ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd17a16
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AJ606031.1| Triticum aestivum partial mRNA for putative pyri... 799 0.0
2gb|BT009021.1| Triticum aestivum clone wdk3c.pk007.j3:fis, full ... 779 0.0
3gb|AY107334.1| Zea mays PCO062090 mRNA sequence 418 e-114
4dbj|AK120153.1| Oryza sativa (japonica cultivar-group) cDNA clon... 240 4e-60
5dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 206 6e-50
6dbj|AP005412.3| Oryza sativa (japonica cultivar-group) genomic D... 206 6e-50
7ref|NM_114287.2| Arabidopsis thaliana disulfide oxidoreductase/ ... 44 0.53
8gb|AC148001.6| Mus musculus BAC clone RP24-82P9 from chromosome ... 44 0.53
9ref|XM_422763.1| PREDICTED: Gallus gallus similar to SUMO1/sentr... 44 0.53
10emb|AL353814.1|ATF26G5 Arabidopsis thaliana DNA chromosome 3, BA... 44 0.53
11gb|BT008451.1| Arabidopsis thaliana At3g44190 gene, complete cds 44 0.53
12emb|BX823155.1|CNS0A7AM Arabidopsis thaliana Full-length cDNA Co... 44 0.53
13emb|BX823570.1|CNS0A6LH Arabidopsis thaliana Full-length cDNA Co... 44 0.53
14gb|AY084651.1| Arabidopsis thaliana clone 114123 mRNA, complete ... 44 0.53
15gb|BT002026.1| Arabidopsis thaliana putative protein (At3g44190)... 44 0.53
16gb|AC107663.10| Mus musculus chromosome 13, clone RP23-99G9, com... 42 2.1
17gb|AC153139.5| Mus musculus BAC clone RP23-411M4 from chromosome... 42 2.1
18gb|AC064856.5| Homo sapiens BAC clone RP11-264N11 from 2, comple... 42 2.1
19gb|AC160651.2| Pan troglodytes BAC clone CH251-489P13 from chrom... 42 2.1
20ref|NM_116172.3| Arabidopsis thaliana unknown protein AT3G63070 ... 40 8.2
21gb|AC158304.11| Mus musculus chromosome 7, clone RP24-192F23, co... 40 8.2
22gb|AC158787.14| Mus musculus chromosome 15, clone RP23-136G8, co... 40 8.2
23ref|XM_659299.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 8.2
24gb|AC125531.3| Mus musculus BAC clone RP23-396D12 from chromosom... 40 8.2
25gb|AC140359.2| Mus musculus BAC clone RP24-240P8 from chromosome... 40 8.2
26gb|AC122045.3| Mus musculus BAC clone RP24-449H18 from 5, comple... 40 8.2
27gb|AC110573.11| Mus musculus chromosome 16, clone RP23-322A15, c... 40 8.2
28gb|AC166568.2| Spironucleus vortens clone JGIBAWF-9N8, complete ... 40 8.2
29gb|AC166575.1| Mus musculus BAC clone RP23-99E16 from chromosome... 40 8.2
30emb|AL772400.3| Human DNA sequence from clone RP11-540N4 on chro... 40 8.2
31emb|AL139328.8| Human DNA sequence from clone RP11-84N7 on chrom... 40 8.2
32emb|AL020995.14|HS117O3 Human DNA sequence from clone RP1-117O3 ... 40 8.2
33gb|AC074336.14| Mus musculus Strain C57BL6/J chromosome 1 BAC, R... 40 8.2
34emb|Z11595.1|EBHCOMPMR Eptatretus burgeri partial mRNA for hagfi... 40 8.2
35emb|AL022018.1|DMC8D8 Drosophila melanogaster cosmid clone 8D8 40 8.2
36gb|AC090881.9| Mus Musculus Strain C57BL6/J chromosome 17 BAC, R... 40 8.2
37gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell ... 40 8.2
38gb|AY119282.1| Drosophila melanogaster SD27341 full insert cDNA 40 8.2
39ref|NM_206602.1| Drosophila melanogaster CG11418-RB, transcript ... 40 8.2
40ref|NM_130548.2| Drosophila melanogaster CG11418-RA, transcript ... 40 8.2
41gb|AC106822.3| Homo sapiens chromosome 5 clone RP11-772C9, compl... 40 8.2
42gb|AC104288.4| Drosophila melanogaster X BAC RP98-30G24 (Roswell... 40 8.2
43gb|AC015468.5|AC015468 Homo sapiens chromosome 8, clone RP11-369... 40 8.2
44gb|DQ310040.1| Phelipanche purpurea subsp. bohemica 5 ribosomal ... 40 8.2
45gb|DQ310039.1| Phelipanche purpurea subsp. bohemica 1 ribosomal ... 40 8.2
46gb|DQ310038.1| Phelipanche purpurea subsp. bohemica 9 ribosomal ... 40 8.2
47gb|DQ310037.1| Phelipanche purpurea subsp. bohemica 2 ribosomal ... 40 8.2
48gb|DQ310036.1| Phelipanche purpurea subsp. bohemica 3 ribosomal ... 40 8.2
49gb|DQ310035.1| Phelipanche purpurea ribosomal protein subunit 2 ... 40 8.2
50gb|AC019181.4| Homo sapiens BAC clone RP11-272E3 from 2, complet... 40 8.2
51gb|AC139713.1| Homo sapiens BAC clone RP11-481K16 from 4, comple... 40 8.2
52gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 8.2
53gb|AC007385.3| Homo sapiens BAC clone RP11-325M10 from 2, comple... 40 8.2
54gb|AC006142.1|AC006142 Homo sapiens PAC clone RP4-572A3, complet... 40 8.2
55gb|AE003420.2| Drosophila melanogaster chromosome X, section 4 o... 40 8.2
56emb|CT030030.12| Mouse DNA sequence from clone RP23-123J19 on ch... 40 8.2
57gb|AC134554.6| Mus musculus BAC clone RP24-313F7 from chromosome... 40 8.2
58gb|AC005291.1|AC005291 Homo sapiens chromosome 17, clone hRPK.40... 40 8.2
59emb|AL163816.1|ATT20O10 Arabidopsis thaliana DNA chromosome 3, B... 40 8.2
60gb|AC129777.4| Mus musculus BAC clone RP23-281H23 from 8, comple... 40 8.2 
>emb|AJ606031.1| Triticum aestivum partial mRNA for putative pyridine
           nucleotide-disulphide oxidoreductase
          Length = 723

