Clone Name	rbasd17f08
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	emb|Z50789.1|HVEF1ALFA H.vulgare mRNA for elongation factor 1-alpha	107	9e-21
2	emb|AJ234435.1|HVU234435 Hordeum vulgare partial mRNA; clone cMW...	107	9e-21
3	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	103	1e-19
4	gb|AC090484.4| Genomic sequence for Oryza sativa, Nipponbare str...	103	1e-19
5	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	103	1e-19
6	gb|AC125472.2| Oryza sativa (japonica cultivar-group) chromosome...	103	1e-19
7	dbj|AK105030.2| Oryza sativa (japonica cultivar-group) cDNA clon...	103	1e-19
8	dbj|AK119537.1| Oryza sativa (japonica cultivar-group) cDNA clon...	103	1e-19
9	dbj|AK119172.1| Oryza sativa (japonica cultivar-group) cDNA clon...	103	1e-19
10	dbj|AK103738.1| Oryza sativa (japonica cultivar-group) cDNA clon...	103	1e-19
11	dbj|AK073196.1| Oryza sativa (japonica cultivar-group) cDNA clon...	103	1e-19
12	dbj|AK072648.1| Oryza sativa (japonica cultivar-group) cDNA clon...	103	1e-19
13	dbj|AK072285.1| Oryza sativa (japonica cultivar-group) cDNA clon...	103	1e-19
14	dbj|AK062030.1| Oryza sativa (japonica cultivar-group) cDNA clon...	103	1e-19
15	dbj|AK061464.1| Oryza sativa (japonica cultivar-group) cDNA clon...	103	1e-19
16	dbj|D63583.1| Oryza sativa mRNA for EF-1 alpha, complete cds	103	1e-19
17	dbj|D63581.1| Oryza sativa mRNA for EF-1 alpha, complete cds	103	1e-19
18	dbj|D63580.1| Oryza sativa mRNA for EF-1 alpha, complete cds	103	1e-19
19	gb|BT016740.1| Zea mays clone Contig573 mRNA sequence	101	6e-19
20	gb|AF331849.1| Saccharum hybrid cultivar CP65-357 elongation fac...	98	9e-18
21	dbj|AK119528.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	9e-18
22	dbj|AK119194.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	9e-18
23	dbj|AK071619.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	9e-18
24	dbj|AK071343.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	9e-18
25	gb|AF030517.1|AF030517 Oryza sativa translation elongation facto...	98	9e-18
26	dbj|D63582.1| Oryza sativa mRNA for EF-1 alpha, complete cds	98	9e-18
27	emb|Z23130.1|HVBLT63A H.vulgare BLT63 mRNA, complete CDS	96	3e-17
28	gb|L11740.1|BLYEFIA Barley elongation factor 1 alpha, (EF-1A) mR...	96	3e-17
29	gb|BT017771.1| Zea mays clone EL01N0502E05.c mRNA sequence	94	1e-16
30	gb|AF136826.1|AF136826 Zea mays clone d elongation factor 1 alph...	94	1e-16
31	gb|AF136828.1|AF136828 Zea mays clone f elongation factor 1 alph...	92	5e-16
32	gb|M90077.1|WHTTEF1X Wheat translation elongation factor 1 alpha...	92	5e-16
33	gb|AF331850.1| Saccharum hybrid cultivar CP72-2086 elongation fa...	90	2e-15
34	dbj|AK119647.1| Oryza sativa (japonica cultivar-group) cDNA clon...	90	2e-15
35	gb|BT016525.1| Zea mays clone Contig358 mRNA sequence	88	8e-15
36	gb|AF136824.1|AF136824 Zea mays clone b elongation factor 1 alph...	88	8e-15
37	gb|AF136823.1|AF136823 Zea mays clone a elongation factor 1 alph...	88	8e-15
38	gb|AY109326.1| Zea mays CL1256_1 mRNA sequence	88	8e-15
39	emb|AJ222579.1|VFEF1A Vicia faba mRNA for elongation factor 1-al...	86	3e-14
40	gb|AF281361.1| Saccharum officinarum elongation factor mRNA, com...	86	3e-14
41	gb|BT016242.1| Zea mays clone Contig75 mRNA sequence	82	5e-13
42	emb|X96555.1|PSEF1ALPH P.sativum mRNA for elongation factor 1-alpha	82	5e-13
43	gb|AF136825.1|AF136825 Zea mays clone c elongation factor 1 alph...	82	5e-13
44	gb|BT016889.1| Zea mays clone Contig722 mRNA sequence	80	2e-12
45	gb|BT016514.1| Zea mays clone Contig347 mRNA sequence	78	8e-12
46	gb|BT016827.1| Zea mays clone Contig660 mRNA sequence	78	8e-12
47	gb|BT009129.1| Triticum aestivum clone wl1n.pk0027.f4:fis, full ...	78	8e-12
48	gb|AY039764.1| Sinapis arvensis elongation factor-1 alpha mRNA, ...	78	8e-12
49	dbj|D45408.1|MZEEF1A Zea mays elongation factor 1alpha gene, com...	78	8e-12
50	gb|U76259.1|ZMU76259 Zea mays elongation factor 1-alpha (EF1-A) ...	78	8e-12
51	dbj|D45407.1|MZEEF1AA Corn mRNA for elongation factor 1A	78	8e-12
52	gb|AF136829.1|AF136829 Zea mays clone g elongation factor 1 alph...	76	3e-11
53	dbj|D12709.1|DARELF1A Daucus carota mRNA for elongation factor 1...	76	3e-11
54	gb|AY205999.1| Malva pusilla translation elongation factor-1 alp...	70	2e-09
55	emb|CR719965.2|CNS0GIGZ Tetraodon nigroviridis full-length cDNA	68	8e-09
56	emb|CR699788.2|CNS0G2WO Tetraodon nigroviridis full-length cDNA	68	8e-09
57	emb|CR698727.2|CNS0G237 Tetraodon nigroviridis full-length cDNA	68	8e-09
58	emb|CR696581.1|CNS0G0FL Tetraodon nigroviridis full-length cDNA	68	8e-09
59	gb|AF136827.1|AF136827 Zea mays clone e elongation factor 1 alph...	68	8e-09
60	dbj|AB073631.1| Salsola komarovii skef-1A mRNA for eukaryotic el...	68	8e-09
61	gb|DQ057979.1| Musa acuminata elongation factor-1 alpha mRNA, co...	66	3e-08
62	emb|X56856.1|GMTEFS1 G.max tefS1 gene for elongation factor EF-1a	64	1e-07
63	gb|AY946009.1| Actinidia deliciosa elongation factor 1 alpha mRN...	64	1e-07
64	gb|AY550990.1| Elaeis guineensis elongation factor 1-alpha 1 (EF...	62	5e-07
65	ref|NM_100666.2| Arabidopsis thaliana calmodulin binding / trans...	62	5e-07
66	gb|AY651886.1| Glycine max elongation factor 1A SMV resistance-r...	62	5e-07
67	gb|AF479046.1| Triticum aestivum elongation factor-1 alpha mRNA,...	62	5e-07
68	emb|X16431.1|ATEF1A23 A.thaliana A2 and A3 genes encoding elonga...	62	5e-07
69	dbj|AK221085.1| Arabidopsis thaliana mRNA for elongation factor ...	62	5e-07
70	gb|AY088358.1| Arabidopsis thaliana clone 6135 mRNA, complete se...	62	5e-07
71	gb|BT002442.1| Arabidopsis thaliana elongation factor 1-alpha (A...	62	5e-07
72	gb|BT002423.1| Arabidopsis thaliana elongation factor 1-alpha (A...	62	5e-07
73	gb|AC026875.4|AC026875 Genomic sequence for Arabidopsis thaliana...	62	5e-07
74	emb|CT010481.8| M.truncatula DNA sequence from clone MTH2-62G7 o...	62	5e-07
75	gb|U63815.1|ATU63815 Arabidopsis thaliana AT.I.24-1, AT.I.24-2, ...	62	5e-07
76	emb|CR734901.2|CNS0GTTW Tetraodon nigroviridis full-length cDNA	60	2e-06
77	emb|CR734626.2|CNS0GTM9 Tetraodon nigroviridis full-length cDNA	60	2e-06
78	emb|CR734524.2|CNS0GTJF Tetraodon nigroviridis full-length cDNA	60	2e-06
79	emb|CR734377.2|CNS0GTFC Tetraodon nigroviridis full-length cDNA	60	2e-06
80	emb|CR733536.2|CNS0GSRZ Tetraodon nigroviridis full-length cDNA	60	2e-06
81	emb|CR732462.2|CNS0GS43 Tetraodon nigroviridis full-length cDNA	60	2e-06
82	emb|CR731974.2|CNS0GRQJ Tetraodon nigroviridis full-length cDNA	60	2e-06
83	emb|CR731790.1|CNS0GRLF Tetraodon nigroviridis full-length cDNA	60	2e-06
84	emb|CR731605.2|CNS0GRGA Tetraodon nigroviridis full-length cDNA	60	2e-06
85	emb|CR731362.2|CNS0GR9J Tetraodon nigroviridis full-length cDNA	60	2e-06
86	emb|CR731103.2|CNS0GR2C Tetraodon nigroviridis full-length cDNA	60	2e-06
87	emb|CR730766.2|CNS0GQSZ Tetraodon nigroviridis full-length cDNA	60	2e-06
88	emb|CR730432.2|CNS0GQJP Tetraodon nigroviridis full-length cDNA	60	2e-06
89	emb|CR730309.2|CNS0GQGA Tetraodon nigroviridis full-length cDNA	60	2e-06
90	emb|CR730105.2|CNS0GQAN Tetraodon nigroviridis full-length cDNA	60	2e-06
91	emb|CR730060.1|CNS0GQ9E Tetraodon nigroviridis full-length cDNA	60	2e-06
92	emb|CR728405.1|CNS0GOZF Tetraodon nigroviridis full-length cDNA	60	2e-06
93	emb|CR728311.1|CNS0GOWT Tetraodon nigroviridis full-length cDNA	60	2e-06
94	emb|CR727943.2|CNS0GOML Tetraodon nigroviridis full-length cDNA	60	2e-06
95	emb|CR727829.2|CNS0GOJF Tetraodon nigroviridis full-length cDNA	60	2e-06
96	emb|CR727751.2|CNS0GOH9 Tetraodon nigroviridis full-length cDNA	60	2e-06
97	emb|CR727869.1|CNS0GOKJ Tetraodon nigroviridis full-length cDNA	60	2e-06
98	emb|CR727445.2|CNS0GO8R Tetraodon nigroviridis full-length cDNA	60	2e-06
99	emb|CR727347.1|CNS0GO61 Tetraodon nigroviridis full-length cDNA	60	2e-06
100	emb|CR726763.2|CNS0GNPT Tetraodon nigroviridis full-length cDNA	60	2e-06
101	emb|CR725992.2|CNS0GN4E Tetraodon nigroviridis full-length cDNA	60	2e-06
102	emb|CR725687.2|CNS0GMVX Tetraodon nigroviridis full-length cDNA	60	2e-06
103	emb|CR725610.2|CNS0GMTS Tetraodon nigroviridis full-length cDNA	60	2e-06
104	emb|CR725478.2|CNS0GMQ4 Tetraodon nigroviridis full-length cDNA	60	2e-06
105	emb|CR720171.2|CNS0GIMP Tetraodon nigroviridis full-length cDNA	60	2e-06
106	emb|CR724326.1|CNS0GLU4 Tetraodon nigroviridis full-length cDNA	60	2e-06
107	emb|CR724083.1|CNS0GLND Tetraodon nigroviridis full-length cDNA	60	2e-06
108	emb|CR724080.1|CNS0GLNA Tetraodon nigroviridis full-length cDNA	60	2e-06
109	emb|CR724835.1|CNS0GM89 Tetraodon nigroviridis full-length cDNA	60	2e-06
110	emb|CR724462.2|CNS0GLXW Tetraodon nigroviridis full-length cDNA	60	2e-06
111	emb|CR724413.2|CNS0GLWJ Tetraodon nigroviridis full-length cDNA	60	2e-06
112	emb|CR724387.2|CNS0GLVT Tetraodon nigroviridis full-length cDNA	60	2e-06
113	emb|CR724386.2|CNS0GLVS Tetraodon nigroviridis full-length cDNA	60	2e-06
114	emb|CR724160.2|CNS0GLPI Tetraodon nigroviridis full-length cDNA	60	2e-06
115	emb|CR723301.2|CNS0GL1N Tetraodon nigroviridis full-length cDNA	60	2e-06
116	emb|CR722538.2|CNS0GKGG Tetraodon nigroviridis full-length cDNA	60	2e-06
117	emb|CR721923.2|CNS0GJZD Tetraodon nigroviridis full-length cDNA	60	2e-06
118	emb|CR721618.2|CNS0GJQW Tetraodon nigroviridis full-length cDNA	60	2e-06
119	emb|CR720504.2|CNS0GIVY Tetraodon nigroviridis full-length cDNA	60	2e-06
120	emb|CR719534.2|CNS0GI50 Tetraodon nigroviridis full-length cDNA	60	2e-06
121	emb|CR714097.2|CNS0GDY5 Tetraodon nigroviridis full-length cDNA	60	2e-06
122	emb|CR713922.2|CNS0GDTA Tetraodon nigroviridis full-length cDNA	60	2e-06
123	emb|CR713766.2|CNS0GDOY Tetraodon nigroviridis full-length cDNA	60	2e-06
124	emb|CR713230.2|CNS0GDA2 Tetraodon nigroviridis full-length cDNA	60	2e-06
125	emb|CR708676.2|CNS0G9RK Tetraodon nigroviridis full-length cDNA	60	2e-06
126	emb|CR707980.2|CNS0G988 Tetraodon nigroviridis full-length cDNA	60	2e-06
127	emb|CR707258.2|CNS0G8O6 Tetraodon nigroviridis full-length cDNA	60	2e-06
128	emb|CR704503.2|CNS0G6JN Tetraodon nigroviridis full-length cDNA	60	2e-06
129	emb|CR704481.2|CNS0G6J1 Tetraodon nigroviridis full-length cDNA	60	2e-06
130	emb|CR704033.2|CNS0G66L Tetraodon nigroviridis full-length cDNA	60	2e-06
131	emb|CR703833.2|CNS0G611 Tetraodon nigroviridis full-length cDNA	60	2e-06
132	emb|CR703295.2|CNS0G5M3 Tetraodon nigroviridis full-length cDNA	60	2e-06
133	emb|CR703157.2|CNS0G5I9 Tetraodon nigroviridis full-length cDNA	60	2e-06
134	emb|CR702997.2|CNS0G5DT Tetraodon nigroviridis full-length cDNA	60	2e-06
135	emb|CR701841.2|CNS0G4HP Tetraodon nigroviridis full-length cDNA	60	2e-06
136	emb|CR701796.2|CNS0G4GG Tetraodon nigroviridis full-length cDNA	60	2e-06
137	emb|CR701487.2|CNS0G47V Tetraodon nigroviridis full-length cDNA	60	2e-06
138	emb|CR701472.2|CNS0G47G Tetraodon nigroviridis full-length cDNA	60	2e-06
139	emb|CR701403.2|CNS0G45J Tetraodon nigroviridis full-length cDNA	60	2e-06
140	emb|CR700378.2|CNS0G3D2 Tetraodon nigroviridis full-length cDNA	60	2e-06
141	emb|CR700019.2|CNS0G333 Tetraodon nigroviridis full-length cDNA	60	2e-06
142	emb|CR700084.1|CNS0G34W Tetraodon nigroviridis full-length cDNA	60	2e-06
143	emb|CR699578.2|CNS0G2QU Tetraodon nigroviridis full-length cDNA	60	2e-06
144	emb|CR699560.2|CNS0G2QC Tetraodon nigroviridis full-length cDNA	60	2e-06
145	emb|CR699497.2|CNS0G2OL Tetraodon nigroviridis full-length cDNA	60	2e-06
146	emb|CR699169.2|CNS0G2FH Tetraodon nigroviridis full-length cDNA	60	2e-06
147	emb|CR698914.2|CNS0G28E Tetraodon nigroviridis full-length cDNA	60	2e-06
148	emb|CR698505.2|CNS0G1X1 Tetraodon nigroviridis full-length cDNA	60	2e-06
149	emb|CR698373.2|CNS0G1TD Tetraodon nigroviridis full-length cDNA	60	2e-06
150	emb|CR698030.2|CNS0G1JU Tetraodon nigroviridis full-length cDNA	60	2e-06
151	emb|CR697861.2|CNS0G1F5 Tetraodon nigroviridis full-length cDNA	60	2e-06
152	emb|CR697619.2|CNS0G18F Tetraodon nigroviridis full-length cDNA	60	2e-06
153	emb|CR697637.1|CNS0G18X Tetraodon nigroviridis full-length cDNA	60	2e-06
154	emb|CR697628.1|CNS0G18O Tetraodon nigroviridis full-length cDNA	60	2e-06
155	emb|CR696999.2|CNS0G0R7 Tetraodon nigroviridis full-length cDNA	60	2e-06
156	emb|CR696989.2|CNS0G0QX Tetraodon nigroviridis full-length cDNA	60	2e-06
157	emb|CR696612.2|CNS0G0GG Tetraodon nigroviridis full-length cDNA	60	2e-06
158	emb|CR696165.2|CNS0G041 Tetraodon nigroviridis full-length cDNA	60	2e-06
159	emb|CR692336.1|CNS0FX5O Tetraodon nigroviridis full-length cDNA	60	2e-06
160	emb|CR695246.2|CNS0FZEI Tetraodon nigroviridis full-length cDNA	60	2e-06
161	emb|CR695245.1|CNS0FZEH Tetraodon nigroviridis full-length cDNA	60	2e-06
162	emb|CR695160.2|CNS0FZC4 Tetraodon nigroviridis full-length cDNA	60	2e-06
163	emb|CR695132.2|CNS0FZBC Tetraodon nigroviridis full-length cDNA	60	2e-06
164	emb|CR694916.2|CNS0FZ5C Tetraodon nigroviridis full-length cDNA	60	2e-06
165	emb|CR694474.2|CNS0FYT2 Tetraodon nigroviridis full-length cDNA	60	2e-06
166	emb|CR694079.2|CNS0FYI3 Tetraodon nigroviridis full-length cDNA	60	2e-06
167	emb|CR693876.2|CNS0FYCG Tetraodon nigroviridis full-length cDNA	60	2e-06
