ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd16j22 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AF542969.2| Triticum aestivum ribosomal protein L19 mRNA, complete cds Length = 854 Score = 926 bits (467), Expect = 0.0 Identities = 591/629 (93%), Gaps = 13/629 (2%) Strand = Plus / Minus Query: 16 atatttaagg-tatctgacaagttgacacaaacacgatattgcacaggnaaacagttctg 74 |||||||||| ||| ||||| |||||||||| || || |||| ||||||||||||||||| Sbjct: 770 atatttaagggtatntgacacgttgacacaancaagaaattggacaggnaaacagttctg 711 Query: 75 aacttctgatgttcc-aaaattagg-ctaacccttgatgataccagnaaagctaaagctt 132 ||||| ||||||||| ||||||||| |||||| || || |||||| || |||||||||| Sbjct: 710 aacttntgatgttcccaaaattagggctaacctttcatagtaccagaaaggctaaagctt 651 Query: 133 caagtcagaccttcacttcttggccttctttggtgccgctgctgccggagctggagctgc 192 || |||||| ||||||||||||||||||||||||||||| |||||||||||| Sbjct: 650 catgtcagaacttcacttcttggccttctttggtgccgc---------agctggagctgc 600 Query: 193 agccgctggtgccggtgcatgatctctggggccctggg-ccaatctctcctccctcctgg 251 |||||||||||| |||||||||||||| ||||| |||| ||||||||||||||||||||| Sbjct: 599 agccgctggtgctggtgcatgatctctcgggccntggggccaatctctcctccctcctgg 540 Query: 252 caatcttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtcagata 311 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | Sbjct: 539 caatcttcctctccctgcttgccttgctcttggcgcgcttggcctcaaactggtcagaga 480 Query: 312 gggtcttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctct 371 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 479 gggtcttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctct 420 Query: 372 tgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcga 431 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 419 tgttcttgaacatgttacctttgaccttcaggtacatgtcatggtacatgtgcttgtcga 360 Query: 432 tcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatcc 491 ||||||| ||||||||||||||||||||||| |||||||| || |||||||||||||||| Sbjct: 359 tcttcttggcctcacggtacttgcgcagaaggcgcctcaggacgcgcatcctccgcatcc 300 Query: 492 acaggatcttggtggggagcctagcctccctggtacccctacgcttaccatatccagagt 551 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 299 acaggatcttggtggggagcctagcctccctggtacccctacgcttaccatatccagagt 240 Query: 552 gacggcccttctgcttggcctcatgtgccctccttgcacgagacctggagtggatcttct 611 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 239 gacggcccttctgcttggcctcatgtgccctccttgcacgagacctggagtggatcttct 180 Query: 612 gaggcttcctgatgatgaaaccatccttt 640 ||||||||||||||||||||||||||||| Sbjct: 179 gaggcttcctgatgatgaaaccatccttt 151
>dbj|AK102721.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033105G07, full insert sequence Length = 914 Score = 559 bits (282), Expect = e-156 Identities = 443/496 (89%), Gaps = 3/496 (0%) Strand = Plus / Minus Query: 144 ttcacttcttggccttctttggtgccgctgctgccggagctggagctgcagccgctggtg 203 |||||||||| |||||||| ||||||||||| | |||| |||||||| || || || | Sbjct: 720 ttcacttctttgccttcttaggtgccgctgcagtttgagcaggagctgccgctgcaggag 661 Query: 204 ccggtgcatgatctctggggccctgggccaatctctcctccctcctggcaatcttcctct 263 | | || | ||||| |||||||| ||||| |||||||||||||||||||||||||||| Sbjct: 660 ctgctg---gctctcttgggccctgagccaacctctcctccctcctggcaatcttcctct 604 Query: 264 ccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtcttctctc 323 | | |||||||||||||||||||||||| ||||||||||||||||| || |||||||||| Sbjct: 603 cacggcttgccttgctcttggcacgcttagcctcaaactggtcagagagtgtcttctctc 544 Query: 324 ttgccttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaaca 383 |||||||||||||||| |||||||||||||| ||||| || || | |||||||||||||| Sbjct: 543 