 Score =  799 bits (403), Expect = 0.0
 Identities = 510/544 (93%), Gaps = 10/544 (1%)
 Strand = Plus / Minus

                                                                       
Query: 59  gcacatcaccaacaattactcgcacagagaacaacgcatgacgatacaacacatatgtgc 118
           |||||||||||||||||||||||||| ||||||   |||     ||||||||||||||||
Sbjct: 714 gcacatcaccaacaattactcgcacacagaaca---catag---tacaacacatatgtgc 661

                                                                       
Query: 119 agccagccagaggtttatttgttttgcctggagatgggccggctcaagcattcaggccca 178
           ||||||||| |||||||||| ||||| ||| ||||    ||||||||||| |||||||||
Sbjct: 660 agccagccataggtttatttcttttgtctgaagat----cggctcaagcactcaggccca 605

                                                                       
Query: 179 tctgcttcctcgtcttgccgacgaacaggtccttggatttgagcatccccggtatgcacc 238
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 604 tctgcttcctcgtcttgccgacgaacaggtccttggatttgagcatccccggtatgcacc 545

                                                                       
Query: 239 cggtgagcgtcaggtagggcagctgcgccagcccttccttccttcccagggagacgatcg 298
           ||||||||||||||||||| ||||| ||||| || ||||||||||| |||||||||||||
Sbjct: 544 cggtgagcgtcaggtagggtagctgtgccagtccgtccttccttccgagggagacgatcg 485

                                                                       
Query: 299 ccagcgggaacccggtgctgtaggtggcgagcttgctcggaggcgaccccttgatcagta 358
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 484 ccagcgggaagccggtgctgtaggtggcgagcttgctcggaggcgaccccttgatcagta 425

                                                                       
Query: 359 gcttcaggttcttcgctaccagcagcgcgtgcttctgggcgaggtacccttgtttgattt 418
           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 424 gcttcaggttcttggctaccagcagcgcgtgcttctgggcgaggtacccttgtttgattt 365

                                                                       
Query: 419 caggaatatctgtgatgtcaccgattgcaaaaatgttatcgtgacccttcactctcaagt 478
           |||||||||| ||||||||||| |||||||||||||||| || |||||||||||| | ||
Sbjct: 364 caggaatatcggtgatgtcaccaattgcaaaaatgttattgtaacccttcactcttaggt 305

                                                                       
Query: 479 ccttctccaccattactcttcccttggtgtccaaagattccttcaggatggtatcatgta 538
           |||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 304 ccttttccaccattactcttcctttggtgtccaaagattccttcaggatggtatcatgta 245

                                                                       
Query: 539 gccacgatgaactcagtggcttgccaatacacacaaagtggcaatcagctgttattgttt 598
           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 244 gccacgatgaactcagtggcttaccaatacacacaaagtggcaatcagctgttattgttt 185

