ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd17d03 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|D38091.1|WHTPH2AE Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-10 Length = 691 Score = 454 bits (229), Expect = e-124 Identities = 362/403 (89%), Gaps = 20/403 (4%) Strand = Plus / Minus Query: 38 caacgaattacagaggatgtaaccattgtccacacctagtttagcaccggtacaagcaca 97 |||||||||||| |||||| ||||||||||||| ||||||||||||||||||||||||| Sbjct: 683 caacgaattacaaaggatgcaaccattgtccacggctagtttagcaccggtacaagcaca 624 Query: 98 cagattcattcagaaactaatac--gtactac--tcctag---taaaacgcaacacctag 150 |||||||| |||||||||| ||||||| |||||| ||||||||||||||||| Sbjct: 623 cagattca----gaaactaatagcagtactaccatcctagaagtaaaacgcaacacctag 568 Query: 151 gcaacacttgactgcagacgctactacacaga------tacagccgagcacccacgacca 204 |||||| || |||| | ||||||||||||||| |||||||||||||||||||||| Sbjct: 567 gcaacatttaactgaacacgctactacacagaactggatacagccgagcacccacgacca 508 Query: 205 ccgagaaggagccgtcatctagctatcgtcatcggcagccgcggccttggcgctgcctcc 264 ||||| ||||| |||||||||||||||||| ||||||||| |||||||| ||||| || Sbjct: 507 ccgaggaggagtcgtcatctagctatcgtcgtcggcagccacggccttg---ctgccacc 451 Query: 265 ggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgt 324 |||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| Sbjct: 450 ggccttcttggggagcaggaggttgtggatgttgggcatgacaccaccgctggcgattgt 391 Query: 325 gaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcg 384 |||||| |||||||||||||||||||||||||||||||||||||| |||||||| || || Sbjct: 390 gaccatgccgagcaggcgggagagctcctcgtcgttgcggacggcgagctggatgtggcg 331 Query: 385 cggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 427 ||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 330 cggcacgatgcgggtcttcttgttgtccctcgccgcgttcccg 288
>dbj|D38089.1|WHTPH2AC Triticum aestivum mRNA for protein H2A, complete cds, clone wcH2A-4 Length = 725 Score = 416 bits (210), Expect = e-113 Identities = 280/303 (92%), Gaps = 9/303 (2%) Strand = Plus / Minus Query: 131 tagtaaaacgcaacacctaggcaacacttgactgcagacgctactacacaga------ta 184 ||||||||||||||||||||||||||||| |||| | ||||||||||||||| || Sbjct: 585 tagtaaaacgcaacacctaggcaacacttaactgaacacgctactacacagaactggata 526 Query: 185 cagccgagcacccacgaccaccgagaaggagccgtcatctagctatcgtcatcggcagcc 244 ||||||||||||||||||| | ||| ||||| |||||||||||||||||| ||||||||| Sbjct: 525 cagccgagcacccacgacctcagaggaggagtcgtcatctagctatcgtcgtcggcagcc 466 Query: 245 gcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttgggcatg 304 |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 465 acggccttg---ctgcctccggccttcttggggagcagaaggttgtggatgttgggcatg 409 Query: 305 acaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgttgcgg 364 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct: 408 acaccgccgctggcgattgtgaccatgccgagcaggcgggagagctcctcgtcgttgcgg 349 Query: 365 acggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggcgttc 424 ||||| |||||||| || ||||||||||||||||||||||||||||||||||| |||||| Sbjct: 348 acggcgagctggatgtggcgcggcacgatgcgggtcttcttgttgtccctcgccgcgttc 289 Query: 425 ccg 427 ||| Sbjct: 288 ccg 286 Score = 143 bits (72), Expect = 5e-31 Identities = 78/80 (97%) Strand = Plus / Minus Query: 26 tatagaacgtagcaacgaattacagaggatgtaaccattgtccacacctagtttagcacc 85 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | Sbjct: 696 tatagaacatagcaacgaattacagaggatgtaaccattgtccacacctagtttagcatc 637 Query: 86 ggtacaagcacacagattca 105 |||||||||||||||||||| Sbjct: 636 ggtacaagcacacagattca 617
>ref|XM_478633.1| Oryza sativa (japonica cultivar-group), mRNA Length = 830 Score = 250 bits (126), Expect = 3e-63 Identities = 171/186 (91%) Strand = Plus / Minus Query: 242 gccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttgggc 301 ||||| |||||||||||||| ||||||||||||||||| || |||||||||||||||||| Sbjct: 544 gccgccgccttggcgctgccgccggccttcttggggaggagcaggttgtggatgttgggc 485 Query: 302 atgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgttg 361 ||||| || |||||||||||||||||| | |||||||||||||| ||||||||||||||| Sbjct: 484 atgacgcctccgctggcgattgtgaccgtgccgagcaggcgggatagctcctcgtcgttg 425 Query: 362 cggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggcg 421 |||||||| |||||||| || || ||||| |||||||||||||||||||||||||| ||| Sbjct: 424 cggacggcgagctggatgtggcggggcactatgcgggtcttcttgttgtccctcgccgcg 365 Query: 422 ttcccg 427 |||||| Sbjct: 364 ttcccg 359
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 250 bits (126), Expect = 3e-63 Identities = 171/186 (91%) Strand = Plus / Minus Query: 242 gccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttgggc 301 ||||| |||||||||||||| ||||||||||||||||| || |||||||||||||||||| Sbjct: 21539692 gccgccgccttggcgctgccgccggccttcttggggaggagcaggttgtggatgttgggc 21539633 Query: 302 atgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgttg 361 ||||| || |||||||||||||||||| | |||||||||||||| ||||||||||||||| Sbjct: 21539632 atgacgcctccgctggcgattgtgaccgtgccgagcaggcgggatagctcctcgtcgttg 21539573 Query: 362 cggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggcg 421 |||||||| |||||||| || || ||||| |||||||||||||||||||||||||| ||| Sbjct: 21539572 cggacggcgagctggatgtggcggggcactatgcgggtcttcttgttgtccctcgccgcg 21539513 Query: 422 ttcccg 427 |||||| Sbjct: 21539512 ttcccg 21539507 Score = 129 bits (65), Expect = 8e-27 Identities = 140/165 (84%) Strand = Plus / Minus Query: 263 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 322 ||||||||||||||||| || | | ||||||||||||||| || |||||||||||||| Sbjct: 21537032 ccggccttcttggggaggaggtgctggtggatgttgggcatcacgccgccgctggcgatg 21536973 Query: 323 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 382 ||| | |||||||| || | ||||||||||||||| || || |||||||| || Sbjct: 21536972 gtggcgccgccgagcagcttggtcaactcctcgtcgttgcgcaccgcgagctggatgtgg 21536913 Query: 383 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 427 ||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 21536912 cgcggcacgatgcgggtcttcttgttgtccctcgccgcgttcccg 21536868
>dbj|AP003838.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1582_D10 Length = 103475 Score = 250 bits (126), Expect = 3e-63 Identities = 171/186 (91%) Strand = Plus / Minus Query: 242 gccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttgggc 301 ||||| |||||||||||||| ||||||||||||||||| || |||||||||||||||||| Sbjct: 77476 gccgccgccttggcgctgccgccggccttcttggggaggagcaggttgtggatgttgggc 77417 Query: 302 atgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgttg 361 ||||| || |||||||||||||||||| | |||||||||||||| ||||||||||||||| Sbjct: 77416 atgacgcctccgctggcgattgtgaccgtgccgagcaggcgggatagctcctcgtcgttg 77357 Query: 362 cggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggcg 421 |||||||| |||||||| || || ||||| |||||||||||||||||||||||||| ||| Sbjct: 77356 cggacggcgagctggatgtggcggggcactatgcgggtcttcttgttgtccctcgccgcg 77297 Query: 422 ttcccg 427 |||||| Sbjct: 77296 ttcccg 77291 Score = 129 bits (65), Expect = 8e-27 Identities = 140/165 (84%) Strand = Plus / Minus Query: 263 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 322 ||||||||||||||||| || | | ||||||||||||||| || |||||||||||||| Sbjct: 74816 ccggccttcttggggaggaggtgctggtggatgttgggcatcacgccgccgctggcgatg 74757 Query: 323 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 382 ||| | |||||||| || | ||||||||||||||| || || |||||||| || Sbjct: 74756 gtggcgccgccgagcagcttggtcaactcctcgtcgttgcgcaccgcgagctggatgtgg 74697 Query: 383 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 427 ||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 74696 cgcggcacgatgcgggtcttcttgttgtccctcgccgcgttcccg 74652
>dbj|AK059228.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-024-D11, full insert sequence Length = 830 Score = 250 bits (126), Expect = 3e-63 Identities = 171/186 (91%) Strand = Plus / Minus Query: 242 gccgcggccttggcgctgcctccggccttcttggggagcagaaggttgtggatgttgggc 301 ||||| |||||||||||||| ||||||||||||||||| || |||||||||||||||||| Sbjct: 544 gccgccgccttggcgctgccgccggccttcttggggaggagcaggttgtggatgttgggc 485 Query: 302 atgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgtcgttg 361 ||||| || |||||||||||||||||| | |||||||||||||| ||||||||||||||| Sbjct: 484 atgacgcctccgctggcgattgtgaccgtgccgagcaggcgggatagctcctcgtcgttg 425 Query: 362 cggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcgcggcg 421 |||||||| |||||||| || || ||||| |||||||||||||||||||||||||| ||| Sbjct: 424 cggacggcgagctggatgtggcggggcactatgcgggtcttcttgttgtccctcgccgcg 365 Query: 422 ttcccg 427 |||||| Sbjct: 364 ttcccg 359
>ref|XM_482492.1| Oryza sativa (japonica cultivar-group), mRNA Length = 405 Score = 186 bits (94), Expect = 4e-44 Identities = 172/198 (86%) Strand = Plus / Minus Query: 230 tcgtcatcggcagccgcggccttggcgctgcctccggccttcttggggagcagaaggttg 289 ||||| ||||| || ||||||||||||||| ||||||||||||||||| || |||||| Sbjct: 401 tcgtcgtcggcggcggcggccttggcgctggagccggccttcttggggaggagcaggttg 342 Query: 290 tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 349 ||||||||||||||||| |||||| ||||||| ||||| ||||||||||| || ||| Sbjct: 341 tggatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagc 282 Query: 350 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 409 |||||||||||||| ||||| |||||||| || | ||||||||| || |||||||||||| Sbjct: 281 tcctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttg 222 Query: 410 tccctcgcggcgttcccg 427 |||| ||| ||||||||| Sbjct: 221 tcccgcgccgcgttcccg 204
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 186 bits (94), Expect = 4e-44 Identities = 172/198 (86%) Strand = Plus / Minus Query: 230 tcgtcatcggcagccgcggccttggcgctgcctccggccttcttggggagcagaaggttg 289 ||||| ||||| || ||||||||||||||| ||||||||||||||||| || |||||| Sbjct: 20566557 tcgtcgtcggcggcggcggccttggcgctggagccggccttcttggggaggagcaggttg 20566498 Query: 290 tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 349 ||||||||||||||||| |||||| ||||||| ||||| ||||||||||| || ||| Sbjct: 20566497 tggatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagc 20566438 Query: 350 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 409 |||||||||||||| ||||| |||||||| || | ||||||||| || |||||||||||| Sbjct: 20566437 tcctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttg 20566378 Query: 410 tccctcgcggcgttcccg 427 |||| ||| ||||||||| Sbjct: 20566377 tcccgcgccgcgttcccg 20566360 Score = 40.1 bits (20), Expect = 5.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 118 tacgtactactcctagtaaa 137 |||||||||||||||||||| Sbjct: 3543090 tacgtactactcctagtaaa 3543109
>dbj|AP005734.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBb0032E15 Length = 120419 Score = 186 bits (94), Expect = 4e-44 Identities = 172/198 (86%) Strand = Plus / Minus Query: 230 tcgtcatcggcagccgcggccttggcgctgcctccggccttcttggggagcagaaggttg 289 ||||| ||||| || ||||||||||||||| ||||||||||||||||| || |||||| Sbjct: 70518 tcgtcgtcggcggcggcggccttggcgctggagccggccttcttggggaggagcaggttg 70459 Query: 290 tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 349 ||||||||||||||||| |||||| ||||||| ||||| ||||||||||| || ||| Sbjct: 70458 tggatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagc 70399 Query: 350 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 409 |||||||||||||| ||||| |||||||| || | ||||||||| || |||||||||||| Sbjct: 70398 tcctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttg 70339 Query: 410 tccctcgcggcgttcccg 427 |||| ||| ||||||||| Sbjct: 70338 tcccgcgccgcgttcccg 70321
>dbj|AP003898.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1663_D06 Length = 139103 Score = 186 bits (94), Expect = 4e-44 Identities = 172/198 (86%) Strand = Plus / Minus Query: 230 tcgtcatcggcagccgcggccttggcgctgcctccggccttcttggggagcagaaggttg 289 ||||| ||||| || ||||||||||||||| ||||||||||||||||| || |||||| Sbjct: 40929 tcgtcgtcggcggcggcggccttggcgctggagccggccttcttggggaggagcaggttg 40870 Query: 290 tggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagc 349 ||||||||||||||||| |||||| ||||||| ||||| ||||||||||| || ||| Sbjct: 40869 tggatgttgggcatgacgccgccgttggcgatggtgacggcgccgagcaggcgcgacagc 40810 Query: 350 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 409 |||||||||||||| ||||| |||||||| || | ||||||||| || |||||||||||| Sbjct: 40809 tcctcgtcgttgcgcacggcgagctggatgtgcctcggcacgatccgcgtcttcttgttg 40750 Query: 410 tccctcgcggcgttcccg 427 |||| ||| ||||||||| Sbjct: 40749 tcccgcgccgcgttcccg 40732