168	emb|CR693709.2|CNS0FY7T Tetraodon nigroviridis full-length cDNA	60	2e-06
169	emb|CR693435.2|CNS0FY07 Tetraodon nigroviridis full-length cDNA	60	2e-06
170	emb|CR692728.2|CNS0FXGK Tetraodon nigroviridis full-length cDNA	60	2e-06
171	emb|CR692433.2|CNS0FX8D Tetraodon nigroviridis full-length cDNA	60	2e-06
172	emb|CR692428.2|CNS0FX88 Tetraodon nigroviridis full-length cDNA	60	2e-06
173	emb|CR692211.2|CNS0FX27 Tetraodon nigroviridis full-length cDNA	60	2e-06
174	emb|CR691919.2|CNS0FWU3 Tetraodon nigroviridis full-length cDNA	60	2e-06
175	emb|CR691626.2|CNS0FWLY Tetraodon nigroviridis full-length cDNA	60	2e-06
176	emb|CR691678.1|CNS0FWNE Tetraodon nigroviridis full-length cDNA	60	2e-06
177	emb|CR691578.2|CNS0FWKM Tetraodon nigroviridis full-length cDNA	60	2e-06
178	emb|CR685858.2|CNS0FS5Q Tetraodon nigroviridis full-length cDNA	60	2e-06
179	emb|CR690842.2|CNS0FW06 Tetraodon nigroviridis full-length cDNA	60	2e-06
180	emb|CR690415.2|CNS0FVOB Tetraodon nigroviridis full-length cDNA	60	2e-06
181	emb|CR690370.2|CNS0FVN2 Tetraodon nigroviridis full-length cDNA	60	2e-06
182	emb|CR688428.2|CNS0FU54 Tetraodon nigroviridis full-length cDNA	60	2e-06
183	emb|CR689688.2|CNS0FV44 Tetraodon nigroviridis full-length cDNA	60	2e-06
184	emb|CR690027.1|CNS0FVDJ Tetraodon nigroviridis full-length cDNA	60	2e-06
185	emb|CR689401.2|CNS0FUW5 Tetraodon nigroviridis full-length cDNA	60	2e-06
186	emb|CR689274.2|CNS0FUSM Tetraodon nigroviridis full-length cDNA	60	2e-06
187	emb|CR688857.2|CNS0FUH1 Tetraodon nigroviridis full-length cDNA	60	2e-06
188	emb|CR688856.2|CNS0FUH0 Tetraodon nigroviridis full-length cDNA	60	2e-06
189	emb|CR688537.2|CNS0FU85 Tetraodon nigroviridis full-length cDNA	60	2e-06
190	emb|CR687875.2|CNS0FTPR Tetraodon nigroviridis full-length cDNA	60	2e-06
191	emb|CR687838.2|CNS0FTOQ Tetraodon nigroviridis full-length cDNA	60	2e-06
192	emb|CR687834.2|CNS0FTOM Tetraodon nigroviridis full-length cDNA	60	2e-06
193	emb|CR687115.2|CNS0FT4N Tetraodon nigroviridis full-length cDNA	60	2e-06
194	emb|CR686564.2|CNS0FSPC Tetraodon nigroviridis full-length cDNA	60	2e-06
195	emb|CR686557.1|CNS0FSP5 Tetraodon nigroviridis full-length cDNA	60	2e-06
196	emb|CR686411.2|CNS0FSL3 Tetraodon nigroviridis full-length cDNA	60	2e-06
197	emb|CR685533.2|CNS0FRWP Tetraodon nigroviridis full-length cDNA	60	2e-06
198	emb|CR685287.2|CNS0FRPV Tetraodon nigroviridis full-length cDNA	60	2e-06
199	emb|CR684943.1|CNS0FRGB Tetraodon nigroviridis full-length cDNA	60	2e-06
200	emb|CR684789.2|CNS0FRC1 Tetraodon nigroviridis full-length cDNA	60	2e-06
201	emb|CR684645.1|CNS0FR81 Tetraodon nigroviridis full-length cDNA	60	2e-06
202	emb|CR681941.2|CNS0FP4X Tetraodon nigroviridis full-length cDNA	60	2e-06
203	emb|CR684345.2|CNS0FQZP Tetraodon nigroviridis full-length cDNA	60	2e-06
204	emb|CR683276.2|CNS0FQ60 Tetraodon nigroviridis full-length cDNA	60	2e-06
205	emb|CR683059.2|CNS0FPZZ Tetraodon nigroviridis full-length cDNA	60	2e-06
206	emb|CR682336.1|CNS0FPFW Tetraodon nigroviridis full-length cDNA	60	2e-06
207	emb|CR681800.2|CNS0FP10 Tetraodon nigroviridis full-length cDNA	60	2e-06
208	emb|CR678878.2|CNS0FMRU Tetraodon nigroviridis full-length cDNA	60	2e-06
209	emb|CR678958.2|CNS0FMU2 Tetraodon nigroviridis full-length cDNA	60	2e-06
210	emb|CR676177.2|CNS0FKP9 Tetraodon nigroviridis full-length cDNA	60	2e-06
211	emb|CR675956.1|CNS0FKJE Tetraodon nigroviridis full-length cDNA	60	2e-06
212	emb|CR674355.1|CNS0FJAX Tetraodon nigroviridis full-length cDNA	60	2e-06
213	emb|CR659722.2|CNS0F80G Tetraodon nigroviridis full-length cDNA	60	2e-06
214	emb|CR659458.1|CNS0F7T4 Tetraodon nigroviridis full-length cDNA	60	2e-06
215	emb|CR656391.1|CNS0F5FX Tetraodon nigroviridis full-length cDNA	60	2e-06
216	emb|CR656143.2|CNS0F591 Tetraodon nigroviridis full-length cDNA	60	2e-06
217	emb|CR656125.1|CNS0F58J Tetraodon nigroviridis full-length cDNA	60	2e-06
218	emb|CR653724.2|CNS0F3DU Tetraodon nigroviridis full-length cDNA	60	2e-06
219	emb|CR653058.2|CNS0F2VC Tetraodon nigroviridis full-length cDNA	60	2e-06
220	emb|CR652429.2|CNS0F2DV Tetraodon nigroviridis full-length cDNA	60	2e-06
221	emb|CR653091.1|CNS0F2W9 Tetraodon nigroviridis full-length cDNA	60	2e-06
222	emb|CR652612.2|CNS0F2IY Tetraodon nigroviridis full-length cDNA	60	2e-06
223	emb|CR650146.1|CNS0F0MG Tetraodon nigroviridis full-length cDNA	60	2e-06
224	emb|CR648965.2|CNS0EZPN Tetraodon nigroviridis full-length cDNA	60	2e-06
225	emb|CR648222.2|CNS0EZ50 Tetraodon nigroviridis full-length cDNA	60	2e-06
226	emb|CR647116.2|CNS0EYAA Tetraodon nigroviridis full-length cDNA	60	2e-06
227	emb|CR647392.2|CNS0EYHY Tetraodon nigroviridis full-length cDNA	60	2e-06
228	emb|CR647290.2|CNS0EYF4 Tetraodon nigroviridis full-length cDNA	60	2e-06
229	emb|CR647286.2|CNS0EYF0 Tetraodon nigroviridis full-length cDNA	60	2e-06
230	emb|CR645791.2|CNS0EX9H Tetraodon nigroviridis full-length cDNA	60	2e-06
231	emb|CR645306.3|CNS0EWW0 Tetraodon nigroviridis full-length cDNA	60	2e-06
232	emb|CR644587.2|CNS0EWC1 Tetraodon nigroviridis full-length cDNA	60	2e-06
233	emb|CR644549.2|CNS0EWAZ Tetraodon nigroviridis full-length cDNA	60	2e-06
234	emb|CR644872.2|CNS0EWJY Tetraodon nigroviridis full-length cDNA	60	2e-06
235	emb|CR644329.2|CNS0EW4V Tetraodon nigroviridis full-length cDNA	60	2e-06
236	emb|CR643685.2|CNS0EVMZ Tetraodon nigroviridis full-length cDNA	60	2e-06
237	emb|CR642053.2|CNS0EUDN Tetraodon nigroviridis full-length cDNA	60	2e-06
238	emb|CR641514.2|CNS0ETYO Tetraodon nigroviridis full-length cDNA	60	2e-06
239	emb|CR641101.1|CNS0ETN7 Tetraodon nigroviridis full-length cDNA	60	2e-06
240	emb|CR640927.2|CNS0ETID Tetraodon nigroviridis full-length cDNA	60	2e-06
241	emb|CR639709.3|CNS0ESKJ Tetraodon nigroviridis full-length cDNA	60	2e-06
242	emb|CR639763.2|CNS0ESM1 Tetraodon nigroviridis full-length cDNA	60	2e-06
243	emb|CR638352.2|CNS0ERIU Tetraodon nigroviridis full-length cDNA	60	2e-06
244	emb|CR638243.1|CNS0ERFT Tetraodon nigroviridis full-length cDNA	60	2e-06
245	emb|CR636980.2|CNS0EQGQ Tetraodon nigroviridis full-length cDNA	60	2e-06
246	emb|CR636487.2|CNS0EQ31 Tetraodon nigroviridis full-length cDNA	60	2e-06
247	emb|CR636278.2|CNS0EPX8 Tetraodon nigroviridis full-length cDNA	60	2e-06
248	emb|CR635593.1|CNS0EPE7 Tetraodon nigroviridis full-length cDNA	60	2e-06
249	emb|CR636202.1|CNS0EPV4 Tetraodon nigroviridis full-length cDNA	60	2e-06
250	emb|CR635580.2|CNS0EPDU Tetraodon nigroviridis full-length cDNA	60	2e-06
251	emb|CR634461.3|CNS0EOIR Tetraodon nigroviridis full-length cDNA	60	2e-06
252	emb|CR634592.2|CNS0EOME Tetraodon nigroviridis full-length cDNA	60	2e-06
253	emb|CR634041.2|CNS0EO73 Tetraodon nigroviridis full-length cDNA	60	2e-06
254	emb|CR633914.1|CNS0EO3K Tetraodon nigroviridis full-length cDNA	60	2e-06
255	emb|BX815663.1|CNS0ABIH Arabidopsis thaliana Full-length cDNA Co...	60	2e-06
256	dbj|AK108374.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	2e-06
257	gb|BT016891.1| Zea mays clone Contig724 mRNA sequence	58	7e-06
258	emb|CR730799.2|CNS0GQTW Tetraodon nigroviridis full-length cDNA	58	7e-06
259	emb|CR633982.1|CNS0EO5G Tetraodon nigroviridis full-length cDNA	58	7e-06
260	emb|X66131.1|RARNAEL1A R.americana mRNA for elongation factor 1-...	58	7e-06
261	gb|BT016906.1| Zea mays clone Contig739 mRNA sequence	56	3e-05
262	ref|XM_445466.1| Candida glabrata CBS138, CAGL0D01188g partial mRNA	56	3e-05
263	emb|CR642155.2|CNS0EUGH Tetraodon nigroviridis full-length cDNA	56	3e-05
264	emb|CR380950.1| Candida glabrata strain CBS138 chromosome D comp...	56	3e-05
265	gb|AC181983.2| Gallus gallus BAC clone CH261-63A17 from chromoso...	56	3e-05
266	gb|AY928339.1| Oscheius tipulae clone pA1 eukaryotic translation...	56	3e-05
267	dbj|AB199910.1| Hyla japonica ef 1a mRNA for elongation factor 1...	56	3e-05
268	emb|BX935744.1| Gallus gallus finished cDNA, clone ChEST2k15	56	3e-05
269	dbj|AK110735.1| Oryza sativa (japonica cultivar-group) cDNA clon...	56	3e-05
270	gb|L00677.1|CHKEF1A Gallus gallus elongation factor 1 alpha mRNA...	56	3e-05
271	ref|NM_100667.2| Arabidopsis thaliana calmodulin binding / trans...	54	1e-04
272	gb|BT018898.1| Zea mays clone EL01T0207D05.d mRNA sequence	54	1e-04
273	gb|AY264256.1| Synodontis sp. GM-2003 elongation factor-1 alpha ...	54	1e-04
274	gb|AY264244.1| Trachydoras nattereri haplotype II elongation fac...	54	1e-04
275	gb|AY264203.1| Physopyxis lyra elongation factor-1 alpha gene, e...	54	1e-04
276	gb|DQ174257.1| Gossypium hirsutum translation elongation factor ...	54	1e-04
277	gb|DQ174256.1| Gossypium hirsutum translation elongation factor ...	54	1e-04
278	gb|DQ174252.1| Gossypium hirsutum translation elongation factor ...	54	1e-04
279	gb|AY123029.1| Arabidopsis thaliana putative elongation factor 1...	54	1e-04
280	gb|AY080660.1| Arabidopsis thaliana putative elongation factor 1...	54	1e-04
281	gb|AF361822.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, comp...	54	1e-04
282	gb|AY065008.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, comp...	54	1e-04
283	gb|AY059160.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, comp...	54	1e-04
284	gb|AF398148.1|AF398148 Brassica rapa subsp. pekinensis translati...	54	1e-04
285	gb|AY048275.1| Arabidopsis thaliana At1g07930/T6D22_3 mRNA, comp...	54	1e-04
286	gb|AF268670.1|AF268670 Numida meleagris DNA sequence derived usi...	54	1e-04
287	gb|AF268667.1|AF268667 Coturnix coturnix DNA sequence derived us...	54	1e-04
288	gb|BT003325.1| Arabidopsis thaliana Unknown protein mRNA, comple...	54	1e-04
289	gb|AF181492.1|AF181492 Lilium longiflorum elongation factor-1 al...	54	1e-04
290	gb|AF121261.1|AF121261 Lilium longiflorum elongation factor 1-al...	54	1e-04
291	gb|U40935.2| Caenorhabditis elegans cosmid F31E3, complete sequence	52	5e-04
292	emb|CR734347.2|CNS0GTEI Tetraodon nigroviridis full-length cDNA	52	5e-04
293	emb|CR733596.2|CNS0GSTN Tetraodon nigroviridis full-length cDNA	52	5e-04
294	emb|CR733510.1|CNS0GSR9 Tetraodon nigroviridis full-length cDNA	52	5e-04
295	emb|CR731666.2|CNS0GRHZ Tetraodon nigroviridis full-length cDNA	52	5e-04
296	emb|CR731544.2|CNS0GREL Tetraodon nigroviridis full-length cDNA	52	5e-04
297	emb|CR730819.2|CNS0GQUG Tetraodon nigroviridis full-length cDNA	52	5e-04
298	emb|CR728779.2|CNS0GP9T Tetraodon nigroviridis full-length cDNA	52	5e-04
299	emb|CR728426.2|CNS0GP00 Tetraodon nigroviridis full-length cDNA	52	5e-04
300	emb|CR728065.1|CNS0GOPZ Tetraodon nigroviridis full-length cDNA	52	5e-04
301	emb|CR726393.2|CNS0GNFJ Tetraodon nigroviridis full-length cDNA	52	5e-04
302	emb|CR726389.2|CNS0GNFF Tetraodon nigroviridis full-length cDNA	52	5e-04
303	emb|CR725371.2|CNS0GMN5 Tetraodon nigroviridis full-length cDNA	52	5e-04
304	emb|CR725363.1|CNS0GMMX Tetraodon nigroviridis full-length cDNA	52	5e-04
305	emb|CR724024.2|CNS0GLLQ Tetraodon nigroviridis full-length cDNA	52	5e-04
306	emb|CR724353.2|CNS0GLUV Tetraodon nigroviridis full-length cDNA	52	5e-04
307	emb|CR720674.2|CNS0GJ0O Tetraodon nigroviridis full-length cDNA	52	5e-04
308	emb|CR703995.2|CNS0G65J Tetraodon nigroviridis full-length cDNA	52	5e-04
309	emb|CR700459.2|CNS0G3FB Tetraodon nigroviridis full-length cDNA	52	5e-04
310	emb|CR699171.2|CNS0G2FJ Tetraodon nigroviridis full-length cDNA	52	5e-04
311	emb|CR698021.2|CNS0G1JL Tetraodon nigroviridis full-length cDNA	52	5e-04
312	emb|CR695387.2|CNS0FZIF Tetraodon nigroviridis full-length cDNA	52	5e-04
313	emb|CR694704.2|CNS0FYZG Tetraodon nigroviridis full-length cDNA	52	5e-04
314	emb|CR693823.2|CNS0FYAZ Tetraodon nigroviridis full-length cDNA	52	5e-04
315	emb|CR693928.1|CNS0FYDW Tetraodon nigroviridis full-length cDNA	52	5e-04
316	emb|CR693472.2|CNS0FY18 Tetraodon nigroviridis full-length cDNA	52	5e-04
317	emb|CR692986.2|CNS0FXNQ Tetraodon nigroviridis full-length cDNA	52	5e-04
318	emb|CR690871.2|CNS0FW0Z Tetraodon nigroviridis full-length cDNA	52	5e-04
319	emb|CR690778.2|CNS0FVYE Tetraodon nigroviridis full-length cDNA	52	5e-04
320	emb|CR689677.2|CNS0FV3T Tetraodon nigroviridis full-length cDNA	52	5e-04
321	emb|CR688145.2|CNS0FTX9 Tetraodon nigroviridis full-length cDNA	52	5e-04
322	emb|CR682458.2|CNS0FPJA Tetraodon nigroviridis full-length cDNA	52	5e-04
323	emb|CR655103.1|CNS0F4G5 Tetraodon nigroviridis full-length cDNA	52	5e-04
324	emb|CR653001.2|CNS0F2TR Tetraodon nigroviridis full-length cDNA	52	5e-04
325	emb|CR649444.2|CNS0F02Y Tetraodon nigroviridis full-length cDNA	52	5e-04
326	emb|CR648772.2|CNS0EZKA Tetraodon nigroviridis full-length cDNA	52	5e-04
327	emb|CR646570.2|CNS0EXV4 Tetraodon nigroviridis full-length cDNA	52	5e-04
328	emb|CR643784.1|CNS0EVPQ Tetraodon nigroviridis full-length cDNA	52	5e-04
329	emb|CR641359.1|CNS0ETUD Tetraodon nigroviridis full-length cDNA	52	5e-04
330	emb|CR638516.2|CNS0ERNE Tetraodon nigroviridis full-length cDNA	52	5e-04
331	emb|CR637042.2|CNS0EQIG Tetraodon nigroviridis full-length cDNA	52	5e-04
332	gb|DQ115328.1| Caenorhabditis remanei translation elongation fac...	52	5e-04
333	gb|AY114651.1| Arabidopsis thaliana putative elongation factor 1...	52	5e-04