               
Query: 599 ctcc 602
           ||||
Sbjct: 184 ctcc 181
to top
>gb|BT009021.1| Triticum aestivum clone wdk3c.pk007.j3:fis, full insert mRNA sequence
          Length = 1349

 Score =  779 bits (393), Expect = 0.0
 Identities = 546/596 (91%), Gaps = 12/596 (2%)
 Strand = Plus / Minus

                                                                        
Query: 11   cgtacatgtacattcacacttctgttaaaatgttcatcaccattctcggcacatcaccaa 70
            |||||||||||||| |||||| ||||||||||||||||||||||| | ||||||||||||
Sbjct: 1279 cgtacatgtacatttacacttttgttaaaatgttcatcaccattcgcagcacatcaccaa 1220

                                                                        
Query: 71   caattactcgcacagagaa----caacgcatgacgatacaacacatatgtgcagccagcc 126
            || ||||||||||| | ||    |||  || ||| ||||||||||||||||||||||   
Sbjct: 1219 catttactcgcacatacaaaacacaagacaagacaatacaacacatatgtgcagccac-- 1162

                                                                        
Query: 127  agaggtttatttgttttgcctggagatgggccggctcaagcattcaggcccatctgcttc 186
              | ||||||||||| || ||||||||    ||||||||||||| |||||||||||||||
Sbjct: 1161 --atgtttatttgttctgtctggagat----cggctcaagcatttaggcccatctgcttc 1108

                                                                        
Query: 187  ctcgtcttgccgacgaacaggtccttggatttgagcatccccggtatgcacccggtgagc 246
            |||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 1107 ctcgtcttgccgacaaacaggtccttggatttgagcatccctggtatgcacccggtgagc 1048

                                                                        
Query: 247  gtcaggtagggcagctgcgccagcccttccttccttcccagggagacgatcgccagcggg 306
            |||||||| || ||||| |||||||||||||||||||| |||||||||||||||||||||
Sbjct: 1047 gtcaggtacggtagctgagccagcccttccttccttccgagggagacgatcgccagcggg 988

                                                                        
Query: 307  aacccggtgctgtaggtggcgagcttgctcggaggcgaccccttgatcagtagcttcagg 366
            || |||||| ||||||||||||||||||||||||||| |||||||||||| |||||||||
Sbjct: 987  aagccggtgatgtaggtggcgagcttgctcggaggcgcccccttgatcagcagcttcagg 928

                                                                        
Query: 367  ttcttcgctaccagcagcgcgtgcttctgggcgaggtacccttgtttgatttcaggaata 426
            ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 927  ttcttggctaccagcagcgcgtgcttctgggcgaggtacccttgtttgatttcaggaata 868

                                                                        
Query: 427  tctgtgatgtcaccgattgcaaaaatgttatcgtgacccttcactctcaagtccttctcc 486
            || ||||||||||| |||||||||||||||| || |||||||||||||| |||||| |||
Sbjct: 867  tcagtgatgtcaccaattgcaaaaatgttattgtaacccttcactctcaggtccttttcc 808

                                                                        
Query: 487  accattactcttcccttggtgtccaaagattccttcaggatggtatcatgtagccacgat 546
            ||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 807  accattattcttcctttggtgtccaaagattccttcaggatggtatcatgtagccacgat 748

                                                                    
Query: 547  gaactcagtggcttgccaatacacacaaagtggcaatcagctgttattgtttctcc 602
            |||||||||||||| || |||||||||||||||||||||||||| |||||||||||
Sbjct: 747  gaactcagtggcttaccgatacacacaaagtggcaatcagctgtaattgtttctcc 692
to top
>gb|AY107334.1| Zea mays PCO062090 mRNA sequence
          Length = 1457

 Score =  418 bits (211), Expect = e-114
 Identities = 385/443 (86%)
 Strand = Plus / Minus

                                                                        
Query: 162  tcaagcattcaggcccatctgcttcctcgtcttgccgacgaacaggtccttggatttgag 221
            |||| |||||||||||||||||||||||||||||| |||||| || |||  |||||||| 
Sbjct: 1100 tcaaccattcaggcccatctgcttcctcgtcttgctgacgaatagatccccggatttgat 1041

                                                                        
Query: 222  catccccggtatgcacccggtgagcgtcaggtagggcagctgcgccagcccttccttcct 281
            ||| || || | ||||||| ||||||||||  | || | ||| |||||||||||||||||
Sbjct: 1040 catgcctggcaagcacccgctgagcgtcagcaatggaaactgagccagcccttccttcct 981