>gb|AY108339.1| Zea mays PCO070432 mRNA sequence Length = 811 Score = 176 bits (89), Expect = 4e-41 Identities = 166/191 (86%), Gaps = 3/191 (1%) Strand = Plus / Minus Query: 240 cagccgcggccttggcgctgcctccggc---cttcttggggagcagaaggttgtggatgt 296 ||||||| |||||||| ||||| ||| | ||||||||| | ||| ||||| ||||||| Sbjct: 504 cagccgcagccttggcactgccgccgccagacttcttgggcaacagcaggttatggatgt 445 Query: 297 tgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgt 356 ||||||||||||| ||||||||||| || ||| | || |||| ||||||||||||||||| Sbjct: 444 tgggcatgacaccaccgctggcgatggtcaccgtgcccagcaagcgggagagctcctcgt 385 Query: 357 cgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtccctcg 416 ||||||||||||| |||||||| || ||||| ||||||||||||||||||||||||| | Sbjct: 384 cgttgcggacggcgagctggatgtggcgcgggacgatgcgggtcttcttgttgtcccgag 325 Query: 417 cggcgttcccg 427 | ||||||||| Sbjct: 324 ccgcgttcccg 314
>gb|AY104637.1| Zea mays PCO070433 mRNA sequence Length = 767 Score = 168 bits (85), Expect = 9e-39 Identities = 153/175 (87%), Gaps = 3/175 (1%) Strand = Plus / Minus Query: 240 cagccgcggccttggcgctgcctccg---gccttcttggggagcagaaggttgtggatgt 296 ||||||| |||||||||||||| ||| |||||||| ||||| || ||||| ||||||| Sbjct: 504 cagccgcagccttggcgctgccgccgccggccttcttcgggagaagcaggttatggatgt 445 Query: 297 tgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagagctcctcgt 356 ||||||||||||| ||||| ||||| || ||| | || |||| |||||||||||| |||| Sbjct: 444 tgggcatgacaccaccgctagcgatggtcaccgtgcccagcaagcgggagagctcttcgt 385 Query: 357 cgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttgtc 411 ||||||||||||| |||||||| || ||||| ||||||||||||||||||||||| Sbjct: 384 cgttgcggacggcgagctggatgtggcgcggtacgatgcgggtcttcttgttgtc 330
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 145 bits (73), Expect = 1e-31 Identities = 142/165 (86%) Strand = Plus / Plus Query: 263 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 322 ||||||||||||||||| || | | |||||||||||||||||| |||||||||||||| Sbjct: 14468520 ccggccttcttggggaggaggtgctggtggatgttgggcatgacgccgccgctggcgatg 14468579 Query: 323 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 382 ||| | |||||||| || |||||||||||||||||| || || |||||||| || Sbjct: 14468580 gtggcgccgccgagcagcttggtgagctcctcgtcgttgcgcaccgcgagctggatgtgg 14468639 Query: 383 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 427 |||||||| |||||||||||||||||||||||||| ||||||||| Sbjct: 14468640 cgcggcacaatgcgggtcttcttgttgtccctcgccgcgttcccg 14468684 Score = 87.7 bits (44), Expect = 3e-14 Identities = 71/80 (88%) Strand = Plus / Plus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||| || || |||||||| || | ||||||||| ||| |||||||| Sbjct: 20924512 agctcctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttg 20924571 Query: 407 ttgtccctcgcggcgttccc 426 ||||||||||| |||||||| Sbjct: 20924572 ttgtccctcgccgcgttccc 20924591
>dbj|AK071511.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023096P04, full insert sequence Length = 824 Score = 145 bits (73), Expect = 1e-31 Identities = 142/165 (86%) Strand = Plus / Minus Query: 263 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 322 ||||||||||||||||| || | | |||||||||||||||||| |||||||||||||| Sbjct: 483 ccggccttcttggggaggaggtgctggtggatgttgggcatgacgccgccgctggcgatg 424 Query: 323 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 382 ||| | |||||||| || |||||||||||||||||| || || |||||||| || Sbjct: 423 gtggcgccgccgagcagcttggtgagctcctcgtcgttgcgcaccgcgagctggatgtgg 364 Query: 383 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 427 |||||||| |||||||||||||||||||||||||| ||||||||| Sbjct: 363 cgcggcacaatgcgggtcttcttgttgtccctcgccgcgttcccg 319
>dbj|AK058913.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-009-A01, full insert sequence Length = 733 Score = 145 bits (73), Expect = 1e-31 Identities = 142/165 (86%) Strand = Plus / Minus Query: 263 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 322 ||||||||||||||||| || | | |||||||||||||||||| |||||||||||||| Sbjct: 482 ccggccttcttggggaggaggtgctggtggatgttgggcatgacgccgccgctggcgatg 423 Query: 323 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 382 ||| | |||||||| || |||||||||||||||||| || || |||||||| || Sbjct: 422 gtggcgccgccgagcagcttggtgagctcctcgtcgttgcgcaccgcgagctggatgtgg 363 Query: 383 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 427 |||||||| |||||||||||||||||||||||||| ||||||||| Sbjct: 362 cgcggcacaatgcgggtcttcttgttgtccctcgccgcgttcccg 318
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 145 bits (73), Expect = 1e-31 Identities = 142/165 (86%) Strand = Plus / Plus Query: 263 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 322 ||||||||||||||||| || | | |||||||||||||||||| |||||||||||||| Sbjct: 14422804 ccggccttcttggggaggaggtgctggtggatgttgggcatgacgccgccgctggcgatg 14422863 Query: 323 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 382 ||| | |||||||| || |||||||||||||||||| || || |||||||| || Sbjct: 14422864 gtggcgccgccgagcagcttggtgagctcctcgtcgttgcgcaccgcgagctggatgtgg 14422923 Query: 383 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 427 |||||||| |||||||||||||||||||||||||| ||||||||| Sbjct: 14422924 cgcggcacaatgcgggtcttcttgttgtccctcgccgcgttcccg 14422968 Score = 87.7 bits (44), Expect = 3e-14 Identities = 71/80 (88%) Strand = Plus / Plus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||| || || |||||||| || | ||||||||| ||| |||||||| Sbjct: 20850726 agctcctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttg 20850785 Query: 407 ttgtccctcgcggcgttccc 426 ||||||||||| |||||||| Sbjct: 20850786 ttgtccctcgccgcgttccc 20850805
>emb|AL731753.2|CNS08C82 Oryza sativa chromosome 12, . BAC OJ1112_B07 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118101 Score = 145 bits (73), Expect = 1e-31 Identities = 142/165 (86%) Strand = Plus / Minus Query: 263 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 322 ||||||||||||||||| || | | |||||||||||||||||| |||||||||||||| Sbjct: 48772 ccggccttcttggggaggaggtgctggtggatgttgggcatgacgccgccgctggcgatg 48713 Query: 323 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 382 ||| | |||||||| || |||||||||||||||||| || || |||||||| || Sbjct: 48712 gtggcgccgccgagcagcttggtgagctcctcgtcgttgcgcaccgcgagctggatgtgg 48653 Query: 383 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 427 |||||||| |||||||||||||||||||||||||| ||||||||| Sbjct: 48652 cgcggcacaatgcgggtcttcttgttgtccctcgccgcgttcccg 48608
>ref|XM_478632.1| Oryza sativa (japonica cultivar-group), mRNA Length = 823 Score = 129 bits (65), Expect = 8e-27 Identities = 140/165 (84%) Strand = Plus / Minus Query: 263 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 322 ||||||||||||||||| || | | ||||||||||||||| || |||||||||||||| Sbjct: 517 ccggccttcttggggaggaggtgctggtggatgttgggcatcacgccgccgctggcgatg 458 Query: 323 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 382 ||| | |||||||| || | ||||||||||||||| || || |||||||| || Sbjct: 457 gtggcgccgccgagcagcttggtcaactcctcgtcgttgcgcaccgcgagctggatgtgg 398 Query: 383 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 427 ||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 397 cgcggcacgatgcgggtcttcttgttgtccctcgccgcgttcccg 353
>dbj|AK099888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013112I10, full insert sequence Length = 823 Score = 129 bits (65), Expect = 8e-27 Identities = 140/165 (84%) Strand = Plus / Minus Query: 263 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 322 ||||||||||||||||| || | | ||||||||||||||| || |||||||||||||| Sbjct: 517 ccggccttcttggggaggaggtgctggtggatgttgggcatcacgccgccgctggcgatg 458 Query: 323 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 382 ||| | |||||||| || | ||||||||||||||| || || |||||||| || Sbjct: 457 gtggcgccgccgagcagcttggtcaactcctcgtcgttgcgcaccgcgagctggatgtgg 398 Query: 383 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 427 ||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 397 cgcggcacgatgcgggtcttcttgttgtccctcgccgcgttcccg 353
>dbj|AK058540.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-017-B06, full insert sequence Length = 1718 Score = 129 bits (65), Expect = 8e-27 Identities = 140/165 (84%) Strand = Plus / Minus Query: 263 ccggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgatt 322 ||||||||||||||||| || | | ||||||||||||||| || |||||||||||||| Sbjct: 518 ccggccttcttggggaggaggtgctggtggatgttgggcatcacgccgccgctggcgatg 459 Query: 323 gtgaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgt 382 ||| | |||||||| || | ||||||||||||||| || || |||||||| || Sbjct: 458 gtggcgccgccgagcagcttggtcaactcctcgtcgttgcgcaccgcgagctggatgtgg 399 Query: 383 cgcggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 427 ||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 398 cgcggcacgatgcgggtcttcttgttgtccctcgccgcgttcccg 354
>gb|AY104828.1| Zea mays PCO072413 mRNA sequence Length = 741 Score = 123 bits (62), Expect = 5e-25 Identities = 137/162 (84%) Strand = Plus / Minus Query: 266 gccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgtg 325 |||||||||||||||||| | | |||||||| ||||| ||||| ||||| ||||| ||| Sbjct: 422 gccttcttggggagcagatgctgatggatgttaggcataacacctccgctcgcgatggtg 363 Query: 326 accataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcgc 385 | ||| | ||| || ||||||||||||||||| || ||||||||||| || ||| Sbjct: 362 gcaccacccaacagtttggtcagctcctcgtcgttgcgcacagcaagctggatgtggcgc 303 Query: 386 ggcacgatgcgggtcttcttgttgtccctcgcggcgttcccg 427 ||||| |||||||||||||||||||||||||||||||||||| Sbjct: 302 ggcacaatgcgggtcttcttgttgtccctcgcggcgttcccg 261
>gb|AY104826.1| Zea mays PCO099353 mRNA sequence Length = 793 Score = 121 bits (61), Expect = 2e-24 Identities = 136/161 (84%) Strand = Plus / Minus Query: 266 gccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgtg 325 |||||||||||||| || | | ||||||||||||||| || |||||||| ||||| ||| Sbjct: 464 gccttcttggggaggaggtgctggtggatgttgggcataacgccgccgctcgcgatggtg 405 Query: 326 accataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcgc 385 | ||| ||||| || ||||||||||||||||| ||||| |||||||| || ||| Sbjct: 404 gcaccaccaagcagcttggtcagctcctcgtcgttgcgcacggcgagctggatgtgacgc 345 Query: 386 ggcacgatgcgggtcttcttgttgtccctcgcggcgttccc 426 ||||||||||||||||||||||| |||||||| |||||||| Sbjct: 344 ggcacgatgcgggtcttcttgttatccctcgctgcgttccc 304
>emb|X94693.1|TAH2A254 T.aestivum histone H2A gene Length = 2241 Score = 117 bits (59), Expect = 3e-23 Identities = 134/159 (84%) Strand = Plus / Minus Query: 265 ggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgt 324 ||||||||||||||| || | | ||||||||||||||| ||||||||||||||||| || Sbjct: 1734 ggccttcttggggaggaggtgctggtggatgttgggcatcacaccgccgctggcgatggt 1675 Query: 325 gaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcg 384 | | ||||||| || ||||||||||| ||||| ||||| |||||||| || || Sbjct: 1674 ggcgccgccgagcaacttggtcagctcctcgtcattgcgcacggcgagctggatgtggcg 1615 Query: 385 cggcacgatgcgggtcttcttgttgtccctcgcggcgtt 423 ||||||||| |||||||||||||||||||| |||||||| Sbjct: 1614 cggcacgatacgggtcttcttgttgtccctggcggcgtt 1576
>gb|L75824.1|WHTHIH2AA Triticum aestivum histone H2A gene, complete cds Length = 2241 Score = 117 bits (59), Expect = 3e-23 Identities = 134/159 (84%) Strand = Plus / Minus Query: 265 ggccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgt 324 ||||||||||||||| || | | ||||||||||||||| ||||||||||||||||| || Sbjct: 1734 ggccttcttggggaggaggtgctggtggatgttgggcatcacaccgccgctggcgatggt 1675 Query: 325 gaccataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcg 384 | | ||||||| || ||||||||||| ||||| ||||| |||||||| || || Sbjct: 1674 ggcgccgccgagcaacttggtcagctcctcgtcattgcgcacggcgagctggatgtggcg 1615 Query: 385 cggcacgatgcgggtcttcttgttgtccctcgcggcgtt 423 ||||||||| |||||||||||||||||||| |||||||| Sbjct: 1614 cggcacgatacgggtcttcttgttgtccctggcggcgtt 1576
>gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome 3, BAC clone OSJNBa0031O09, complete sequence Length = 161339 Score = 89.7 bits (45), Expect = 7e-15 Identities = 72/81 (88%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||| || || |||||||| || ||||||||||| | | |||||||| Sbjct: 38405 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 38346 Query: 407 ttgtccctcgcggcgttcccg 427 ||||||||||| ||||||||| Sbjct: 38345 ttgtccctcgccgcgttcccg 38325
>gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone B1154F06 map near C10769, complete sequence Length = 194856 Score = 89.7 bits (45), Expect = 7e-15 Identities = 72/81 (88%) Strand = Plus / Plus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||| || || |||||||| || ||||||||||| | | |||||||| Sbjct: 141027 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 141086 Query: 407 ttgtccctcgcggcgttcccg 427 ||||||||||| ||||||||| Sbjct: 141087 ttgtccctcgccgcgttcccg 141107
>gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic sequence, complete sequence Length = 184366 Score = 89.7 bits (45), Expect = 7e-15 Identities = 72/81 (88%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||| || || |||||||| || ||||||||||| | | |||||||| Sbjct: 181559 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 181500 Query: 407 ttgtccctcgcggcgttcccg 427 ||||||||||| ||||||||| Sbjct: 181499 ttgtccctcgccgcgttcccg 181479
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 89.7 bits (45), Expect = 7e-15 Identities = 72/81 (88%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||| || || |||||||| || ||||||||||| | | |||||||| Sbjct: 28998264 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 28998205 Query: 407 ttgtccctcgcggcgttcccg 427 ||||||||||| ||||||||| Sbjct: 28998204 ttgtccctcgccgcgttcccg 28998184 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 399 tcttcttgttgtccctcgcggcgttcccg 427 |||||||||||||||| || ||||||||| Sbjct: 9471354 tcttcttgttgtccctggccgcgttcccg 9471382
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 89.7 bits (45), Expect = 7e-15 Identities = 72/81 (88%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||| || || |||||||| || ||||||||||| | | |||||||| Sbjct: 29089686 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 29089627 Query: 407 ttgtccctcgcggcgttcccg 427 ||||||||||| ||||||||| Sbjct: 29089626 ttgtccctcgccgcgttcccg 29089606 Score = 42.1 bits (21), Expect = 1.5 Identities = 27/29 (93%) Strand = Plus / Plus Query: 399 tcttcttgttgtccctcgcggcgttcccg 427 |||||||||||||||| || ||||||||| Sbjct: 9469475 tcttcttgttgtccctggccgcgttcccg 9469503
>dbj|AK064299.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-107-A07, full insert sequence Length = 724 Score = 89.7 bits (45), Expect = 7e-15 Identities = 72/81 (88%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||| || || |||||||| || ||||||||||| | | |||||||| Sbjct: 397 agctcctcgtcgttgcgcaccgccagctggatgtgccgcggcacgatcctgttcttcttg 338 Query: 407 ttgtccctcgcggcgttcccg 427 ||||||||||| ||||||||| Sbjct: 337 ttgtccctcgccgcgttcccg 317
>dbj|AK121752.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087P07, full insert sequence Length = 747 Score = 87.7 bits (44), Expect = 3e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||| || || |||||||| || | ||||||||| ||| |||||||| Sbjct: 400 agctcctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttg 341 Query: 407 ttgtccctcgcggcgttccc 426 ||||||||||| |||||||| Sbjct: 340 ttgtccctcgccgcgttccc 321
>emb|AL713943.3|CNS07YPC Oryza sativa chromosome 12, . BAC OSJNBa0030G16 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 182172 Score = 87.7 bits (44), Expect = 3e-14 Identities = 71/80 (88%) Strand = Plus / Plus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||| || || |||||||| || | ||||||||| ||| |||||||| Sbjct: 10002 agctcctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttg 10061 Query: 407 ttgtccctcgcggcgttccc 426 ||||||||||| |||||||| Sbjct: 10062 ttgtccctcgccgcgttccc 10081
>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 107819 Score = 87.7 bits (44), Expect = 3e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||| || || |||||||| || | ||||||||| ||| |||||||| Sbjct: 34483 agctcctcgtcgttgcgcaccgccagctggatgtgcctcggcacgatccggttcttcttg 34424 Query: 407 ttgtccctcgcggcgttccc 426 ||||||||||| |||||||| Sbjct: 34423 ttgtccctcgccgcgttccc 34404
>gb|AY110108.1| Zea mays CL14299_1 mRNA sequence Length = 712 Score = 83.8 bits (42), Expect = 4e-13 Identities = 57/62 (91%) Strand = Plus / Plus Query: 350 tcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgttg 409 |||||||||||||| ||||| |||||||| || ||||||||||||||| ||||||||||| Sbjct: 354 tcctcgtcgttgcgcacggcgagctggatgtgacgcggcacgatgcggttcttcttgttg 413 Query: 410 tc 411 || Sbjct: 414 tc 415
>gb|L41841.1|CREHIH3G Chlamydomonas reinhardtii histone H3, histone H4, histone H2B, and histone H2A genes, complete cds Length = 4358 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| |||||||| || || |||||||||||| |||||||| Sbjct: 4081 agctcctcgtcgttgcggatggccagctggatgtggcggggcacgatgcggttcttcttg 4022 Query: 407 ttgtc 411 ||||| Sbjct: 4021 ttgtc 4017
>gb|M31922.1|VVCH4AB V.carteri histone H2A-IV and H2B-IV genes, complete cds Length = 2132 Score = 81.8 bits (41), Expect = 2e-12 Identities = 59/65 (90%) Strand = Plus / Plus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| |||||||| || ||||| ||||||||| |||||||| Sbjct: 550 agctcctcgtcgttgcggatggcgagctggatgtggcgcgggacgatgcggttcttcttg 609 Query: 407 ttgtc 411 ||||| Sbjct: 610 ttgtc 614
>ref|XM_865976.1| PREDICTED: Bos taurus similar to Histone H2A.g (H2A/g) (H2A.3) (LOC614970), mRNA Length = 447 Score = 79.8 bits (40), Expect = 7e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | ||| ||||| | ||||||||||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcagatgacgcgggatgatgcgggtcttctt 223 Query: 406 gttgtccc 413 |||||||| Sbjct: 222 gttgtccc 215
>gb|BC016677.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone MGC:17204 IMAGE:4342191), complete cds Length = 2256 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| || |||| ||| ||||| | ||||||||||||||| Sbjct: 301 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 242 Query: 406 gttgtc 411 |||||| Sbjct: 241 gttgtc 236
>gb|BC067782.1| Homo sapiens histone 1, H2ag, mRNA (cDNA clone IMAGE:5314244), partial cds Length = 2270 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| || |||| ||| ||||| | ||||||||||||||| Sbjct: 312 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 253 Query: 406 gttgtc 411 |||||| Sbjct: 252 gttgtc 247
>ref|NM_021064.3| Homo sapiens histone 1, H2ag (HIST1H2AG), mRNA Length = 2267 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| || |||| ||| ||||| | ||||||||||||||| Sbjct: 312 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 253 Query: 406 gttgtc 411 |||||| Sbjct: 252 gttgtc 247
>emb|AL021807.2|HS86C11 Human DNA sequence from clone RP1-86C11 on chromosome 6p21.31-22.1 Contains a vomeronasal olfactory 1 receptor chromosome 6-2 (VN1R6-2P) pseudogene, histone genes H2BFN and H2AFA, the gene for a novel protein identical to H2B histone family member A (H2BFA), the gene for a novel protein identical to H2A histone family member I (H2AFI), a novel histone gene similar to H4F2 and three CpG islands, complete sequence Length = 89016 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| || |||| ||| ||||| | ||||||||||||||| Sbjct: 56658 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 56599 Query: 406 gttgtc 411 |||||| Sbjct: 56598 gttgtc 56593 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| || |||| || ||||| | ||| ||||||||||| Sbjct: 70715 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 70656 Query: 406 gttgtc 411 |||||| Sbjct: 70655 gttgtc 70650
>ref|XM_577577.1| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC502129), mRNA Length = 393 Score = 75.8 bits (38), Expect = 1e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtccctcgcggcgtt 423 |||||||||||| ||||| Sbjct: 222 gttgtccctcgctgcgtt 205
>ref|XM_225386.2| PREDICTED: Rattus norvegicus histone 1, H2an (predicted) (Hist1h2an_predicted), mRNA Length = 546 Score = 75.8 bits (38), Expect = 1e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtccctcgcggcgtt 423 |||||||||||| ||||| Sbjct: 222 gttgtccctcgctgcgtt 205
>ref|XM_225372.2| PREDICTED: Rattus norvegicus similar to Histone H2A.1 (LOC306962), mRNA Length = 437 Score = 75.8 bits (38), Expect = 1e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 296 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 237 Query: 406 gttgtccctcgcggcgtt 423 |||||||||||| ||||| Sbjct: 236 gttgtccctcgccgcgtt 219
>gb|AY131987.1| Homo sapiens histone H2A (HIST1H2AG) gene, complete cds Length = 1173 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| || |||| ||| ||||| | ||||||||||||||| Sbjct: 674 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 615 Query: 406 gttgtc 411 |||||| Sbjct: 614 gttgtc 609
>gb|L19778.1|HUMH2A1B Homo sapiens histone H2A.1b mRNA, complete cds Length = 2250 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| || |||| ||| ||||| | ||||||||||||||| Sbjct: 312 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 253 Query: 406 gttgtc 411 |||||| Sbjct: 252 gttgtc 247
>ref|NG_000827.2| Homo sapiens genomic histone family microcluster (HFM@) on chromosome 6 Length = 20621 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| || |||| ||| ||||| | ||||||||||||||| Sbjct: 5859 gagctcctcgtcgttgcggatggccagttggagatgacgcgggatgatgcgggtcttctt 5800 Query: 406 gttgtc 411 |||||| Sbjct: 5799 gttgtc 5794 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| || |||| || ||||| | ||| ||||||||||| Sbjct: 19916 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 19857 Query: 406 gttgtc 411 |||||| Sbjct: 19856 gttgtc 19851
>gb|BT016168.1| Zea mays clone Contig1 mRNA sequence Length = 676 Score = 73.8 bits (37), Expect = 4e-10 Identities = 70/81 (86%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 |||||||||||||| || || || |||||||| || ||||||||||| ||| |||||||| Sbjct: 382 agctcctcgtcgttccgcaccgccagctggatgtggcgcggcacgatacggttcttcttg 323 Query: 407 ttgtccctcgcggcgttcccg 427 ||||||| || ||||||||| Sbjct: 322 ttgtcccgagcagcgttcccg 302
>gb|AY105006.1| Zea mays PCO108932 mRNA sequence Length = 841 Score = 73.8 bits (37), Expect = 4e-10 Identities = 70/81 (86%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 |||||||||||||| || || || |||||||| || ||||||||||| ||| |||||||| Sbjct: 370 agctcctcgtcgttccgcaccgccagctggatgtggcgcggcacgatacggttcttcttg 311 Query: 407 ttgtccctcgcggcgttcccg 427 ||||||| || ||||||||| Sbjct: 310 ttgtcccgagcagcgttcccg 290
>gb|U16724.1|CRU16724 Chlamydomonas reinhardtii histone H3 (ch3-II), histone H4 (ch4-II), histone H2B (ch2b-II) and histone H2A (ch2a-II) genes, complete cds Length = 3777 Score = 73.8 bits (37), Expect = 4e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 |||||||| |||||||||| ||| |||||||| || || |||||||||||| |||||||| Sbjct: 3500 agctcctcatcgttgcggatggccagctggatgtggcggggcacgatgcggttcttcttg 3441 Query: 407 ttgtc 411 ||||| Sbjct: 3440 ttgtc 3436
>ref|XM_865148.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC613926), mRNA Length = 393 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtgacgcgggatgatgcgggtcttctt 223 Query: 406 gttgtccc 413 |||||||| Sbjct: 222 gttgtccc 215
>ref|XM_868899.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC616790), mRNA Length = 413 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 302 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatgatgcgggtcttctt 243 Query: 406 gttgtccc 413 |||||||| Sbjct: 242 gttgtccc 235
>ref|XM_518300.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462507), mRNA Length = 846 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 228 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 169 Query: 406 gttgtc 411 |||||| Sbjct: 168 gttgtc 163
>gb|BC104198.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MGC:125892 IMAGE:40031339), complete cds Length = 438 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>gb|BC104199.1| Homo sapiens histone 1, H2ak, mRNA (cDNA clone MGC:125893 IMAGE:40031340), complete cds Length = 438 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_583411.2| PREDICTED: Bos taurus similar to Histone H2A.l (H2A/l), transcript variant 1 (LOC506900), mRNA Length = 1039 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | ||| ||||| | ||| ||||||||||| Sbjct: 320 gagctcctcgtcgttgcggatggccagctgtaaatggcgcgggatgatacgggtcttctt 261 Query: 406 gttgtc 411 |||||| Sbjct: 260 gttgtc 255
>ref|XM_869647.1| PREDICTED: Bos taurus similar to Histone H2A.l (H2A/l), transcript variant 2 (LOC506900), mRNA Length = 703 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | ||| ||||| | ||| ||||||||||| Sbjct: 320 gagctcctcgtcgttgcggatggccagctgtaaatggcgcgggatgatacgggtcttctt 261 Query: 406 gttgtc 411 |||||| Sbjct: 260 gttgtc 255