334	gb|AY062553.1| Arabidopsis thaliana putative elongation factor 1...	52	5e-04
335	ref|NM_066119.3| Caenorhabditis elegans Elongation FacTor family...	52	5e-04
336	gb|AY422992.1| Danio rerio eukaryotic translation elongation fac...	50	0.002
337	gb|BC064291.1| Danio rerio elongation factor 1-alpha, mRNA (cDNA...	50	0.002
338	ref|NM_131263.1| Danio rerio elongation factor 1-alpha (ef1a), mRNA	50	0.002
339	ref|XM_846935.1| PREDICTED: Canis familiaris similar to eukaryot...	50	0.002
340	emb|CR732497.2|CNS0GS52 Tetraodon nigroviridis full-length cDNA	50	0.002
341	emb|CR702574.2|CNS0G522 Tetraodon nigroviridis full-length cDNA	50	0.002
342	emb|X77689.1|BREF1MRN B.rerio ef-1 alpha mRNA	50	0.002
343	emb|X60302.1|DCEF1A D.carota gene for elongation factor 1A	50	0.002
344	gb|DQ083545.1| Danio rerio eukaryotic translation elongation fac...	50	0.002
345	gb|L47669.1|ZEFEF1A Brachydanio rerio translation elongation fac...	50	0.002
346	gb|L23807.1|ZEFEF1AL Danio rerio elongation factor 1 alpha (EFL1...	50	0.002
347	dbj|D13338.1|BMOEF1A Bombyx mori mRNA for elongation factor 1 alpha	50	0.002
348	gb|BC086701.1| Danio rerio zgc:101545, mRNA (cDNA clone MGC:1015...	48	0.007
349	gb|DQ228347.1| Solanum tuberosum clone 149A09 elongation factor ...	48	0.007
350	gb|AY300042.1| Solanum tuberosum putative translation elongation...	48	0.007
351	gb|DQ174258.1| Gossypium hirsutum translation elongation factor ...	48	0.007
352	gb|DQ174254.1| Gossypium hirsutum translation elongation factor ...	48	0.007
353	gb|DQ174251.1| Gossypium hirsutum translation elongation factor ...	48	0.007
354	emb|X73978.1|AGTEF1A A.gossypii TEF gene for translation elongat...	48	0.007
355	emb|X03349.1|ASEF1A Brine shrimp (artemia) mRNA for elongation f...	48	0.007
356	emb|AJ250733.1|DPO250733 Dreissena polymorpha mRNA for translati...	48	0.007
357	emb|AJ720062.1| Gallus gallus mRNA for hypothetical protein, clo...	48	0.007
358	ref|NM_204157.2| Gallus gallus eukaryotic translation elongation...	48	0.007
359	gb|AF321836.1| Salmo salar elongation factor 1 alpha mRNA, compl...	48	0.007
360	gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10...	48	0.007
361	gb|AF268682.1|AF268682 Meleagris gallopavo DNA sequence derived ...	48	0.007
362	ref|NM_001008638.1| Danio rerio zgc:101545 (zgc:101545), mRNA	48	0.007
363	ref|NM_209079.1| Eremothecium gossypii ADL370Cp (ADL370C), mRNA	48	0.007
364	gb|AF067195.1|AF067195 Oryza sativa translation elongation facto...	48	0.007
365	gb|AF056101.1|AF056101 Kentrophoros sp. translation elongation f...	48	0.007
366	emb|X03708.1|ASEF1A5G A.salina EF-1-alpha gene, exon 5	48	0.007
367	dbj|AB073630.1| Suaeda japonica sjef-1A mRNA for eukaryotic elon...	48	0.007
368	gb|U14100.1|HCTEF Histoplasma capsulatum elongation factor 1-alp...	48	0.007
369	gb|DQ252511.1| Solanum tuberosum clone 087B12 elongation factor ...	48	0.007
370	ref|NM_125432.2| Arabidopsis thaliana calmodulin binding / trans...	46	0.028
371	ref|NM_001037030.1| Arabidopsis thaliana calmodulin binding / tr...	46	0.028
372	ref|NM_001035916.1| Arabidopsis thaliana calmodulin binding / tr...	46	0.028
373	ref|NM_100668.2| Arabidopsis thaliana calmodulin binding / trans...	46	0.028
374	gb|DQ228328.1| Solanum tuberosum clone 135G05 elongation factor ...	46	0.028
375	gb|DQ228326.1| Solanum tuberosum clone 135F02 elongation factor ...	46	0.028
376	gb|DQ222490.1| Solanum tuberosum clone 098G02 elongation factor ...	46	0.028
377	gb|AF242732.1| Capsicum annuum translation elongation factor 1a ...	46	0.028
378	gb|AY712790.1| Felis catus elongation factor 1 alpha mRNA, compl...	46	0.028
379	gb|BT012707.1| Lycopersicon esculentum clone 113585F, mRNA sequence	46	0.028
380	gb|AY264197.1| Sorubim lima elongation factor-1 alpha gene, exon...	46	0.028
381	ref|XM_844751.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
382	ref|XM_845844.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
383	ref|XM_545177.2| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
384	ref|XM_843417.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
385	ref|XM_846211.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
386	ref|XM_852185.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
387	ref|XM_852052.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
388	ref|XM_851020.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
389	ref|XM_850978.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
390	ref|XM_850940.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
391	ref|XR_000307.2| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
392	ref|XM_845314.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
393	ref|XM_854601.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
394	ref|XM_851802.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
395	ref|XM_843622.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
396	ref|XM_847797.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
397	ref|XM_846482.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
398	ref|XM_845726.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
399	gb|AY496125.1| Capsicum annuum elongation factor 1-alpha mRNA, c...	46	0.028
400	ref|XM_843675.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
401	ref|XM_857522.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
402	ref|XM_851994.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
403	ref|XM_533344.2| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
404	ref|XM_860644.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
405	ref|XM_860631.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
406	ref|XM_860616.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
407	ref|XM_860599.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
408	ref|XM_847329.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
409	ref|XM_856907.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
410	ref|XM_860614.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
411	ref|XM_532520.2| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
412	ref|XM_847233.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
413	ref|XM_856877.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
414	ref|XM_856852.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
415	ref|XM_856828.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
416	ref|XM_856800.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
417	ref|XM_856776.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
418	ref|XM_845503.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
419	ref|XM_532203.2| PREDICTED: Canis familiaris eukaryotic translat...	46	0.028
420	ref|XM_862288.1| PREDICTED: Canis familiaris eukaryotic translat...	46	0.028
421	ref|XM_853745.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
422	ref|XM_844358.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
423	ref|XM_843986.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
424	ref|XM_853670.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
425	ref|XM_852832.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
426	ref|XM_531887.2| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
427	gb|AY310807.1| Nicotiana benthamiana clone 12-120 unknown mRNA	46	0.028
428	ref|XM_843767.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
429	ref|XM_843332.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
430	emb|CR686571.2|CNS0FSPJ Tetraodon nigroviridis full-length cDNA	46	0.028
431	ref|XM_849232.1| PREDICTED: Canis familiaris similar to eukaryot...	46	0.028
432	gb|BT000688.1| Arabidopsis thaliana clone RAFL08-11-M03 (R11086)...	46	0.028
433	gb|BT000595.1| Arabidopsis thaliana elongation factor 1-alpha (...	46	0.028
434	emb|X16432.1|ATEF1AA4 Arabidopsis thaliana EF-1 alpha-A4 (NAEEFT...	46	0.028
435	emb|X16430.1|ATEF1AA1 Arabidopsis thaliana EF-1 alpha A1 gene fo...	46	0.028
436	emb|X73529.1|PGEFIA P.graminis ef-1alpha gene for elongation factor	46	0.028
437	gb|AF360167.1| Arabidopsis thaliana putative translation elongat...	46	0.028
438	emb|X53043.1|LEEF1A L.esculentum gene for elongation factor 1-alpha	46	0.028
439	emb|X14449.1|LELEEF1 Tomato LeEF-1 mRNA for elongation factor 1 ...	46	0.028
440	gb|AY140099.1| Arabidopsis thaliana unknown protein mRNA, comple...	46	0.028
441	gb|AY140095.1| Arabidopsis thaliana unknown protein mRNA, comple...	46	0.028
442	gb|AY133532.1| Arabidopsis thaliana At5g60390/muf9_40 mRNA, comp...	46	0.028
443	gb|AY128802.1| Arabidopsis thaliana elongation factor 1-alpha mR...	46	0.028
444	gb|AY115575.1| Trichophyton rubrum elongation factor 1-alpha mRN...	46	0.028
445	gb|AY060564.1| Arabidopsis thaliana AT5g60390/muf9_40 mRNA, comp...	46	0.028
446	gb|AF419586.1|AF419586 Arabidopsis thaliana AT5g60390/muf9_40 mR...	46	0.028
447	gb|AY059904.1| Arabidopsis thaliana elongation factor 1-alpha (E...	46	0.028
448	dbj|AK221032.1| Arabidopsis thaliana mRNA for elongation factor ...	46	0.028
449	dbj|AK221176.1| Arabidopsis thaliana mRNA for translation elonga...	46	0.028
450	gb|BT006369.1| Arabidopsis thaliana At5g60390/muf9_40 gene, comp...	46	0.028
451	gb|AY039583.1| Arabidopsis thaliana At1g07940/T6D22_14 mRNA, com...	46	0.028
452	emb|BX814695.1|CNS0ADQC Arabidopsis thaliana Full-length cDNA Co...	46	0.028
453	dbj|AB193485.1| Takifugu rubripes EF-1a mRNA for elongation fact...	46	0.028
454	emb|BX829434.1|CNS0A06V Arabidopsis thaliana Full-length cDNA Co...	46	0.028
455	ref|NM_001009326.1| Felis catus elongation factor 1 alpha (EF1A)...	46	0.028
456	gb|BT002510.1| Arabidopsis thaliana Unknown protein mRNA, comple...	46	0.028
457	gb|AY157315.1| Stevia rebaudiana elongation factor 1 alpha mRNA,...	46	0.028
458	dbj|AB011483.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	46	0.028
459	emb|AJ010225.1|CAR010225 Cicer arietinum mRNA for elongation fac...	46	0.028
460	ref|NM_001037873.1| Takifugu rubripes elongation factor 1 alpha ...	46	0.028
461	dbj|AP006106.1| Lotus japonicus genomic DNA, chromosome 1, clone...	46	0.028
462	gb|U19723.1|APU19723 Aureobasidium pullulans translation elongat...	46	0.028
463	gb|DQ268854.1| Solanum tuberosum clone 171A01 elongation factor ...	46	0.028
464	gb|U04632.1|NTU04632 Nicotiana tabacum Wisconsin 38 vitronectin-...	46	0.028
465	dbj|D63396.1|TOBBY2A Nicotiana tabacum mRNA for elongation facto...	46	0.028
466	gb|U37548.1| Caenorhabditis elegans cosmid C54D2, complete sequence	44	0.11
467	gb|U51994.1| Caenorhabditis elegans cosmid R03G5, complete sequence	44	0.11
468	ref|XR_000300.2| PREDICTED: Canis familiaris similar to eukaryot...	44	0.11
469	emb|CR734125.2|CNS0GT8C Tetraodon nigroviridis full-length cDNA	44	0.11
470	emb|CR734384.2|CNS0GTFJ Tetraodon nigroviridis full-length cDNA	44	0.11
471	emb|CR725103.2|CNS0GMFP Tetraodon nigroviridis full-length cDNA	44	0.11
472	emb|CR697972.2|CNS0G1I8 Tetraodon nigroviridis full-length cDNA	44	0.11
473	emb|CR696708.1|CNS0G0J4 Tetraodon nigroviridis full-length cDNA	44	0.11
474	emb|CR687455.1|CNS0FTE3 Tetraodon nigroviridis full-length cDNA	44	0.11
475	emb|CR683592.2|CNS0FQES Tetraodon nigroviridis full-length cDNA	44	0.11
476	emb|CR674085.2|CNS0FJ3F Tetraodon nigroviridis full-length cDNA	44	0.11
477	ref|XM_501628.1| Yarrowia lipolytica CLIB122, YALI0C09141g predi...	44	0.11
478	ref|NM_182444.2| Caenorhabditis elegans Elongation FacTor family...	44	0.11
479	ref|NM_182443.2| Caenorhabditis elegans Elongation FacTor family...	44	0.11
480	ref|NM_076922.2| Caenorhabditis elegans Elongation FacTor family...	44	0.11
481	gb|AF378368.1|AF378368 Coccidioides immitis elongation factor 1-...	44	0.11
482	gb|AF054510.1|AF054510 Yarrowia lipolytica translation elongatio...	44	0.11
483	emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1...	44	0.11
484	ref|NM_001016692.2| Xenopus tropicalis hypothetical protein LOC5...	42	0.44
485	gb|AY617294.1| Sterkiella histriomuscorum clone UGC1O0001_K13_R ...	42	0.44
486	ref|XM_844920.1| PREDICTED: Canis familiaris similar to eukaryot...	42	0.44
487	ref|XM_852859.1| PREDICTED: Canis familiaris similar to eukaryot...	42	0.44
488	ref|XM_844012.1| PREDICTED: Canis familiaris similar to eukaryot...	42	0.44
489	ref|XM_848236.1| PREDICTED: Canis familiaris similar to eukaryot...	42	0.44
490	ref|XM_848170.1| PREDICTED: Canis familiaris similar to eukaryot...	42	0.44
491	emb|CR727866.2|CNS0GOKG Tetraodon nigroviridis full-length cDNA	42	0.44
492	emb|CR693052.2|CNS0FXPK Tetraodon nigroviridis full-length cDNA	42	0.44
493	emb|Z68181.1|HVEF1AMR H.vulgaris mRNA for elongation factor EF1-...	42	0.44
494	emb|X57926.1|SLEFAA S.lemnae efaA gene for elongation factor alp...	42	0.44
495	emb|X55324.1|XLEF1A X. laevis EF-1alpha mRNA for elongation fact...	42	0.44
496	emb|Z14080.1|NTEF13 N.tabacum mRNA for elongation factor 1-a (pa...	42	0.44
497	gb|BC097730.1| Xenopus laevis cDNA clone IMAGE:3749812	42	0.44
498	gb|BC043843.1| Xenopus laevis eukaryotic translation elongation ...	42	0.44
499	emb|CR760182.2| Xenopus tropicalis finished cDNA, clone TNeu134e08	42	0.44
500	emb|CR761905.2| Xenopus tropicalis finished cDNA, clone TNeu093n11	42	0.44