                                                                        
Query: 282  tcccagggagacgatcgccagcgggaacccggtgctgtaggtggcgagcttgctcggagg 341
            ||| || ||||||| |||||||||  | ||||||||||| || || || |||||   |||
Sbjct: 980  tccaagagagacgagcgccagcggatagccggtgctgtaagtcgccagtttgctgttagg 921

                                                                        
Query: 342  cgaccccttgatcagtagcttcaggttcttcgctaccagcagcgcgtgcttctgggcgag 401
                |||||| |||||||||||||||||||||| || |||||||||||||||||||||||
Sbjct: 920  gagacccttggtcagtagcttcaggttcttcgccactagcagcgcgtgcttctgggcgag 861

                                                                        
Query: 402  gtacccttgtttgatttcaggaatatctgtgatgtcaccgattgcaaaaatgttatcgtg 461
            ||||||||||||||||||||||||||||||||||||||| || |||||||||||||    
Sbjct: 860  gtacccttgtttgatttcaggaatatctgtgatgtcaccaatcgcaaaaatgttattaaa 801

                                                                        
Query: 462  acccttcactctcaagtccttctccaccattactcttcccttggtgtccaaagattcctt 521
            ||| |||||||| || ||||| |||||||||||||| |||||| | ||||| ||||||||
Sbjct: 800  acctttcactcttaaatccttttccaccattactctccccttgctatccaaggattcctt 741

                                                                        
Query: 522  caggatggtatcatgtagccacgatgaactcagtggcttgccaatacacacaaagtggca 581
             ||||||||||||||||||||||| |||||||||||||| ||||| || |||||||||||
Sbjct: 740  taggatggtatcatgtagccacgacgaactcagtggctttccaatgcatacaaagtggca 681

                                   
Query: 582  atcagctgttattgtttctccgc 604
            ||||||||||| |||||||||||
Sbjct: 680  atcagctgttactgtttctccgc 658
to top
>dbj|AK120153.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013029P18, full
            insert sequence
          Length = 2277

 Score =  240 bits (121), Expect = 4e-60
 Identities = 208/237 (87%)
 Strand = Plus / Minus

                                                                        
Query: 366  gttcttcgctaccagcagcgcgtgcttctgggcgaggtacccttgtttgatttcaggaat 425
            |||||| ||||| ||||| || ||||| ||||| ||||| ||||| || |||||||||||
Sbjct: 1896 gttctttgctactagcagagcatgcttatgggcaaggtaaccttgcttaatttcaggaat 1837

                                                                        
Query: 426  atctgtgatgtcaccgattgcaaaaatgttatcgtgacccttcactctcaagtccttctc 485
            ||||||||||||||| ||||||||||||||||  | ||| || | ||| || ||||| ||
Sbjct: 1836 atctgtgatgtcaccaattgcaaaaatgttattataaccttttattcttaaatccttttc 1777

                                                                        
Query: 486  caccattactcttcccttggtgtccaaagattccttcaggatggtatcatgtagccacga 545
            |||||||| |||||||||| ||||||| |||||||| || ||||||||||||||||| ||
Sbjct: 1776 caccattagtcttcccttgttgtccaaggattcctttagaatggtatcatgtagccatga 1717

                                                                     
Query: 546  tgaactcagtggcttgccaatacacacaaagtggcaatcagctgttattgtttctcc 602
            |||||| |||||||| || |||||||||||||||||||||||||||| |||||||||
Sbjct: 1716 tgaactgagtggcttaccgatacacacaaagtggcaatcagctgttactgtttctcc 1660
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  206 bits (104), Expect = 6e-50
 Identities = 164/184 (89%)
 Strand = Plus / Minus

                                                                           
Query: 419     caggaatatctgtgatgtcaccgattgcaaaaatgttatcgtgacccttcactctcaagt 478
               |||||||||||||||||||||| ||||||||||||||||  | ||| || | ||| || |
Sbjct: 2778367 caggaatatctgtgatgtcaccaattgcaaaaatgttattataaccttttattcttaaat 2778308

                                                                           
Query: 479     ccttctccaccattactcttcccttggtgtccaaagattccttcaggatggtatcatgta 538
               |||| |||||||||| |||||||||| ||||||| |||||||| || |||||||||||||
Sbjct: 2778307 ccttttccaccattagtcttcccttgttgtccaaggattcctttagaatggtatcatgta 2778248

                                                                           
Query: 539     gccacgatgaactcagtggcttgccaatacacacaaagtggcaatcagctgttattgttt 598
               |||| |||||||| |||||||| || |||||||||||||||||||||||||||| |||||
Sbjct: 2778247 gccatgatgaactgagtggcttaccgatacacacaaagtggcaatcagctgttactgttt 2778188