>gb|BC034487.2| Homo sapiens histone 1, H2ak, mRNA (cDNA clone IMAGE:4825623), with apparent retained intron Length = 2884 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 318 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 259 Query: 406 gttgtc 411 |||||| Sbjct: 258 gttgtc 253
>ref|NM_177688.2| Mus musculus H2A histone family, member J (H2afj), mRNA Length = 1754 Score = 67.9 bits (34), Expect = 3e-08 Identities = 67/78 (85%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 299 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 240 Query: 406 gttgtccctcgcggcgtt 423 |||||||||||| ||||| Sbjct: 239 gttgtccctcgccgcgtt 222
>ref|NG_000009.2| Homo sapiens small histone family cluster (HFS@) on chromosome 6 Length = 91567 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 56394 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 56335 Query: 406 gttgtc 411 |||||| Sbjct: 56334 gttgtc 56329 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 85961 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 86020 Query: 406 gttgtc 411 |||||| Sbjct: 86021 gttgtc 86026 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 79993 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 79934 Query: 406 gttgtc 411 |||||| Sbjct: 79933 gttgtc 79928 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||||| Sbjct: 28816 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 28875 Query: 406 gttgtc 411 |||||| Sbjct: 28876 gttgtc 28881 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||| || Sbjct: 1584 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 1525 Query: 406 gttgtc 411 |||||| Sbjct: 1524 gttgtc 1519
>ref|NM_003510.2| Homo sapiens histone 1, H2ak (HIST1H2AK), mRNA Length = 460 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_906486.2| PREDICTED: Mus musculus similar to H2A histone family, member J (LOC632401), mRNA Length = 1833 Score = 67.9 bits (34), Expect = 3e-08 Identities = 67/78 (85%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 378 gagctcctcgtcgttgcggatggccagctgcaggtggcgagggatgatgcgcgtcttctt 319 Query: 406 gttgtccctcgcggcgtt 423 |||||||||||| ||||| Sbjct: 318 gttgtccctcgccgcgtt 301
>gb|AC122804.4| Mus musculus BAC clone RP23-296J10 from 6, complete sequence Length = 205659 Score = 67.9 bits (34), Expect = 3e-08 Identities = 67/78 (85%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 108662 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 108721 Query: 406 gttgtccctcgcggcgtt 423 |||||||||||| ||||| Sbjct: 108722 gttgtccctcgccgcgtt 108739
>emb|Z98744.2|HS193B12 Human DNA sequence from clone RP1-193B12 on chromosome 6p21.3-22.3 Contains the H2AFD, H2BFD, H2AFI, H1F5, H3FF, H4FK, H3FJ, H2AFN, and H2BFN histone genes, the OR2B2 gene for olfactory receptor 2B2, histone H2B family member I pseudogene H2BFIP, a hypothetical protein pseudogene, ESTs, STSs, GSSs and CpG islands, complete sequence Length = 100374 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 1799 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 1858 Query: 406 gttgtc 411 |||||| Sbjct: 1859 gttgtc 1864 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||| || Sbjct: 56609 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 56668 Query: 406 gttgtc 411 |||||| Sbjct: 56669 gttgtc 56674 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||||| Sbjct: 29377 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 29318 Query: 406 gttgtc 411 |||||| Sbjct: 29317 gttgtc 29312
>emb|Z83739.1|HSZ83739 H.sapiens hH2A/d gene Length = 650 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 425 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 366 Query: 406 gttgtc 411 |||||| Sbjct: 365 gttgtc 360
>dbj|AK053755.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130307C13 product:HISTONE H2A homolog [Gallus gallus], full insert sequence Length = 1754 Score = 67.9 bits (34), Expect = 3e-08 Identities = 67/78 (85%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 299 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 240 Query: 406 gttgtccctcgcggcgtt 423 |||||||||||| ||||| Sbjct: 239 gttgtccctcgccgcgtt 222
>ref|XM_344599.2| PREDICTED: Rattus norvegicus histone 1, H2ao (predicted) (Hist1h2ao_predicted), mRNA Length = 483 Score = 67.9 bits (34), Expect = 3e-08 Identities = 67/78 (85%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| ||||| || Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtgacgcggaatgatgcgtgtcttttt 223 Query: 406 gttgtccctcgcggcgtt 423 |||||||||||| ||||| Sbjct: 222 gttgtccctcgccgcgtt 205
>gb|AY131991.1| Homo sapiens histone H2A (HIST1H2AK) gene, complete cds Length = 1119 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 655 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 596 Query: 406 gttgtc 411 |||||| Sbjct: 595 gttgtc 590
>dbj|AK130106.1| Homo sapiens cDNA FLJ26596 fis, clone LNF08501 Length = 1723 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 299 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 358 Query: 406 gttgtc 411 |||||| Sbjct: 359 gttgtc 364
>gb|AY893520.1| Synthetic construct Homo sapiens clone FLH130895.01X histone 1 H2ak (HIST1H2AK) mRNA, complete cds Length = 393 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence Length = 200326 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | ||| ||||| | |||||| |||||||| Sbjct: 45202 gagctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatgcgcgtcttctt 45261 Query: 406 gttgtc 411 |||||| Sbjct: 45262 gttgtc 45267 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 70501 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 70442 Query: 406 gttgtc 411 |||||| Sbjct: 70441 gttgtc 70436 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 64608 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 64667 Query: 406 gttgtc 411 |||||| Sbjct: 64668 gttgtc 64673
>gb|BC099606.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone MGC:118637 IMAGE:1383389), complete cds Length = 587 Score = 67.9 bits (34), Expect = 3e-08 Identities = 67/78 (85%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 356 gagctcctcgtcgttgcggatggccagctgcaggtgacgagggatgatgcgcgtcttctt 297 Query: 406 gttgtccctcgcggcgtt 423 |||||||||||| ||||| Sbjct: 296 gttgtccctcgccgcgtt 279
>gb|BC024397.1| Mus musculus H2A histone family, member J, mRNA (cDNA clone MGC:36202 IMAGE:5055276), complete cds Length = 550 Score = 67.9 bits (34), Expect = 3e-08 Identities = 67/78 (85%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || || || | |||||| |||||||| Sbjct: 334 gagctcctcgtcgttgcggatggccagctgcaggtggcgagggatgatgcgcgtcttctt 275 Query: 406 gttgtccctcgcggcgtt 423 |||||||||||| ||||| Sbjct: 274 gttgtccctcgccgcgtt 257
>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence Length = 166720 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | ||| ||||| | |||||| |||||||| Sbjct: 55491 gagctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatgcgcgtcttctt 55432 Query: 406 gttgtc 411 |||||| Sbjct: 55431 gttgtc 55426 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 36085 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 36026 Query: 406 gttgtc 411 |||||| Sbjct: 36025 gttgtc 36020 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 30192 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 30251 Query: 406 gttgtc 411 |||||| Sbjct: 30252 gttgtc 30257
>ref|XM_527262.1| PREDICTED: Pan troglodytes similar to histone protein Hist1h2af (LOC471884), mRNA Length = 420 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||||||| Sbjct: 281 agctcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttcttg 222 Query: 407 ttgtc 411 ||||| Sbjct: 221 ttgtc 217
>ref|XM_518289.1| PREDICTED: Pan troglodytes similar to Histone H2A.g (H2A/g) (H2A.3) (LOC462493), mRNA Length = 1052 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 331 agctcctcgtcgttgcggatggctagctgcaggtgtcgggggatgatgcgggtcttcttg 272 Query: 407 ttgtc 411 ||||| Sbjct: 271 ttgtc 267
>gb|AY389710.1| Hyacinthus orientalis histone H2A mRNA, partial cds Length = 677 Score = 65.9 bits (33), Expect = 1e-07 Identities = 129/161 (80%) Strand = Plus / Minus Query: 266 gccttcttggggagcagaaggttgtggatgttgggcatgacaccgccgctggcgattgtg 325 |||||||| ||||||| |||||||||||||||||||| ||||| ||| | ||||| || Sbjct: 453 gccttcttcgggagcaagaggttgtggatgttgggcatcacacctccgtttgcgatggtc 394 Query: 326 accataccgagcaggcgggagagctcctcgtcgttgcggacggcaagctggatatgtcgc 385 ||||| || | || || |||||||| ||||| | || || |||||||| || || Sbjct: 393 accatccccaagagcttcgacagctcctcatcgttcctcaccgcgagctggatgtgacgt 334 Query: 386 ggcacgatgcgggtcttcttgttgtccctcgcggcgttccc 426 |||||||| | ||||||||||||||| ||||| || ||||| Sbjct: 333 ggcacgatcctggtcttcttgttgtctctcgcagcattccc 293
>gb|BC031333.1| Homo sapiens histone 1, H3d, mRNA (cDNA clone MGC:45668 IMAGE:3608479), complete cds Length = 890 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 250 agctcctcgtcgttgcggatggccagctgcaagtgtcgggggatgatgcgggtcttcttg 191 Query: 407 ttgtc 411 ||||| Sbjct: 190 ttgtc 186
>ref|NG_001335.1| Homo sapiens genomic large histone family cluster (HFL@) on chromosome 6 Length = 269712 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Plus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 182963 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 183022 Query: 407 ttgtc 411 ||||| Sbjct: 183023 ttgtc 183027 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 108456 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 108397 Query: 406 gttgtc 411 |||||| Sbjct: 108396 gttgtc 108391 Score = 58.0 bits (29), Expect = 2e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 201255 agctcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttctta 201196 Query: 407 ttgtc 411 ||||| Sbjct: 201195 ttgtc 201191 Score = 42.1 bits (21), Expect = 1.5 Identities = 54/65 (83%) Strand = Plus / Plus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||| ||||||| ||| | || | || ||||| | |||||||||||||||| Sbjct: 17230 agctcctcgtcattgcggatggccaattgcaggtggcgcgggatgatgcgggtcttcttg 17289 Query: 407 ttgtc 411 ||||| Sbjct: 17290 ttgtc 17294
>ref|NM_003530.3| Homo sapiens histone 1, H3d (HIST1H3D), mRNA Length = 864 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 274 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 215 Query: 407 ttgtc 411 ||||| Sbjct: 214 ttgtc 210
>ref|NM_021065.2| Homo sapiens histone 1, H2ad (HIST1H2AD), mRNA Length = 460 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 281 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 222 Query: 407 ttgtc 411 ||||| Sbjct: 221 ttgtc 217
>emb|AL031777.5|HS34B20 Human DNA sequence from clone RP1-34B20 on chromosome 6p21.31-22.2 Contains seventeen histone (pseudo)genes and gene RPS10P1 (40S Ribosomal protein S10 pseudogene 1), three CpG islands, ESTs, STSs and GSSs, complete sequence Length = 89301 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Plus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 4345 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 4404 Query: 407 ttgtc 411 ||||| Sbjct: 4405 ttgtc 4409 Score = 58.0 bits (29), Expect = 2e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 22637 agctcctcgtcgttgcggatggctagctgcaggtggcgcgggatgatgcgggtcttctta 22578 Query: 407 ttgtc 411 ||||| Sbjct: 22577 ttgtc 22573
>emb|Z80776.1|HSH2AG H.sapiens H2A/g gene Length = 840 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 479 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 420 Query: 407 ttgtc 411 ||||| Sbjct: 419 ttgtc 415
>emb|X16495.1|MMHIST2A Murine H2A gene for histone H2A Length = 470 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 284 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 225 Query: 407 ttgtc 411 ||||| Sbjct: 224 ttgtc 220
>gb|BC093807.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MGC:120842 IMAGE:7939652), complete cds Length = 467 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 320 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 261 Query: 407 ttgtc 411 ||||| Sbjct: 260 ttgtc 256
>emb|CR541999.1| Homo sapiens full open reading frame cDNA clone RZPDo834C1135D for gene HIST1H3D, histone 1, H3d; complete cds, without stopcodon Length = 390 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 281 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 222 Query: 407 ttgtc 411 ||||| Sbjct: 221 ttgtc 217