---

>emb|Z50789.1|HVEF1ALFA H.vulgare mRNA for elongation factor 1-alpha
          Length = 1609

 Score =  107 bits (54), Expect = 9e-21
 Identities = 83/93 (89%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            ||||||| ||||||||||||| |||| ||| ||||||||||||||||||| |||||||||
Sbjct: 1394 cttcttgatggcagccttggtcaccttggctccggtggggtccttcttctccacgccctt 1335

                                             
Query: 103  gatgactccgacagcaaccgtttgtctcatgtc 135
            |||||| || ||||| || ||||| ||||||||
Sbjct: 1334 gatgacaccaacagccacagtttgcctcatgtc 1302

---

>emb|AJ234435.1|HVU234435 Hordeum vulgare partial mRNA; clone cMWG0716.rev
          Length = 325

 Score =  107 bits (54), Expect = 9e-21
 Identities = 83/93 (89%)
 Strand = Plus / Plus

                                                                       
Query: 43  cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
           ||||||| ||||||||||||| |||| ||| ||||||||||||||||||| |||||||||
Sbjct: 171 cttcttgatggcagccttggtcaccttggctccggtggggtccttcttctccacgccctt 230

                                            
Query: 103 gatgactccgacagcaaccgtttgtctcatgtc 135
           |||||| || ||||| || ||||| ||||||||
Sbjct: 231 gatgacaccaacagccacagtttgcctcatgtc 263

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                           
Query: 43      cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
               |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 4101201 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 4101142

                                                         
Query: 103     gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
               |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 4101141 gatgacgccaacagccaccgtttgcctcatgtcacgcacggc 4101100



 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                           
Query: 43      cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
               |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 4084349 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 4084290

                                                         
Query: 103     gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
               |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 4084289 gatgacgccaacagccaccgtttgcctcatgtcacgcacggc 4084248



 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                           
Query: 43      cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
               |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 4078909 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 4078850

                                                         
Query: 103     gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
               |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 4078849 gatgacgccaacagccaccgtttgcctcatgtcccgcacggc 4078808



 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                           
Query: 43      cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
               |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 4095031 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 4094972

                                                      
Query: 103     gatgactccgacagcaaccgtttgtctcatgtcncgcac 141
               |||||| || ||||| |||||||| |||||||| |||||
Sbjct: 4094971 gatgacgccaacagccaccgtttgcctcatgtcacgcac 4094933



 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 95       acgcccttgatgactccga 113
                |||||||||||||||||||
Sbjct: 30786340 acgcccttgatgactccga 30786322

---

>gb|AC090484.4| Genomic sequence for Oryza sativa, Nipponbare strain, clone
             OSJNBa0061L19, from chromosome 3, complete sequence
          Length = 153322

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                         
Query: 43    cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
             |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 20459 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 20518

                                                       
Query: 103   gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
             |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 20519 gatgacgccaacagccaccgtttgcctcatgtcccgcacggc 20560



 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Plus

                                                                         
Query: 43    cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
             |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 15019 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 15078

                                                       
Query: 103   gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
             |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 15079 gatgacgccaacagccaccgtttgcctcatgtcacgcacggc 15120



 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 86/99 (86%)
 Strand = Plus / Plus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 4337 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 4396

                                                   
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcac 141
            |||||| || ||||| |||||||| |||||||| |||||
Sbjct: 4397 gatgacgccaacagccaccgtttgcctcatgtcacgcac 4435

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                           
Query: 43      cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
               |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 4101310 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 4101251

                                                         
Query: 103     gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
               |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 4101250 gatgacgccaacagccaccgtttgcctcatgtcacgcacggc 4101209



 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                           
Query: 43      cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
               |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 4084460 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 4084401

                                                         
Query: 103     gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
               |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 4084400 gatgacgccaacagccaccgtttgcctcatgtcacgcacggc 4084359



 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                           
Query: 43      cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
               |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 4079020 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 4078961

                                                         
Query: 103     gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
               |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 4078960 gatgacgccaacagccaccgtttgcctcatgtcccgcacggc 4078919



 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                           
Query: 43      cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
               |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 4095142 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 4095083

                                                      
Query: 103     gatgactccgacagcaaccgtttgtctcatgtcncgcac 141
               |||||| || ||||| |||||||| |||||||| |||||
Sbjct: 4095082 gatgacgccaacagccaccgtttgcctcatgtcacgcac 4095044



 Score = 38.2 bits (19), Expect = 6.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                   
Query: 95       acgcccttgatgactccga 113
                |||||||||||||||||||
Sbjct: 30877763 acgcccttgatgactccga 30877745

---

>gb|AC125472.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
            OSJNBa0050H14, complete sequence
          Length = 142245

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1838 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1779

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 1778 gatgacgccaacagccaccgtttgcctcatgtcacgcacggc 1737

---

>dbj|AK105030.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-012-F06, full
            insert sequence
          Length = 1632

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1433 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1374

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 1373 gatgacgccaacagccaccgtttgcctcatgtcccgcacggc 1332

---

>dbj|AK119537.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-B11, full
            insert sequence
          Length = 1722

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1435 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1376

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 1375 gatgacgccaacagccaccgtttgcctcatgtcacgcacggc 1334

---

>dbj|AK119172.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-A11, full
            insert sequence
          Length = 1661

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1428 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1369

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 1368 gatgacgccaacagccaccgtttgcctcatgtcccgcacggc 1327

---

>dbj|AK103738.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033138K07, full
            insert sequence
          Length = 3222

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 3023 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 2964

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 2963 gatgacgccaacagccaccgtttgcctcatgtcccgcacggc 2922

---

>dbj|AK073196.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033024M04, full
            insert sequence
          Length = 2157

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1994 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1935

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 1934 gatgacgccaacagccaccgtttgcctcatgtcacgcacggc 1893

---

>dbj|AK072648.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023126K23, full
            insert sequence
          Length = 1760

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1432 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1373

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 1372 gatgacgccaacagccaccgtttgcctcatgtcccgcacggc 1331

---

>dbj|AK072285.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023016F09, full
            insert sequence
          Length = 1653

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1421 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1362

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 1361 gatgacgccaacagccaccgtttgcctcatgtcacgcacggc 1320

---

>dbj|AK062030.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-G10, full
            insert sequence
          Length = 1357

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1154 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1095

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 1094 gatgacgccaacagccaccgtttgcctcatgtcccgcacggc 1053

---

>dbj|AK061464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-C01, full
            insert sequence
          Length = 1620

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1434 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1375

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 1374 gatgacgccaacagccaccgtttgcctcatgtcacgcacggc 1333

---

>dbj|D63583.1| Oryza sativa mRNA for EF-1 alpha, complete cds
          Length = 1599

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1413 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1354

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 1353 gatgacgccaacagccaccgtttgcctcatgtcacgcacggc 1312

---

>dbj|D63581.1| Oryza sativa mRNA for EF-1 alpha, complete cds
          Length = 1630

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1399 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1340

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 1339 gatgacgccaacagccaccgtttgcctcatgtcacgcacggc 1298

---

>dbj|D63580.1| Oryza sativa mRNA for EF-1 alpha, complete cds
          Length = 1644

 Score =  103 bits (52), Expect = 1e-19
 Identities = 89/102 (87%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1411 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1352

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            |||||| || ||||| |||||||| |||||||| ||||||||
Sbjct: 1351 gatgacgccaacagccaccgtttgcctcatgtcccgcacggc 1310

---

>gb|BT016740.1| Zea mays clone Contig573 mRNA sequence
          Length = 1712

 Score =  101 bits (51), Expect = 6e-19
 Identities = 75/83 (90%)
 Strand = Plus / Minus