                   
Query: 599     ctcc 602
               ||||
Sbjct: 2778187 ctcc 2778184
to top
>dbj|AP005412.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0050G13
          Length = 150685

 Score =  206 bits (104), Expect = 6e-50
 Identities = 164/184 (89%)
 Strand = Plus / Minus

                                                                         
Query: 419   caggaatatctgtgatgtcaccgattgcaaaaatgttatcgtgacccttcactctcaagt 478
             |||||||||||||||||||||| ||||||||||||||||  | ||| || | ||| || |
Sbjct: 46595 caggaatatctgtgatgtcaccaattgcaaaaatgttattataaccttttattcttaaat 46536

                                                                         
Query: 479   ccttctccaccattactcttcccttggtgtccaaagattccttcaggatggtatcatgta 538
             |||| |||||||||| |||||||||| ||||||| |||||||| || |||||||||||||
Sbjct: 46535 ccttttccaccattagtcttcccttgttgtccaaggattcctttagaatggtatcatgta 46476

                                                                         
Query: 539   gccacgatgaactcagtggcttgccaatacacacaaagtggcaatcagctgttattgttt 598
             |||| |||||||| |||||||| || |||||||||||||||||||||||||||| |||||
Sbjct: 46475 gccatgatgaactgagtggcttaccgatacacacaaagtggcaatcagctgttactgttt 46416

                 
Query: 599   ctcc 602
             ||||
Sbjct: 46415 ctcc 46412
to top
>ref|NM_114287.2| Arabidopsis thaliana disulfide oxidoreductase/ electron carrier/
            oxidoreductase AT3G44190 mRNA, complete cds
          Length = 1517

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 183  cttcctcgtcttgccgacgaacaggtccttggatttga 220
            |||||||||||| ||||| ||||| ||||| |||||||
Sbjct: 1274 cttcctcgtcttcccgacaaacagatccttagatttga 1237
to top
>gb|AC148001.6| Mus musculus BAC clone RP24-82P9 from chromosome 18, complete sequence
          Length = 181022

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 136    tttgttttgcctggagatgggc 157
              ||||||||||||||||||||||
Sbjct: 129624 tttgttttgcctggagatgggc 129603
to top
>ref|XM_422763.1| PREDICTED: Gallus gallus similar to SUMO1/sentrin specific protease 5
            (LOC424955), mRNA
          Length = 3015

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 13   tacatgtacattcacacttctg 34
            ||||||||||||||||||||||
Sbjct: 1804 tacatgtacattcacacttctg 1825
to top
>emb|AL353814.1|ATF26G5 Arabidopsis thaliana DNA chromosome 3, BAC clone F26G5
          Length = 102873

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 183   cttcctcgtcttgccgacgaacaggtccttggatttga 220
             |||||||||||| ||||| ||||| ||||| |||||||
Sbjct: 83341 cttcctcgtcttcccgacaaacagatccttagatttga 83378
to top
>gb|BT008451.1| Arabidopsis thaliana At3g44190 gene, complete cds
          Length = 1104

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 183  cttcctcgtcttgccgacgaacaggtccttggatttga 220
            |||||||||||| ||||| ||||| ||||| |||||||
Sbjct: 1068 cttcctcgtcttcccgacaaacagatccttagatttga 1031
to top
>emb|BX823155.1|CNS0A7AM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB93ZH08 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1316

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 183  cttcctcgtcttgccgacgaacaggtccttggatttga 220
            |||||||||||| ||||| ||||| ||||| |||||||
Sbjct: 1103 cttcctcgtcttcccgacaaacagatccttagatttga 1066
to top
>emb|BX823570.1|CNS0A6LH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS51ZG01 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1359

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 183  cttcctcgtcttgccgacgaacaggtccttggatttga 220
            |||||||||||| ||||| ||||| ||||| |||||||
Sbjct: 1136 cttcctcgtcttcccgacaaacagatccttagatttga 1099
to top
>gb|AY084651.1| Arabidopsis thaliana clone 114123 mRNA, complete sequence
          Length = 1505

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 183  cttcctcgtcttgccgacgaacaggtccttggatttga 220
            |||||||||||| ||||| ||||| ||||| |||||||
Sbjct: 1274 cttcctcgtcttcccgacaaacagatccttagatttga 1237
to top
>gb|BT002026.1| Arabidopsis thaliana putative protein (At3g44190) mRNA, complete cds
          Length = 1423

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 183  cttcctcgtcttgccgacgaacaggtccttggatttga 220
            |||||||||||| ||||| ||||| ||||| |||||||
Sbjct: 1164 cttcctcgtcttcccgacaaacagatccttagatttga 1127
to top
>gb|AC107663.10| Mus musculus chromosome 13, clone RP23-99G9, complete sequence
          Length = 213163

