ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd17b01 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|D13472.2|BLYINOPP Hordeum vulgare mRNA for vacuolar membrane proton-translocating inorganic pyrophosphatase, complete cds Length = 2649 Score = 821 bits (414), Expect = 0.0 Identities = 501/521 (96%), Gaps = 17/521 (3%) Strand = Plus / Minus Query: 7 aagggtgggttnaa-cattatcgtcgtcatcatgggacgaggaaaatttgccaggcacat 65 ||||||||||| || ||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 2626 aagggtgggttcaaacattatcgtcgtcatcatgggacgaggaaaatttgccagacacat 2567 Query: 66 accaacgagggaggacatctggtctctctcttctactacatggagctacaagccggtaat 125 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 2566 accaacgagggaggacatctggtctctctcttctactacatggagctacaagccg-taat 2508 Query: 126 gtaatggtgagactaacataacgccttcaagaggccaggggaaaggggggtaggtaaccg 185 |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| | Sbjct: 2507 gtaatg-tgagactaacataacgc-ttcaagaggccaggggaaaggggggtaggtaactg 2450 Query: 186 cggcaatcctggaatgacattgacaaccaaaaataacagcagcgcacaacgtacgaa--- 242 ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2449 cggcaatcctgga-tgacattgacaaccaaaaataacagcagcgcacaacgtacgaacgg 2391 Query: 243 --ggcgggcgggcaggcaggcgggggagttattcgtgacagtgtctgtagatcatcgctc 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2390 cgggcgggcgggcaggcaggcgggggagttattcgtgacagtgtctgtagatcatcgctc 2331 Query: 301 gactc-----gagtcctctagatgtacttgaacagcagacctccgtacgtggcgaagaag 355 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2330 gactcatcacgagtcctctagatgtacttgaacagcagacctccgtacgtggcgaagaag 2271 Query: 356 ggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgacgggcct 415 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2270 ggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgacgggcc- 2212 Query: 416 tgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcccttgtggcagt 475 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 2211 tgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcgg-ccttgtggcagt 2153 Query: 476 ctgaacccttgggaccaagggacctcgcatgctcgctgttg 516 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 2152 ctgaacccttgggaccaagggacctcgcatgctcgctgttg 2112
>gb|AY296911.1| Triticum aestivum vacuolar proton-inorganic pyrophosphatase mRNA, complete cds Length = 2671 Score = 325 bits (164), Expect = 8e-86 Identities = 202/212 (95%), Gaps = 2/212 (0%) Strand = Plus / Minus Query: 305 cgagtcctctagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaac 364 |||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 2327 cgagtcttctagatgtacttgaacagcacacctccgtacgtggcgaagaagggcgcgaac 2268 Query: 365 acgagggactcaacggccatgagcttgatgaggatgttgagcgacgggccttgaggtgtc 424 ||||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||| Sbjct: 2267 acgagggactcgacggccatcagcttgatgaggatgttgagcgacgggcc-tgaggtgtc 2209 Query: 425 cttgagggggtctccgatggtgtcaccgatcacggcggcccttgtggcagtctgaaccct 484 |||||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||| Sbjct: 2208 cttgagggggtctccgatggtgtcgccgatcacggccg-ccttgtggcagtctgaaccct 2150 Query: 485 tgggaccaagggacctcgcatgctcgctgttg 516 |||| |||||||||||||| |||||||||||| Sbjct: 2149 tggggccaagggacctcgcgtgctcgctgttg 2118 Score = 170 bits (86), Expect = 3e-39 Identities = 210/244 (86%), Gaps = 18/244 (7%) Strand = Plus / Minus Query: 19 aacattatcgtcgtcatcatgggacgaggaaaatttgccaggcacataccaacgagg--- 75 ||||||||||||||||||| ||||||||||||||||||||| |||||||||| | | Sbjct: 2610 aacattatcgtcgtcatcacgggacgaggaaaatttgccagacacataccaataatgacc 2551 Query: 76 gaggacatctggtctctctcttctactacatggagctacaagccggtaatgtaatggtga 135 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 2550 gaggacatctggtctctctcttctactacatggagctacaagccg-----gtaatggtga 2496 Query: 136 gactaacataacgccttcaagaggcc-aggggaaag-gggggtaggtaaccgcggcaatc 193 ||||||| |||| | ||||||||| | ||||||| ||||||| ||| ||||||||| Sbjct: 2495 gactaacgtaacacacccaagaggccaaagggaaagtgggggta---aactgcggcaatc 2439 Query: 194 ctgg---aatgacattgacaaccaaaaataacagcagcgcacaacgtacgaa-ggcgggc 249 |||| ||||||| | |||||||||||||||||||||||||| |||||| ||||||| Sbjct: 2438 ctggaataatgaca-caagaaccaaaaataacagcagcgcacaacatacgaacggcgggc 2380 Query: 250 gggc 253 |||| Sbjct: 2379 gggc 2376
>ref|XM_476313.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2304 Score = 240 bits (121), Expect = 4e-60 Identities = 174/189 (92%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 321 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 380 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 2296 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 2237 Query: 381 ccatgagcttgatgaggatgttgagcgacgggccttgaggtgtccttgagggggtctccg 440 |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| Sbjct: 2236 ccatgagcttgatgaggatgttgagcgacgggcc-tgatgtgtccttgagggggtctcca 2178 Query: 441 atggtgtcaccgatcacggcggcccttgtggcagtctgaacccttgggaccaagggacct 500 |||||||||||||||||||||| |||||||||||||||| |||||||||||||||| || Sbjct: 2177 atggtgtcaccgatcacggcgg-ccttgtggcagtctgatcccttgggaccaagggtccg 2119 Query: 501 cgcatgctc 509 |||||||| Sbjct: 2118 agcatgctc 2110
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 240 bits (121), Expect = 4e-60 Identities = 174/189 (92%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 321 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 380 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 3934784 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 3934725 Query: 381 ccatgagcttgatgaggatgttgagcgacgggccttgaggtgtccttgagggggtctccg 440 |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| Sbjct: 3934724 ccatgagcttgatgaggatgttgagcgacgggcc-tgatgtgtccttgagggggtctcca 3934666 Query: 441 atggtgtcaccgatcacggcggcccttgtggcagtctgaacccttgggaccaagggacct 500 |||||||||||||||||||||| |||||||||||||||| |||||||||||||||| || Sbjct: 3934665 atggtgtcaccgatcacggcgg-ccttgtggcagtctgatcccttgggaccaagggtccg 3934607 Query: 501 cgcatgctc 509 |||||||| Sbjct: 3934606 agcatgctc 3934598 Score = 123 bits (62), Expect = 6e-25 Identities = 142/166 (85%), Gaps = 2/166 (1%) Strand = Plus / Minus Query: 344 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 403 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 25894188 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 25894129 Query: 404 agcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggc 463 ||||| ||||| ||||||||||||||| || || || |||||||| |||||||| || | Sbjct: 25894128 agcgaggggcc-tgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcag- 25894071 Query: 464 ccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 |||||||||||||||| || || || || |||| ||| |||||||| Sbjct: 25894070 ccttgtggcagtctgagcctttcgggcccagggtccttgcatgctc 25894025 Score = 81.8 bits (41), Expect = 2e-12 Identities = 41/41 (100%) Strand = Plus / Minus Query: 19 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 59 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 3935066 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 3935026
>dbj|AP003019.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0035I03 Length = 153749 Score = 240 bits (121), Expect = 4e-60 Identities = 174/189 (92%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 321 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 380 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 40660 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 40601 Query: 381 ccatgagcttgatgaggatgttgagcgacgggccttgaggtgtccttgagggggtctccg 440 |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| Sbjct: 40600 ccatgagcttgatgaggatgttgagcgacgggcc-tgatgtgtccttgagggggtctcca 40542 Query: 441 atggtgtcaccgatcacggcggcccttgtggcagtctgaacccttgggaccaagggacct 500 |||||||||||||||||||||| |||||||||||||||| |||||||||||||||| || Sbjct: 40541 atggtgtcaccgatcacggcgg-ccttgtggcagtctgatcccttgggaccaagggtccg 40483 Query: 501 cgcatgctc 509 |||||||| Sbjct: 40482 agcatgctc 40474 Score = 81.8 bits (41), Expect = 2e-12 Identities = 41/41 (100%) Strand = Plus / Minus Query: 19 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 59 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 40942 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 40902
>dbj|AK066933.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013091F19, full insert sequence Length = 2738 Score = 240 bits (121), Expect = 4e-60 Identities = 174/189 (92%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 321 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 380 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 2405 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 2346 Query: 381 ccatgagcttgatgaggatgttgagcgacgggccttgaggtgtccttgagggggtctccg 440 |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| Sbjct: 2345 ccatgagcttgatgaggatgttgagcgacgggcc-tgatgtgtccttgagggggtctcca 2287 Query: 441 atggtgtcaccgatcacggcggcccttgtggcagtctgaacccttgggaccaagggacct 500 |||||||||||||||||||||| |||||||||||||||| |||||||||||||||| || Sbjct: 2286 atggtgtcaccgatcacggcgg-ccttgtggcagtctgatcccttgggaccaagggtccg 2228 Query: 501 cgcatgctc 509 |||||||| Sbjct: 2227 agcatgctc 2219 Score = 81.8 bits (41), Expect = 2e-12 Identities = 41/41 (100%) Strand = Plus / Minus Query: 19 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 59 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 2687 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 2647
>dbj|AB012766.1| Oryza sativa gene for ovp2, complete cds Length = 5985 Score = 240 bits (121), Expect = 4e-60 Identities = 174/189 (92%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 321 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 380 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 5664 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 5605 Query: 381 ccatgagcttgatgaggatgttgagcgacgggccttgaggtgtccttgagggggtctccg 440 |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| Sbjct: 5604 ccatgagcttgatgaggatgttgagcgacgggcc-tgatgtgtccttgagggggtctcca 5546 Query: 441 atggtgtcaccgatcacggcggcccttgtggcagtctgaacccttgggaccaagggacct 500 |||||||||||||||||||||| |||||||||||||||| |||||||||||||||| || Sbjct: 5545 atggtgtcaccgatcacggcgg-ccttgtggcagtctgatcccttgggaccaagggtccg 5487 Query: 501 cgcatgctc 509 |||||||| Sbjct: 5486 agcatgctc 5478 Score = 81.8 bits (41), Expect = 2e-12 Identities = 41/41 (100%) Strand = Plus / Minus Query: 19 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 59 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 5946 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 5906
