ||||||||||||||||||||
Sbjct: 466 caccatcccacagagaatga 447

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 41      acagagaatgagctggggga 60
               ||||||||||||||||||||
Sbjct: 1729923 acagagaatgagctggggga 1729904

>gb|AC002341.3| Arabidopsis thaliana chromosome 2 clone T14G11 map TEn5, complete
             sequence
          Length = 82484

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 32    caccatcccacagagaatga 51
             ||||||||||||||||||||
Sbjct: 49000 caccatcccacagagaatga 49019

>emb|BX820715.1|CNS0A9YV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH62ZA05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1611

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 32  caccatcccacagagaatga 51
           ||||||||||||||||||||
Sbjct: 522 caccatcccacagagaatga 503

>emb|BX820714.1|CNS0A9YU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH62ZA03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1523

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 32  caccatcccacagagaatga 51
           ||||||||||||||||||||
Sbjct: 529 caccatcccacagagaatga 510

>emb|BX820084.1|CNS0A9YM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS72ZA05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1579

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 32  caccatcccacagagaatga 51
           ||||||||||||||||||||
Sbjct: 522 caccatcccacagagaatga 503

>emb|BX819429.1|CNS0A9X2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB76ZH12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1486

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 32  caccatcccacagagaatga 51
           ||||||||||||||||||||
Sbjct: 529 caccatcccacagagaatga 510

>emb|BX818993.1|CNS0A9V4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB35ZD03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1706

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 32  caccatcccacagagaatga 51
           ||||||||||||||||||||
Sbjct: 526 caccatcccacagagaatga 507

>emb|BX818991.1|CNS0A9UD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB35ZC04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1703

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 32  caccatcccacagagaatga 51
           ||||||||||||||||||||
Sbjct: 525 caccatcccacagagaatga 506

>emb|BX819964.1|CNS0A9FN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS54ZF06 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 2058

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 32  caccatcccacagagaatga 51
           ||||||||||||||||||||
Sbjct: 527 caccatcccacagagaatga 508

>gb|BT002072.1| Arabidopsis thaliana Unknown protein (At2g34090) mRNA, complete cds
          Length = 1523

 Score = 40.1 bits (20), Expect = 1.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 32  caccatcccacagagaatga 51
           ||||||||||||||||||||
Sbjct: 490 caccatcccacagagaatga 471

>gb|AC119220.11| Mus musculus chromosome 1, clone RP24-201K16, complete sequence
          Length = 162827

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 109   gccctcccagcaggcaaac 127
             |||||||||||||||||||
Sbjct: 85290 gccctcccagcaggcaaac 85272

>gb|AC149324.2| Phakopsora pachyrhizi clone JGIAFNA-13C12, complete sequence
          Length = 43237

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 93    ttcatgactttgcttagcc 111
             |||||||||||||||||||
Sbjct: 31594 ttcatgactttgcttagcc 31576

>ref|XM_583818.2| PREDICTED: Bos taurus similar to chloride intracellular channel 6
           (LOC507243), mRNA
          Length = 2466

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 85  atccacctttcatgacttt 103
           |||||||||||||||||||
Sbjct: 965 atccacctttcatgacttt 983

>gb|AC123852.4| Mus musculus BAC clone RP23-326G23 from chromosome 6, complete sequence
          Length = 195925

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                         
Query: 65     tgcatccaggtgtacattccatccacc 91
              |||||||||||||||||  ||||||||
Sbjct: 134207 tgcatccaggtgtacatcacatccacc 134233

>gb|AC074271.24| Homo sapiens 3 BAC RP11-65D10 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 63185

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 27    atcaccaccatcccacaga 45
             |||||||||||||||||||
Sbjct: 42564 atcaccaccatcccacaga 42546

>gb|AC115747.8| Mus musculus chromosome 10, clone RP23-8P5, complete sequence
          Length = 193706

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 54     tgggggaaaagtgcatcca 72
              |||||||||||||||||||
Sbjct: 124811 tgggggaaaagtgcatcca 124829

>emb|AL135785.10| Human DNA sequence from clone RP11-113O24 on chromosome 9p11-13.3
             Contains a novel gene, possible ortholog of mouse
             insulin-like growth factor binding protein 7 (IGFBP7), a
             novel gene similar to aldehyde dehydrogenase 1 family,
             member B1 (ALDH5, ALDHX, MGC2230) (ALDH1B1), a novel gene
             and four CpG islands, complete sequence
          Length = 166207

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 27    atcaccaccatcccacaga 45
             |||||||||||||||||||
Sbjct: 23728 atcaccaccatcccacaga 23710

>emb|AL132981.12|HSDJ80L13 Human DNA sequence from clone RP1-80L13 on chromosome 20 Contains STSs
             and GSSs, complete sequence
          Length = 112186

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 42    cagagaatgagctgggggaaaag 64
             ||||||||||||||||| |||||
Sbjct: 56042 cagagaatgagctggggaaaaag 56064

>gb|AC093851.5| Homo sapiens chromosome 4 clone RP11-499N1, complete sequence
          Length = 200968

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 27     atcaccaccatcccacaga 45
              |||||||||||||||||||
Sbjct: 196545 atcaccaccatcccacaga 196563

>gb|AC092691.3| Homo sapiens 3q BAC RP11-768G7 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 170215

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 72     aggtgtacattccatccac 90
              |||||||||||||||||||
Sbjct: 134338 aggtgtacattccatccac 134356

>gb|AC025568.25| Homo sapiens 12 BAC RP11-540D4 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 151154

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 22     tggtgatcaccaccatccc 40
              |||||||||||||||||||
Sbjct: 132756 tggtgatcaccaccatccc 132774

>gb|AC010364.6| Homo sapiens chromosome 5 clone CTD-2042D5, complete sequence
          Length = 163400

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 28/31 (90%)
 Strand = Plus / Minus

                                            
Query: 43    agagaatgagctgggggaaaagtgcatccag 73
             |||||||||||||| |||||||  |||||||
Sbjct: 53586 agagaatgagctggtggaaaagaacatccag 53556

>gb|AY737061.1| Oreochromis mossambicus clone Ov06E02 V-ATPase subunit A mRNA,
           partial cds
          Length = 755

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 55  gggggaaaagtgcatccag 73
           |||||||||||||||||||
Sbjct: 736 gggggaaaagtgcatccag 718

>gb|AC008507.11| Homo sapiens chromosome 19 clone CTC-448F2, complete sequence
          Length = 179005

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 33     accatcccacagagaatgagctg 55
              ||||||||||||||| |||||||
Sbjct: 163112 accatcccacagagagtgagctg 163134

>gb|AC006406.1|AC006406 Homo sapiens, clone hRPK.25_A_1, complete sequence
          Length = 159115

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 28/31 (90%)
 Strand = Plus / Plus

                                             
Query: 43     agagaatgagctgggggaaaagtgcatccag 73
              |||||||||||||| |||||||  |||||||
Sbjct: 109234 agagaatgagctggtggaaaagaacatccag 109264


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,281,560
Number of Sequences: 3902068
Number of extensions: 1281560
Number of successful extensions: 108263
Number of sequences better than 10.0: 29
Number of HSP's better than 10.0 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 108206
Number of HSP's gapped (non-prelim): 57
length of query: 138
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 117
effective length of database: 17,151,101,840
effective search space: 2006678915280
effective search space used: 2006678915280
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)