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 260   gctgcgccagcccttccttccttcc 284
             ||||| |||||||||||||||||||
Sbjct: 93611 gctgccccagcccttccttccttcc 93635
to top
>gb|AC153139.5| Mus musculus BAC clone RP23-411M4 from chromosome 13, complete sequence
          Length = 192541

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 260    gctgcgccagcccttccttccttcc 284
              ||||| |||||||||||||||||||
Sbjct: 161962 gctgccccagcccttccttccttcc 161986
to top
>gb|AC064856.5| Homo sapiens BAC clone RP11-264N11 from 2, complete sequence
          Length = 107706

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 206  ggtccttggatttgagcatcc 226
            |||||||||||||||||||||
Sbjct: 4867 ggtccttggatttgagcatcc 4847
to top
>gb|AC160651.2| Pan troglodytes BAC clone CH251-489P13 from chromosome unknown,
             complete sequence
          Length = 209305

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 206   ggtccttggatttgagcatcc 226
             |||||||||||||||||||||
Sbjct: 12506 ggtccttggatttgagcatcc 12486
to top
>ref|NM_116172.3| Arabidopsis thaliana unknown protein AT3G63070 mRNA, complete cds
          Length = 4429

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 38   aaatgttcatcaccattctc 57
            ||||||||||||||||||||
Sbjct: 1525 aaatgttcatcaccattctc 1506
to top
>gb|AC158304.11| Mus musculus chromosome 7, clone RP24-192F23, complete sequence
          Length = 166451

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 274    tccttccttcccagggagac 293
              ||||||||||||||||||||
Sbjct: 111676 tccttccttcccagggagac 111695
to top
>gb|AC158787.14| Mus musculus chromosome 15, clone RP23-136G8, complete sequence
          Length = 203772

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 170    tcaggcccatctgcttcctc 189
              ||||||||||||||||||||
Sbjct: 182713 tcaggcccatctgcttcctc 182694
to top
>ref|XM_659299.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN6787.2), mRNA
          Length = 1761

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 247  gtcaggtagggcagctgcgccagc 270
            |||||||||||||||||| |||||
Sbjct: 1175 gtcaggtagggcagctgctccagc 1152
to top
>gb|AC125531.3| Mus musculus BAC clone RP23-396D12 from chromosome 10, complete sequence
          Length = 219818

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 555    tggcttgccaatacacacaa 574
              ||||||||||||||||||||
Sbjct: 113510 tggcttgccaatacacacaa 113529
to top
>gb|AC140359.2| Mus musculus BAC clone RP24-240P8 from chromosome 5, complete sequence
          Length = 167021

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     tgcgtacatgtacattcaca 28
             ||||||||||||||||||||
Sbjct: 74880 tgcgtacatgtacattcaca 74899
to top
>gb|AC122045.3| Mus musculus BAC clone RP24-449H18 from 5, complete sequence
          Length = 142673

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     tgcgtacatgtacattcaca 28
             ||||||||||||||||||||
Sbjct: 96839 tgcgtacatgtacattcaca 96858
to top
>gb|AC110573.11| Mus musculus chromosome 16, clone RP23-322A15, complete sequence
          Length = 190173

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 411    tttgatttcaggaatatctg 430
              ||||||||||||||||||||
Sbjct: 100847 tttgatttcaggaatatctg 100866
to top
>gb|AC166568.2| Spironucleus vortens clone JGIBAWF-9N8, complete sequence
          Length = 38345

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 384   cgcgtgcttctgggcgaggt 403
             ||||||||||||||||||||
Sbjct: 35606 cgcgtgcttctgggcgaggt 35587
to top
>gb|AC166575.1| Mus musculus BAC clone RP23-99E16 from chromosome 17, complete sequence
          Length = 200353

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 265   gccagcccttccttccttcc 284
             ||||||||||||||||||||
Sbjct: 41557 gccagcccttccttccttcc 41576
to top
>emb|AL772400.3| Human DNA sequence from clone RP11-540N4 on chromosome X Contains the
             3' end of the PRPS1 gene for phosphoribosyl pyrophosphate
             synthetase 1 (PRSI), complete sequence
          Length = 74714

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 581   aatcagctgttattgtttct 600
             ||||||||||||||||||||
Sbjct: 26778 aatcagctgttattgtttct 26759
to top
>emb|AL139328.8| Human DNA sequence from clone RP11-84N7 on chromosome 13 Contains part
             of the DGKH gene for diacylglycerol kinase eta, complete
             sequence
          Length = 148430