>dbj|D45384.1| Oryza sativa mRNA for vacuolar H+-pyrophosphatase, complete cds Length = 2710 Score = 240 bits (121), Expect = 4e-60 Identities = 174/189 (92%), Gaps = 2/189 (1%) Strand = Plus / Minus Query: 321 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 380 |||||||||||||||| |||| ||||||||||| ||||| ||||| |||||||| |||| Sbjct: 2390 acttgaacagcagaccaccgtgtgtggcgaagaaaggcgcaaacacaagggactcgacgg 2331 Query: 381 ccatgagcttgatgaggatgttgagcgacgggccttgaggtgtccttgagggggtctccg 440 |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||| Sbjct: 2330 ccatgagcttgatgaggatgttgagcgacgggcc-tgatgtgtccttgagggggtctcca 2272 Query: 441 atggtgtcaccgatcacggcggcccttgtggcagtctgaacccttgggaccaagggacct 500 |||||||||||||||||||||| |||||||||||||||| |||||||||||||||| || Sbjct: 2271 atggtgtcaccgatcacggcgg-ccttgtggcagtctgatcccttgggaccaagggtccg 2213 Query: 501 cgcatgctc 509 |||||||| Sbjct: 2212 agcatgctc 2204 Score = 81.8 bits (41), Expect = 2e-12 Identities = 41/41 (100%) Strand = Plus / Minus Query: 19 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 59 ||||||||||||||||||||||||||||||||||||||||| Sbjct: 2672 aacattatcgtcgtcatcatgggacgaggaaaatttgccag 2632
>dbj|AB032839.1| Hordeum vulgare HVP1 mRNA for vacuolar proton-inorganic pyrophosphatase, complete cds Length = 2757 Score = 186 bits (94), Expect = 5e-44 Identities = 132/142 (92%), Gaps = 2/142 (1%) Strand = Plus / Minus Query: 335 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 394 ||||| || |||||||||||||| |||||||||||||||||||| ||||||||||||||| Sbjct: 2376 cctccataggtggcgaagaagggggcgaacacgagggactcaaccgccatgagcttgatg 2317 Query: 395 aggatgttgagcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgat 454 |||||||||||||| ||||| |||||||||||||| ||||| ||||||||||||||||| Sbjct: 2316 aggatgttgagcgaggggcc-cgaggtgtccttgagagggtccccgatggtgtcaccgat 2258 Query: 455 cacggcggcccttgtggcagtc 476 |||||||| ||||||||||||| Sbjct: 2257 cacggcgg-ccttgtggcagtc 2237
>gb|AY103622.1| Zea mays PCO084888 mRNA sequence Length = 2801 Score = 180 bits (91), Expect = 3e-42 Identities = 171/195 (87%), Gaps = 2/195 (1%) Strand = Plus / Minus Query: 319 gtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaac 378 ||||||||| ||||| || || | ||||| |||||||| || |||||||||||||| || Sbjct: 2373 gtacttgaagagcaggccaccctgggtggcaaagaagggggcaaacacgagggactccac 2314 Query: 379 ggccatgagcttgatgaggatgttgagcgacgggccttgaggtgtccttgagggggtctc 438 ||||||||||||||||||||||||||| |||||||| ||||||||||| |||||||| | Sbjct: 2313 ggccatgagcttgatgaggatgttgagggacgggcc-ggaggtgtccttcagggggtcac 2255 Query: 439 cgatggtgtcaccgatcacggcggcccttgtggcagtctgaacccttgggaccaagggac 498 | ||||||||||| ||||| |||| ||||||||||||| || ||||||||||| |||| | Sbjct: 2254 caatggtgtcacctatcacagcgg-ccttgtggcagtcggatcccttgggaccgagggtc 2196 Query: 499 ctcgcatgctcgctg 513 ||||| ||||||||| Sbjct: 2195 ctcgcgtgctcgctg 2181
>gb|AY255181.1| Hordeum brevisubulatum vacuolar proton-inorganic pyrophosphatase (AVP1) mRNA, complete cds Length = 2777 Score = 176 bits (89), Expect = 5e-41 Identities = 133/145 (91%), Gaps = 2/145 (1%) Strand = Plus / Minus Query: 335 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 394 |||||||| |||||||||||||| ||||||||||||||||| || ||||||||||||||| Sbjct: 2338 cctccgtaggtggcgaagaagggggcgaacacgagggactcgaccgccatgagcttgatg 2279 Query: 395 aggatgttgagcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgat 454 |||||||||||||| ||||| |||||||||||||| ||||| ||||||||||| ||||| Sbjct: 2278 aggatgttgagcgaggggcc-cgaggtgtccttgagagggtccccgatggtgtcgccgat 2220 Query: 455 cacggcggcccttgtggcagtctga 479 ||| |||| |||||||||||||||| Sbjct: 2219 cactgcgg-ccttgtggcagtctga 2196
>emb|AJ621242.1| Oryza sativa mRNA for proton translocating pyrophosphatase (VP4 gene) Length = 2289 Score = 165 bits (83), Expect = 2e-37 Identities = 154/175 (88%), Gaps = 2/175 (1%) Strand = Plus / Minus Query: 335 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 394 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 2267 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 2208 Query: 395 aggatgttgagcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgat 454 |||||||| ||||||||||| || ||||||||||| ||||| ||||||||||| ||||| Sbjct: 2207 aggatgttcagcgacgggcc-cgacgtgtccttgagcgggtcgccgatggtgtcgccgat 2149 Query: 455 cacggcggcccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 ||| || | ||||||||||||| || |||||||| || || |||||||| ||||| Sbjct: 2148 caccgccg-ccttgtggcagtccgatcccttgggccccagcgacctcgcgtgctc 2095
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 157 bits (79), Expect = 4e-35 Identities = 153/175 (87%), Gaps = 2/175 (1%) Strand = Plus / Plus Query: 335 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 394 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 34229256 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 34229315 Query: 395 aggatgttgagcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgat 454 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| ||||| Sbjct: 34229316 aggatgttcagcgacgggcc-cgacgtgtccttgagcgggtcgccaatggtgtcgccgat 34229374 Query: 455 cacggcggcccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 ||| || | ||||||||||||| || |||||||| || || |||||||| ||||| Sbjct: 34229375 caccgccg-ccttgtggcagtccgatcccttgggccccagcgacctcgcgtgctc 34229428 Score = 147 bits (74), Expect = 4e-32 Identities = 145/166 (87%), Gaps = 2/166 (1%) Strand = Plus / Plus Query: 344 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 403 |||||||||||||| ||||| |||||||| || || |||||||||||||||||||||||| Sbjct: 4694181 gtggcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttg 4694240 Query: 404 agcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggc 463 || || ||| | ||| ||||||||||| ||||||||||||||||||||||| ||||| | Sbjct: 4694241 agaga-gggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccg- 4694298 Query: 464 ccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 |||||||| || ||||| ||||||||||||| ||| |||||||| Sbjct: 4694299 ccttgtggggatcggaacctttgggaccaagggtcctggcatgctc 4694344
>dbj|AP007227.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0032L17 Length = 165808 Score = 157 bits (79), Expect = 4e-35 Identities = 153/175 (87%), Gaps = 2/175 (1%) Strand = Plus / Plus Query: 335 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 394 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 156770 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 156829 Query: 395 aggatgttgagcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgat 454 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| ||||| Sbjct: 156830 aggatgttcagcgacgggcc-cgacgtgtccttgagcgggtcgccaatggtgtcgccgat 156888 Query: 455 cacggcggcccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 ||| || | ||||||||||||| || |||||||| || || |||||||| ||||| Sbjct: 156889 caccgccg-ccttgtggcagtccgatcccttgggccccagcgacctcgcgtgctc 156942
>dbj|AP005056.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0689B12 Length = 154745 Score = 157 bits (79), Expect = 4e-35 Identities = 153/175 (87%), Gaps = 2/175 (1%) Strand = Plus / Plus Query: 335 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 394 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 64529 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 64588 Query: 395 aggatgttgagcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgat 454 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| ||||| Sbjct: 64589 aggatgttcagcgacgggcc-cgacgtgtccttgagcgggtcgccaatggtgtcgccgat 64647 Query: 455 cacggcggcccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 ||| || | ||||||||||||| || |||||||| || || |||||||| ||||| Sbjct: 64648 caccgccg-ccttgtggcagtccgatcccttgggccccagcgacctcgcgtgctc 64701
>dbj|AB126350.1| Oryza sativa (japonica cultivar-group) OVP3 gene for vacuolar proton pyrophosphatase, complete cds Length = 5548 Score = 157 bits (79), Expect = 4e-35 Identities = 153/175 (87%), Gaps = 2/175 (1%) Strand = Plus / Minus Query: 335 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 394 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 5235 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 5176 Query: 395 aggatgttgagcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgat 454 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| ||||| Sbjct: 5175 aggatgttcagcgacgggcc-cgacgtgtccttgagcgggtcgccaatggtgtcgccgat 5117 Query: 455 cacggcggcccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 ||| || | ||||||||||||| || |||||||| || || |||||||| ||||| Sbjct: 5116 caccgccg-ccttgtggcagtccgatcccttgggccccagcgacctcgcgtgctc 5063
>dbj|AK102146.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086B11, full insert sequence Length = 2699 Score = 157 bits (79), Expect = 4e-35 Identities = 153/175 (87%), Gaps = 2/175 (1%) Strand = Plus / Minus Query: 335 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 394 ||||||| |||||||||||| ||||||||||| || ||||| |||||||||||||||||| Sbjct: 2376 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccatgagcttgatg 2317 Query: 395 aggatgttgagcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgat 454 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| ||||| Sbjct: 2316 aggatgttcagcgacgggcc-cgacgtgtccttgagcgggtcgccaatggtgtcgccgat 2258 Query: 455 cacggcggcccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 ||| || | ||||||||||||| || |||||||| || || |||||||| ||||| Sbjct: 2257 caccgccg-ccttgtggcagtccgatcccttgggccccagcgacctcgcgtgctc 2204
>dbj|AK064361.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-108-B10, full insert sequence Length = 2009 Score = 149 bits (75), Expect = 1e-32 Identities = 152/175 (86%), Gaps = 2/175 (1%) Strand = Plus / Minus Query: 335 cctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatg 394 ||||||| |||||||||||| ||||||||||| || ||||| |||||| ||||||||||| Sbjct: 1670 cctccgtgcgtggcgaagaatggcgcgaacaccagcgactcgacggccgtgagcttgatg 1611 Query: 395 aggatgttgagcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgat 454 |||||||| ||||||||||| || ||||||||||| ||||| || |||||||| ||||| Sbjct: 1610 aggatgttcagcgacgggcc-cgacgtgtccttgagcgggtcgccaatggtgtcgccgat 1552 Query: 455 cacggcggcccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 ||| || | ||||||||||||| || |||||||| || || |||||||| ||||| Sbjct: 1551 caccgccg-ccttgtggcagtccgatcccttgggccccagcgacctcgcgtgctc 1498