ttgccttctcagccttagacttgtggatactttccataagaacacgcttgttcttgaaca 484 Query: 384 tgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctttgcct 443 |||||||||||||||||| |||||||||||| |||||||||||||| |||||||| |||| Sbjct: 483 tgttacccttgaccttcatgtacatgtcatgatacatgtgcttgtcaatcttcttggcct 424 Query: 444 cacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccacaggatcttgg 503 |||| ||||||||||| | |||||| |||||||||||||||| ||||||||||||||||| Sbjct: 423 cacgatacttgcgcagcaaacgcctgagcacacgcatcctcctcatccacaggatcttgg 364 Query: 504 tggggagcctagcctccctggtacccctacgcttaccatatccagagtgacggcccttct 563 ||||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||| Sbjct: 363 tggggagcctagcctcccttgtacccctacgcttaccatagccagagtgacgtcccttct 304 Query: 564 gcttggcctcatgtgccctccttgcacgagacctggagtggatcttctgaggcttcctga 623 |||| |||||||| || |||| ||| || ||||||||||| |||||||| |||||| ||| Sbjct: 303 gcttagcctcatgggctctccgtgctcgggacctggagtgaatcttctggggcttcttga 244 Query: 624 tgatgaaaccatcctt 639 ||||||| |||||||| Sbjct: 243 tgatgaatccatcctt 228
>dbj|AK059309.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-G06, full insert sequence Length = 1121 Score = 559 bits (282), Expect = e-156 Identities = 443/496 (89%), Gaps = 3/496 (0%) Strand = Plus / Minus Query: 144 ttcacttcttggccttctttggtgccgctgctgccggagctggagctgcagccgctggtg 203 |||||||||| |||||||| ||||||||||| | |||| |||||||| || || || | Sbjct: 721 ttcacttctttgccttcttaggtgccgctgcagtttgagcaggagctgccgctgcaggag 662 Query: 204 ccggtgcatgatctctggggccctgggccaatctctcctccctcctggcaatcttcctct 263 | | || | ||||| |||||||| ||||| |||||||||||||||||||||||||||| Sbjct: 661 ctgctg---gctctcttgggccctgagccaacctctcctccctcctggcaatcttcctct 605 Query: 264 ccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtcttctctc 323 | | |||||||||||||||||||||||| ||||||||||||||||| || |||||||||| Sbjct: 604 cacggcttgccttgctcttggcacgcttagcctcaaactggtcagagagtgtcttctctc 545 Query: 324 ttgccttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaaca 383 |||||||||||||||| |||||||||||||| ||||| || || | |||||||||||||| Sbjct: 544 ttgccttctcagccttagacttgtggatactttccataagaacacgcttgttcttgaaca 485 Query: 384 tgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctttgcct 443 |||||||||||||||||| |||||||||||| |||||||||||||| |||||||| |||| Sbjct: 484 tgttacccttgaccttcatgtacatgtcatgatacatgtgcttgtcaatcttcttggcct 425 Query: 444 cacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccacaggatcttgg 503 |||| ||||||||||| | |||||| |||||||||||||||| ||||||||||||||||| Sbjct: 424 cacgatacttgcgcagcaaacgcctgagcacacgcatcctcctcatccacaggatcttgg 365 Query: 504 tggggagcctagcctccctggtacccctacgcttaccatatccagagtgacggcccttct 563 ||||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||| Sbjct: 364 tggggagcctagcctcccttgtacccctacgcttaccatagccagagtgacgtcccttct 305 Query: 564 gcttggcctcatgtgccctccttgcacgagacctggagtggatcttctgaggcttcctga 623 |||| |||||||| || |||| ||| || ||||||||||| |||||||| |||||| ||| Sbjct: 304 gcttagcctcatgggctctccgtgctcgggacctggagtgaatcttctggggcttcttga 245 Query: 624 tgatgaaaccatcctt 639 ||||||| |||||||| Sbjct: 244 tgatgaatccatcctt 229