>emb|CR541970.1| Homo sapiens full open reading frame cDNA clone RZPDo834G1134D for gene HIST1H3D, histone 1, H3d; complete cds, incl. stopcodon Length = 393 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 281 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 222 Query: 407 ttgtc 411 ||||| Sbjct: 221 ttgtc 217
>gb|BC093809.1| Homo sapiens histone 1, H2ad, mRNA (cDNA clone MGC:120844 IMAGE:7939654), complete cds Length = 473 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 323 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 264 Query: 407 ttgtc 411 ||||| Sbjct: 263 ttgtc 259
>ref|XM_314447.2| Anopheles gambiae str. PEST ENSANGP00000016040 (ENSANGG00000013551), partial mRNA Length = 375 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | ||| ||||| | |||||| ||||||||| Sbjct: 278 agctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatgcgcgtcttcttg 219 Query: 407 ttgtc 411 ||||| Sbjct: 218 ttgtc 214
>ref|XM_306256.1| Anopheles gambiae str. PEST ENSANGP00000000004 (ENSANGG00000000004), mRNA Length = 630 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | ||| ||||| | |||||| ||||||||| Sbjct: 392 agctcctcgtcgttgcggatggccagctgcagatggcgcgggatgatgcgcgtcttcttg 333 Query: 407 ttgtc 411 ||||| Sbjct: 332 ttgtc 328
>gb|U16726.1|CRU16726 Chlamydomonas reinhardtii histone H1 (ch1), histone H2A (ch2a-IV), and histone H2B (ch2b-IV) genes, complete cds Length = 4502 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Plus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 |||||||| |||||||||| ||| |||||||| || || ||||| |||||| |||||||| Sbjct: 3194 agctcctcatcgttgcggatggccagctggatgtggcgaggcacaatgcggttcttcttg 3253 Query: 407 ttgtc 411 ||||| Sbjct: 3254 ttgtc 3258
>gb|M31921.1|VVCH2AB V.carteri histone H2A-III and H2B-III genes, complete cds Length = 1442 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Plus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||| ||||||| ||| | ||||||||| || || ||||||||| |||||||| Sbjct: 267 agctcctcgtcattgcggatggccaactggatatggcgtgggacgatgcggttcttcttg 326 Query: 407 ttgtc 411 ||||| Sbjct: 327 ttgtc 331
>gb|AY131985.1| Homo sapiens histone H2A (HIST1H2AD) gene, complete cds Length = 1119 Score = 65.9 bits (33), Expect = 1e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||||||||||| ||| ||||| | ||||| || | |||||||||||||||| Sbjct: 654 agctcctcgtcgttgcggatggccagctgcaggtgtcgggggatgatgcgggtcttcttg 595 Query: 407 ttgtc 411 ||||| Sbjct: 594 ttgtc 590
>ref|XM_870473.1| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC618147), mRNA Length = 434 Score = 63.9 bits (32), Expect = 4e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||| ||||||||||||| ||| ||||| | || ||||| | ||||||||||||||| Sbjct: 323 gagctcttcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttctt 264 Query: 406 gttgtccc 413 |||||||| Sbjct: 263 gttgtccc 256
>ref|XM_607721.2| PREDICTED: Bos taurus similar to Histone H2A.1 (LOC529277), mRNA Length = 522 Score = 63.9 bits (32), Expect = 4e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 283 gagctcctcgtcgttgcggatggccagctgcaggtgacgcgggatgatgcgcgtcttctt 224 Query: 406 gttgtccc 413 |||||||| Sbjct: 223 gttgtccc 216
>gb|BT016569.1| Zea mays clone Contig402 mRNA sequence Length = 719 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| |||||| | | || ||||| | ||||||||||||||| Sbjct: 414 gagctcctcgtcgttgcggatggcaaggagcacgtggcgcgggatgatgcgggtcttctt 355 Query: 406 gttgtcc 412 ||||||| Sbjct: 354 gttgtcc 348
>emb|X94973.1|TAH2A274 T.aestivum histone H2A gene (clone TH274) Length = 2546 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||| ||||||||||||||| ||| | | || ||||| | ||||||||||||||| Sbjct: 2157 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcgggtcttctt 2098 Query: 406 gttgtcc 412 ||||||| Sbjct: 2097 gttgtcc 2091
>gb|L75802.1|WHTHIH2A Triticum aestivum histone H2A gene, complete cds Length = 2546 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||| ||||||||||||||| ||| | | || ||||| | ||||||||||||||| Sbjct: 2157 gagctcctggtcgttgcggacggcgagcagcaggtggcgcgggatgatgcgggtcttctt 2098 Query: 406 gttgtcc 412 ||||||| Sbjct: 2097 gttgtcc 2091
>ref|XM_318363.2| Anopheles gambiae str. PEST ENSANGP00000015971 (ENSANGG00000013482), partial mRNA Length = 372 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 349 ctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgtt 408 ||||||||||||||||| ||| ||||| | ||| ||||| | |||||| ||||||||||| Sbjct: 273 ctcctcgtcgttgcggatggccagctgcagatgacgcgggatgatgcgcgtcttcttgtt 214 Query: 409 gtc 411 ||| Sbjct: 213 gtc 211
>ref|XM_318365.1| Anopheles gambiae str. PEST ENSANGP00000015967 (ENSANGG00000013478), partial mRNA Length = 375 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 349 ctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgtt 408 ||||||||||||||||| ||| ||||| | ||| ||||| | |||||| ||||||||||| Sbjct: 276 ctcctcgtcgttgcggatggccagctgcagatgacgcgggatgatgcgcgtcttcttgtt 217 Query: 409 gtc 411 ||| Sbjct: 216 gtc 214
>ref|XM_307083.1| Anopheles gambiae str. PEST ENSANGP00000012043 (ENSANGG00000009554), partial mRNA Length = 375 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 349 ctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttgtt 408 ||||||||||||||||| ||| ||||| | ||| ||||| | |||||| ||||||||||| Sbjct: 276 ctcctcgtcgttgcggatggccagctgcagatgacgcgggatgatgcgcgtcttcttgtt 217 Query: 409 gtc 411 ||| Sbjct: 216 gtc 214
>gb|AY103710.1| Zea mays PCO123562 mRNA sequence Length = 770 Score = 61.9 bits (31), Expect = 2e-06 Identities = 58/67 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| |||||| | | || ||||| | ||||||||||||||| Sbjct: 414 gagctcctcgtcgttgcggatggcaaggagcacgtggcgcgggatgatgcgggtcttctt 355 Query: 406 gttgtcc 412 ||||||| Sbjct: 354 gttgtcc 348
>ref|XM_527287.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC471909), mRNA Length = 537 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||| || Sbjct: 426 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 367 Query: 406 gttgtc 411 |||||| Sbjct: 366 gttgtc 361
>ref|XM_527283.1| PREDICTED: Pan troglodytes similar to Hist2h2aa1 protein (LOC471905), mRNA Length = 555 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||||| Sbjct: 444 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 385 Query: 406 gttgtc 411 |||||| Sbjct: 384 gttgtc 379
>ref|XM_527281.1| PREDICTED: Pan troglodytes similar to H2A histone family, member E (LOC471903), mRNA Length = 372 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 267 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 208 Query: 406 gttgtc 411 |||||| Sbjct: 207 gttgtc 202
>ref|XM_527273.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC471895), mRNA Length = 387 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| || |||| || ||||| | ||| ||||||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_527272.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC471894), mRNA Length = 372 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| || |||| || ||||| | ||| ||||||||||| Sbjct: 261 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 202 Query: 406 gttgtc 411 |||||| Sbjct: 201 gttgtc 196
>ref|XM_518299.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC462506), mRNA Length = 792 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 333 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 274 Query: 406 gttgtc 411 |||||| Sbjct: 273 gttgtc 268
>ref|XM_518286.1| PREDICTED: Pan troglodytes similar to Histone H2A.l (H2A/l) (LOC462490), mRNA Length = 565 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 324 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 265 Query: 406 gttgtc 411 |||||| Sbjct: 264 gttgtc 259
>ref|XM_525084.1| PREDICTED: Pan troglodytes similar to Histone H2A.1 (LOC469700), mRNA Length = 393 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|NM_175662.1| Mus musculus histone 2, H2ac (Hist2h2ac), mRNA Length = 390 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|NM_013549.1| Mus musculus histone 2, H2aa1 (Hist2h2aa1), mRNA Length = 578 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 325 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 266 Query: 406 gttgtc 411 |||||| Sbjct: 265 gttgtc 260
>gb|BC062305.1| Homo sapiens cDNA clone IMAGE:3162462 Length = 2706 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 300 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 241 Query: 406 gttgtc 411 |||||| Sbjct: 240 gttgtc 235
>gb|BC001193.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:3165 IMAGE:3355200), complete cds Length = 897 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 324 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 265 Query: 406 gttgtc 411 |||||| Sbjct: 264 gttgtc 259
>gb|BC017379.1| Homo sapiens histone 1, H2ac, mRNA (cDNA clone MGC:1730 IMAGE:2988620), complete cds Length = 1656 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 334 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 275 Query: 406 gttgtc 411 |||||| Sbjct: 274 gttgtc 269
>gb|BC082269.1| Homo sapiens histone 3, H2a, mRNA (cDNA clone MGC:99456 IMAGE:6671338), complete cds Length = 889 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 314 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 255 Query: 406 gttgtc 411 |||||| Sbjct: 254 gttgtc 249
>gb|BC080809.1| Mus musculus cDNA clone IMAGE:6466339 Length = 2972 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250 Query: 406 gttgtc 411 |||||| Sbjct: 249 gttgtc 244
>gb|BC069306.1| Homo sapiens histone 1, H2al, mRNA (cDNA clone MGC:97481 IMAGE:7262757), complete cds Length = 469 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||||| Sbjct: 308 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 249 Query: 406 gttgtc 411 |||||| Sbjct: 248 gttgtc 243
>gb|BC010336.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone MGC:11561 IMAGE:3156946), complete cds Length = 1414 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 329 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 270 Query: 406 gttgtc 411 |||||| Sbjct: 269 gttgtc 264
>gb|BC010564.1| Mus musculus histone 2, H2aa1, mRNA (cDNA clone IMAGE:3582122), partial cds Length = 543 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250 Query: 406 gttgtc 411 |||||| Sbjct: 249 gttgtc 244
>ref|NM_178185.1| Mus musculus histone 1, H2ao (Hist1h2ao), mRNA Length = 393 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|NM_178213.2| Mus musculus histone 2, H2ab (Hist2h2ab), mRNA Length = 390 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|NM_033445.2| Homo sapiens histone 3, H2a (HIST3H2A), mRNA Length = 496 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 324 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 265 Query: 406 gttgtc 411 |||||| Sbjct: 264 gttgtc 259
>ref|NM_021066.2| Homo sapiens histone 1, H2aj (HIST1H2AJ), mRNA Length = 439 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|NM_080596.1| Homo sapiens histone 1, H2ah (HIST1H2AH), mRNA Length = 439 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| || |||| || ||||| | ||| ||||||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|NM_003514.2| Homo sapiens histone 1, H2am (HIST1H2AM), mRNA Length = 487 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||| || Sbjct: 318 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 259 Query: 406 gttgtc 411 |||||| Sbjct: 258 gttgtc 253
>ref|NM_003512.3| Homo sapiens histone 1, H2ac (HIST1H2AC), mRNA Length = 546 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 370 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 311 Query: 406 gttgtc 411 |||||| Sbjct: 310 gttgtc 305
>ref|NM_003511.2| Homo sapiens histone 1, H2al (HIST1H2AL), mRNA Length = 470 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||||| Sbjct: 308 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 249 Query: 406 gttgtc 411 |||||| Sbjct: 248 gttgtc 243
>ref|NM_003509.2| Homo sapiens histone 1, H2ai (HIST1H2AI), mRNA Length = 469 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 293 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 234 Query: 406 gttgtc 411 |||||| Sbjct: 233 gttgtc 228