>ref|XM_464356.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2313 Score = 147 bits (74), Expect = 4e-32 Identities = 145/166 (87%), Gaps = 2/166 (1%) Strand = Plus / Minus Query: 344 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 403 |||||||||||||| ||||| |||||||| || || |||||||||||||||||||||||| Sbjct: 2282 gtggcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttg 2223 Query: 404 agcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggc 463 || || ||| | ||| ||||||||||| ||||||||||||||||||||||| ||||| | Sbjct: 2222 agaga-gggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccg- 2165 Query: 464 ccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 |||||||| || ||||| ||||||||||||| ||| |||||||| Sbjct: 2164 ccttgtggggatcggaacctttgggaccaagggtcctggcatgctc 2119
>dbj|AP004066.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1572_F02 Length = 93626 Score = 147 bits (74), Expect = 4e-32 Identities = 145/166 (87%), Gaps = 2/166 (1%) Strand = Plus / Plus Query: 344 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 403 |||||||||||||| ||||| |||||||| || || |||||||||||||||||||||||| Sbjct: 66253 gtggcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttg 66312 Query: 404 agcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggc 463 || || ||| | ||| ||||||||||| ||||||||||||||||||||||| ||||| | Sbjct: 66313 agaga-gggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccg- 66370 Query: 464 ccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 |||||||| || ||||| ||||||||||||| ||| |||||||| Sbjct: 66371 ccttgtggggatcggaacctttgggaccaagggtcctggcatgctc 66416
>dbj|AB126351.1| Oryza sativa (japonica cultivar-group) OVP5 gene for vacuolar proton pyrophosphatase, complete cds Length = 5595 Score = 143 bits (72), Expect = 6e-31 Identities = 143/164 (87%), Gaps = 2/164 (1%) Strand = Plus / Minus Query: 344 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 403 |||||||||||||| ||||| |||||||| || || |||||||||||||||||||||||| Sbjct: 5248 gtggcgaagaagggggcgaaaacgagggattcgaccgccatgagcttgatgaggatgttg 5189 Query: 404 agcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggc 463 || || ||| | ||| ||||||||||| ||||||||||||||||||||||| ||||| | Sbjct: 5188 agaga-gggtcctgaagtgtccttgagagggtctccgatggtgtcaccgatgacggccg- 5131 Query: 464 ccttgtggcagtctgaacccttgggaccaagggacctcgcatgc 507 |||||||| || ||||| ||||||||||||| ||| |||||| Sbjct: 5130 ccttgtggggatcggaacctttgggaccaagggtcctggcatgc 5087
>dbj|AB097115.1| Pyrus communis PVP3 mRNA for vacuolar proton-inorganic pyrophosphatase, complete cds Length = 2625 Score = 131 bits (66), Expect = 2e-27 Identities = 143/166 (86%), Gaps = 2/166 (1%) Strand = Plus / Minus Query: 344 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 403 |||||||||||||| || |||||||||||||| |||||||||||||| || ||||||||| Sbjct: 2337 gtggcgaagaagggagcaaacacgagggactccacggccatgagcttaataaggatgttg 2278 Query: 404 agcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggc 463 || || |||| ||||||||||||||| |||||||| ||||||||||| ||||| || | Sbjct: 2277 agtga-tggccctgaggtgtccttgagcgggtctccaatggtgtcaccaatcactgctg- 2220 Query: 464 ccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 ||||||| |||||||||||| || || |||| ||| |||||||| Sbjct: 2219 ccttgtgtgggtctgaacccttcgggccgagggtccttgcatgctc 2174
>emb|AJ304836.1|CRE304836 Chlamydomonas reinhardtii mRNA for proton-translocating inorganic pyrophosphatase (vppa gene) Length = 2381 Score = 127 bits (64), Expect = 4e-26 Identities = 114/128 (89%), Gaps = 2/128 (1%) Strand = Plus / Minus Query: 349 gaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcga 408 |||||||||||||||||| || ||||| ||||||||||||||||| |||||||||||||| Sbjct: 2277 gaagaagggcgcgaacaccagcgactccacggccatgagcttgatcaggatgttgagcga 2218 Query: 409 cgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcccttg 468 ||||| | |||||||||||| ||||| || | |||||| ||||||||||||| ||||| Sbjct: 2217 ggggccgt-tggtgtccttgagcgggtcgcccacggtgtcgccgatcacggcgg-ccttg 2160 Query: 469 tggcagtc 476 |||||||| Sbjct: 2159 tggcagtc 2152
>dbj|AP003568.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0017B12 Length = 157424 Score = 123 bits (62), Expect = 6e-25 Identities = 142/166 (85%), Gaps = 2/166 (1%) Strand = Plus / Minus Query: 344 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 403 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 49286 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 49227 Query: 404 agcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggc 463 ||||| ||||| ||||||||||||||| || || || |||||||| |||||||| || | Sbjct: 49226 agcgaggggcc-tgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcag- 49169 Query: 464 ccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 |||||||||||||||| || || || || |||| ||| |||||||| Sbjct: 49168 ccttgtggcagtctgagcctttcgggcccagggtccttgcatgctc 49123
>dbj|AK119631.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-E10, full insert sequence Length = 1674 Score = 123 bits (62), Expect = 6e-25 Identities = 142/166 (85%), Gaps = 2/166 (1%) Strand = Plus / Minus Query: 344 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 403 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 1300 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 1241 Query: 404 agcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggc 463 ||||| ||||| ||||||||||||||| || || || |||||||| |||||||| || | Sbjct: 1240 agcgaggggcc-tgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcag- 1183 Query: 464 ccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 |||||||||||||||| || || || || |||| ||| |||||||| Sbjct: 1182 ccttgtggcagtctgagcctttcgggcccagggtccttgcatgctc 1137
>dbj|AK099807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013098H04, full insert sequence Length = 3197 Score = 123 bits (62), Expect = 6e-25 Identities = 142/166 (85%), Gaps = 2/166 (1%) Strand = Plus / Minus Query: 344 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 403 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 2373 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 2314 Query: 404 agcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggc 463 ||||| ||||| ||||||||||||||| || || || |||||||| |||||||| || | Sbjct: 2313 agcgaggggcc-tgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcag- 2256 Query: 464 ccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 |||||||||||||||| || || || || |||| ||| |||||||| Sbjct: 2255 ccttgtggcagtctgagcctttcgggcccagggtccttgcatgctc 2210
>dbj|AB012765.1| Oryza sativa gene for ovp1, complete cds Length = 6410 Score = 123 bits (62), Expect = 6e-25 Identities = 142/166 (85%), Gaps = 2/166 (1%) Strand = Plus / Minus Query: 344 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 403 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 6016 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 5957 Query: 404 agcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggc 463 ||||| ||||| ||||||||||||||| || || || |||||||| |||||||| || | Sbjct: 5956 agcgaggggcc-tgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcag- 5899 Query: 464 ccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 |||||||||||||||| || || || || |||| ||| |||||||| Sbjct: 5898 ccttgtggcagtctgagcctttcgggcccagggtccttgcatgctc 5853
>dbj|D45383.1| Oryza sativa mRNA for vacuolar H+-pyrophosphatase, complete cds Length = 2742 Score = 123 bits (62), Expect = 6e-25 Identities = 142/166 (85%), Gaps = 2/166 (1%) Strand = Plus / Minus Query: 344 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 403 ||||||||||| || || |||||||| ||||| || ||||| |||||||||||||||||| Sbjct: 2349 gtggcgaagaacggggcaaacacgagcgactcgacagccatcagcttgatgaggatgttg 2290 Query: 404 agcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggc 463 ||||| ||||| ||||||||||||||| || || || |||||||| |||||||| || | Sbjct: 2289 agcgaggggcc-tgaggtgtccttgagaggatccccaatggtgtcgccgatcacagcag- 2232 Query: 464 ccttgtggcagtctgaacccttgggaccaagggacctcgcatgctc 509 |||||||||||||||| || || || || |||| ||| |||||||| Sbjct: 2231 ccttgtggcagtctgagcctttcgggcccagggtccttgcatgctc 2186
>ref|XM_475605.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2313 Score = 111 bits (56), Expect = 2e-21 Identities = 99/112 (88%), Gaps = 1/112 (0%) Strand = Plus / Minus Query: 346 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 405 |||||||||||| ||||| ||||| | ||| |||||||||||||||| |||||||||||| Sbjct: 2280 ggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgaggatgttgag 2221 Query: 406 cgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcac 457 ||| |||| |||||||||||||| ||||| ||||||||||| |||||||| Sbjct: 2220 cga-tggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcac 2170
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 111 bits (56), Expect = 2e-21 Identities = 99/112 (88%), Gaps = 1/112 (0%) Strand = Plus / Plus Query: 346 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 405 |||||||||||| ||||| ||||| | ||| |||||||||||||||| |||||||||||| Sbjct: 3275269 ggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgaggatgttgag 3275328 Query: 406 cgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcac 457 ||| |||| |||||||||||||| ||||| ||||||||||| |||||||| Sbjct: 3275329 cga-tggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcac 3275379
>dbj|AK109809.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-147-G08, full insert sequence Length = 1486 Score = 111 bits (56), Expect = 2e-21 Identities = 99/112 (88%), Gaps = 1/112 (0%) Strand = Plus / Plus Query: 346 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 405 |||||||||||| ||||| ||||| | ||| |||||||||||||||| |||||||||||| Sbjct: 23 ggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgaggatgttgag 82 Query: 406 cgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcac 457 ||| |||| |||||||||||||| ||||| ||||||||||| |||||||| Sbjct: 83 cga-tggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcac 133
>dbj|AK107275.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-126-A04, full insert sequence Length = 2661 Score = 111 bits (56), Expect = 2e-21 Identities = 99/112 (88%), Gaps = 1/112 (0%) Strand = Plus / Minus Query: 346 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 405 |||||||||||| ||||| ||||| | ||| |||||||||||||||| |||||||||||| Sbjct: 2375 ggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgaggatgttgag 2316 Query: 406 cgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcac 457 ||| |||| |||||||||||||| ||||| ||||||||||| |||||||| Sbjct: 2315 cga-tggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcac 2265
>gb|AC087425.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0676G05, complete sequence Length = 167317 Score = 111 bits (56), Expect = 2e-21 Identities = 99/112 (88%), Gaps = 1/112 (0%) Strand = Plus / Plus Query: 346 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 405 |||||||||||| ||||| ||||| | ||| |||||||||||||||| |||||||||||| Sbjct: 69093 ggcgaagaagggggcgaagacgagcgcctcgacggccatgagcttgacgaggatgttgag 69152 Query: 406 cgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcac 457 ||| |||| |||||||||||||| ||||| ||||||||||| |||||||| Sbjct: 69153 cga-tggccccgaggtgtccttgagcgggtcgccgatggtgtccccgatcac 69203
