Clone Name | rbasd17j01 |
---|---|
Clone Library Name | barley_pub |
>emb|AL662952.6|OSJN00151 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0009P12, complete sequence Length = 179644 Score = 48.1 bits (24), Expect = 0.029 Identities = 64/75 (85%), Gaps = 2/75 (2%) Strand = Plus / Plus Query: 435 ttttcttgagcctcgtccttgctcancaatgcttggtgtgacccgagacgacgccgatca 494 |||||||| || |||||||||| || ||||| ||||||||||| || || | ||||||| Sbjct: 85617 ttttcttgcgcttcgtccttgcccaacaatg-ttggtgtgacc-gaaacaatcccgatca 85674 Query: 495 agaacagcagagcta 509 |||||||||| |||| Sbjct: 85675 agaacagcagcgcta 85689
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 48.1 bits (24), Expect = 0.029 Identities = 64/75 (85%), Gaps = 2/75 (2%) Strand = Plus / Plus Query: 435 ttttcttgagcctcgtccttgctcancaatgcttggtgtgacccgagacgacgccgatca 494 |||||||| || |||||||||| || ||||| ||||||||||| || || | ||||||| Sbjct: 29948865 ttttcttgcgcttcgtccttgcccaacaatg-ttggtgtgacc-gaaacaatcccgatca 29948922 Query: 495 agaacagcagagcta 509 |||||||||| |||| Sbjct: 29948923 agaacagcagcgcta 29948937
>dbj|AK071102.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023077L10, full insert sequence Length = 1310 Score = 48.1 bits (24), Expect = 0.029 Identities = 64/75 (85%), Gaps = 2/75 (2%) Strand = Plus / Minus Query: 435 ttttcttgagcctcgtccttgctcancaatgcttggtgtgacccgagacgacgccgatca 494 |||||||| || |||||||||| || ||||| ||||||||||| || || | ||||||| Sbjct: 892 ttttcttgcgcttcgtccttgcccaacaatg-ttggtgtgacc-gaaacaatcccgatca 835 Query: 495 agaacagcagagcta 509 |||||||||| |||| Sbjct: 834 agaacagcagcgcta 820
>gb|AC127269.3| Mus musculus BAC clone RP23-432B20 from chromosome 9, complete sequence Length = 212660 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 134 gatgggcattgtgcttcccagat 156 ||||||||||||||||||||||| Sbjct: 160404 gatgggcattgtgcttcccagat 160426
>gb|AC156503.1| Mus musculus BAC clone RP23-272M11 from 9, complete sequence Length = 162078 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 134 gatgggcattgtgcttcccagat 156 ||||||||||||||||||||||| Sbjct: 53631 gatgggcattgtgcttcccagat 53653
>gb|AY110364.1| Zea mays CL5344_1 mRNA sequence Length = 1292 Score = 46.1 bits (23), Expect = 0.11 Identities = 35/38 (92%), Gaps = 1/38 (2%) Strand = Plus / Minus Query: 1 atggattgaatgaatctggtnatatatatacaaggatt 38 |||||||||||||||||||| | ||||||||| ||||| Sbjct: 1281 atggattgaatgaatctggtta-atatatacagggatt 1245
>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence Length = 3363523 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Plus Query: 332 cccaaatccaatgaagccgccgcat 356 ||||||||| ||||||||||||||| Sbjct: 847795 cccaaatccgatgaagccgccgcat 847819
>emb|AL138956.17| Human DNA sequence from clone RP11-16D22 on chromosome 13 Contains the 5' end of a novel gene, complete sequence Length = 165257 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 297 aaaccatgtgtcatccgcctc 317 ||||||||||||||||||||| Sbjct: 41431 aaaccatgtgtcatccgcctc 41451
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 ccgagacgacgccgatcaag 496 |||||||||||||||||||| Sbjct: 349223 ccgagacgacgccgatcaag 349204
>gb|AC121297.20| Mus musculus chromosome 1, clone RP23-326H11, complete sequence Length = 207496 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 423 atttctggtgccttttcttg 442 |||||||||||||||||||| Sbjct: 100603 atttctggtgccttttcttg 100622
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 386 gtggctcctcttcggtgttcatga 409 |||||| ||||||||||||||||| Sbjct: 750582 gtggctgctcttcggtgttcatga 750605
>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome Length = 6260361 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 224 tccggcaggcgggtgatggg 243 |||||||||||||||||||| Sbjct: 1906763 tccggcaggcgggtgatggg 1906744
>emb|AL807387.10| Mouse DNA sequence from clone RP23-24J10 on chromosome 4, complete sequence Length = 241148 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 135 atgggcattgtgcttcccag 154 |||||||||||||||||||| Sbjct: 140568 atgggcattgtgcttcccag 140587
>gb|AC154884.15| Mus musculus chromosome 3, clone RP23-145H17, complete sequence Length = 231400 Score = 40.1 bits (20), Expect = 7.0 Identities = 29/32 (90%) Strand = Plus / Plus Query: 173 atgtggggggtgaccatgaaatgaaacagtgt 204 ||||| |||| |||| |||||||||||||||| Sbjct: 223436 atgtgtggggagaccttgaaatgaaacagtgt 223467
>gb|AC115043.10| Mus musculus chromosome 3, clone RP24-294N3, complete sequence Length = 150336 Score = 40.1 bits (20), Expect = 7.0 Identities = 29/32 (90%) Strand = Plus / Minus Query: 173 atgtggggggtgaccatgaaatgaaacagtgt 204 ||||| |||| |||| |||||||||||||||| Sbjct: 45227 atgtgtggggagaccttgaaatgaaacagtgt 45196 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,870,059 Number of Sequences: 3902068 Number of extensions: 3870059 Number of successful extensions: 57809 Number of sequences better than 10.0: 15 Number of HSP's better than 10.0 without gapping: 12 Number of HSP's successfully gapped in prelim test: 3 Number of HSP's that attempted gapping in prelim test: 57696 Number of HSP's gapped (non-prelim): 117 length of query: 516 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 493 effective length of database: 17,143,297,704 effective search space: 8451645768072 effective search space used: 8451645768072 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)