>gb|AC034285.6| Mus musculus chromosome 13, clone RP23-220G21, complete sequence Length = 209720 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 101186 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 101245 Query: 406 gttgtc 411 |||||| Sbjct: 101246 gttgtc 101251 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 64551 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 64492 Query: 406 gttgtc 411 |||||| Sbjct: 64491 gttgtc 64486 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 60626 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 60685 Query: 406 gttgtc 411 |||||| Sbjct: 60686 gttgtc 60691
>gb|AY573602.1| Toxoplasma gondii histone H2A.1 gene, complete cds Length = 782 Score = 60.0 bits (30), Expect = 6e-06 Identities = 75/90 (83%) Strand = Plus / Minus Query: 289 gtggatgttgggcatgacaccgccgctggcgattgtgaccataccgagcaggcgggagag 348 ||||| ||||||||||||||| ||||||||||| || || ||||| | |||||| Sbjct: 500 gtggacgttgggcatgacaccaccgctggcgatggtcactccgccgaggaacttggagag 441 Query: 349 ctcctcgtcgttgcggacggcaagctggat 378 |||||||||||||||||||| |||||||| Sbjct: 440 ttcctcgtcgttgcggacggccagctggat 411
>ref|NG_002734.1| Mus musculus histone 1, H2aj (Hist1h2aj) pseudogene on chromosome 13 Length = 1357 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 764 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 705 Query: 406 gttgtc 411 |||||| Sbjct: 704 gttgtc 699
>gb|BC066234.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IMAGE:7002043), partial cds Length = 404 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>gb|BC066232.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IMAGE:7002040), partial cds Length = 404 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>gb|BC066233.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IMAGE:7002042), partial cds Length = 404 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>gb|BC066237.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IMAGE:7002046), partial cds Length = 404 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>gb|BC066236.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IMAGE:7002045), partial cds Length = 404 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>gb|BC066235.1| Homo sapiens histone 1, H2aj, mRNA (cDNA clone IMAGE:7002044), partial cds Length = 404 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_545430.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488308), mRNA Length = 456 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 345 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 286 Query: 406 gttgtc 411 |||||| Sbjct: 285 gttgtc 280
>ref|XM_545426.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488304), mRNA Length = 588 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 429 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 370 Query: 406 gttgtc 411 |||||| Sbjct: 369 gttgtc 364
>ref|XM_849168.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC611496), mRNA Length = 393 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_545421.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488299), mRNA Length = 387 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_545419.2| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488297), mRNA Length = 393 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_545413.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488291), mRNA Length = 387 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_545411.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC488289), mRNA Length = 393 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_545400.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488278), mRNA Length = 576 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_545394.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488272), mRNA Length = 393 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_848774.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611132), mRNA Length = 393 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_848759.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488270), mRNA Length = 462 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 351 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 292 Query: 406 gttgtc 411 |||||| Sbjct: 291 gttgtc 286
>ref|XM_545384.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488262), mRNA Length = 393 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_848716.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC611082), mRNA Length = 393 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_545376.2| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l) (LOC488254), mRNA Length = 417 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 306 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 247 Query: 406 gttgtc 411 |||||| Sbjct: 246 gttgtc 241
>ref|XM_545373.1| PREDICTED: Canis familiaris similar to histone H2A (LOC488251), mRNA Length = 396 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_854341.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l), transcript variant 2 (LOC488268), mRNA Length = 402 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_545390.1| PREDICTED: Canis familiaris similar to Histone H2A.l (H2A/l), transcript variant 1 (LOC488268), mRNA Length = 393 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_981616.1| PREDICTED: Mus musculus similar to H2A histone family, member O (LOC670497), mRNA Length = 3003 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 288 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 229 Query: 406 gttgtc 411 |||||| Sbjct: 228 gttgtc 223
>ref|XM_992084.1| PREDICTED: Mus musculus similar to H2A histone family, member O (LOC667728), mRNA Length = 3054 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 339 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 280 Query: 406 gttgtc 411 |||||| Sbjct: 279 gttgtc 274
>ref|XM_994730.1| PREDICTED: Mus musculus similar to H2A histone family, member O (LOC677006), mRNA Length = 2991 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 276 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 217 Query: 406 gttgtc 411 |||||| Sbjct: 216 gttgtc 211
>ref|XM_978341.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 2 (LOC665433), mRNA Length = 465 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 314 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 255 Query: 406 gttgtc 411 |||||| Sbjct: 254 gttgtc 249
>ref|XM_978296.1| PREDICTED: Mus musculus similar to histone 2a, transcript variant 1 (LOC665433), mRNA Length = 467 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 316 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 257 Query: 406 gttgtc 411 |||||| Sbjct: 256 gttgtc 251
>ref|XM_886396.1| PREDICTED: Mus musculus histone 2, H3c1 (Hist2h3c1), mRNA Length = 2956 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 309 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 250 Query: 406 gttgtc 411 |||||| Sbjct: 249 gttgtc 244
>gb|BC064002.1| Mus musculus cDNA clone IMAGE:6823756, partial cds Length = 819 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 308 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 249 Query: 406 gttgtc 411 |||||| Sbjct: 248 gttgtc 243
>ref|XM_539322.1| PREDICTED: Canis familiaris similar to Histone H2A.1 (LOC482203), mRNA Length = 393 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|XM_569065.1| Cryptococcus neoformans var. neoformans JEC21 histone H2A-1 (CNB00550) partial mRNA Length = 544 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||| |||||||| |||||||||||||| | ||||| || ||||| |||| |||||| Sbjct: 342 gagctcttcgtcgtttcggacggcaagctgaaggtgtcgggggacgatacgggacttctt 283 Query: 406 gttgtc 411 |||||| Sbjct: 282 gttgtc 277
>gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosome 9, complete sequence Length = 185902 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 149732 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 149791 Query: 406 gttgtc 411 |||||| Sbjct: 149792 gttgtc 149797
>ref|NM_010436.2| Mus musculus H2A histone family, member X (H2afx), mRNA Length = 1414 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 329 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 270 Query: 406 gttgtc 411 |||||| Sbjct: 269 gttgtc 264
>gb|BC058544.1| Mus musculus cDNA clone IMAGE:5711765, with apparent retained intron Length = 497 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 313 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 254 Query: 406 gttgtc 411 |||||| Sbjct: 253 gttgtc 248
>gb|AY158922.2| Mus musculus histone protein Hist2h2ab gene, complete cds Length = 1680 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 490 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 431 Query: 406 gttgtc 411 |||||| Sbjct: 430 gttgtc 425
>emb|AL353759.8| Human DNA sequence from clone RP1-221C16 on chromosome 6 Contains the 3' part of the HFE gene for haemochromatosis protein, two genes for novel histone 4 family members, two genes for novel histone 1 family members, three genes for novel histone 2B family members, a gene for a novel histone 2A family member, a novel pseudogene, STSs, GSSs, ESTs and CpG islands, complete sequence Length = 101099 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 30837 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 30778 Query: 406 gttgtc 411 |||||| Sbjct: 30777 gttgtc 30772
>emb|AL139288.15| Human DNA sequence from clone RP5-915N17 on chromosome 1q42.11-42.3, complete sequence Length = 151563 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 100829 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 100770 Query: 406 gttgtc 411 |||||| Sbjct: 100769 gttgtc 100764
>emb|AL049822.30|HSJ160A22 Human DNA sequence from clone RP1-160A22 on chromosome 6p21.2-22.2 Contains histone genes H2AFE, H2BFE, H4FE and H4FD, ESTs, STSs, GSSs and three CpG islands, complete sequence Length = 24706 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 2806 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 2865 Query: 406 gttgtc 411 |||||| Sbjct: 2866 gttgtc 2871
>gb|AY270707.1| Homo sapiens clone SKA08-D09 putative promoter sequence Length = 457 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 110 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 51 Query: 406 gttgtc 411 |||||| Sbjct: 50 gttgtc 45
>emb|AL009179.1|HS97D16 Human DNA sequence from clone RP1-97D16 on chromosome 6p21.3-22.2 Contains a novel pseudogene, a 60S Ribosomal protein L30 (RPL30) pseudogene, H4 histone family member F pseudogene H4FFP and histone genes H2BFC, H2AFC, H3FK. Contains ESTs, STSs, GSSs and two CpG islands, complete sequence Length = 139904 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 136642 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 136583 Query: 406 gttgtc 411 |||||| Sbjct: 136582 gttgtc 136577
>emb|Z83742.1|HSZ83742 H.sapiens hH2A/c gene Length = 786 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 396 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 337 Query: 406 gttgtc 411 |||||| Sbjct: 336 gttgtc 331
>emb|Z83736.1|HSZ83736 H.sapiens hH2A/e gene Length = 625 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 468 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 409 Query: 406 gttgtc 411 |||||| Sbjct: 408 gttgtc 403
>emb|Z80778.1|HSH2AL H.sapiens H2A/l gene Length = 601 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 421 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 362 Query: 406 gttgtc 411 |||||| Sbjct: 361 gttgtc 356
>emb|Z35401.1|MMHISTH2A M.musculus C3H gene for histone H2A.X Length = 2166 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 908 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 849 Query: 406 gttgtc 411 |||||| Sbjct: 848 gttgtc 843
>emb|Z30940.1|MDH2AHIST M.domesticus (CD-1) mRNA for histone H2A (partial) Length = 523 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 304 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 245 Query: 406 gttgtc 411 |||||| Sbjct: 244 gttgtc 239
>emb|X80327.1|MPMP323 M.pahari genes mpH323 and mph2a23 Length = 2724 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 1098 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1039 Query: 406 gttgtc 411 |||||| Sbjct: 1038 gttgtc 1033