>gb|AF367446.1| Prunus persica clone Vp1 vacuolar H+-pyrophosphatase (vp1) mRNA, complete cds Length = 2619 Score = 107 bits (54), Expect = 4e-20 Identities = 100/114 (87%), Gaps = 1/114 (0%) Strand = Plus / Minus Query: 344 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 403 ||||| |||||||| || ||||| |||||||| || |||||||||||||||||||||||| Sbjct: 2346 gtggcaaagaagggagcaaacacaagggactccactgccatgagcttgatgaggatgttg 2287 Query: 404 agcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcac 457 || || ||||| |||||||||||| || ||||| || ||||||||||| ||||| Sbjct: 2286 agtgatgggcc-tgaggtgtccttcagtgggtccccaatggtgtcaccaatcac 2234
>gb|L32792.1|BEUPYROA Beta vulgaris clone P1 pyrophosphatase mRNA, complete cds Length = 2801 Score = 105 bits (53), Expect = 1e-19 Identities = 165/197 (83%), Gaps = 4/197 (2%) Strand = Plus / Minus Query: 314 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 373 |||| ||||||||| |||| || |||| |||||||||||||| |||||||| || ||| Sbjct: 2354 tagaggtacttgaagagcaagccaccgtgggtggcgaagaagggggcgaacactagtgac 2295 Query: 374 tcaacggccatgagcttgatgaggatgttgagcgacgggccttgaggtgtccttgagggg 433 || || ||||| |||||||| || |||||||| || || || ||| |||||||| || || Sbjct: 2294 tcgacagccataagcttgattagaatgttgagtgatggtcc-tgatgtgtccttaagtgg 2236 Query: 434 gtctccgatggtgtcaccgatcacggcggcccttgtg-gcagtctgaacccttgggacca 492 ||| |||||||||||||||||||| || | ||||||| ||| ||||| |||||||||||| Sbjct: 2235 gtcaccgatggtgtcaccgatcacagctg-ccttgtgtgca-tctgatcccttgggacca 2178 Query: 493 agggacctcgcatgctc 509 || | ||| |||||||| Sbjct: 2177 agtgtccttgcatgctc 2161
>emb|AJ715528.1| Zea mays mRNA for vacuolar H+-translocating inorganic pyrophosphatase (vpp1 gene) Length = 2631 Score = 91.7 bits (46), Expect = 2e-15 Identities = 92/106 (86%), Gaps = 1/106 (0%) Strand = Plus / Minus Query: 346 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 405 |||||||||||| ||||| || ||||| ||||| ||||| |||||||||||||||||||| Sbjct: 2268 ggcgaagaagggggcgaagacaagggattcaaccgccataagcttgatgaggatgttgag 2209 Query: 406 cgacgggccttgaggtgtccttgagggggtctccgatggtgtcacc 451 || ||||| || ||||||||||| || ||||| ||||||||||| Sbjct: 2208 ggaagggcc-agacgtgtccttgagaggatctccaatggtgtcacc 2164
>emb|AJ715529.1| Zea mays vpp1 gene for vacuolar H+-translocating inorganic pyrophosphatase, exons 1-8 Length = 9177 Score = 91.7 bits (46), Expect = 2e-15 Identities = 92/106 (86%), Gaps = 1/106 (0%) Strand = Plus / Minus Query: 346 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 405 |||||||||||| ||||| || ||||| ||||| ||||| |||||||||||||||||||| Sbjct: 8742 ggcgaagaagggggcgaagacaagggattcaaccgccataagcttgatgaggatgttgag 8683 Query: 406 cgacgggccttgaggtgtccttgagggggtctccgatggtgtcacc 451 || ||||| || ||||||||||| || ||||| ||||||||||| Sbjct: 8682 ggaagggcc-agacgtgtccttgagaggatctccaatggtgtcacc 8638
>gb|AF257777.1|AF257777 Vitis vinifera H+-pyrophosphatase mRNA, complete cds Length = 2745 Score = 91.7 bits (46), Expect = 2e-15 Identities = 120/142 (84%), Gaps = 2/142 (1%) Strand = Plus / Minus Query: 347 gcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagc 406 |||||||| || ||||| || | |||||| || |||||||||||||| ||||||||||| Sbjct: 2495 gcgaagaacggagcgaagaccaaggactcgaccgccatgagcttgatcaggatgttgagt 2436 Query: 407 gacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggccct 466 || ||||| ||||||||||||||||| || ||||| |||||||| ||||| || | ||| Sbjct: 2435 gaagggcc-agaggtgtccttgaggggatcgccgattgtgtcacctatcacagctg-cct 2378 Query: 467 tgtggcagtctgaacccttggg 488 ||||| |||||| |||||||| Sbjct: 2377 tgtgggggtctgaccccttggg 2356
>ref|NM_183912.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2322 Score = 89.7 bits (45), Expect = 8e-15 Identities = 122/145 (84%), Gaps = 2/145 (1%) Strand = Plus / Minus Query: 350 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 409 ||||| |||||||| ||||| || || ||||||||||||||||| | ||||||||||||| Sbjct: 2291 aagaatggcgcgaagacgagagattcgacggccatgagcttgatcaagatgttgagcgac 2232 Query: 410 gggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcccttgt 469 |||| || ||||||||||| ||||| || ||||| || |||||||| || | |||||| Sbjct: 2231 -ggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatcaccgccg-ccttgt 2174 Query: 470 ggcagtctgaacccttgggaccaag 494 | ||| ||||||||||||||||| Sbjct: 2173 gagcgtccgaacccttgggaccaag 2149
>gb|AY333187.1| Oryza sativa (japonica cultivar-group) H+-pyrophosphatase mRNA, complete cds Length = 2610 Score = 89.7 bits (45), Expect = 8e-15 Identities = 122/145 (84%), Gaps = 2/145 (1%) Strand = Plus / Minus Query: 350 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 409 ||||| |||||||| ||||| || || ||||||||||||||||| | ||||||||||||| Sbjct: 2388 aagaatggcgcgaagacgagagattcgacggccatgagcttgatcaagatgttgagcgac 2329 Query: 410 gggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcccttgt 469 |||| || ||||||||||| ||||| || ||||| || |||||||| || | |||||| Sbjct: 2328 -ggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatcaccgccg-ccttgt 2271 Query: 470 ggcagtctgaacccttgggaccaag 494 | ||| ||||||||||||||||| Sbjct: 2270 gagcgtccgaacccttgggaccaag 2246
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 89.7 bits (45), Expect = 8e-15 Identities = 122/145 (84%), Gaps = 2/145 (1%) Strand = Plus / Minus Query: 350 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 409 ||||| |||||||| ||||| || || ||||||||||||||||| | ||||||||||||| Sbjct: 13228730 aagaatggcgcgaagacgagagattcgacggccatgagcttgatcaagatgttgagcgac 13228671 Query: 410 gggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcccttgt 469 |||| || ||||||||||| ||||| || ||||| || |||||||| || | |||||| Sbjct: 13228670 -ggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatcaccgccg-ccttgt 13228613 Query: 470 ggcagtctgaacccttgggaccaag 494 | ||| ||||||||||||||||| Sbjct: 13228612 gagcgtccgaacccttgggaccaag 13228588
>dbj|AP003793.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0487E11 Length = 151303 Score = 89.7 bits (45), Expect = 8e-15 Identities = 122/145 (84%), Gaps = 2/145 (1%) Strand = Plus / Minus Query: 350 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 409 ||||| |||||||| ||||| || || ||||||||||||||||| | ||||||||||||| Sbjct: 101031 aagaatggcgcgaagacgagagattcgacggccatgagcttgatcaagatgttgagcgac 100972 Query: 410 gggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcccttgt 469 |||| || ||||||||||| ||||| || ||||| || |||||||| || | |||||| Sbjct: 100971 -ggcccggatgtgtccttgagcgggtcgccaatggtatcgccgatcaccgccg-ccttgt 100914 Query: 470 ggcagtctgaacccttgggaccaag 494 | ||| ||||||||||||||||| Sbjct: 100913 gagcgtccgaacccttgggaccaag 100889
>dbj|AP006375.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT32M04, TM0219, complete sequence Length = 72880 Score = 81.8 bits (41), Expect = 2e-12 Identities = 90/105 (85%), Gaps = 1/105 (0%) Strand = Plus / Minus Query: 347 gcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagc 406 ||||||||||| ||||||||||| |||||||| ||||| ||||||||||||||||| || Sbjct: 42907 gcgaagaagggtgcgaacacgagagactcaacagccattagcttgatgaggatgttaagt 42848 Query: 407 gacgggccttgaggtgtccttgagggggtctccgatggtgtcacc 451 || ||| | || || ||||| || |||||||| ||||||||||| Sbjct: 42847 ga-gggaccagatgtatccttaagagggtctccaatggtgtcacc 42804
>gb|AF367447.1| Prunus persica clone Vp2 vacuolar H+-pyrophosphatase (vp2) mRNA, complete cds Length = 2646 Score = 77.8 bits (39), Expect = 3e-11 Identities = 79/91 (86%), Gaps = 1/91 (1%) Strand = Plus / Minus Query: 370 ggactcaacggccatgagcttgatgaggatgttgagcgacgggccttgaggtgtccttga 429 ||||||||| |||||||||||||| || |||||||| || || || || |||||||||| Sbjct: 2340 ggactcaactgccatgagcttgataagaatgttgagtgaaggacca-gaagtgtccttga 2282 Query: 430 gggggtctccgatggtgtcaccgatcacggc 460 ||||||||||||| ||||| || |||||||| Sbjct: 2281 gggggtctccgattgtgtcgcctatcacggc 2251
>gb|BT018996.1| Zea mays clone Contig484.F mRNA sequence Length = 1100 Score = 75.8 bits (38), Expect = 1e-10 Identities = 90/106 (84%), Gaps = 1/106 (0%) Strand = Plus / Minus Query: 346 ggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgag 405 |||||||||||| ||||| || ||||| ||||| ||||| ||||||||||| |||||||| Sbjct: 580 ggcgaagaagggggcgaagacaagggattcaaccgccataagcttgatgagaatgttgag 521 Query: 406 cgacgggccttgaggtgtccttgagggggtctccgatggtgtcacc 451 || ||||| || ||||||||||| || ||||| || |||||||| Sbjct: 520 ggaggggcc-agacgtgtccttgagaggatctccaatagtgtcacc 476
>gb|AY514019.1| Hevea brasiliensis PPase mRNA, complete cds Length = 2807 Score = 75.8 bits (38), Expect = 1e-10 Identities = 96/114 (84%), Gaps = 1/114 (0%) Strand = Plus / Minus Query: 344 gtggcgaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttg 403 ||||| |||||||| || || ||||| || || || ||||| ||||||||||| |||||| Sbjct: 2386 gtggcaaagaagggagcaaagacgagagattccacagccataagcttgatgagaatgttg 2327 Query: 404 agcgacgggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcac 457 || || ||||| ||| |||||||| || ||||| |||||||||||||| ||||| Sbjct: 2326 agtgatgggcc-tgaagtgtccttaagtgggtcaccgatggtgtcaccaatcac 2274
>ref|NM_101437.2| Arabidopsis thaliana AVP1; ATPase AT1G15690 (AVP1) mRNA, complete cds Length = 3207 Score = 73.8 bits (37), Expect = 5e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 314 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 373 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 2437 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 2378 Query: 374 tcaacggccatgagcttgatgaggatgtt 402 ||||| ||||||||||||||||||||||| Sbjct: 2377 tcaacagccatgagcttgatgaggatgtt 2349
>gb|AY078953.1| Arabidopsis thaliana At1g15690/F7H2_3 mRNA, complete cds Length = 2669 Score = 73.8 bits (37), Expect = 5e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 314 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 373 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 2430 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 2371 Query: 374 tcaacggccatgagcttgatgaggatgtt 402 ||||| ||||||||||||||||||||||| Sbjct: 2370 tcaacagccatgagcttgatgaggatgtt 2342
>gb|AY065016.1| Arabidopsis thaliana At1g15690/F7H2_3 mRNA, complete cds Length = 2760 Score = 73.8 bits (37), Expect = 5e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 314 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 373 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 2430 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 2371 Query: 374 tcaacggccatgagcttgatgaggatgtt 402 ||||| ||||||||||||||||||||||| Sbjct: 2370 tcaacagccatgagcttgatgaggatgtt 2342