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 268   agcccttccttccttcccag 287
             ||||||||||||||||||||
Sbjct: 73093 agcccttccttccttcccag 73074
to top
>emb|AL020995.14|HS117O3 Human DNA sequence from clone RP1-117O3 on chromosome 1p33-34.3 Contains
              the 3' end of a novel gene, the AK2 gene for adenylate
              kinase 2, the gene for ornithine decarboxylase-like (ODC-p)
              and a CpG island, complete sequence
          Length = 150997

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 265    gccagcccttccttccttcc 284
              ||||||||||||||||||||
Sbjct: 145628 gccagcccttccttccttcc 145647
to top
>gb|AC074336.14| Mus musculus Strain C57BL6/J chromosome 1 BAC, RP23-366C17, Complete
              Sequence, complete sequence
          Length = 217768

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 272    cttccttccttcccagggag 291
              ||||||||||||||||||||
Sbjct: 149455 cttccttccttcccagggag 149474
to top
>emb|Z11595.1|EBHCOMPMR Eptatretus burgeri partial mRNA for hagfish complement
          Length = 4902

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 469  actctcaagtccttctccac 488
            ||||||||||||||||||||
Sbjct: 2681 actctcaagtccttctccac 2662
to top
>emb|AL022018.1|DMC8D8 Drosophila melanogaster cosmid clone 8D8
          Length = 38397

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 257   gcagctgcgccagcccttccttcc 280
             |||||||||||||||| |||||||
Sbjct: 26291 gcagctgcgccagcccatccttcc 26268
to top
>gb|AC090881.9| Mus Musculus Strain C57BL6/J chromosome 17 BAC, RP23-465G4, Complete
             Sequence, complete sequence
          Length = 167475

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 265   gccagcccttccttccttcc 284
             ||||||||||||||||||||
Sbjct: 15373 gccagcccttccttccttcc 15354
to top
>gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 181360

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 257   gcagctgcgccagcccttccttcc 280
             |||||||||||||||| |||||||
Sbjct: 22682 gcagctgcgccagcccatccttcc 22659
to top
>gb|AY119282.1| Drosophila melanogaster SD27341 full insert cDNA
          Length = 2338

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 257  gcagctgcgccagcccttccttcc 280
            |||||||||||||||| |||||||
Sbjct: 1245 gcagctgcgccagcccatccttcc 1268
to top
>ref|NM_206602.1| Drosophila melanogaster CG11418-RB, transcript variant B (CG11418),
           mRNA
          Length = 1372

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 257 gcagctgcgccagcccttccttcc 280
           |||||||||||||||| |||||||
Sbjct: 300 gcagctgcgccagcccatccttcc 323
to top
>ref|NM_130548.2| Drosophila melanogaster CG11418-RA, transcript variant A (CG11418),
            mRNA
          Length = 2317

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 257  gcagctgcgccagcccttccttcc 280
            |||||||||||||||| |||||||
Sbjct: 1245 gcagctgcgccagcccatccttcc 1268
to top
>gb|AC106822.3| Homo sapiens chromosome 5 clone RP11-772C9, complete sequence
          Length = 115988

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 270    cccttccttccttcccaggg 289
              ||||||||||||||||||||
Sbjct: 105831 cccttccttccttcccaggg 105812
to top
>gb|AC104288.4| Drosophila melanogaster X BAC RP98-30G24 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 164252

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 257   gcagctgcgccagcccttccttcc 280
             |||||||||||||||| |||||||
Sbjct: 82197 gcagctgcgccagcccatccttcc 82174
to top
>gb|AC015468.5|AC015468 Homo sapiens chromosome 8, clone RP11-369E15, complete sequence
          Length = 189662

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 266    ccagcccttccttccttccc 285
              ||||||||||||||||||||
Sbjct: 111608 ccagcccttccttccttccc 111627
to top
>gb|DQ310040.1| Phelipanche purpurea subsp. bohemica 5 ribosomal protein subunit 2
           (rps2) gene, partial cds; plastid
          Length = 567

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 581 aatcagctgttattgtttct 600
           ||||||||||||||||||||
Sbjct: 190 aatcagctgttattgtttct 171
to top
>gb|DQ310039.1| Phelipanche purpurea subsp. bohemica 1 ribosomal protein subunit 2
           (rps2) gene, partial cds; plastid
          Length = 567

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 581 aatcagctgttattgtttct 600
           ||||||||||||||||||||
Sbjct: 190 aatcagctgttattgtttct 171
to top
>gb|DQ310038.1| Phelipanche purpurea subsp. bohemica 9 ribosomal protein subunit 2
           (rps2) gene, partial cds; plastid
          Length = 567