>emb|X83549.1|HSHISTN2A H.sapiens gene for histone H2A Length = 776 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||||| Sbjct: 534 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 475 Query: 406 gttgtc 411 |||||| Sbjct: 474 gttgtc 469
>emb|X80328.1|MMH2B143 M.musculus genes H2b-143, H3-143 Length = 3210 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 1855 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1796 Query: 406 gttgtc 411 |||||| Sbjct: 1795 gttgtc 1790
>emb|X16148.1|MMHIS2A3 Mouse H2a and H3 histone genes Length = 3098 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 1139 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1080 Query: 406 gttgtc 411 |||||| Sbjct: 1079 gttgtc 1074
>emb|X57138.1|HSH2B2H2 Human H2B.2 and H2A.1 genes for Histone H2A and H2B Length = 1661 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||| || Sbjct: 1373 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 1314 Query: 406 gttgtc 411 |||||| Sbjct: 1313 gttgtc 1308
>emb|X05863.1|MMHIS2BB Mouse H2B and H2A-pseudo histone genes (291B) Length = 1826 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 1230 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1171 Query: 406 gttgtc 411 |||||| Sbjct: 1170 gttgtc 1165
>emb|X05862.1|MMHIS2BA Mouse H2B and H2A histone genes (291A) Length = 1797 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 1231 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1172 Query: 406 gttgtc 411 |||||| Sbjct: 1171 gttgtc 1166
>gb|BC099406.1| Mus musculus histone 1, H2ac, mRNA (cDNA clone MGC:117571 IMAGE:30789778), complete cds Length = 1075 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 292 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 233 Query: 406 gttgtc 411 |||||| Sbjct: 232 gttgtc 227
>emb|AL592149.8| Mouse DNA sequence from clone RP23-283N14 on chromosome 13 Contains a novel gene, the genes for three H1, four H2a, five H2b, four H3 and four H4 histone family members, the 3' end of a variant of the Hfe gene for hemochromatosis protein (Mr2) and ten CpG islands, complete sequence Length = 184730 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 164051 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 164110 Query: 406 gttgtc 411 |||||| Sbjct: 164111 gttgtc 164116 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 55358 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 55299 Query: 406 gttgtc 411 |||||| Sbjct: 55298 gttgtc 55293 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 51433 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 51492 Query: 406 gttgtc 411 |||||| Sbjct: 51493 gttgtc 51498 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 14794 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 14735 Query: 406 gttgtc 411 |||||| Sbjct: 14734 gttgtc 14729
>ref|NM_178189.2| Mus musculus histone 1, H2ac (Hist1h2ac), mRNA Length = 2493 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 326 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 267 Query: 406 gttgtc 411 |||||| Sbjct: 266 gttgtc 261
>emb|AL589879.21| Mouse DNA sequence from clone RP23-38E20 on chromosome 13 Contains the genes for H2b histone family member A, two H2a, two H4 and an H2b histone family member, a serine/threonine protein kinase pseudogene, a novel pseudogene, a novel gene (4930500C15Rik), the gene for a novel KRAB box and C2H2 Zinc Finger containing protein, a ribosomal protein L21 (RPL21) pseudogene, a TU mitochondrial translation elongation factor (tufa) pseudogene, the 5' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121 and four CpG islands, complete sequence Length = 182817 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 33361 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 33420 Query: 406 gttgtc 411 |||||| Sbjct: 33421 gttgtc 33426 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 10915 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 10856 Query: 406 gttgtc 411 |||||| Sbjct: 10855 gttgtc 10850
>emb|AL590614.8| Mouse DNA sequence from clone RP23-9O16 on chromosome 13 Contains the 3' end of the gene for a novel protein similar to nuclear envelope pore membrane protein POM121, the Prss16 gene for thymus serine protease16, three novel genes, the genes for two H2a, two H2b and one H4 histone family members, a ribosomal protein L37A (Rpl37a) pseudogene, a novel pseudogene, three genes for novel vomeronasal 1 receptor H (V1rh) family members, the gene for a novel vomeronasal 1 receptor I (V1ri) family member, six V1ri pseudogenes, a V1rh pseudogene and six CpG islands, complete sequence Length = 210845 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 60002 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 60061 Query: 406 gttgtc 411 |||||| Sbjct: 60062 gttgtc 60067 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 52627 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 52686 Query: 406 gttgtc 411 |||||| Sbjct: 52687 gttgtc 52692
>emb|AL589651.8| Mouse DNA sequence from clone RP23-138F20 on chromosome 13 Contains five genes for olfactory receptors, a novel gene, the H1f5 gene for H1 histone family member 5, three genes and one pseudogene for H2a histone family members, four genes for H2b, two genes for H4, and two genes for H3 histone family members and seven CpG islands, complete sequence Length = 222823 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 207927 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 207986 Query: 406 gttgtc 411 |||||| Sbjct: 207987 gttgtc 207992 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 142528 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 142587 Query: 406 gttgtc 411 |||||| Sbjct: 142588 gttgtc 142593 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 137693 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 137634 Query: 406 gttgtc 411 |||||| Sbjct: 137633 gttgtc 137628 Score = 52.0 bits (26), Expect = 0.002 Identities = 56/66 (84%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | ||||| |||||||| Sbjct: 174536 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggataatgcgcgtcttctt 174595 Query: 406 gttgtc 411 |||||| Sbjct: 174596 gttgtc 174601
>emb|AL590388.4| Mouse DNA sequence from clone RP23-480B19 on chromosome 13 Contains the Slc17a1 gene for solute carrier family 17 (vesicular glutamate transporter) member 1, two genes for novel solute carrier family 17 (Slc17) members, two novel genes, the gene for a novel C3HC4 type zinc finger (ring finger) protein, the gene for an H2a, an H2b, two genes for H3 and two genes for H4 histone family members, a H2a histone family pseudogene, the H1f1 and H1f2 genes for H1 histone family members 1 and 2, the H3f2 gene for H3 histone family, member 2 (H3.2), a novel pseudogene, the Hfe gene for hemochromatosis protein (Mr2) and two CpG islands, complete sequence Length = 186062 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 142102 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 142043 Query: 406 gttgtc 411 |||||| Sbjct: 142042 gttgtc 142037 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 136964 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 137023 Query: 406 gttgtc 411 |||||| Sbjct: 137024 gttgtc 137029
>gb|BC065803.1| Mus musculus histone 1, H2ag, mRNA (cDNA clone MGC:73771 IMAGE:1263745), complete cds Length = 527 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 304 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 245 Query: 406 gttgtc 411 |||||| Sbjct: 244 gttgtc 239
>gb|BC076498.1| Mus musculus histone 1, H2ae, mRNA (cDNA clone MGC:90847 IMAGE:5713252), complete cds Length = 492 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 312 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 253 Query: 406 gttgtc 411 |||||| Sbjct: 252 gttgtc 247
>gb|BC005468.1| Mus musculus H2A histone family, member X, mRNA (cDNA clone MGC:6616 IMAGE:3490058), complete cds Length = 1367 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 323 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 264 Query: 406 gttgtc 411 |||||| Sbjct: 263 gttgtc 258
>gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 2, complete sequence Length = 1632307 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||| |||||||| |||||||||||||| | ||||| || ||||| |||| |||||| Sbjct: 161666 gagctcttcgtcgtttcggacggcaagctgaaggtgtcgggggacgatacgggacttctt 161725 Query: 406 gttgtc 411 |||||| Sbjct: 161726 gttgtc 161731
>emb|CR624886.1| full-length cDNA clone CS0DK009YH13 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1446 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 312 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 253 Query: 406 gttgtc 411 |||||| Sbjct: 252 gttgtc 247
>emb|CR621753.1| full-length cDNA clone CS0DI059YA15 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1462 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 312 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 253 Query: 406 gttgtc 411 |||||| Sbjct: 252 gttgtc 247
>gb|BC032686.1| Homo sapiens, clone IMAGE:5581652, mRNA Length = 1138 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||| || Sbjct: 333 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 274 Query: 406 gttgtc 411 |||||| Sbjct: 273 gttgtc 268
>emb|CR608156.1| full-length cDNA clone CS0DI013YB19 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1620 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 298 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 239 Query: 406 gttgtc 411 |||||| Sbjct: 238 gttgtc 233
>dbj|AK145443.1| Mus musculus 5 days embryo whole body cDNA, RIKEN full-length enriched library, clone:I0C0045N09 product:histone 1, H2ad, full insert sequence Length = 446 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 315 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 256 Query: 406 gttgtc 411 |||||| Sbjct: 255 gttgtc 250
>dbj|AK146117.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730004H15 product:histone 1, H2ai, full insert sequence Length = 1396 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 294 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 235 Query: 406 gttgtc 411 |||||| Sbjct: 234 gttgtc 229
>dbj|AK146846.1| Mus musculus 17 days embryo heart cDNA, RIKEN full-length enriched library, clone:I920064A15 product:histone 1, H2ad, full insert sequence Length = 445 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 313 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 254 Query: 406 gttgtc 411 |||||| Sbjct: 253 gttgtc 248
>gb|U91328.1|HSU91328 Human hereditary haemochromatosis region, histone 2A-like protein gene, hereditary haemochromatosis (HLA-H) gene, RoRet gene, and sodium phosphate transporter (NPT3) gene, complete cds Length = 246282 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 16545 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 16604 Query: 406 gttgtc 411 |||||| Sbjct: 16605 gttgtc 16610 Score = 42.1 bits (21), Expect = 1.5 Identities = 54/65 (83%) Strand = Plus / Minus Query: 347 agctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttcttg 406 ||||||||||| ||||||| ||| | || | || ||||| | |||||||||||||||| Sbjct: 107771 agctcctcgtcattgcggatggccaattgcaggtggcgcgggatgatgcgggtcttcttg 107712 Query: 407 ttgtc 411 ||||| Sbjct: 107711 ttgtc 107707
>gb|U90551.1|HSU90551 Human histone 2A-like protein (H2A/l) mRNA, complete cds Length = 1666 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 379 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgagtcttctt 320 Query: 406 gttgtc 411 |||||| Sbjct: 319 gttgtc 314
>dbj|AK158457.1| Mus musculus adult inner ear cDNA, RIKEN full-length enriched library, clone:F930118D21 product:unclassifiable, full insert sequence Length = 2833 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 520 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 579 Query: 406 gttgtc 411 |||||| Sbjct: 580 gttgtc 585
>ref|NM_175660.2| Mus musculus histone 1, H2ab (Hist1h2ab), mRNA Length = 506 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 327 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 268 Query: 406 gttgtc 411 |||||| Sbjct: 267 gttgtc 262
>gb|BC090402.1| Mus musculus cDNA clone MGC:103288 IMAGE:5150365, complete cds Length = 447 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 294 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 235 Query: 406 gttgtc 411 |||||| Sbjct: 234 gttgtc 229