>dbj|AK221989.1| Arabidopsis thaliana mRNA for hypothetical protein, complete cds, clone: RAFL22-60-N09 Length = 717 Score = 73.8 bits (37), Expect = 5e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 314 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 373 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 532 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 473 Query: 374 tcaacggccatgagcttgatgaggatgtt 402 ||||| ||||||||||||||||||||||| Sbjct: 472 tcaacagccatgagcttgatgaggatgtt 444
>gb|BT002481.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 2680 Score = 73.8 bits (37), Expect = 5e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 314 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 373 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 2437 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 2378 Query: 374 tcaacggccatgagcttgatgaggatgtt 402 ||||| ||||||||||||||||||||||| Sbjct: 2377 tcaacagccatgagcttgatgaggatgtt 2349
>gb|AC034256.3|F7H2 Sequence of BAC F7H2 from Arabidopsis thaliana chromosome 1, complete sequence Length = 77521 Score = 73.8 bits (37), Expect = 5e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 314 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 373 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 14757 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 14698 Query: 374 tcaacggccatgagcttgatgaggatgtt 402 ||||| ||||||||||||||||||||||| Sbjct: 14697 tcaacagccatgagcttgatgaggatgtt 14669
>dbj|AB015138.1| Arabidopsis thaliana AVP3 gene for Vacuolar proton pyrophosphatase, complete cds Length = 4648 Score = 73.8 bits (37), Expect = 5e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 314 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 373 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 4484 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 4425 Query: 374 tcaacggccatgagcttgatgaggatgtt 402 ||||| ||||||||||||||||||||||| Sbjct: 4424 tcaacagccatgagcttgatgaggatgtt 4396
>emb|X83728.1|NTIPTVP17 N.tabacum mRNA for inorganic pyrophosphatase (TVP17 clone) Length = 1838 Score = 73.8 bits (37), Expect = 5e-10 Identities = 70/81 (86%) Strand = Plus / Minus Query: 322 cttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggc 381 |||||| || ||||| |||| |||||||||||||| |||||||||||||| || || || Sbjct: 1618 cttgaagagaagaccaccgtgagtggcgaagaagggagcgaacacgagggattcgacagc 1559 Query: 382 catgagcttgatgaggatgtt 402 ||| ||||||||||| ||||| Sbjct: 1558 catcagcttgatgagaatgtt 1538
>gb|M61742.1|ATHPATPC A.thaliana chloroplast ATP synthase gamma subunit (atpC2) gene, complete cds Length = 4418 Score = 73.8 bits (37), Expect = 5e-10 Identities = 76/89 (85%) Strand = Plus / Plus Query: 314 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 373 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 3647 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 3706 Query: 374 tcaacggccatgagcttgatgaggatgtt 402 ||||| ||||||||||||||||||||||| Sbjct: 3707 tcaacagccatgagcttgatgaggatgtt 3735
>gb|M81892.1|ATHAVP3 Arabidopsis thaliana vacuolar H+ - pyrophosphatase (AVP-3) mRNA, complete cds Length = 2813 Score = 73.8 bits (37), Expect = 5e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 314 tagatgtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggac 373 |||| ||||||||| || | ||| |||| |||||||||||||| || || || || ||| Sbjct: 2467 tagaagtacttgaaaaggataccaccgtgagtggcgaagaagggagcaaagacaagagac 2408 Query: 374 tcaacggccatgagcttgatgaggatgtt 402 ||||| ||||||||||||||||||||||| Sbjct: 2407 tcaacagccatgagcttgatgaggatgtt 2379
>emb|AJ557256.2|VVI557256 Vitis vinifera mRNA for vacuolar pyrophosphatase (vpp2 gene) Length = 2664 Score = 71.9 bits (36), Expect = 2e-09 Identities = 73/84 (86%), Gaps = 1/84 (1%) Strand = Plus / Minus Query: 374 tcaacggccatgagcttgatgaggatgttgagcgacgggccttgaggtgtccttgagggg 433 ||||| ||||| |||||||||||||||||||| |||||||| || ||||||||||| || Sbjct: 2231 tcaactgccattagcttgatgaggatgttgagagacgggcc-agaagtgtccttgagagg 2173 Query: 434 gtctccgatggtgtcaccgatcac 457 ||| || || |||||||| ||||| Sbjct: 2172 gtccccaattgtgtcaccaatcac 2149
>emb|X83730.1|NTIPTVP9 N.tabacum mRNA for inorganic pyrophosphatase (TVP9 clone) Length = 2551 Score = 71.9 bits (36), Expect = 2e-09 Identities = 152/188 (80%), Gaps = 2/188 (1%) Strand = Plus / Minus Query: 322 cttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggc 381 |||||| |||||||| || | ||||| ||||| || || || ||||| || || || || Sbjct: 2307 cttgaaaagcagaccaccatgagtggcaaagaatggagcaaatacgagtgattcgactgc 2248 Query: 382 catgagcttgatgaggatgttgagcgacgggccttgaggtgtccttgagggggtctccga 441 ||| |||||||| || |||||||| || |||||| || |||||||| || ||||| || | Sbjct: 2247 catcagcttgatcagaatgttgagtgatgggcct-gaagtgtccttcagagggtcgccaa 2189 Query: 442 tggtgtcaccgatcacggcggcccttgtggcagtctgaacccttgggaccaagggacctc 501 |||||||||| || || || ||| ||||| |||||||||||| |||||||||| ||| Sbjct: 2188 tggtgtcaccaataacagctgcc-ttgtgtgggtctgaaccctttggaccaagggtcctt 2130 Query: 502 gcatgctc 509 |||||||| Sbjct: 2129 gcatgctc 2122
>gb|BT018410.1| Zea mays clone EL01N0326G05.d mRNA sequence Length = 1446 Score = 69.9 bits (35), Expect = 8e-09 Identities = 91/107 (85%), Gaps = 2/107 (1%) Strand = Plus / Minus Query: 346 ggcgaagaagggcgcgaacac-gagggactcaacggccatgagcttgatgaggatgttga 404 |||||||||||| ||||| || |||||| ||||| ||||| ||||||||||| ||||||| Sbjct: 936 ggcgaagaagggggcgaagacagagggattcaaccgccataagcttgatgagaatgttga 877 Query: 405 gcgacgggccttgaggtgtccttgagggggtctccgatggtgtcacc 451 | || ||||| || ||||||||||| || ||||| || |||||||| Sbjct: 876 gggaggggcc-agacgtgtccttgagaggatctccaatagtgtcacc 831
>emb|AJ278019.1|LES278019 Lycopersicon esculentum partial mRNA for vacuolar-type H+-pyrophosphatase (vp1.1 gene) Length = 1335 Score = 67.9 bits (34), Expect = 3e-08 Identities = 70/82 (85%) Strand = Plus / Minus Query: 321 acttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacgg 380 ||||||| || ||||| |||| |||||| |||||||| || |||||||||||||| || | Sbjct: 1063 acttgaagagaagaccaccgtgcgtggcaaagaagggagcaaacacgagggactcgacag 1004 Query: 381 ccatgagcttgatgaggatgtt 402 |||| |||||||| || ||||| Sbjct: 1003 ccatcagcttgataagaatgtt 982
>gb|AF533337.1| Chenopodium rubrum vacuolar proton-pumping PPase (CVP1) precursor RNA, intron and complete cds Length = 2898 Score = 63.9 bits (32), Expect = 5e-07 Identities = 90/108 (83%), Gaps = 1/108 (0%) Strand = Plus / Minus Query: 350 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 409 |||||||| || ||||| || ||||| || ||||| |||||||| || |||||||| ||| Sbjct: 2540 aagaagggggcaaacactagtgactcgacagccataagcttgatcagaatgttgagtgac 2481 Query: 410 gggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcac 457 || || || |||||||| || ||||| || ||||||||||||||||| Sbjct: 2480 ggtcca-gatgtgtccttaagagggtcaccaatggtgtcaccgatcac 2434
>gb|AF533336.1| Chenopodium rubrum vacuolar proton-pumping PPase (CVP1) mRNA, complete cds Length = 2695 Score = 63.9 bits (32), Expect = 5e-07 Identities = 90/108 (83%), Gaps = 1/108 (0%) Strand = Plus / Minus Query: 350 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 409 |||||||| || ||||| || ||||| || ||||| |||||||| || |||||||| ||| Sbjct: 2337 aagaagggggcaaacactagtgactcgacagccataagcttgatcagaatgttgagtgac 2278 Query: 410 gggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcac 457 || || || |||||||| || ||||| || ||||||||||||||||| Sbjct: 2277 ggtcca-gatgtgtccttaagagggtcaccaatggtgtcaccgatcac 2231
>dbj|AK110424.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-166-A10, full insert sequence Length = 2654 Score = 61.9 bits (31), Expect = 2e-06 Identities = 65/75 (86%), Gaps = 1/75 (1%) Strand = Plus / Minus Query: 379 ggccatgagcttgatgaggatgttgagcgacgggccttgaggtgtccttgagggggtctc 438 ||||||||| |||||||| ||||||||||||||||| || |||||||| || ||||| | Sbjct: 2229 ggccatgagtttgatgagaatgttgagcgacgggcc-agacgtgtccttcagcgggtcac 2171 Query: 439 cgatggtgtcaccga 453 ||| |||||||||| Sbjct: 2170 cgaccgtgtcaccga 2156
>dbj|AB018529.1| Chara corallina CPP1 mRNA for vacuolar H+-pyrophosphatase, complete cds Length = 2839 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 349 gaagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcga 408 |||||| ||||| ||||| ||||| || ||||||||||||||||| || |||||||| || Sbjct: 2558 gaagaaaggcgcaaacacaagggattcgacggccatgagcttgataagaatgttgagtga 2499 Query: 409 cgg 411 ||| Sbjct: 2498 cgg 2496
>gb|U31467.1|VRU31467 Vigna radiata pyrophosphatase mRNA, complete cds Length = 2522 Score = 60.0 bits (30), Expect = 8e-06 Identities = 119/146 (81%), Gaps = 2/146 (1%) Strand = Plus / Minus Query: 350 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 409 |||||||| || || || || |||||||| ||||| |||||||| |||||||| || || Sbjct: 2284 aagaagggggcaaaaacaagagactcaactgccatcagcttgataaggatgttaagtgag 2225 Query: 410 gggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcccttgt 469 || || || || |||||||| |||||||| ||||||||||| || || || | |||||| Sbjct: 2224 ggacca-gatgtatccttgagagggtctccaatggtgtcaccaataactgctg-ccttgt 2167 Query: 470 ggcagtctgaacccttgggaccaagg 495 |||| ||||| || || ||||||||| Sbjct: 2166 ggcaatctgacccttttggaccaagg 2141
>dbj|AB009077.1| Vigna radiata mRNA for proton pyrophosphatase, complete cds Length = 2531 Score = 60.0 bits (30), Expect = 8e-06 Identities = 119/146 (81%), Gaps = 2/146 (1%) Strand = Plus / Minus Query: 350 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 409 |||||||| || || || || |||||||| ||||| |||||||| |||||||| || || Sbjct: 2277 aagaagggggcaaaaacaagagactcaactgccatcagcttgataaggatgttaagtgag 2218 Query: 410 gggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcccttgt 469 || || || || |||||||| |||||||| ||||||||||| || || || | |||||| Sbjct: 2217 ggacca-gatgtatccttgagagggtctccaatggtgtcaccaataactgctg-ccttgt 2160 Query: 470 ggcagtctgaacccttgggaccaagg 495 |||| ||||| || || ||||||||| Sbjct: 2159 ggcaatctgacccttttggaccaagg 2134
>emb|X83729.1|NTIPTVP31 N.tabacum mRNA for inorganic pyrophosphatase (TVP31 clone) Length = 2867 Score = 58.0 bits (29), Expect = 3e-05 Identities = 68/81 (83%) Strand = Plus / Minus Query: 322 cttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggc 381 |||||| || ||||| |||| ||||| |||||||| |||||||| ||||| || || || Sbjct: 2646 cttgaagagaagaccaccgtgagtggcaaagaagggagcgaacaccagggattcgacagc 2587 Query: 382 catgagcttgatgaggatgtt 402 ||| ||||||||||| ||||| Sbjct: 2586 catcagcttgatgagaatgtt 2566
