Clone Name | rbasd17g22 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | gb|AY485643.1| Hordeum vulgare subsp. vulgare BAC 615K1, complet... | 157 | 2e-35 | 2 | gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c... | 40 | 2.9 | 3 | emb|AL592169.14| Mouse DNA sequence from clone RP23-305P10 on ch... | 40 | 2.9 |
---|
>gb|AY485643.1| Hordeum vulgare subsp. vulgare BAC 615K1, complete sequence Length = 114996 Score = 157 bits (79), Expect = 2e-35 Identities = 93/98 (94%) Strand = Plus / Minus Query: 119 ggtcatcaaggaggagaaacaccacggttgctcgcgccggcttcgtttggagacggntgc 178 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| Sbjct: 25485 ggtcatcaaggaggagaaacaccacggttgctcgcgccggcttcatttggagacggttgc 25426 Query: 179 cctagagaagggtcgtgcgatgccgctcgggagttatt 216 ||| |||||||||| || |||||||||||||||||||| Sbjct: 25425 cctggagaagggtcatgtgatgccgctcgggagttatt 25388
>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence Length = 3131724 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 122 catcaaggaggagaaacacc 141 |||||||||||||||||||| Sbjct: 652317 catcaaggaggagaaacacc 652336
>emb|AL592169.14| Mouse DNA sequence from clone RP23-305P10 on chromosome 15, complete sequence Length = 161985 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 130 aggagaaacaccacggttgc 149 |||||||||||||||||||| Sbjct: 159090 aggagaaacaccacggttgc 159109 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,076,238 Number of Sequences: 3902068 Number of extensions: 1076238 Number of successful extensions: 63704 Number of sequences better than 10.0: 3 Number of HSP's better than 10.0 without gapping: 3 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 63685 Number of HSP's gapped (non-prelim): 19 length of query: 227 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 205 effective length of database: 17,147,199,772 effective search space: 3515175953260 effective search space used: 3515175953260 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)