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 581 aatcagctgttattgtttct 600
           ||||||||||||||||||||
Sbjct: 190 aatcagctgttattgtttct 171
to top
>gb|DQ310037.1| Phelipanche purpurea subsp. bohemica 2 ribosomal protein subunit 2
           (rps2) gene, partial cds; plastid
          Length = 567

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 581 aatcagctgttattgtttct 600
           ||||||||||||||||||||
Sbjct: 190 aatcagctgttattgtttct 171
to top
>gb|DQ310036.1| Phelipanche purpurea subsp. bohemica 3 ribosomal protein subunit 2
           (rps2) gene, partial cds; plastid
          Length = 567

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 581 aatcagctgttattgtttct 600
           ||||||||||||||||||||
Sbjct: 190 aatcagctgttattgtttct 171
to top
>gb|DQ310035.1| Phelipanche purpurea ribosomal protein subunit 2 (rps2) gene,
           partial cds; plastid
          Length = 483

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 581 aatcagctgttattgtttct 600
           ||||||||||||||||||||
Sbjct: 163 aatcagctgttattgtttct 144
to top
>gb|AC019181.4| Homo sapiens BAC clone RP11-272E3 from 2, complete sequence
          Length = 190998

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 431   tgatgtcaccgattgcaaaa 450
             ||||||||||||||||||||
Sbjct: 82239 tgatgtcaccgattgcaaaa 82258
to top
>gb|AC139713.1| Homo sapiens BAC clone RP11-481K16 from 4, complete sequence
          Length = 196020

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 575   agtggcaatcagctgttattgttt 598
             ||||||||||| ||||||||||||
Sbjct: 62417 agtggcaatcaactgttattgttt 62440
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 380    gcagcgcgtgcttctgggcgaggt 403
              ||||||||||||||||| ||||||
Sbjct: 127601 gcagcgcgtgcttctggacgaggt 127624
to top
>gb|AC007385.3| Homo sapiens BAC clone RP11-325M10 from 2, complete sequence
          Length = 188062

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 131  gtttatttgttttgcctgga 150
            ||||||||||||||||||||
Sbjct: 5166 gtttatttgttttgcctgga 5147
to top
>gb|AC006142.1|AC006142 Homo sapiens PAC clone RP4-572A3, complete sequence
          Length = 143623

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 270   cccttccttccttcccaggg 289
             ||||||||||||||||||||
Sbjct: 58827 cccttccttccttcccaggg 58808
to top
>gb|AE003420.2| Drosophila melanogaster chromosome X, section 4 of 74 of the complete
              sequence
          Length = 308311

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 257    gcagctgcgccagcccttccttcc 280
              |||||||||||||||| |||||||
Sbjct: 193517 gcagctgcgccagcccatccttcc 193494
to top
>emb|CT030030.12| Mouse DNA sequence from clone RP23-123J19 on chromosome 12, complete
             sequence
          Length = 201738

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 483   ctccaccattactcttcccttggt 506
             |||| |||||||||||||||||||
Sbjct: 81483 ctcccccattactcttcccttggt 81460
to top
>gb|AC134554.6| Mus musculus BAC clone RP24-313F7 from chromosome 15, complete sequence
          Length = 148029

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 170   tcaggcccatctgcttcctc 189
             ||||||||||||||||||||
Sbjct: 93666 tcaggcccatctgcttcctc 93647
to top
>gb|AC005291.1|AC005291 Homo sapiens chromosome 17, clone hRPK.401_O_9, complete sequence
          Length = 198582

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 266    ccagcccttccttccttcccaggg 289
              |||||||||| |||||||||||||
Sbjct: 148254 ccagcccttctttccttcccaggg 148231
to top
>emb|AL163816.1|ATT20O10 Arabidopsis thaliana DNA chromosome 3, BAC clone T20O10
          Length = 83122

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 38    aaatgttcatcaccattctc 57
             ||||||||||||||||||||
Sbjct: 48056 aaatgttcatcaccattctc 48037
to top
>gb|AC129777.4| Mus musculus BAC clone RP23-281H23 from 8, complete sequence
          Length = 228174

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 265   gccagcccttccttccttcc 284
             ||||||||||||||||||||
Sbjct: 32454 gccagcccttccttccttcc 32473


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,373,949
Number of Sequences: 3902068
Number of extensions: 6373949
Number of successful extensions: 605373
Number of sequences better than 10.0: 60
Number of HSP's better than 10.0 without gapping: 60
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 604799
Number of HSP's gapped (non-prelim): 567
length of query: 604
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 581
effective length of database: 17,143,297,704
effective search space: 9960255966024
effective search space used: 9960255966024
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top