>gb|DQ443731.1| Chenopodium glaucum vacuolar H+-pyrophosphatase (CVP1) mRNA, complete cds Length = 2718 Score = 56.0 bits (28), Expect = 1e-04 Identities = 89/108 (82%), Gaps = 1/108 (0%) Strand = Plus / Minus Query: 350 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 409 |||||||| || ||||| || |||||||| ||||| |||||||| ||||||||||| || Sbjct: 2255 aagaagggggcaaacactagtgactcaacagccatcagcttgatcaggatgttgagtgat 2196 Query: 410 gggccttgaggtgtccttgagggggtctccgatggtgtcaccgatcac 457 || || || || ||||| || ||||| || ||||||||||| ||||| Sbjct: 2195 ggtcca-gatgtatccttaagagggtcaccaatggtgtcaccaatcac 2149
>gb|AY436553.2| Thellungiella salsuginea pyrophosphate-energized vacuolar membrane proton pump (vp1) mRNA, complete cds Length = 2759 Score = 56.0 bits (28), Expect = 1e-04 Identities = 70/84 (83%) Strand = Plus / Minus Query: 319 gtacttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaac 378 ||||||||| || | ||| |||| ||||| |||||||| || || || || |||||||| Sbjct: 2409 gtacttgaaaaggataccaccgtgggtggcaaagaagggagcaaagacaagagactcaac 2350 Query: 379 ggccatgagcttgatgaggatgtt 402 |||||||||||||| |||||||| Sbjct: 2349 agccatgagcttgatcaggatgtt 2326
>gb|CP000088.1| Thermobifida fusca YX, complete genome Length = 3642249 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 419 ggtgtccttgagggggtctccgatggtgtcaccgatcacggcggcc 464 ||||||||||| |||||| ||||||||||| ||||| |||| |||| Sbjct: 158979 ggtgtccttgaaggggtcgccgatggtgtcgccgatgacggtggcc 158934
>gb|L32791.1|BEUPYRO Beta vulgaris clone P2 pyrophosphatase mRNA, complete cds Length = 2868 Score = 52.0 bits (26), Expect = 0.002 Identities = 84/102 (82%), Gaps = 1/102 (0%) Strand = Plus / Minus Query: 350 aagaagggcgcgaacacgagggactcaacggccatgagcttgatgaggatgttgagcgac 409 ||||| || ||||| ||||| |||||||||||||| || ||||| | ||||| | || Sbjct: 2449 aagaatggagcgaaaacgagagactcaacggccataagtttgatcaaaatgttcaatgaa 2390 Query: 410 gggccttgaggtgtccttgagggggtctccgatggtgtcacc 451 ||||| ||||||||||||||| ||||| || ||||| ||||| Sbjct: 2389 gggcc-tgaggtgtccttgagtgggtcaccaatggtatcacc 2349
>gb|AC004695.1|AC004695 Homo sapiens BAC clone CTA-317H1 from 3p13-3p14.2, complete sequence Length = 149572 Score = 48.1 bits (24), Expect = 0.029 Identities = 24/24 (100%) Strand = Plus / Plus Query: 240 gaaggcgggcgggcaggcaggcgg 263 |||||||||||||||||||||||| Sbjct: 102371 gaaggcgggcgggcaggcaggcgg 102394
>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome Length = 3566135 Score = 48.1 bits (24), Expect = 0.029 Identities = 49/56 (87%), Gaps = 1/56 (1%) Strand = Plus / Plus Query: 386 agcttgatgaggatgttgagcgacgggccttgaggtgtccttgagggggtctccga 441 |||||||| |||||||| | ||||||||| ||||||||||||| |||||| |||| Sbjct: 2750041 agcttgatcaggatgttcatcgacgggccg-gaggtgtccttgaaggggtcgccga 2750095
>gb|AC163640.5| Mus musculus BAC clone RP24-182L3 from chromosome 16, complete sequence Length = 168350 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggcggg 264 ||||||||||||||||||||||| Sbjct: 151434 aggcgggcgggcaggcaggcggg 151412
>gb|AC160961.3| Mus musculus BAC clone RP24-288N19 from chromosome 16, complete sequence Length = 157144 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggcggg 264 ||||||||||||||||||||||| Sbjct: 4912 aggcgggcgggcaggcaggcggg 4890
>gb|AC122873.5| Mus musculus BAC clone RP23-110K10 from 8, complete sequence Length = 199474 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 242 aggcgggcgggcaggcaggcggg 264 ||||||||||||||||||||||| Sbjct: 91354 aggcgggcgggcaggcaggcggg 91376
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 346 ggcgaagaagggcgcgaacacga 368 ||||||||||||||||||||||| Sbjct: 972774 ggcgaagaagggcgcgaacacga 972796
>emb|CR956397.19| Pig DNA sequence from clone CH242-259E5 on chromosome 17, complete sequence Length = 177531 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 242 aggcgggcgggcaggcaggcggg 264 ||||||||||||||||||||||| Sbjct: 41128 aggcgggcgggcaggcaggcggg 41150
>gb|AC127258.4| Mus musculus BAC clone RP24-302G16 from 8, complete sequence Length = 163028 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggcggg 264 ||||||||||||||||||||||| Sbjct: 1135 aggcgggcgggcaggcaggcggg 1113
>ref|NM_001033812.1| Mus musculus RIKEN cDNA F830208F22 gene (F830208F22Rik), mRNA Length = 2892 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 gcgggcgggcaggcaggcgggg 265 |||||||||||||||||||||| Sbjct: 1663 gcgggcgggcaggcaggcgggg 1642
>gb|AF109905.1|MMHC213L3 Mus musculus major histocompatibility locus class III regions Hsc70t gene, partial cds; smRNP, G7A, NG23, MutS homolog, CLCP, NG24, NG25, and NG26 genes, complete cds; and unknown genes Length = 135545 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 243 ggcgggcgggcaggcaggcggg 264 |||||||||||||||||||||| Sbjct: 122842 ggcgggcgggcaggcaggcggg 122821
>gb|AC162291.13| Mus musculus chromosome 18, clone RP23-264B14, complete sequence Length = 198736 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 gcgggcgggcaggcaggcgggg 265 |||||||||||||||||||||| Sbjct: 77888 gcgggcgggcaggcaggcgggg 77867
>gb|BC056354.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone MGC:73491 IMAGE:6811460), complete cds Length = 2691 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 377 cgggcgggcaggcaggcggggg 356
>gb|BC056383.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone MGC:73932 IMAGE:6853955), complete cds Length = 4252 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 358 cgggcgggcaggcaggcggggg 337
>gb|AC132099.3| Mus musculus BAC clone RP24-292F6 from chromosome 16, complete sequence Length = 160650 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 243 ggcgggcgggcaggcaggcggg 264 |||||||||||||||||||||| Sbjct: 7840 ggcgggcgggcaggcaggcggg 7819
>gb|AC083805.17| Homo sapiens 12 BAC RP11-620J15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 104816 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Minus Query: 243 ggcgggcgggcaggcaggcgggggag 268 ||||||||||||||| |||||||||| Sbjct: 85751 ggcgggcgggcaggctggcgggggag 85726
>gb|BC056970.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone MGC:66790 IMAGE:6811460), complete cds Length = 2691 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 377 cgggcgggcaggcaggcggggg 356
>gb|AC087117.9| Mus Musculus Strain C57BL6/J chromosome 17 BAC, RP23-349B4, Complete Sequence, complete sequence Length = 221899 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 243 ggcgggcgggcaggcaggcggg 264 |||||||||||||||||||||| Sbjct: 208704 ggcgggcgggcaggcaggcggg 208683
>gb|AC114487.2| Homo sapiens chromosome 1 clone RP4-706L14, complete sequence Length = 160957 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 240 gaaggcgggcgggcaggcaggc 261 |||||||||||||||||||||| Sbjct: 135833 gaaggcgggcgggcaggcaggc 135854
>dbj|AK134191.1| Mus musculus adult male thymus cDNA, RIKEN full-length enriched library, clone:5830469J19 product:LUC7-like 2 (S. cerevisiae), full insert sequence Length = 2071 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 293 cgggcgggcaggcaggcggggg 272
>dbj|AK147889.1| Mus musculus melanocyte cDNA, RIKEN full-length enriched library, clone:G270081I19 product:LUC7-like 2 (S. cerevisiae), full insert sequence Length = 2861 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 310 cgggcgggcaggcaggcggggg 289
>dbj|AK156688.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830037L18 product:unclassifiable, full insert sequence Length = 2892 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 gcgggcgggcaggcaggcgggg 265 |||||||||||||||||||||| Sbjct: 1663 gcgggcgggcaggcaggcgggg 1642
>dbj|AK155264.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN full-length enriched library, clone:F630212I17 product:LUC7-like 2 (S. cerevisiae), full insert sequence Length = 3394 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 369 cgggcgggcaggcaggcggggg 348
>dbj|AK163879.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230006F22 product:unclassifiable, full insert sequence Length = 2357 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 gcgggcgggcaggcaggcgggg 265 |||||||||||||||||||||| Sbjct: 1128 gcgggcgggcaggcaggcgggg 1107
>dbj|AK166155.1| Mus musculus lung RCB-0558 LLC cDNA, RIKEN full-length enriched library, clone:G730048C18 product:LUC7-like 2 (S. cerevisiae), full insert sequence Length = 3491 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 335 cgggcgggcaggcaggcggggg 314
>gb|AC161147.6| Mus musculus BAC clone RP23-357G12 from chromosome 6, complete sequence Length = 225957 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 204291 cgggcgggcaggcaggcggggg 204312
>dbj|AK172459.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830208F22 product:hypothetical protein, full insert sequence Length = 2892 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 244 gcgggcgggcaggcaggcgggg 265 |||||||||||||||||||||| Sbjct: 1663 gcgggcgggcaggcaggcgggg 1642
>dbj|AK046307.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN full-length enriched library, clone:B230368A09 product:similar to CDNA FLJ10657 FIS, CLONE NT2RP2006043, WEAKLY SIMILAR TO SPLICING FACTOR, ARGININE/SERINE-RICH 4 [Homo sapiens], full insert sequence Length = 3145 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 490 cgggcgggcaggcaggcggggg 469
>dbj|AK038543.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length enriched library, clone:A230031O05 product:RIKEN cDNA 4930471C18 gene, full insert sequence Length = 2299 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 293 cgggcgggcaggcaggcggggg 272
>dbj|AK044839.1| Mus musculus 9.5 days embryo parthenogenote cDNA, RIKEN full-length enriched library, clone:B130007I01 product:unclassifiable, full insert sequence Length = 2934 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 380 cgggcgggcaggcaggcggggg 359
>dbj|AK048581.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched library, clone:C130080B05 product:unclassifiable, full insert sequence Length = 2815 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 293 cgggcgggcaggcaggcggggg 272
>dbj|AK053863.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130315L24 product:unclassifiable, full insert sequence Length = 2816 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 293 cgggcgggcaggcaggcggggg 272
>gb|AC073916.41| Homo sapiens 12 BAC RP11-408I18 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 205283 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 243 ggcgggcgggcaggcaggcgggggag 268 ||||||||||||||| |||||||||| Sbjct: 104610 ggcgggcgggcaggcgggcgggggag 104635
>gb|AF318301.1|AF318301 Mus musculus CGI-74-like SR-rich protein mRNA, complete cds Length = 2622 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 304 cgggcgggcaggcaggcggggg 283