                                                                        
Query: 53   gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
            ||||||||||| |||| ||||||||| ||||||||||||| ||| | |||||||||||| 
Sbjct: 1423 gcagccttggtcaccttggcaccggtcgggtccttcttctccacactcttgatgactcca 1364

                                   
Query: 113  acagcaaccgtttgtctcatgtc 135
            ||||||||||| |||||||||||
Sbjct: 1363 acagcaaccgtctgtctcatgtc 1341

---

>gb|AF331849.1| Saccharum hybrid cultivar CP65-357 elongation factor 1 alpha (SEF1a)
            gene, complete cds
          Length = 4537

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||| || || ||||||||||||| ||| | |||
Sbjct: 4083 cttcttggcggcagccttggtcaccttggctccagttgggtccttcttctccacactctt 4024

                                                   
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcac 141
            ||||||||||||||| |||||||| |||||||| |||||
Sbjct: 4023 gatgactccgacagccaccgtttgcctcatgtcccgcac 3985

---

>dbj|AK119528.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-C04, full
            insert sequence
          Length = 1818

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1424 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1365

                                                   
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcac 141
            |||||| || ||||| |||||||| |||||||| |||||
Sbjct: 1364 gatgacgccaacagccaccgtttgcctcatgtcacgcac 1326

---

>dbj|AK119194.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-041-C03, full
           insert sequence
          Length = 1130

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 43  cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
           |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 893 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 834

                                                  
Query: 103 gatgactccgacagcaaccgtttgtctcatgtcncgcac 141
           |||||| || ||||| |||||||| |||||||| |||||
Sbjct: 833 gatgacgccaacagccaccgtttgcctcatgtcacgcac 795

---

>dbj|AK071619.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023100M05, full
            insert sequence
          Length = 1867

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1699 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1640

                                                   
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcac 141
            |||||| || ||||| |||||||| |||||||| |||||
Sbjct: 1639 gatgacgccaacagccaccgtttgcctcatgtcacgcac 1601

---

>dbj|AK071343.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023091A02, full
            insert sequence
          Length = 1658

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1424 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1365

                                                   
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcac 141
            |||||| || ||||| |||||||| |||||||| |||||
Sbjct: 1364 gatgacgccaacagccaccgtttgcctcatgtcacgcac 1326

---

>gb|AF030517.1|AF030517 Oryza sativa translation elongation factor-1 alpha mRNA, complete cds
          Length = 1562

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1338 cttcttgcgggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1279

                                                   
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcac 141
            |||||| || ||||| |||||||| |||||||| |||||
Sbjct: 1278 gatgacgccaacagccaccgtttgcctcatgtcacgcac 1240

---

>dbj|D63582.1| Oryza sativa mRNA for EF-1 alpha, complete cds
          Length = 1637

 Score = 97.6 bits (49), Expect = 9e-18
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||||||||| ||||||||||||| ||||  |||
Sbjct: 1403 cttcttggcggcagccttggtcaccttggcaccggttgggtccttcttctccacgttctt 1344

                                                   
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcac 141
            |||||| || ||||| |||||||| |||||||| |||||
Sbjct: 1343 gatgacgccaacagccaccgtttgcctcatgtcacgcac 1305

---

>emb|Z23130.1|HVBLT63A H.vulgare BLT63 mRNA, complete CDS
          Length = 1560

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            ||||||| | |||||||||||||||| ||| ||||| || |||||||||| ||||| |||
Sbjct: 1384 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 1325

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||| || || ||||||||||| || |||||||| ||||||||
Sbjct: 1324 gatcacacccacagcaaccgtctgcctcatgtcacgcacggc 1283

---

>gb|L11740.1|BLYEFIA Barley elongation factor 1 alpha, (EF-1A) mRNA sequence
          Length = 1725

 Score = 95.6 bits (48), Expect = 3e-17
 Identities = 88/102 (86%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            ||||||| | |||||||||||||||| ||| ||||| || |||||||||| ||||| |||
Sbjct: 1445 cttcttgatcgcagccttggtaaccttggcgccggtcggctccttcttctccacgctctt 1386

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||| || || ||||||||||| || |||||||| ||||||||
Sbjct: 1385 gatcacacccacagcaaccgtctgcctcatgtcacgcacggc 1344

---

>gb|BT017771.1| Zea mays clone EL01N0502E05.c mRNA sequence
          Length = 959

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 74/83 (89%)
 Strand = Plus / Minus

                                                                       
Query: 53  gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
           ||||||||||| |||| |||||| || ||||||||||||| ||||| |||||||||||| 
Sbjct: 788 gcagccttggtcaccttggcaccagttgggtccttcttctccacgctcttgatgactcca 729

                                  
Query: 113 acagcaaccgtttgtctcatgtc 135
           ||||||||||| || ||||||||
Sbjct: 728 acagcaaccgtctgcctcatgtc 706

---

>gb|AF136826.1|AF136826 Zea mays clone d elongation factor 1 alpha mRNA, complete cds
          Length = 1546

 Score = 93.7 bits (47), Expect = 1e-16
 Identities = 74/83 (89%)
 Strand = Plus / Minus

                                                                        
Query: 53   gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
            ||||||||||| |||| |||||| || ||||||||||||| ||||| |||||||||||| 
Sbjct: 1359 gcagccttggtcaccttggcaccagttgggtccttcttctccacgctcttgatgactcca 1300

                                   
Query: 113  acagcaaccgtttgtctcatgtc 135
            ||||||||||| || ||||||||
Sbjct: 1299 acagcaaccgtctgcctcatgtc 1277

---

>gb|AF136828.1|AF136828 Zea mays clone f elongation factor 1 alpha mRNA, complete cds
          Length = 1596

 Score = 91.7 bits (46), Expect = 5e-16
 Identities = 78/89 (87%)
 Strand = Plus / Minus

                                                                        
Query: 56   gccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccgaca 115
            ||||||||||||| ||| ||||| ||||||||||||| ||| | |||||||||||| |||
Sbjct: 1394 gccttggtaaccttggcgccggtcgggtccttcttctccacactcttgatgactccaaca 1335

                                         
Query: 116  gcaaccgtttgtctcatgtcncgcacggc 144
            |||||||| || |||||||| || |||||
Sbjct: 1334 gcaaccgtctgcctcatgtcgcggacggc 1306

---

>gb|M90077.1|WHTTEF1X Wheat translation elongation factor 1 alpha-subunit (TEF1) mRNA,
            complete cds
          Length = 2062

 Score = 91.7 bits (46), Expect = 5e-16
 Identities = 81/93 (87%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            ||||||| ||||||||||||| |||| ||| ||||| ||||||||||||| ||| |||||
Sbjct: 1819 cttcttgatggcagccttggtcaccttggcgccggttgggtccttcttctccacaccctt 1760

                                             
Query: 103  gatgactccgacagcaaccgtttgtctcatgtc 135
            |||||| || ||||| || ||||| ||||||||
Sbjct: 1759 gatgacaccaacagccacagtttgcctcatgtc 1727

---

>gb|AF331850.1| Saccharum hybrid cultivar CP72-2086 elongation factor 1 alpha (SEF1a)
            mRNA, partial cds
          Length = 1578

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| ||| || || ||||||||||||| ||| | |||
Sbjct: 1320 cttcttggcggcagccttggtcaccttggctccagttgggtccttcttctccacactctt 1261

                                                   
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcac 141
            ||||||||| ||||| |||||||| |||||||| |||||
Sbjct: 1260 gatgactccaacagccaccgtttgcctcatgtcccgcac 1222

---

>dbj|AK119647.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-G07, full
            insert sequence
          Length = 1660

 Score = 89.7 bits (45), Expect = 2e-15
 Identities = 85/99 (85%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  |||||||||||| |||| || |||||| ||||||||||||| ||||  |||
Sbjct: 1426 cttcttggcggcagccttggtcaccttggtaccggttgggtccttcttctccacgttctt 1367

                                                   
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcac 141
            |||||| || ||||| |||||||| |||||||| |||||
Sbjct: 1366 gatgacgccaacagccaccgtttgcctcatgtcacgcac 1328

---

>gb|BT016525.1| Zea mays clone Contig358 mRNA sequence
          Length = 1705

 Score = 87.7 bits (44), Expect = 8e-15
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  ||| |||||||| |||| ||| ||||| ||||||||||||| ||| | |||
Sbjct: 1417 cttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccacactctt 1358

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| ||||||||||| || |||||||| || |||||
Sbjct: 1357 gatgactccaacagcaaccgtctgcctcatgtcgcggacggc 1316

---

>gb|AF136824.1|AF136824 Zea mays clone b elongation factor 1 alpha mRNA, complete cds
          Length = 1604

 Score = 87.7 bits (44), Expect = 8e-15
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  ||| |||||||| |||| ||| ||||| ||||||||||||| ||| | |||
Sbjct: 1398 cttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccacactctt 1339

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| ||||||||||| || |||||||| || |||||
Sbjct: 1338 gatgactccaacagcaaccgtctgcctcatgtcgcggacggc 1297

---

>gb|AF136823.1|AF136823 Zea mays clone a elongation factor 1 alpha mRNA, complete cds
          Length = 1600

 Score = 87.7 bits (44), Expect = 8e-15
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  ||| |||||||| |||| ||| ||||| ||||||||||||| ||| | |||
Sbjct: 1409 cttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccacactctt 1350

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| ||||||||||| || |||||||| || |||||
Sbjct: 1349 gatgactccaacagcaaccgtctgcctcatgtcgcggacggc 1308

---

>gb|AY109326.1| Zea mays CL1256_1 mRNA sequence
          Length = 2360

 Score = 87.7 bits (44), Expect = 8e-15
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  ||| |||||||| |||| ||| ||||| ||||||||||||| ||| | |||
Sbjct: 2026 cttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccacactctt 1967

                                                      
Query: 103  gatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| ||||||||||| || |||||||| || |||||
Sbjct: 1966 gatgactccaacagcaaccgtctgcctcatgtcgcggacggc 1925

---

>emb|AJ222579.1|VFEF1A Vicia faba mRNA for elongation factor 1-alpha (EF1-a)
          Length = 1599

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 73/83 (87%)
 Strand = Plus / Minus

                                                                        
Query: 53   gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
            ||||| ||||| |||| ||| || || ||||||||||||| ||| | |||||||||||||
Sbjct: 1369 gcagctttggtgaccttggctccagttgggtccttcttctccacactcttgatgactccg 1310

                                   
Query: 113  acagcaaccgtttgtctcatgtc 135
            |||||||| ||||||||||||||
Sbjct: 1309 acagcaacagtttgtctcatgtc 1287

---

>gb|AF281361.1| Saccharum officinarum elongation factor mRNA, complete cds
          Length = 1745

 Score = 85.7 bits (43), Expect = 3e-14
 Identities = 73/83 (87%)
 Strand = Plus / Minus

                                                                        
Query: 53   gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
            ||||||||||| |||| ||| ||||| ||||||||||||| ||| | |||||||| ||| 
Sbjct: 1431 gcagccttggtcaccttggcgccggtcgggtccttcttctccacactcttgatgattcca 1372

                                   
Query: 113  acagcaaccgtttgtctcatgtc 135
            |||||||||||||| ||||||||
Sbjct: 1371 acagcaaccgtttgcctcatgtc 1349

---

>gb|BT016242.1| Zea mays clone Contig75 mRNA sequence
          Length = 1421

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                        
Query: 55   agccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccgac 114
            ||||||||| |||| ||| || || ||||||||||||| ||| | |||||||||||||||
Sbjct: 1179 agccttggtcaccttggctccagttgggtccttcttctccacactcttgatgactccgac 1120

                                 
Query: 115  agcaaccgtttgtctcatgtc 135
            ||| |||||||| ||||||||
Sbjct: 1119 agccaccgtttgcctcatgtc 1099

---

>emb|X96555.1|PSEF1ALPH P.sativum mRNA for elongation factor 1-alpha
          Length = 1670

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                        
Query: 59   ttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccgacagca 118
            ||||| |||| ||| || || ||||||||||||| ||| | |||||||||||||||||||
Sbjct: 1425 ttggtgaccttggctccagttgggtccttcttctccacactcttgatgactccgacagca 1366

                             
Query: 119  accgtttgtctcatgtc 135
            || ||||||||||||||
Sbjct: 1365 acagtttgtctcatgtc 1349

---

>gb|AF136825.1|AF136825 Zea mays clone c elongation factor 1 alpha mRNA, complete cds
          Length = 1609

 Score = 81.8 bits (41), Expect = 5e-13
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                        
Query: 53   gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
            |||||||| || |||| ||| || || ||||||||||||| ||| | |||||||||||||
Sbjct: 1404 gcagccttcgtcaccttggctccagttgggtccttcttctccacactcttgatgactccg 1345

                                            
Query: 113  acagcaaccgtttgtctcatgtcncgcacggc 144
            ||||| |||||||| |||||||| || |||||
Sbjct: 1344 acagccaccgtttgcctcatgtcacggacggc 1313

---

>gb|BT016889.1| Zea mays clone Contig722 mRNA sequence
          Length = 930

 Score = 79.8 bits (40), Expect = 2e-12
 Identities = 70/80 (87%)
 Strand = Plus / Plus

                                                                       
Query: 56  gccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccgaca 115
           ||||||||||||| ||| ||||| ||||||||||||| ||| | |||||||||||| |||
Sbjct: 318 gccttggtaaccttggcgccggtcgggtccttcttctccacactcttgatgactccaaca 377

                               
Query: 116 gcaaccgtttgtctcatgtc 135
           ||||| || || ||||||||
Sbjct: 378 gcaactgtctgcctcatgtc 397

---

>gb|BT016514.1| Zea mays clone Contig347 mRNA sequence
          Length = 1687

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                        
Query: 53   gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
            ||||||||||| |||| ||| ||||| ||||||||||||| ||| | |||||| ||||| 
Sbjct: 1408 gcagccttggtcaccttggcgccggttgggtccttcttctccacactcttgataactcca 1349

                                   
Query: 113  acagcaaccgtttgtctcatgtc 135
            ||||||||||| || ||||||||
Sbjct: 1348 acagcaaccgtctgcctcatgtc 1326

---

>gb|BT016827.1| Zea mays clone Contig660 mRNA sequence
          Length = 1780

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                        
Query: 53   gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
            |||||||| || |||| ||| || || ||||||||||||| ||| | |||||||||||||
Sbjct: 1461 gcagccttcgtcaccttggctccagttgggtccttcttctccacactcttgatgactccg 1402

                                   
Query: 113  acagcaaccgtttgtctcatgtc 135
            ||||| |||||||| ||||||||
Sbjct: 1401 acagccaccgtttgcctcatgtc 1379

---

>gb|BT009129.1| Triticum aestivum clone wl1n.pk0027.f4:fis, full insert mRNA sequence
          Length = 2565