>gb|BC062251.1| Mus musculus cDNA clone MGC:73635 IMAGE:1224905, complete cds Length = 444 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 294 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 235 Query: 406 gttgtc 411 |||||| Sbjct: 234 gttgtc 229
>gb|BC069947.1| Mus musculus cDNA clone IMAGE:6494016 Length = 2110 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 552 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 493 Query: 406 gttgtc 411 |||||| Sbjct: 492 gttgtc 487
>gb|BC055904.1| Mus musculus cDNA clone IMAGE:4913108 Length = 2221 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 550 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 491 Query: 406 gttgtc 411 |||||| Sbjct: 490 gttgtc 485
>dbj|AK006728.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:1700048I17 product:histone gene complex 2, full insert sequence Length = 578 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 325 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 266 Query: 406 gttgtc 411 |||||| Sbjct: 265 gttgtc 260
>ref|NM_178186.2| Mus musculus histone 1, H2ag (Hist1h2ag), mRNA Length = 527 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 304 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 245 Query: 406 gttgtc 411 |||||| Sbjct: 244 gttgtc 239
>ref|NM_178187.2| Mus musculus histone 1, H2ae (Hist1h2ae), mRNA Length = 705 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 395 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 336 Query: 406 gttgtc 411 |||||| Sbjct: 335 gttgtc 330
>ref|NM_178188.3| Mus musculus histone 1, H2ad (Hist1h2ad), mRNA Length = 393 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>dbj|AK088040.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430002L09 product:H2A histone family, member X, full insert sequence Length = 1379 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 352 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 293 Query: 406 gttgtc 411 |||||| Sbjct: 292 gttgtc 287
>dbj|AK077055.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4932439K17 product:histone gene complex 2, full insert sequence Length = 2876 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 140 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgagtcttctt 81 Query: 406 gttgtc 411 |||||| Sbjct: 80 gttgtc 75
>dbj|AK002725.1| Mus musculus adult male kidney cDNA, RIKEN full-length enriched library, clone:0610031H01 product:histone gene complex 2, full insert sequence Length = 545 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 326 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 267 Query: 406 gttgtc 411 |||||| Sbjct: 266 gttgtc 261
>dbj|AK016171.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930558E18 product:histone gene complex 2, full insert sequence Length = 1059 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 100 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 159 Query: 406 gttgtc 411 |||||| Sbjct: 160 gttgtc 165
>gb|AF255739.1|AF255739 Bufo bufo gagarizans replication-dependent histone H2A gene, complete cds Length = 2120 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||| ||||| ||||| | || || || | ||||||||||||||| Sbjct: 1087 gagctcctcgtcgttgcgcacggccagctgcaggtgacgggggatgatgcgggtcttctt 1028 Query: 406 gttgtc 411 |||||| Sbjct: 1027 gttgtc 1022
>gb|U62674.1|MMU62674 Mus musculus histone H2a.2-615 (H2a-615), and histone H3.2-615 (H3-615) genes, complete cds Length = 2997 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 1288 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1229 Query: 406 gttgtc 411 |||||| Sbjct: 1228 gttgtc 1223
>gb|U62673.1|MMU62673 Mus musculus histone H2a(A)-613, histone H2a(B)-613, and histone H2b-613 (H2b) genes, complete cds Length = 2618 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 1311 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1370 Query: 406 gttgtc 411 |||||| Sbjct: 1371 gttgtc 1376
>gb|U62669.1|MMU62669 Mus musculus histone H3.2-F (H3-F), histone H2a.1-F (H2a-F), histone H2b-F (H2b-F) genes, complete cds Length = 2822 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 1547 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 1606 Query: 406 gttgtc 411 |||||| Sbjct: 1607 gttgtc 1612
>dbj|AK008124.1| Mus musculus adult male small intestine cDNA, RIKEN full-length enriched library, clone:2010005I09 product:H2A histone family, member X, full insert sequence Length = 564 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 349 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 290 Query: 406 gttgtc 411 |||||| Sbjct: 289 gttgtc 284
>dbj|AK028129.1| Mus musculus adult male stomach cDNA, RIKEN full-length enriched library, clone:2210403F13 product:histone gene complex 2, full insert sequence Length = 2428 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 578 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 637 Query: 406 gttgtc 411 |||||| Sbjct: 638 gttgtc 643
>dbj|AK028026.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length enriched library, clone:1190022L06 product:HISTONE H2A homolog [Homo sapiens], full insert sequence Length = 705 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 395 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 336 Query: 406 gttgtc 411 |||||| Sbjct: 335 gttgtc 330
>dbj|AK033518.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched library, clone:9030420B16 product:histone 1, H2ac, full insert sequence Length = 2493 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 326 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 267 Query: 406 gttgtc 411 |||||| Sbjct: 266 gttgtc 261
>gb|BC093851.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MGC:120886 IMAGE:7939696), complete cds Length = 457 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| || |||| || ||||| | ||| ||||||||||| Sbjct: 329 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 270 Query: 406 gttgtc 411 |||||| Sbjct: 269 gttgtc 264
>gb|BC093849.1| Homo sapiens histone 1, H2ai, mRNA (cDNA clone MGC:120884 IMAGE:7939694), complete cds Length = 457 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| || |||| || ||||| | ||| ||||||||||| Sbjct: 329 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 270 Query: 406 gttgtc 411 |||||| Sbjct: 269 gttgtc 264
>ref|NM_178184.1| Mus musculus histone 1, H2an (Hist1h2an), mRNA Length = 393 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|NM_178182.1| Mus musculus histone 1, H2ai (Hist1h2ai), mRNA Length = 393 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>ref|NM_178212.1| Mus musculus histone 2, H2aa2 (Hist2h2aa2), mRNA Length = 393 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 282 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 223 Query: 406 gttgtc 411 |||||| Sbjct: 222 gttgtc 217
>gb|AY131993.1| Homo sapiens histone H2A (HIST1H2AM) gene, complete cds Length = 1119 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||| || Sbjct: 655 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggatgatgcgggtcttttt 596 Query: 406 gttgtc 411 |||||| Sbjct: 595 gttgtc 590
>gb|AY131992.1| Homo sapiens histone H2A (HIST1H2AL) gene, complete cds Length = 1173 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||||||||||| Sbjct: 674 gagctcctcgtcgttgcggatggccagctgcaagtggcgcgggataatgcgggtcttctt 615 Query: 406 gttgtc 411 |||||| Sbjct: 614 gttgtc 609
>gb|AY131990.1| Homo sapiens histone H2A (HIST1H2AJ) gene, complete cds Length = 1119 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 655 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 596 Query: 406 gttgtc 411 |||||| Sbjct: 595 gttgtc 590
>gb|AY131989.1| Homo sapiens histone H2A (HIST1H2AI) gene, complete cds Length = 1173 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 ||||||||| |||||||||| ||| ||||||| || ||||| | |||||| |||||||| Sbjct: 674 gagctcctcatcgttgcggatggccagctggaggtgacgcgggatgatgcgagtcttctt 615 Query: 406 gttgtc 411 |||||| Sbjct: 614 gttgtc 609
>gb|AY131988.1| Homo sapiens histone H2A (HIST1H2AH) gene, complete cds Length = 1155 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| || |||| || ||||| | ||| ||||||||||| Sbjct: 668 gagctcctcgtcgttgcggatggccagttggaggtgacgcgggatgatacgggtcttctt 609 Query: 406 gttgtc 411 |||||| Sbjct: 608 gttgtc 603
>gb|AY158953.1| Mus musculus histone protein Hist2h3c2 gene, complete cds Length = 1440 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 502 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 561 Query: 406 gttgtc 411 |||||| Sbjct: 562 gttgtc 567
>gb|AY158925.1| Mus musculus histone protein Hist2h2aa1 gene, complete cds Length = 1387 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 779 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 720 Query: 406 gttgtc 411 |||||| Sbjct: 719 gttgtc 714
>gb|AY158924.1| Mus musculus histone protein Hist2h2aa2 gene, complete cds Length = 1387 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 779 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 720 Query: 406 gttgtc 411 |||||| Sbjct: 719 gttgtc 714
>gb|AY158923.1| Mus musculus histone protein Hist2h2ac gene, complete cds Length = 1200 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 590 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 531 Query: 406 gttgtc 411 |||||| Sbjct: 530 gttgtc 525
>gb|AY158920.1| Mus musculus histone protein Hist1h2ab gene, complete cds Length = 1390 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723 Query: 406 gttgtc 411 |||||| Sbjct: 722 gttgtc 717
>gb|AY158919.1| Mus musculus histone protein Hist1h2ac gene, complete cds Length = 1390 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723 Query: 406 gttgtc 411 |||||| Sbjct: 722 gttgtc 717
>gb|AY158918.1| Mus musculus histone protein Hist1h2ad gene, complete cds Length = 1390 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723 Query: 406 gttgtc 411 |||||| Sbjct: 722 gttgtc 717
>gb|AY158917.1| Mus musculus histone protein Hist1h2ae gene, complete cds Length = 1390 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723 Query: 406 gttgtc 411 |||||| Sbjct: 722 gttgtc 717
>gb|AY158916.1| Mus musculus histone protein Hist1h2af gene, complete cds Length = 1390 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 806 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 747 Query: 406 gttgtc 411 |||||| Sbjct: 746 gttgtc 741
>gb|AY158915.1| Mus musculus histone protein Hist1h2ag gene, complete cds Length = 1392 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 781 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 722 Query: 406 gttgtc 411 |||||| Sbjct: 721 gttgtc 716
>gb|AY158914.1| Mus musculus histone protein Hist1h2ah gene, complete cds Length = 1381 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 779 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 720 Query: 406 gttgtc 411 |||||| Sbjct: 719 gttgtc 714
>gb|AY158913.1| Mus musculus histone protein Hist1h2ao gene, complete cds Length = 1390 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723 Query: 406 gttgtc 411 |||||| Sbjct: 722 gttgtc 717
>gb|AY158912.1| Mus musculus histone protein Hist1h2an gene, complete cds Length = 1390 Score = 60.0 bits (30), Expect = 6e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 346 gagctcctcgtcgttgcggacggcaagctggatatgtcgcggcacgatgcgggtcttctt 405 |||||||||||||||||||| ||| ||||| | || ||||| | |||||| |||||||| Sbjct: 782 gagctcctcgtcgttgcggatggccagctgcaggtggcgcgggatgatgcgcgtcttctt 723 Query: 406 gttgtc 411 |||||| Sbjct: 722 gttgtc 717 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,484,081 Number of Sequences: 3902068 Number of extensions: 2484081 Number of successful extensions: 51247 Number of sequences better than 10.0: 598 Number of HSP's better than 10.0 without gapping: 597 Number of HSP's successfully gapped in prelim test: 7 Number of HSP's that attempted gapping in prelim test: 49660 Number of HSP's gapped (non-prelim): 1481 length of query: 428 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 406 effective length of database: 17,147,199,772 effective search space: 6961763107432 effective search space used: 6961763107432 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