>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome Length = 3179300 Score = 44.1 bits (22), Expect = 0.45 Identities = 34/38 (89%) Strand = Plus / Minus Query: 417 gaggtgtccttgagggggtctccgatggtgtcaccgat 454 ||||| ||||||| |||||| |||| |||||||||||| Sbjct: 1966579 gaggtatccttgaaggggtcgccgacggtgtcaccgat 1966542
>gb|AC124762.4| Mus musculus BAC clone RP23-155A10 from 6, complete sequence Length = 199207 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 23344 cgggcgggcaggcaggcggggg 23365
>emb|CR974444.18| Mouse DNA sequence from clone RP23-115O3 on chromosome 17, complete sequence Length = 190041 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 243 ggcgggcgggcaggcaggcggg 264 |||||||||||||||||||||| Sbjct: 36082 ggcgggcgggcaggcaggcggg 36061
>gb|U68299.1|MCU68299 Mouse cytomegalovirus 1 complete genomic sequence Length = 230278 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 243 ggcgggcgggcaggcaggcggg 264 |||||||||||||||||||||| Sbjct: 23591 ggcgggcgggcaggcaggcggg 23612
>gb|AC139573.4| Mus musculus BAC clone RP23-472H13 from 16, complete sequence Length = 189632 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Plus Query: 243 ggcgggcgggcaggcaggcggg 264 |||||||||||||||||||||| Sbjct: 10235 ggcgggcgggcaggcaggcggg 10256
>gb|AC134329.3| Mus musculus BAC clone RP24-310D17 from 10, complete sequence Length = 159173 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Plus Query: 243 ggcgggcgggcaggcaggcgggggag 268 ||||||||||||||| |||||||||| Sbjct: 106316 ggcgggcgggcaggctggcgggggag 106341
>ref|NM_138680.1| Mus musculus LUC7-like 2 (S. cerevisiae) (Luc7l2), mRNA Length = 2622 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggggg 266 |||||||||||||||||||||| Sbjct: 304 cgggcgggcaggcaggcggggg 283
>emb|AL732613.10| Mouse DNA sequence from clone RP23-193A21 on chromosome 4, complete sequence Length = 204012 Score = 44.1 bits (22), Expect = 0.45 Identities = 22/22 (100%) Strand = Plus / Minus Query: 243 ggcgggcgggcaggcaggcggg 264 |||||||||||||||||||||| Sbjct: 162541 ggcgggcgggcaggcaggcggg 162520
>gb|BT017471.1| Zea mays clone EL01N0408D01.c mRNA sequence Length = 1159 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 244 gcgggcgggcaggcaggcggg 264 ||||||||||||||||||||| Sbjct: 875 gcgggcgggcaggcaggcggg 855
>gb|AY773965.1| Homo sapiens glutamate-cysteine ligase, modifier subunit (GCLM) gene, complete cds Length = 24112 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 243 ggcgggcgggcaggcaggcgg 263 ||||||||||||||||||||| Sbjct: 2179 ggcgggcgggcaggcaggcgg 2159
>gb|AY382196.1| Homo sapiens glutamate-cysteine ligase modifier subunit gene, promoter region and partial cds Length = 3319 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 243 ggcgggcgggcaggcaggcgg 263 ||||||||||||||||||||| Sbjct: 3221 ggcgggcgggcaggcaggcgg 3201
>gb|AC149221.2| Mus musculus BAC clone RP23-402P22 from chromosome 7, complete sequence Length = 202580 Score = 42.1 bits (21), Expect = 1.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 13 gggttnaacattatcgtcgtcatc 36 ||||| |||||||||||||||||| Sbjct: 32677 gggttgaacattatcgtcgtcatc 32700
>ref|NM_002061.2| Homo sapiens glutamate-cysteine ligase, modifier subunit (GCLM), mRNA Length = 3074 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 243 ggcgggcgggcaggcaggcgg 263 ||||||||||||||||||||| Sbjct: 253 ggcgggcgggcaggcaggcgg 233
>gb|AY480047.1| Homo sapiens plectin 6 mRNA, complete cds Length = 15249 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggcggggg 266 |||||||||||||||||||| |||| Sbjct: 49 aggcgggcgggcaggcaggctgggg 25
>gb|AC134603.4| Mus musculus BAC clone RP23-246L24 from chromosome 7, complete sequence Length = 229312 Score = 42.1 bits (21), Expect = 1.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 13 gggttnaacattatcgtcgtcatc 36 ||||| |||||||||||||||||| Sbjct: 196392 gggttgaacattatcgtcgtcatc 196415
>ref|NM_201380.2| Homo sapiens plectin 1, intermediate filament binding protein 500kDa (PLEC1), transcript variant 6, mRNA Length = 15249 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggcggggg 266 |||||||||||||||||||| |||| Sbjct: 49 aggcgggcgggcaggcaggctgggg 25
>emb|AL117351.12|HSJ837O21 Human DNA sequence from clone RP5-837O21 on chromosome 1p22 Contains the 5' end of the GCLM gene for glutamate-cysteine ligase modifier subunit, a pseudogene similar to part of NADH dehydrogenase 4 (MTND4), a NADH dehydrogenase 3 (MTND3) pseudogene, a cytochrome c oxidase III (MTCO3) pseudogene, a ATP synthase 6 (MTATP6) pseudogene, a cytochrome c oxidase II (MTCO2) pseudogene, a pseudogene similar to part of cytochrome c oxidase I (MTCO1), a pseudogene similar to part of NADH dehydrogenase 2 (MTND2), a coiled-coil-helix-coiled-coil-helix domain containing 2 (CHCHD2) pseudogene and a CpG island, complete sequence Length = 93800 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 243 ggcgggcgggcaggcaggcgg 263 ||||||||||||||||||||| Sbjct: 74262 ggcgggcgggcaggcaggcgg 74242
>gb|BC041809.1| Homo sapiens glutamate-cysteine ligase, modifier subunit, mRNA (cDNA clone MGC:41886 IMAGE:5311598), complete cds Length = 1613 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 243 ggcgggcgggcaggcaggcgg 263 ||||||||||||||||||||| Sbjct: 196 ggcgggcgggcaggcaggcgg 176
>gb|AC109322.16| Homo sapiens chromosome 8, clone CTD-3065J16, complete sequence Length = 215342 Score = 42.1 bits (21), Expect = 1.8 Identities = 24/25 (96%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggcggggg 266 |||||||||||||||||||| |||| Sbjct: 121067 aggcgggcgggcaggcaggctgggg 121043
>emb|BX957342.5| Zebrafish DNA sequence from clone CH211-120P12 in linkage group 13, complete sequence Length = 182888 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 85 tggtctctctcttctactaca 105 ||||||||||||||||||||| Sbjct: 109831 tggtctctctcttctactaca 109851
>emb|BX247887.6| Zebrafish DNA sequence from clone CH211-142L10, complete sequence Length = 143903 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 244 gcgggcgggcaggcaggcggg 264 ||||||||||||||||||||| Sbjct: 54645 gcgggcgggcaggcaggcggg 54625
>gb|U72210.1|HSU72210 Human gamma-glutamylcysteine synthetase light subunit gene, 5'flanking sequence and partial cds Length = 3314 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 243 ggcgggcgggcaggcaggcgg 263 ||||||||||||||||||||| Sbjct: 3217 ggcgggcgggcaggcaggcgg 3197
>gb|AF028815.1|AF028815 Homo sapiens gamma-glutamylcysteine synthetase regulatory subunit (GLCLR) gene, 5' flanking region Length = 1930 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 243 ggcgggcgggcaggcaggcgg 263 ||||||||||||||||||||| Sbjct: 1887 ggcgggcgggcaggcaggcgg 1867
>gb|U74631.1|RCU74631 Ricinus communis calreticulin gene, complete cds Length = 4975 Score = 42.1 bits (21), Expect = 1.8 Identities = 63/77 (81%) Strand = Plus / Minus Query: 323 ttgaacagcagacctccgtacgtggcgaagaagggcgcgaacacgagggactcaacggcc 382 ||||||||||||||||||| | || ||||| || || ||||| | ||||| || ||| Sbjct: 183 ttgaacagcagacctccgtgagcagcaaagaatggagcaaacaccaatgactcgactgcc 124 Query: 383 atgagcttgatgaggat 399 ||||||||||| ||||| Sbjct: 123 atgagcttgatcaggat 107
>gb|L35546.1|HUMGCSL Homo sapiens gamma-glutamylcysteine synthetase light subunit mRNA, complete cds Length = 1610 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Minus Query: 243 ggcgggcgggcaggcaggcgg 263 ||||||||||||||||||||| Sbjct: 214 ggcgggcgggcaggcaggcgg 194
>gb|AC160538.8| Mus musculus chromosome 15, clone RP24-156D3, complete sequence Length = 158943 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 202 acattgacaaccaaaaataa 221 |||||||||||||||||||| Sbjct: 66522 acattgacaaccaaaaataa 66503
>gb|AC114649.9| Mus musculus chromosome 5, clone RP24-150M14, complete sequence Length = 154765 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 tctctctcttctactacatg 107 |||||||||||||||||||| Sbjct: 137646 tctctctcttctactacatg 137627
>gb|AC146132.3| Pan troglodytes BAC clone RP43-23H13 from 7, complete sequence Length = 164355 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 ttcaagaggccaggggaaag 170 |||||||||||||||||||| Sbjct: 84354 ttcaagaggccaggggaaag 84335
>ref|XM_001000399.1| PREDICTED: Mus musculus similar to Protein C1orf77 homolog (LOC622845), mRNA Length = 2049 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 1259 aggcgggcgggcaggcaggc 1240
>ref|XM_908936.2| PREDICTED: Mus musculus similar to Protein C1orf77 homolog (LOC634257), mRNA Length = 2053 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 1263 aggcgggcgggcaggcaggc 1244
>ref|XM_890379.2| PREDICTED: Mus musculus similar to Protein C1orf77 homolog, transcript variant 1 (LOC622845), mRNA Length = 2049 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 1259 aggcgggcgggcaggcaggc 1240
>gb|AC115800.13| Mus musculus chromosome 8, clone RP23-407E22, complete sequence Length = 228513 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 31686 aggcgggcgggcaggcaggc 31667
>gb|AC105947.11| Mus musculus chromosome 18, clone RP24-66N1, complete sequence Length = 207139 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 89 ctctctcttctactacatgg 108 |||||||||||||||||||| Sbjct: 166627 ctctctcttctactacatgg 166608
>gb|AC132255.3| Mus musculus BAC clone RP24-472I15 from chromosome 5, complete sequence Length = 168528 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 23756 aggcgggcgggcaggcaggc 23775
>gb|AC140316.3| Mus musculus BAC clone RP23-419L10 from chromosome 18, complete sequence Length = 195911 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 89 ctctctcttctactacatgg 108 |||||||||||||||||||| Sbjct: 178571 ctctctcttctactacatgg 178590
>gb|BC020058.1| Mus musculus LUC7-like 2 (S. cerevisiae), mRNA (cDNA clone IMAGE:4009362), containing frame-shift errors Length = 2411 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggg 264 |||||||||||||||||||| Sbjct: 20 cgggcgggcaggcaggcggg 1
>ref|XM_808881.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053506661.50) partial mRNA Length = 2991 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 tcatgggacgaggaaaattt 54 |||||||||||||||||||| Sbjct: 1392 tcatgggacgaggaaaattt 1411
>gb|AC072039.19| Homo sapiens 3 BAC RP11-305O4 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 154964 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 83 tctggtctctctcttctact 102 |||||||||||||||||||| Sbjct: 108378 tctggtctctctcttctact 108359