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                        
Query: 53   gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
            |||||||| || |||| ||| || || ||||||||||||| ||| | |||||||||||||
Sbjct: 2383 gcagccttcgtcaccttggctccagttgggtccttcttctccacactcttgatgactccg 2324

                                   
Query: 113  acagcaaccgtttgtctcatgtc 135
            ||||| |||||||| ||||||||
Sbjct: 2323 acagccaccgtttgcctcatgtc 2301

---

>gb|AY039764.1| Sinapis arvensis elongation factor-1 alpha mRNA, partial cds
          Length = 523

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 80/94 (85%)
 Strand = Plus / Minus

                                                                       
Query: 42  ccttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccct 101
           ||||||||  |||||||||||| |||| ||| ||||| ||||||||||| | ||||| ||
Sbjct: 259 ccttcttgacggcagccttggtcaccttggctccggttgggtccttcttgtccacgctct 200

                                             
Query: 102 tgatgactccgacagcaaccgtttgtctcatgtc 135
           ||||||| ||||| ||||| || || ||||||||
Sbjct: 199 tgatgacaccgactgcaacagtctgcctcatgtc 166

---

>dbj|D45408.1|MZEEF1A Zea mays elongation factor 1alpha gene, complete cds
          Length = 3062

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                        
Query: 53   gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
            |||||||| || |||| ||| || || ||||||||||||| ||| | |||||||||||||
Sbjct: 2694 gcagccttcgtcaccttggctccagttgggtccttcttctccacactcttgatgactccg 2635

                                   
Query: 113  acagcaaccgtttgtctcatgtc 135
            ||||| |||||||| ||||||||
Sbjct: 2634 acagccaccgtttgcctcatgtc 2612

---

>gb|U76259.1|ZMU76259 Zea mays elongation factor 1-alpha (EF1-A) mRNA, complete cds
          Length = 1692

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                        
Query: 53   gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
            |||||||| || |||| ||| || || ||||||||||||| ||| | |||||||||||||
Sbjct: 1461 gcagccttcgtcaccttggctccagttgggtccttcttctccacactcttgatgactccg 1402

                                   
Query: 113  acagcaaccgtttgtctcatgtc 135
            ||||| |||||||| ||||||||
Sbjct: 1401 acagccaccgtttgcctcatgtc 1379

---

>dbj|D45407.1|MZEEF1AA Corn mRNA for elongation factor 1A
          Length = 1519

 Score = 77.8 bits (39), Expect = 8e-12
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                        
Query: 53   gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
            |||||||| || |||| ||| || || ||||||||||||| ||| | |||||||||||||
Sbjct: 1312 gcagccttcgtcaccttggctccagttgggtccttcttctccacactcttgatgactccg 1253

                                   
Query: 113  acagcaaccgtttgtctcatgtc 135
            ||||| |||||||| ||||||||
Sbjct: 1252 acagccaccgtttgcctcatgtc 1230

---

>gb|AF136829.1|AF136829 Zea mays clone g elongation factor 1 alpha mRNA, complete cds
          Length = 1592

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  ||| |||||||| |||| ||| ||||| ||||||||||||| ||| | |||
Sbjct: 1438 cttcttggcggccgccttggtcaccttggcgccggtcgggtccttcttctccacactctt 1379

                                             
Query: 103  gatgactccgacagcaaccgtttgtctcatgtc 135
            ||||||||| |||||||| || || ||||||||
Sbjct: 1378 gatgactccaacagcaactgtctgcctcatgtc 1346

---

>dbj|D12709.1|DARELF1A Daucus carota mRNA for elongation factor 1-alpha, complete cds
          Length = 1700

 Score = 75.8 bits (38), Expect = 3e-11
 Identities = 79/93 (84%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            ||||||| | ||||||||||| |||| ||| ||||| || |||||||||| ||| | |||
Sbjct: 1371 cttcttgattgcagccttggtgaccttggctccggtaggatccttcttctccacactctt 1312

                                             
Query: 103  gatgactccgacagcaaccgtttgtctcatgtc 135
            ||||||||| |||||||| || || ||||||||
Sbjct: 1311 gatgactcccacagcaacagtctgcctcatgtc 1279

---

>gb|AY205999.1| Malva pusilla translation elongation factor-1 alpha mRNA, partial cds
          Length = 1320

 Score = 69.9 bits (35), Expect = 2e-09
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                        
Query: 53   gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
            ||||||||||| | || ||||||||| ||||| |||||||  || | ||||||||| || 
Sbjct: 1189 gcagccttggtgatcttggcaccggttgggtctttcttctcaacactcttgatgacacca 1130

                                   
Query: 113  acagcaaccgtttgtctcatgtc 135
            |||||||| ||||||||||||||
Sbjct: 1129 acagcaacagtttgtctcatgtc 1107

---

>emb|CR719965.2|CNS0GIGZ Tetraodon nigroviridis full-length cDNA
          Length = 1758

 Score = 67.9 bits (34), Expect = 8e-09
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| ||||||||||||||||| |||||||| ||||||||
Sbjct: 1392 cttgatgacgccgacagcaaccgtttgcctcatgtcgcgcacggc 1348

---

>emb|CR699788.2|CNS0G2WO Tetraodon nigroviridis full-length cDNA
          Length = 1628

 Score = 67.9 bits (34), Expect = 8e-09
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| ||||||||||||||||| |||||||| ||||||||
Sbjct: 1258 cttgatgacgccgacagcaaccgtttgcctcatgtcgcgcacggc 1214

---

>emb|CR698727.2|CNS0G237 Tetraodon nigroviridis full-length cDNA
          Length = 1352

 Score = 67.9 bits (34), Expect = 8e-09
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| ||||||||||||||||| |||||||| ||||||||
Sbjct: 993 cttgatgacaccgacagcaaccgtttgcctcatgtcgcgcacggc 949

---

>emb|CR696581.1|CNS0G0FL Tetraodon nigroviridis full-length cDNA
          Length = 1729

 Score = 67.9 bits (34), Expect = 8e-09
 Identities = 42/45 (93%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| ||||||||||||||||| |||||||| ||||||||
Sbjct: 1376 cttgatgacgccgacagcaaccgtttggctcatgtcgcgcacggc 1332

---

>gb|AF136827.1|AF136827 Zea mays clone e elongation factor 1 alpha mRNA, complete cds
          Length = 1606

 Score = 67.9 bits (34), Expect = 8e-09
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                        
Query: 43   cttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccctt 102
            |||||||  ||| |||||||| |||| ||| ||||| ||||||||||||| ||| | |||
Sbjct: 1426 cttcttggcggccgccttggtcaccttggcgccggttgggtccttcttctccacactctt 1367

                                             
Query: 103  gatgactccgacagcaaccgtttgtctcatgtc 135
            ||| || ||||| |||||||| || ||||||||
Sbjct: 1366 gatcacgccgactgcaaccgtctgcctcatgtc 1334

---

>dbj|AB073631.1| Salsola komarovii skef-1A mRNA for eukaryotic elongation factor  1A,
            complete cds
          Length = 1646

 Score = 67.9 bits (34), Expect = 8e-09
 Identities = 78/93 (83%)
 Strand = Plus / Minus

                                                                        
Query: 52   ggcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactcc 111
            |||||||||||| |||| |||||| || |||||||||||||  ||   ||||||||| ||
Sbjct: 1351 ggcagccttggtgaccttggcaccagttgggtccttcttctcaacattcttgatgacacc 1292

                                             
Query: 112  gacagcaaccgtttgtctcatgtcncgcacggc 144
             |||||||| ||||| |||||||| | ||||||
Sbjct: 1291 aacagcaacagtttgcctcatgtccctcacggc 1259

---

>gb|DQ057979.1| Musa acuminata elongation factor-1 alpha mRNA, complete cds
          Length = 1644

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                        
Query: 59   ttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccgacagca 118
            |||||||||| ||| |||||||| |||||||||| |||||  ||||| || || || |||
Sbjct: 1408 ttggtaaccttggctccggtgggatccttcttctccacgcttttgataacacccacggca 1349

                             
Query: 119  accgtttgtctcatgtc 135
            ||||| |||||||||||
Sbjct: 1348 accgtctgtctcatgtc 1332

---

>emb|X56856.1|GMTEFS1 G.max tefS1 gene for elongation factor EF-1a
          Length = 1979

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                        
Query: 52   ggcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactcc 111
            |||||||||||| |||| ||| ||||| || ||||||||||  |||  ||||||||||||
Sbjct: 1894 ggcagccttggtgaccttggctccggtaggatccttcttctcaacgttcttgatgactcc 1835

                                    
Query: 112  gacagcaaccgtttgtctcatgtc 135
             |||||||| ||||| | ||||||
Sbjct: 1834 cacagcaacagtttgacgcatgtc 1811

---

>gb|AY946009.1| Actinidia deliciosa elongation factor 1 alpha mRNA, complete cds
          Length = 1738

 Score = 63.9 bits (32), Expect = 1e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                    
Query: 53   gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgac 108
            ||||||||||| |||| ||||||||| || |||||||||| ||||| |||||||||
Sbjct: 1425 gcagccttggtgaccttggcaccggtcggatccttcttctccacgctcttgatgac 1370

---

>gb|AY550990.1| Elaeis guineensis elongation factor 1-alpha 1 (EF1-a1) mRNA, complete
            cds
          Length = 1623

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 70/83 (84%)
 Strand = Plus / Minus

                                                                        
Query: 53   gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
            |||| |||||| |||| ||||||  | |||||||||||||  || | |||||||||||| 
Sbjct: 1401 gcagacttggtgaccttggcaccactagggtccttcttctcaacactcttgatgactccc 1342

                                   
Query: 113  acagcaaccgtttgtctcatgtc 135
            ||||| ||||| |||||||||||
Sbjct: 1341 acagccaccgtctgtctcatgtc 1319

---

>ref|NM_100666.2| Arabidopsis thaliana calmodulin binding / translation elongation
            factor AT1G07920 mRNA, complete cds
          Length = 1782

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                        
Query: 42   ccttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccct 101
            ||||||||  ||||||||||||||||| ||| ||||| ||||||||||| |  || | ||
Sbjct: 1451 ccttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactct 1392

                                              
Query: 102  tgatgactccgacagcaaccgtttgtctcatgtc 135
            |||| || ||||| ||||| || || ||||||||
Sbjct: 1391 tgataacaccgactgcaacagtctgcctcatgtc 1358

---

>gb|AY651886.1| Glycine max elongation factor 1A SMV resistance-related protein
           mRNA, partial cds
          Length = 965

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                       
Query: 52  ggcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactcc 111
           |||||||||||| |||| ||| || || || |||||||||| ||||  ||||||||||||
Sbjct: 567 ggcagccttggtgaccttggctccagtaggatccttcttctccacgttcttgatgactcc 508

                          
Query: 112 gacagcaaccgtttg 126
            |||||||| |||||
Sbjct: 507 cacagcaacagtttg 493

---

>gb|AF479046.1| Triticum aestivum elongation factor-1 alpha mRNA, partial cds
          Length = 432

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 74/89 (83%)
 Strand = Plus / Minus

                                                                       
Query: 53  gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
           ||||||||||| |||| ||| ||||| || ||||| |||| |||| ||||||| || || 
Sbjct: 416 gcagccttggtcaccttggcgccggtcggatccttnttctccacggccttgataacgccc 357

                                        
Query: 113 acagcaaccgtttgtctcatgtcncgcac 141
           || |||||||| || |||||||| |||||
Sbjct: 356 accgcaaccgtctgcctcatgtcacgcac 328

---

>emb|X16431.1|ATEF1A23 A.thaliana A2 and A3 genes encoding elongation factor 1-alpha
          Length = 6022

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                        
Query: 42   ccttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccct 101
            ||||||||  ||||||||||||||||| ||| ||||| ||||||||||| |  || | ||
Sbjct: 1911 ccttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactct 1852

                                              
Query: 102  tgatgactccgacagcaaccgtttgtctcatgtc 135
            |||| || ||||| ||||| || || ||||||||
Sbjct: 1851 tgataacaccgactgcaacagtctgcctcatgtc 1818



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                        
Query: 53   gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
            |||||||||||||||| ||| ||||| ||||||||||| |  || | |||||| || |||
Sbjct: 5331 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 5272

                                   
Query: 113  acagcaaccgtttgtctcatgtc 135
            || ||||| || || ||||||||
Sbjct: 5271 actgcaacagtctgcctcatgtc 5249

---

>dbj|AK221085.1| Arabidopsis thaliana mRNA for elongation factor 1-alpha, complete
           cds, clone: RAFL22-81-H15
          Length = 630

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                       
Query: 42  ccttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccct 101
           ||||||||  ||||||||||||||||| ||| ||||| ||||||||||| |  || | ||
Sbjct: 359 ccttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactct 300

                                             
Query: 102 tgatgactccgacagcaaccgtttgtctcatgtc 135
           |||| || ||||| ||||| || || ||||||||
Sbjct: 299 tgataacaccgactgcaacagtctgcctcatgtc 266

---

>gb|AY088358.1| Arabidopsis thaliana clone 6135 mRNA, complete sequence
          Length = 1687

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                        
Query: 42   ccttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccct 101
            ||||||||  ||||||||||||||||| ||| ||||| ||||||||||| |  || | ||
Sbjct: 1420 ccttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactct 1361

                                              
Query: 102  tgatgactccgacagcaaccgtttgtctcatgtc 135
            |||| || ||||| ||||| || || ||||||||
Sbjct: 1360 tgataacaccgactgcaacagtctgcctcatgtc 1327

---

>gb|BT002442.1| Arabidopsis thaliana elongation factor 1-alpha (At1g07940) mRNA,
            complete cds
          Length = 1704

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                        
Query: 42   ccttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccct 101
            ||||||||  ||||||||||||||||| ||| ||||| ||||||||||| |  || | ||
Sbjct: 1419 ccttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactct 1360

                                              
Query: 102  tgatgactccgacagcaaccgtttgtctcatgtc 135
            |||| || ||||| ||||| || || ||||||||
Sbjct: 1359 tgataacaccgactgcaacagtctgcctcatgtc 1326

---

>gb|BT002423.1| Arabidopsis thaliana elongation factor 1-alpha (At1g07920) mRNA,
            complete cds
          Length = 1664

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                        
Query: 42   ccttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccct 101
            ||||||||  ||||||||||||||||| ||| ||||| ||||||||||| |  || | ||
Sbjct: 1419 ccttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactct 1360

                                              
Query: 102  tgatgactccgacagcaaccgtttgtctcatgtc 135
            |||| || ||||| ||||| || || ||||||||
Sbjct: 1359 tgataacaccgactgcaacagtctgcctcatgtc 1326

