ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd17h04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC145923.3| Pan troglodytes BAC clone RP43-10M24 from 7, comp... 48 0.018
2gb|AC008283.3| Homo sapiens BAC clone RP11-575G1 from 7, complet... 48 0.018
3gb|AC151737.3| Pan troglodytes BAC clone RP43-70B8 from chromoso... 48 0.018
4emb|AL139338.21| Human DNA sequence from clone RP11-149I8 on chr... 42 1.1
5emb|BX640439.1| Bordetella bronchiseptica strain RB50, complete ... 40 4.4
6emb|BX640425.1| Bordetella parapertussis strain 12822, complete ... 40 4.4
7emb|BX640420.1| Bordetella pertussis strain Tohama I, complete g... 40 4.4
8gb|AC016251.9| Homo sapiens chromosome 15, clone RP11-759A24, co... 40 4.4
9gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 4.4
10emb|AJ329820.1|HSA329820 Homo sapiens genomic sequence surroundi... 40 4.4

>gb|AC145923.3| Pan troglodytes BAC clone RP43-10M24 from 7, complete sequence
          Length = 181799

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 98     ccatatatccagctaaatggcagg 121
              ||||||||||||||||||||||||
Sbjct: 134153 ccatatatccagctaaatggcagg 134130



to top

>gb|AC008283.3| Homo sapiens BAC clone RP11-575G1 from 7, complete sequence
          Length = 57287

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 98    ccatatatccagctaaatggcagg 121
             ||||||||||||||||||||||||
Sbjct: 43304 ccatatatccagctaaatggcagg 43281



to top

>gb|AC151737.3| Pan troglodytes BAC clone RP43-70B8 from chromosome 7, complete
             sequence
          Length = 212458

 Score = 48.1 bits (24), Expect = 0.018
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 98    ccatatatccagctaaatggcagg 121
             ||||||||||||||||||||||||
Sbjct: 16690 ccatatatccagctaaatggcagg 16713



to top

>emb|AL139338.21| Human DNA sequence from clone RP11-149I8 on chromosome 10p12.31-14
             Contains the 5' end of the gene for a novel protein
             (LOC221061) and a CpG island, complete sequence
          Length = 112261

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 67    acaccatacaagaaaacaaga 87
             |||||||||||||||||||||
Sbjct: 52981 acaccatacaagaaaacaaga 53001



to top

>emb|BX640439.1| Bordetella bronchiseptica strain RB50, complete genome; segment 3/16
          Length = 346362

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 302    cgcagcagcgctcgcagggccagc 325
              ||||||||||| ||||||||||||
Sbjct: 243508 cgcagcagcgcgcgcagggccagc 243485



to top

>emb|BX640425.1| Bordetella parapertussis strain 12822, complete genome; segment 3/14
          Length = 348257

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 302    cgcagcagcgctcgcagggccagc 325
              ||||||||||| ||||||||||||
Sbjct: 157440 cgcagcagcgcgcgcagggccagc 157417



to top

>emb|BX640420.1| Bordetella pertussis strain Tohama I, complete genome; segment 10/12
          Length = 348134

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 302    cgcagcagcgctcgcagggccagc 325
              ||||||||||| ||||||||||||
Sbjct: 222603 cgcagcagcgcgcgcagggccagc 222626



to top

>gb|AC016251.9| Homo sapiens chromosome 15, clone RP11-759A24, complete sequence
          Length = 182943

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 306   gcagcgctcgcagggccagc 325
             ||||||||||||||||||||
Sbjct: 11787 gcagcgctcgcagggccagc 11768



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 298    aaggcgcagcagcgctcgcagggc 321
              ||||||||||||||| ||||||||
Sbjct: 804969 aaggcgcagcagcgcgcgcagggc 804992



to top

>emb|AJ329820.1|HSA329820 Homo sapiens genomic sequence surrounding NotI site, clone
           NR1-RB24R
          Length = 689

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 159 atggcaccagaatgcctggg 178
           ||||||||||||||||||||
Sbjct: 619 atggcaccagaatgcctggg 600


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,232,243
Number of Sequences: 3902068
Number of extensions: 2232243
Number of successful extensions: 38833
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 38810
Number of HSP's gapped (non-prelim): 23
length of query: 333
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 311
effective length of database: 17,147,199,772
effective search space: 5332779129092
effective search space used: 5332779129092
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top