>ref|XM_812966.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053511245.110) partial mRNA Length = 2988 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 35 tcatgggacgaggaaaattt 54 |||||||||||||||||||| Sbjct: 1392 tcatgggacgaggaaaattt 1411
>gb|AC084054.12| Mus Musculus Strain C57BL6/J chromosome 5 BAC, RP23-137N6, complete sequence Length = 231589 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 243 ggcgggcgggcaggcaggcg 262 |||||||||||||||||||| Sbjct: 146 ggcgggcgggcaggcaggcg 127
>gb|AC124464.3| Mus musculus BAC clone RP24-155I15 from chromosome 19, complete sequence Length = 188587 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 2722 aggcgggcgggcaggcaggc 2741
>gb|AC126266.3| Mus musculus BAC clone RP23-402N17 from chromosome 19, complete sequence Length = 205037 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 147742 aggcgggcgggcaggcaggc 147761
>gb|AC113976.13| Mus musculus chromosome 15, clone RP23-146F23, complete sequence Length = 184010 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 202 acattgacaaccaaaaataa 221 |||||||||||||||||||| Sbjct: 38446 acattgacaaccaaaaataa 38465
>gb|AC142299.1| Pan troglodytes BAC clone RP43-121O18 from 7, complete sequence Length = 146878 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 151 ttcaagaggccaggggaaag 170 |||||||||||||||||||| Sbjct: 105556 ttcaagaggccaggggaaag 105575
>emb|AL353621.19| Human DNA sequence from clone RP11-490D19 on chromosome 9 Contains a novel pseudogene, the MRPL50 gene for mitochondrial ribosomal protein L50, the ZNF189 gene for zinc finger protein 189, the ALDOB gene for aldolase B, fructose-bisphosphate, a NADH dehydrogenase (ubiquinone) 1 alpha subcomplex (NDUFA4) pseudogene, three novel genes, the 5' end of the RNF20 gene for ring finger protein 20 and three CpG islands, complete sequence Length = 164115 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 243 ggcgggcgggcaggcaggcg 262 |||||||||||||||||||| Sbjct: 72831 ggcgggcgggcaggcaggcg 72850
>emb|AL035692.10|HS329N18 Human DNA sequence from clone RP3-329N18 on chromosome 6q22.1-22.33, complete sequence Length = 84764 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 83 tctggtctctctcttctact 102 |||||||||||||||||||| Sbjct: 50835 tctggtctctctcttctact 50816
>gb|DQ133470.1| Pan paniscus ribosomal RNA intergenic spacer, partial sequence Length = 4544 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 110 aggcgggcgggcaggcaggc 129
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 344 gtggcgaagaagggcgcgaa 363 |||||||||||||||||||| Sbjct: 447622 gtggcgaagaagggcgcgaa 447603
>gb|AC121765.2| Homo sapiens chromosome 3 clone RP11-767D18, complete sequence Length = 194455 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 202 acattgacaaccaaaaataa 221 |||||||||||||||||||| Sbjct: 77255 acattgacaaccaaaaataa 77274
>emb|CR377210.7| Zebrafish DNA sequence from clone CH211-195C22 in linkage group 5, complete sequence Length = 170134 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 77535 aggcgggcgggcaggcaggc 77516
>gb|AC107464.5| Homo sapiens BAC clone RP11-1191J2 from 4, complete sequence Length = 219357 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 26460 aggcgggcgggcaggcaggc 26441
>gb|AC105266.2| Homo sapiens chromosome 3 clone RP11-796K6, complete sequence Length = 181462 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 202 acattgacaaccaaaaataa 221 |||||||||||||||||||| Sbjct: 33181 acattgacaaccaaaaataa 33200
>gb|AC080043.5| Homo sapiens chromosome , clone RP11-45M9, complete sequence Length = 161443 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 44687 aggcgggcgggcaggcaggc 44668
>gb|AC023566.11| Homo sapiens chromosome 8, clone RP11-660D5, complete sequence Length = 184543 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 94243 aggcgggcgggcaggcaggc 94224
>gb|AC093925.5| Genomic sequence for Mus musculus, clone RP23-304H5, complete sequence Length = 227242 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 132663 aggcgggcgggcaggcaggc 132644
>gb|AF005042.1|AF005042 Homo sapiens cGMP-phosphodiesterase beta-subunit (PDE6E) gene, complete intron 2 sequence Length = 952 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 63 aggcgggcgggcaggcaggc 44
>gb|AF005041.1|AF005041 Homo sapiens cGMP-phosphodiesterase beta-subunit (PDE6E) gene, complete intron 2 sequence Length = 906 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 63 aggcgggcgggcaggcaggc 44
>emb|BX571666.10| Zebrafish DNA sequence from clone DKEY-221F8 in linkage group 5, complete sequence Length = 115940 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 6671 aggcgggcgggcaggcaggc 6652
>emb|BX005480.12| Mouse DNA sequence from clone RP23-142M12 on chromosome X, complete sequence Length = 196326 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 135612 aggcgggcgggcaggcaggc 135593
>gb|AC131664.3| Mus musculus BAC clone RP23-274J16 from chromosome 5, complete sequence Length = 189996 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 79800 aggcgggcgggcaggcaggc 79781
>gb|AC113484.14| Mus musculus chromosome 8, clone RP23-343H23, complete sequence Length = 176303 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 158826 aggcgggcgggcaggcaggc 158807
>gb|AC009198.8|AC009198 Drosophila melanogaster, chromosome 2L, region 33B-33C, BAC clone BACR19C12, complete sequence Length = 171134 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 312 tctagatgtacttgaacagc 331 |||||||||||||||||||| Sbjct: 76960 tctagatgtacttgaacagc 76941
>gb|DQ164097.1| Callithrix jacchus gamma-glutamylcysteine synthetase regulatory subunit mRNA, complete cds Length = 1202 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 244 gcgggcgggcaggcaggcgg 263 |||||||||||||||||||| Sbjct: 257 gcgggcgggcaggcaggcgg 238
>gb|AC134025.2| Homo sapiens 3 BAC RP11-231I13 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 183111 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 202 acattgacaaccaaaaataa 221 |||||||||||||||||||| Sbjct: 80094 acattgacaaccaaaaataa 80075
>gb|AC016700.8| Homo sapiens BAC clone RP11-175A7 from 2, complete sequence Length = 177995 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 243 ggcgggcgggcaggcaggcg 262 |||||||||||||||||||| Sbjct: 174868 ggcgggcgggcaggcaggcg 174887
>gb|AY148158.1| Mus musculus lamin B receptor gene, partial cds Length = 29007 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 15874 aggcgggcgggcaggcaggc 15855
>gb|AC093540.3| Pan troglodytes clone RP43-84M6, complete sequence Length = 171092 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 245 cgggcgggcaggcaggcggg 264 |||||||||||||||||||| Sbjct: 114785 cgggcgggcaggcaggcggg 114766
>gb|AE003635.2| Drosophila melanogaster chromosome 2L, section 44 of 83 of the complete sequence Length = 308012 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 312 tctagatgtacttgaacagc 331 |||||||||||||||||||| Sbjct: 137931 tctagatgtacttgaacagc 137912
>emb|X62693.1|HSCGMP2 H.sapiens DNA for cGMP phosphodiesterase exon 2 Length = 556 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 417 aggcgggcgggcaggcaggc 398
>gb|AC105072.9| Mus musculus chromosome 5, clone RP24-167C6, complete sequence Length = 173710 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 243 ggcgggcgggcaggcaggcg 262 |||||||||||||||||||| Sbjct: 17283 ggcgggcgggcaggcaggcg 17302
>gb|CP000159.1| Salinibacter ruber DSM 13855, complete genome Length = 3551823 Score = 40.1 bits (20), Expect = 7.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 381 ccatgagcttgatgaggatgttgagcga 408 |||| ||||||||||||| ||||||||| Sbjct: 1035895 ccatcagcttgatgaggacgttgagcga 1035868
>emb|AL844566.8| Mouse DNA sequence from clone RP23-173H17 on chromosome 2, complete sequence Length = 229583 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 113280 aggcgggcgggcaggcaggc 113299
>gb|AC151735.3| Mus musculus BAC clone RP23-24D16 from 9, complete sequence Length = 201762 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 139401 aggcgggcgggcaggcaggc 139382
>emb|AL603706.13| Mouse DNA sequence from clone RP23-407I21 on chromosome 11, complete sequence Length = 220242 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 43459 aggcgggcgggcaggcaggc 43478
>emb|AL807399.5| Mouse DNA sequence from clone RP23-382O11 on chromosome 4, complete sequence Length = 181004 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 242 aggcgggcgggcaggcaggc 261 |||||||||||||||||||| Sbjct: 160196 aggcgggcgggcaggcaggc 160177
>emb|AL589870.30| Mouse DNA sequence from clone RP23-118A2 on chromosome 2, complete sequence Length = 202686 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 243 ggcgggcgggcaggcaggcg 262 |||||||||||||||||||| Sbjct: 135217 ggcgggcgggcaggcaggcg 135236
>dbj|D86306.1| Cucurbita moschata mRNA for proton-translocating inorganic pyrophosphatase, complete cds Length = 2704 Score = 40.1 bits (20), Expect = 7.0 Identities = 29/32 (90%) Strand = Plus / Minus Query: 432 gggtctccgatggtgtcaccgatcacggcggc 463 ||||||||||| ||||||||||| || ||||| Sbjct: 2293 gggtctccgatcgtgtcaccgataacagcggc 2262
>dbj|AB044479.1| Volvox rousseletii chloroplast psbC gene for photosystem II CP43 apoprotein, strain:UTEX 1862 Length = 780 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 aaccaaaaataacagcagcg 229 |||||||||||||||||||| Sbjct: 370 aaccaaaaataacagcagcg 351
>dbj|AB044478.1| Volvox globator chloroplast psbC gene for photosystem II CP43 apoprotein, strain:UTEX 955 Length = 780 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 aaccaaaaataacagcagcg 229 |||||||||||||||||||| Sbjct: 370 aaccaaaaataacagcagcg 351
>dbj|AB044477.1| Volvox barberi chloroplast psbC gene for photosystem II CP43 apoprotein, strain:UTEX 804 Length = 780 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 aaccaaaaataacagcagcg 229 |||||||||||||||||||| Sbjct: 370 aaccaaaaataacagcagcg 351 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,399,191 Number of Sequences: 3902068 Number of extensions: 3399191 Number of successful extensions: 83224 Number of sequences better than 10.0: 184 Number of HSP's better than 10.0 without gapping: 184 Number of HSP's successfully gapped in prelim test: 2 Number of HSP's that attempted gapping in prelim test: 82482 Number of HSP's gapped (non-prelim): 637 length of query: 516 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 493 effective length of database: 17,143,297,704 effective search space: 8451645768072 effective search space used: 8451645768072 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