---

>gb|AC026875.4|AC026875 Genomic sequence for Arabidopsis thaliana BAC T6D22 from chromosome I,
             complete sequence
          Length = 120965

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                         
Query: 42    ccttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccct 101
             ||||||||  ||||||||||||||||| ||| ||||| ||||||||||| |  || | ||
Sbjct: 12885 ccttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactct 12826

                                               
Query: 102   tgatgactccgacagcaaccgtttgtctcatgtc 135
             |||| || ||||| ||||| || || ||||||||
Sbjct: 12825 tgataacaccgactgcaacagtctgcctcatgtc 12792



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 69/83 (83%)
 Strand = Plus / Minus

                                                                         
Query: 53    gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
             |||||||||||||||| ||| ||||| ||||||||||| |  || | |||||| || |||
Sbjct: 16331 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 16272

                                    
Query: 113   acagcaaccgtttgtctcatgtc 135
             || ||||| || || ||||||||
Sbjct: 16271 actgcaacagtctgcctcatgtc 16249



 Score = 46.1 bits (23), Expect = 0.028
 Identities = 68/83 (81%)
 Strand = Plus / Plus

                                                                         
Query: 53    gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
             |||||||||||||||| ||| || || ||||||||||| |  || | |||||| || |||
Sbjct: 19267 gcagccttggtaaccttggctccagttgggtccttcttgtcaacactcttgataacaccg 19326

                                    
Query: 113   acagcaaccgtttgtctcatgtc 135
             || ||||| || || ||||||||
Sbjct: 19327 actgcaacagtctgcctcatgtc 19349

---

>emb|CT010481.8| M.truncatula DNA sequence from clone MTH2-62G7 on chromosome 3,
             complete sequence
          Length = 113400

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 70/83 (84%)
 Strand = Plus / Plus

                                                                         
Query: 53    gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
             ||||||||||| |||| ||| ||||| || |||||||||| |||  |||||||||| || 
Sbjct: 72737 gcagccttggtgaccttggctccggtaggatccttcttctccacagccttgatgacacca 72796

                                    
Query: 113   acagcaaccgtttgtctcatgtc 135
             |||||||| ||||| | ||||||
Sbjct: 72797 acagcaacagtttgacgcatgtc 72819

---

>gb|U63815.1|ATU63815 Arabidopsis thaliana AT.I.24-1, AT.I.24-2, AT.I.24-3, AT.I.24-4,
             AT.I.24-5, AT.I.24-6, AT.I.24-9 and AT.I.24-14 genes,
             partial cds, AT.I.24-7, ascorbate peroxidase (ATHAPX1),
             EF-1alpha-A1, -A2 and -A3 (EF-1alpha) and AT.I.24-13
             genes, complete cds
          Length = 63093

 Score = 61.9 bits (31), Expect = 5e-07
 Identities = 78/94 (82%)
 Strand = Plus / Plus

                                                                         
Query: 42    ccttcttgntggcagccttggtaacctgggcaccggtggggtccttcttctgcacgccct 101
             ||||||||  ||||||||||||||||| ||| ||||| ||||||||||| |  || | ||
Sbjct: 47827 ccttcttgacggcagccttggtaaccttggctccggttgggtccttcttgtcaacactct 47886

                                               
Query: 102   tgatgactccgacagcaaccgtttgtctcatgtc 135
             |||| || ||||| ||||| || || ||||||||
Sbjct: 47887 tgataacaccgactgcaacagtctgcctcatgtc 47920



 Score = 54.0 bits (27), Expect = 1e-04
 Identities = 69/83 (83%)
 Strand = Plus / Plus

                                                                         
Query: 53    gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
             |||||||||||||||| ||| ||||| ||||||||||| |  || | |||||| || |||
Sbjct: 44398 gcagccttggtaaccttggctccggttgggtccttcttgtcaacactcttgataacaccg 44457

                                    
Query: 113   acagcaaccgtttgtctcatgtc 135
             || ||||| || || ||||||||
Sbjct: 44458 actgcaacagtctgcctcatgtc 44480



 Score = 46.1 bits (23), Expect = 0.028
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                         
Query: 53    gcagccttggtaacctgggcaccggtggggtccttcttctgcacgcccttgatgactccg 112
             |||||||||||||||| ||| || || ||||||||||| |  || | |||||| || |||
Sbjct: 41457 gcagccttggtaaccttggctccagttgggtccttcttgtcaacactcttgataacaccg 41398

                                    
Query: 113   acagcaaccgtttgtctcatgtc 135
             || ||||| || || ||||||||
Sbjct: 41397 actgcaacagtctgcctcatgtc 41375

---

>emb|CR734901.2|CNS0GTTW Tetraodon nigroviridis full-length cDNA
          Length = 1759

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1395 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1351

---

>emb|CR734626.2|CNS0GTM9 Tetraodon nigroviridis full-length cDNA
          Length = 502

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 135 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 91

---

>emb|CR734524.2|CNS0GTJF Tetraodon nigroviridis full-length cDNA
          Length = 1762

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1391 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1347

---

>emb|CR734377.2|CNS0GTFC Tetraodon nigroviridis full-length cDNA
          Length = 1760

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1393 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1349

---

>emb|CR733536.2|CNS0GSRZ Tetraodon nigroviridis full-length cDNA
          Length = 1002

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 633 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 589

---

>emb|CR732462.2|CNS0GS43 Tetraodon nigroviridis full-length cDNA
          Length = 1694

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1334 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1290

---

>emb|CR731974.2|CNS0GRQJ Tetraodon nigroviridis full-length cDNA
          Length = 1761

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1394 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1350

---

>emb|CR731790.1|CNS0GRLF Tetraodon nigroviridis full-length cDNA
          Length = 1731

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1376 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1332

---

>emb|CR731605.2|CNS0GRGA Tetraodon nigroviridis full-length cDNA
          Length = 1745

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1383 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1339

---

>emb|CR731362.2|CNS0GR9J Tetraodon nigroviridis full-length cDNA
          Length = 1100

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 733 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 689

---

>emb|CR731103.2|CNS0GR2C Tetraodon nigroviridis full-length cDNA
          Length = 1758

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1392 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1348

---

>emb|CR730766.2|CNS0GQSZ Tetraodon nigroviridis full-length cDNA
          Length = 1048

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 681 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 637

---

>emb|CR730432.2|CNS0GQJP Tetraodon nigroviridis full-length cDNA
          Length = 1106

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 739 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 695

---

>emb|CR730309.2|CNS0GQGA Tetraodon nigroviridis full-length cDNA
          Length = 1664

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1333 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1289

---

>emb|CR730105.2|CNS0GQAN Tetraodon nigroviridis full-length cDNA
          Length = 1755

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1392 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1348

---

>emb|CR730060.1|CNS0GQ9E Tetraodon nigroviridis full-length cDNA
          Length = 1749

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1386 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1342

---

>emb|CR728405.1|CNS0GOZF Tetraodon nigroviridis full-length cDNA
          Length = 1734

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1371 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1327

---

>emb|CR728311.1|CNS0GOWT Tetraodon nigroviridis full-length cDNA
          Length = 1713

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1377 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1333

---

>emb|CR727943.2|CNS0GOML Tetraodon nigroviridis full-length cDNA
          Length = 1706

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1367 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1323

---

>emb|CR727829.2|CNS0GOJF Tetraodon nigroviridis full-length cDNA
          Length = 1689

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1329 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1285

---

>emb|CR727751.2|CNS0GOH9 Tetraodon nigroviridis full-length cDNA
          Length = 1049

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 682 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 638

---

>emb|CR727869.1|CNS0GOKJ Tetraodon nigroviridis full-length cDNA
          Length = 1704

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1372 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1328

---

>emb|CR727445.2|CNS0GO8R Tetraodon nigroviridis full-length cDNA
          Length = 1692

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1340 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1296

---

>emb|CR727347.1|CNS0GO61 Tetraodon nigroviridis full-length cDNA
          Length = 1737

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1380 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1336

---

>emb|CR726763.2|CNS0GNPT Tetraodon nigroviridis full-length cDNA
          Length = 1676

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1312 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1268

---

>emb|CR725992.2|CNS0GN4E Tetraodon nigroviridis full-length cDNA
          Length = 1763

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1394 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1350

---

>emb|CR725687.2|CNS0GMVX Tetraodon nigroviridis full-length cDNA
          Length = 1064

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 697 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 653

---

>emb|CR725610.2|CNS0GMTS Tetraodon nigroviridis full-length cDNA
          Length = 1747

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1390 cttgatgaccccgacagcaaccgtctgcctcatgtcgcgcacggc 1346

---

>emb|CR725478.2|CNS0GMQ4 Tetraodon nigroviridis full-length cDNA
          Length = 1057

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 690 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 646

---

>emb|CR720171.2|CNS0GIMP Tetraodon nigroviridis full-length cDNA
          Length = 1759

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1392 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1348

---

>emb|CR724326.1|CNS0GLU4 Tetraodon nigroviridis full-length cDNA
          Length = 1748

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1385 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1341

---

>emb|CR724083.1|CNS0GLND Tetraodon nigroviridis full-length cDNA
          Length = 1727

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1376 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1332

---

>emb|CR724080.1|CNS0GLNA Tetraodon nigroviridis full-length cDNA
          Length = 1756

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1385 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1341

---

>emb|CR724835.1|CNS0GM89 Tetraodon nigroviridis full-length cDNA
          Length = 1722

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1385 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1341

---

>emb|CR724462.2|CNS0GLXW Tetraodon nigroviridis full-length cDNA
          Length = 1731

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1380 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1336

---

>emb|CR724413.2|CNS0GLWJ Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 888 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 844

---

>emb|CR724387.2|CNS0GLVT Tetraodon nigroviridis full-length cDNA
          Length = 1762

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1394 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1350

---

>emb|CR724386.2|CNS0GLVS Tetraodon nigroviridis full-length cDNA
          Length = 1534

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1177 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1133

---

>emb|CR724160.2|CNS0GLPI Tetraodon nigroviridis full-length cDNA
          Length = 1106

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 738 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 694

---

>emb|CR723301.2|CNS0GL1N Tetraodon nigroviridis full-length cDNA
          Length = 1719

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1387 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1343

---

>emb|CR722538.2|CNS0GKGG Tetraodon nigroviridis full-length cDNA
          Length = 1758

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1391 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1347

---

>emb|CR721923.2|CNS0GJZD Tetraodon nigroviridis full-length cDNA
          Length = 1758

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1392 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1348

---

>emb|CR721618.2|CNS0GJQW Tetraodon nigroviridis full-length cDNA
          Length = 732

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 365 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 321

---

>emb|CR720504.2|CNS0GIVY Tetraodon nigroviridis full-length cDNA
          Length = 1202

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 836 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 792

---

>emb|CR719534.2|CNS0GI50 Tetraodon nigroviridis full-length cDNA
          Length = 1333

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 966 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 922

---

>emb|CR714097.2|CNS0GDY5 Tetraodon nigroviridis full-length cDNA
          Length = 539

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 172 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 128

---

>emb|CR713922.2|CNS0GDTA Tetraodon nigroviridis full-length cDNA
          Length = 1758

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1392 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 1348

---

>emb|CR713766.2|CNS0GDOY Tetraodon nigroviridis full-length cDNA
          Length = 421

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 54  cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 10

---

>emb|CR713230.2|CNS0GDA2 Tetraodon nigroviridis full-length cDNA
          Length = 540

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 173 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 129

---

>emb|CR708676.2|CNS0G9RK Tetraodon nigroviridis full-length cDNA
          Length = 539

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 172 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 128

---

>emb|CR707980.2|CNS0G988 Tetraodon nigroviridis full-length cDNA
          Length = 540

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 173 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 129

---

>emb|CR707258.2|CNS0G8O6 Tetraodon nigroviridis full-length cDNA
          Length = 540

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 173 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 129

---

>emb|CR704503.2|CNS0G6JN Tetraodon nigroviridis full-length cDNA
          Length = 1730

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1380 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 1336

---

>emb|CR704481.2|CNS0G6J1 Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 887 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 843

---

>emb|CR704033.2|CNS0G66L Tetraodon nigroviridis full-length cDNA
          Length = 1041

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 674 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 630

---

>emb|CR703833.2|CNS0G611 Tetraodon nigroviridis full-length cDNA
          Length = 1181

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 820 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 776

---

>emb|CR703295.2|CNS0G5M3 Tetraodon nigroviridis full-length cDNA
          Length = 1751

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1381 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1337

---

>emb|CR703157.2|CNS0G5I9 Tetraodon nigroviridis full-length cDNA
          Length = 1760

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1394 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1350

---

>emb|CR702997.2|CNS0G5DT Tetraodon nigroviridis full-length cDNA
          Length = 1627

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1284 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1240

---

>emb|CR701841.2|CNS0G4HP Tetraodon nigroviridis full-length cDNA
          Length = 1515

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1167 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1123

---

>emb|CR701796.2|CNS0G4GG Tetraodon nigroviridis full-length cDNA
          Length = 1755

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1392 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 1348

---

>emb|CR701487.2|CNS0G47V Tetraodon nigroviridis full-length cDNA
          Length = 1741

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1381 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1337

---

>emb|CR701472.2|CNS0G47G Tetraodon nigroviridis full-length cDNA
          Length = 1735

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1380 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1336

---

>emb|CR701403.2|CNS0G45J Tetraodon nigroviridis full-length cDNA
          Length = 1013

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 645 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 601

---

>emb|CR700378.2|CNS0G3D2 Tetraodon nigroviridis full-length cDNA
          Length = 1755

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1393 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1349

---

>emb|CR700019.2|CNS0G333 Tetraodon nigroviridis full-length cDNA
          Length = 1223

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 871 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 827

---

>emb|CR700084.1|CNS0G34W Tetraodon nigroviridis full-length cDNA
          Length = 1728

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1379 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1335

---

>emb|CR699578.2|CNS0G2QU Tetraodon nigroviridis full-length cDNA
          Length = 1629

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1278 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1234

---

>emb|CR699560.2|CNS0G2QC Tetraodon nigroviridis full-length cDNA
          Length = 1001

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 653 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 609

---

>emb|CR699497.2|CNS0G2OL Tetraodon nigroviridis full-length cDNA
          Length = 1414

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1064 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1020

---

>emb|CR699169.2|CNS0G2FH Tetraodon nigroviridis full-length cDNA
          Length = 1722

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1383 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1339

---

>emb|CR698914.2|CNS0G28E Tetraodon nigroviridis full-length cDNA
          Length = 1271

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 918 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 874

---

>emb|CR698505.2|CNS0G1X1 Tetraodon nigroviridis full-length cDNA
          Length = 1653

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1307 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1263

---

>emb|CR698373.2|CNS0G1TD Tetraodon nigroviridis full-length cDNA
          Length = 1395

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1033 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 989

---

>emb|CR698030.2|CNS0G1JU Tetraodon nigroviridis full-length cDNA
          Length = 1465

