>gb|AC122707.2| Homo sapiens chromosome 5 clone RP11-158J3, complete sequence
          Length = 180483

 Score = 42.1 bits (21), Expect = 0.42
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 103    ccaccatgattgaaaggatgt 123
              |||||||||||||||||||||
Sbjct: 157872 ccaccatgattgaaaggatgt 157852

>gb|AC022163.5| Homo sapiens chromosome 5 clone RP11-454F19, complete sequence
          Length = 165675

 Score = 42.1 bits (21), Expect = 0.42
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 103   ccaccatgattgaaaggatgt 123
             |||||||||||||||||||||
Sbjct: 32358 ccaccatgattgaaaggatgt 32338

>gb|AC008965.6| Homo sapiens chromosome 5 clone CTD-2364L17, complete sequence
          Length = 139939

 Score = 42.1 bits (21), Expect = 0.42
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 103   ccaccatgattgaaaggatgt 123
             |||||||||||||||||||||
Sbjct: 37593 ccaccatgattgaaaggatgt 37613

>gb|AC144517.7| Medicago truncatula clone mth2-13k17, complete sequence
          Length = 107710

 Score = 40.1 bits (20), Expect = 1.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 59    gcaaggagtgcaagaccatt 78
             ||||||||||||||||||||
Sbjct: 77144 gcaaggagtgcaagaccatt 77163

>gb|AC154520.3| Mus musculus BAC clone RP23-471P16 from chromosome 14, complete sequence
          Length = 199186

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 21     attcagggctcattctttc 39
              |||||||||||||||||||
Sbjct: 135035 attcagggctcattctttc 135053

>gb|AC008221.5| Drosophila melanogaster clone BACR30B13, complete sequence
          Length = 184278

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 96    acaatagccaccatgattg 114
             |||||||||||||||||||
Sbjct: 98636 acaatagccaccatgattg 98618

>ref|NM_144019.1| Drosophila melanogaster CG18672-RA (CG18672), mRNA
          Length = 708

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 96  acaatagccaccatgattg 114
           |||||||||||||||||||
Sbjct: 359 acaatagccaccatgattg 341

>gb|AE003777.3| Drosophila melanogaster chromosome 3R, section 115 of 118 of the complete
              sequence
          Length = 232290

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 96     acaatagccaccatgattg 114
              |||||||||||||||||||
Sbjct: 128861 acaatagccaccatgattg 128843

>gb|AC123709.9| Mus musculus chromosome 13, clone RP23-375O18, complete sequence
          Length = 99670

 Score = 38.2 bits (19), Expect = 6.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 20    gattcagggctcattcttt 38
             |||||||||||||||||||
Sbjct: 66438 gattcagggctcattcttt 66456


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 678,683
Number of Sequences: 3902068
Number of extensions: 678683
Number of successful extensions: 39538
Number of sequences better than 10.0: 9
Number of HSP's better than 10.0 without gapping: 9
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 39528
Number of HSP's gapped (non-prelim): 10
length of query: 137
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 116
effective length of database: 17,151,101,840
effective search space: 1989527813440
effective search space used: 1989527813440
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)