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1101 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1057

---

>emb|CR697861.2|CNS0G1F5 Tetraodon nigroviridis full-length cDNA
          Length = 1761

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1394 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1350

---

>emb|CR697619.2|CNS0G18F Tetraodon nigroviridis full-length cDNA
          Length = 1753

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1392 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1348

---

>emb|CR697637.1|CNS0G18X Tetraodon nigroviridis full-length cDNA
          Length = 1752

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1392 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 1348

---

>emb|CR697628.1|CNS0G18O Tetraodon nigroviridis full-length cDNA
          Length = 867

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 524 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 480

---

>emb|CR696999.2|CNS0G0R7 Tetraodon nigroviridis full-length cDNA
          Length = 1739

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1380 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1336

---

>emb|CR696989.2|CNS0G0QX Tetraodon nigroviridis full-length cDNA
          Length = 1736

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1382 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1338

---

>emb|CR696612.2|CNS0G0GG Tetraodon nigroviridis full-length cDNA
          Length = 1751

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1392 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1348

---

>emb|CR696165.2|CNS0G041 Tetraodon nigroviridis full-length cDNA
          Length = 1691

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1323 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 1279

---

>emb|CR692336.1|CNS0FX5O Tetraodon nigroviridis full-length cDNA
          Length = 1727

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1381 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1337

---

>emb|CR695246.2|CNS0FZEI Tetraodon nigroviridis full-length cDNA
          Length = 905

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 538 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 494

---

>emb|CR695245.1|CNS0FZEH Tetraodon nigroviridis full-length cDNA
          Length = 1699

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1360 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1316

---

>emb|CR695160.2|CNS0FZC4 Tetraodon nigroviridis full-length cDNA
          Length = 1005

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 638 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 594

---

>emb|CR695132.2|CNS0FZBC Tetraodon nigroviridis full-length cDNA
          Length = 1633

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1327 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1283

---

>emb|CR694916.2|CNS0FZ5C Tetraodon nigroviridis full-length cDNA
          Length = 1674

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1330 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1286

---

>emb|CR694474.2|CNS0FYT2 Tetraodon nigroviridis full-length cDNA
          Length = 1747

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1384 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1340

---

>emb|CR694079.2|CNS0FYI3 Tetraodon nigroviridis full-length cDNA
          Length = 1144

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 781 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 737

---

>emb|CR693876.2|CNS0FYCG Tetraodon nigroviridis full-length cDNA
          Length = 1653

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1290 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1246

---

>emb|CR693709.2|CNS0FY7T Tetraodon nigroviridis full-length cDNA
          Length = 1193

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 837 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 793

---

>emb|CR693435.2|CNS0FY07 Tetraodon nigroviridis full-length cDNA
          Length = 401

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 54  cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 10

---

>emb|CR692728.2|CNS0FXGK Tetraodon nigroviridis full-length cDNA
          Length = 1377

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1030 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 986

---

>emb|CR692433.2|CNS0FX8D Tetraodon nigroviridis full-length cDNA
          Length = 970

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 645 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 601

---

>emb|CR692428.2|CNS0FX88 Tetraodon nigroviridis full-length cDNA
          Length = 1759

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1393 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1349

---

>emb|CR692211.2|CNS0FX27 Tetraodon nigroviridis full-length cDNA
          Length = 1762

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1395 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1351

---

>emb|CR691919.2|CNS0FWU3 Tetraodon nigroviridis full-length cDNA
          Length = 1731

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1380 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1336

---

>emb|CR691626.2|CNS0FWLY Tetraodon nigroviridis full-length cDNA
          Length = 1762

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1395 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1351

---

>emb|CR691678.1|CNS0FWNE Tetraodon nigroviridis full-length cDNA
          Length = 1739

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1381 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1337

---

>emb|CR691578.2|CNS0FWKM Tetraodon nigroviridis full-length cDNA
          Length = 1763

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1395 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 1351

---

>emb|CR685858.2|CNS0FS5Q Tetraodon nigroviridis full-length cDNA
          Length = 1018

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 651 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 607

---

>emb|CR690842.2|CNS0FW06 Tetraodon nigroviridis full-length cDNA
          Length = 1748

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1388 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1344

---

>emb|CR690415.2|CNS0FVOB Tetraodon nigroviridis full-length cDNA
          Length = 1668

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1337 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1293

---

>emb|CR690370.2|CNS0FVN2 Tetraodon nigroviridis full-length cDNA
          Length = 1680

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1374 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1330

---

>emb|CR688428.2|CNS0FU54 Tetraodon nigroviridis full-length cDNA
          Length = 1303

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 938 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 894

---

>emb|CR689688.2|CNS0FV44 Tetraodon nigroviridis full-length cDNA
          Length = 1739

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1384 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1340

---

>emb|CR690027.1|CNS0FVDJ Tetraodon nigroviridis full-length cDNA
          Length = 1728

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1382 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1338

---

>emb|CR689401.2|CNS0FUW5 Tetraodon nigroviridis full-length cDNA
          Length = 1761

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1394 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1350

---

>emb|CR689274.2|CNS0FUSM Tetraodon nigroviridis full-length cDNA
          Length = 458

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 91  cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 47

---

>emb|CR688857.2|CNS0FUH1 Tetraodon nigroviridis full-length cDNA
          Length = 557

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 189 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 145

---

>emb|CR688856.2|CNS0FUH0 Tetraodon nigroviridis full-length cDNA
          Length = 953

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 636 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 592

---

>emb|CR688537.2|CNS0FU85 Tetraodon nigroviridis full-length cDNA
          Length = 1011

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 644 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 600

---

>emb|CR687875.2|CNS0FTPR Tetraodon nigroviridis full-length cDNA
          Length = 1739

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1379 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1335

---

>emb|CR687838.2|CNS0FTOQ Tetraodon nigroviridis full-length cDNA
          Length = 418

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 51  cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 7

---

>emb|CR687834.2|CNS0FTOM Tetraodon nigroviridis full-length cDNA
          Length = 1491

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1187 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1143

---

>emb|CR687115.2|CNS0FT4N Tetraodon nigroviridis full-length cDNA
          Length = 1129

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 767 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 723

---

>emb|CR686564.2|CNS0FSPC Tetraodon nigroviridis full-length cDNA
          Length = 1617

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1262 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1218

---

>emb|CR686557.1|CNS0FSP5 Tetraodon nigroviridis full-length cDNA
          Length = 1732

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1381 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1337

---

>emb|CR686411.2|CNS0FSL3 Tetraodon nigroviridis full-length cDNA
          Length = 1747

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1396 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1352

---

>emb|CR685533.2|CNS0FRWP Tetraodon nigroviridis full-length cDNA
          Length = 1724

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1377 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1333

---

>emb|CR685287.2|CNS0FRPV Tetraodon nigroviridis full-length cDNA
          Length = 1782

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1446 cttgatgacaccgacagcaaccgtctgcctcatgtcgcgcacggc 1402

---

>emb|CR684943.1|CNS0FRGB Tetraodon nigroviridis full-length cDNA
          Length = 1751

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1392 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1348

---

>emb|CR684789.2|CNS0FRC1 Tetraodon nigroviridis full-length cDNA
          Length = 1759

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1392 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1348

---

>emb|CR684645.1|CNS0FR81 Tetraodon nigroviridis full-length cDNA
          Length = 1734

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1383 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1339

---

>emb|CR681941.2|CNS0FP4X Tetraodon nigroviridis full-length cDNA
          Length = 1654

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1293 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1249

---

>emb|CR684345.2|CNS0FQZP Tetraodon nigroviridis full-length cDNA
          Length = 1752

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1385 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1341

---

>emb|CR683276.2|CNS0FQ60 Tetraodon nigroviridis full-length cDNA
          Length = 1766

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1399 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1355

---

>emb|CR683059.2|CNS0FPZZ Tetraodon nigroviridis full-length cDNA
          Length = 1708

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1379 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1335

---

>emb|CR682336.1|CNS0FPFW Tetraodon nigroviridis full-length cDNA
          Length = 1515

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1163 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1119

---

>emb|CR681800.2|CNS0FP10 Tetraodon nigroviridis full-length cDNA
          Length = 1743

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1392 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1348

---

>emb|CR678878.2|CNS0FMRU Tetraodon nigroviridis full-length cDNA
          Length = 1728

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1380 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1336

---

>emb|CR678958.2|CNS0FMU2 Tetraodon nigroviridis full-length cDNA
          Length = 1742

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1383 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1339

---

>emb|CR676177.2|CNS0FKP9 Tetraodon nigroviridis full-length cDNA
          Length = 1758

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1391 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1347

---

>emb|CR675956.1|CNS0FKJE Tetraodon nigroviridis full-length cDNA
          Length = 1744

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1385 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1341

---

>emb|CR674355.1|CNS0FJAX Tetraodon nigroviridis full-length cDNA
          Length = 1730

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1383 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1339

---

>emb|CR659722.2|CNS0F80G Tetraodon nigroviridis full-length cDNA
          Length = 984

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 617 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 573

---

>emb|CR659458.1|CNS0F7T4 Tetraodon nigroviridis full-length cDNA
          Length = 1756

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1392 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1348

---

>emb|CR656391.1|CNS0F5FX Tetraodon nigroviridis full-length cDNA
          Length = 1750

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1387 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1343

---

>emb|CR656143.2|CNS0F591 Tetraodon nigroviridis full-length cDNA
          Length = 1745

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1381 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1337

---

>emb|CR656125.1|CNS0F58J Tetraodon nigroviridis full-length cDNA
          Length = 1812

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1465 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1421

---

>emb|CR653724.2|CNS0F3DU Tetraodon nigroviridis full-length cDNA
          Length = 1760

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1392 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1348

---

>emb|CR653058.2|CNS0F2VC Tetraodon nigroviridis full-length cDNA
          Length = 1715

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1371 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1327

---

>emb|CR652429.2|CNS0F2DV Tetraodon nigroviridis full-length cDNA
          Length = 1730

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1377 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1333

---

>emb|CR653091.1|CNS0F2W9 Tetraodon nigroviridis full-length cDNA
          Length = 1738

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1383 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1339

---

>emb|CR652612.2|CNS0F2IY Tetraodon nigroviridis full-length cDNA
          Length = 1727

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1377 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1333

---

>emb|CR650146.1|CNS0F0MG Tetraodon nigroviridis full-length cDNA
          Length = 1443

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1097 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1053

---

>emb|CR648965.2|CNS0EZPN Tetraodon nigroviridis full-length cDNA
          Length = 1720

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1371 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1327

---

>emb|CR648222.2|CNS0EZ50 Tetraodon nigroviridis full-length cDNA
          Length = 1225

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 877 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 833

---

>emb|CR647116.2|CNS0EYAA Tetraodon nigroviridis full-length cDNA
          Length = 1733

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1374 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1330

---

>emb|CR647392.2|CNS0EYHY Tetraodon nigroviridis full-length cDNA
          Length = 1434

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1076 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1032

---

>emb|CR647290.2|CNS0EYF4 Tetraodon nigroviridis full-length cDNA
          Length = 524

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 157 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 113

---

>emb|CR647286.2|CNS0EYF0 Tetraodon nigroviridis full-length cDNA
          Length = 1538

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1177 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1133

---

>emb|CR645791.2|CNS0EX9H Tetraodon nigroviridis full-length cDNA
          Length = 972

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 605 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 561

---

>emb|CR645306.3|CNS0EWW0 Tetraodon nigroviridis full-length cDNA
          Length = 597

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 239 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 195

---

>emb|CR644587.2|CNS0EWC1 Tetraodon nigroviridis full-length cDNA
          Length = 1543

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1175 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1131

---

>emb|CR644549.2|CNS0EWAZ Tetraodon nigroviridis full-length cDNA
          Length = 1735

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1379 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1335

---

>emb|CR644872.2|CNS0EWJY Tetraodon nigroviridis full-length cDNA
          Length = 1698

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1341 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1297

---

>emb|CR644329.2|CNS0EW4V Tetraodon nigroviridis full-length cDNA
          Length = 1227

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 877 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 833

---

>emb|CR643685.2|CNS0EVMZ Tetraodon nigroviridis full-length cDNA
          Length = 1332

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 968 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 924

---

>emb|CR642053.2|CNS0EUDN Tetraodon nigroviridis full-length cDNA
          Length = 1759

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1393 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1349

---

>emb|CR641514.2|CNS0ETYO Tetraodon nigroviridis full-length cDNA
          Length = 1686

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1340 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1296

---

>emb|CR641101.1|CNS0ETN7 Tetraodon nigroviridis full-length cDNA
          Length = 1744

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1390 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1346

---

>emb|CR640927.2|CNS0ETID Tetraodon nigroviridis full-length cDNA
          Length = 1702

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1340 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1296

---

>emb|CR639709.3|CNS0ESKJ Tetraodon nigroviridis full-length cDNA
          Length = 1272

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 905 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 861

---

>emb|CR639763.2|CNS0ESM1 Tetraodon nigroviridis full-length cDNA
          Length = 1760

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1393 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1349

---

>emb|CR638352.2|CNS0ERIU Tetraodon nigroviridis full-length cDNA
          Length = 998

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 290 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 246

---

>emb|CR638243.1|CNS0ERFT Tetraodon nigroviridis full-length cDNA
          Length = 1712

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1378 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1334

---

>emb|CR636980.2|CNS0EQGQ Tetraodon nigroviridis full-length cDNA
          Length = 1013

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 100 cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
           ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 645 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 601

---

>emb|CR636487.2|CNS0EQ31 Tetraodon nigroviridis full-length cDNA
          Length = 1737

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1386 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1342

---

>emb|CR636278.2|CNS0EPX8 Tetraodon nigroviridis full-length cDNA
          Length = 1703

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1378 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1334

---

>emb|CR635593.1|CNS0EPE7 Tetraodon nigroviridis full-length cDNA
          Length = 1743

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1385 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1341

---

>emb|CR636202.1|CNS0EPV4 Tetraodon nigroviridis full-length cDNA
          Length = 1755

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1392 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1348

---

>emb|CR635580.2|CNS0EPDU Tetraodon nigroviridis full-length cDNA
          Length = 1730

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                         
Query: 100  cttgatgactccgacagcaaccgtttgtctcatgtcncgcacggc 144
            ||||||||| |||||||||||||| || |||||||| ||||||||
Sbjct: 1383 cttgatgacgccgacagcaaccgtctgcctcatgtcgcgcacggc 1339


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 503,778
Number of Sequences: 3902068
Number of extensions: 503778
Number of successful extensions: 30070
Number of sequences better than 10.0: 578
Number of HSP's better than 10.0 without gapping: 579
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 29356
Number of HSP's gapped (non-prelim): 712
length of query: 144
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 123
effective length of database: 17,151,101,840
effective search space: 2109585526320
effective search space used: 2109585526320
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)

---