>gb|AY103679.1| Zea mays PCO152526 mRNA sequence Length = 1051 Score = 549 bits (277), Expect = e-153 Identities = 388/425 (91%) Strand = Plus / Minus Query: 215 tctctggggccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgcc 274 ||||| ||||||||||||| |||||||||||||| |||||||||||||| | ||||||| Sbjct: 638 tctcttgggccctgggccagcctctcctccctcctagcaatcttcctctcacggcttgcc 579 Query: 275 ttgctcttggcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctca 334 |||||||| |||||||||||||||||||| ||||| || ||||||||||| ||||||||| Sbjct: 578 ttgctctttgcacgcttggcctcaaactgatcagaaagtgtcttctctctggccttctca 519 Query: 335 gccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttg 394 |||||||||||||||||||||||||| || |||||||||||||| ||||| ||||||||| Sbjct: 518 gccttggacttgtggatactctccataagcaccctcttgttcttaaacatattacccttg 459 Query: 395 accttcaggtacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttg 454 ||||||| |||||||||||| ||||||||||||||||||||||| ||||||||||||||| Sbjct: 458 accttcatgtacatgtcatgatacatgtgcttgtcgatcttcttggcctcacggtacttg 399 Query: 455 cgcagaagacgcctcagcacacgcatcctccgcatccacaggatcttggtggggagccta 514 || || || |||||||| ||||||||||||| ||||||||| |||||||||||||||||| Sbjct: 398 cggagcaggcgcctcagaacacgcatcctcctcatccacagaatcttggtggggagccta 339 Query: 515 gcctccctggtacccctacgcttaccatatccagagtgacggcccttctgcttggcctca 574 ||||||||||||||||| ||||| || ||||||||||| | |||||||||||||||||| Sbjct: 338 gcctccctggtacccctgcgcttgccgtatccagagtgccttcccttctgcttggcctca 279 Query: 575 tgtgccctccttgcacgagacctggagtggatcttctgaggcttcctgatgatgaaacca 634 |||||||| |||||||| ||||| ||||| | ||||||||||||||||||||| || ||| Sbjct: 278 tgtgcccttcttgcacgggacctagagtgaaccttctgaggcttcctgatgataaaccca 219 Query: 635 tcctt 639 ||||| Sbjct: 218 tcctt 214
>gb|BT019233.1| Zea mays clone Contig906.F mRNA sequence Length = 1470 Score = 507 bits (256), Expect = e-140 Identities = 376/416 (90%) Strand = Plus / Plus Query: 224 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 283 ||||||||||| |||||||||||||| || ||||||||||| | ||| |||||||||||| Sbjct: 278 ccctgggccaacctctcctccctcctagcgatcttcctctcacggctcgccttgctcttg 337 Query: 284 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 343 || ||||||||||||||||||||||| || ||||||||||| |||||||||||||||||| Sbjct: 338 gcgcgcttggcctcaaactggtcagaaagtgtcttctctctggccttctcagccttggac 397 Query: 344 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 403 ||||||||||||||||| || ||||||||||||||||| |||||| |||||||||| | Sbjct: 398 ttgtggatactctccataagcaccctcttgttcttgaaggcgttacctttgaccttcatg 457 Query: 404 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 463 ||||||||||| |||||||||||||| |||||||| |||||||| |||||||| ||||| Sbjct: 458 tacatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcggagaagg 517 Query: 464 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 523 |||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||||| Sbjct: 518 cgcctcagcacacgcatcctcctcatccacagaaccttggtgggtagcctagcctccctg 577 Query: 524 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctcatgtgccctc 583 ||||||||||||||||||||||| ||||| || ||||| |||||||| ||||||||||| Sbjct: 578 gtacccctacgcttaccatatcctgagtggcgtcccttttgcttggcgtcatgtgccctt 637 Query: 584 cttgcacgagacctggagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||||| || || ||||||||||| ||||||||| ||||||| || |||||||| Sbjct: 638 cttgcacgggatctagagtggatcttatgaggcttcttgatgataaacccatcctt 693
>gb|BT016537.1| Zea mays clone Contig370 mRNA sequence Length = 956 Score = 507 bits (256), Expect = e-140 Identities = 376/416 (90%) Strand = Plus / Minus Query: 224 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 283 ||||||||||| |||||||||||||| || ||||||||||| | ||| |||||||||||| Sbjct: 738 ccctgggccaacctctcctccctcctagcgatcttcctctcacggctcgccttgctcttg 679 Query: 284 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 343 || ||||||||||||||||||||||| || ||||||||||| |||||||||||||||||| Sbjct: 678 gcgcgcttggcctcaaactggtcagaaagtgtcttctctctggccttctcagccttggac 619 Query: 344 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 403 ||||||||||||||||| || ||||||||||||||||| |||||| |||||||||| | Sbjct: 618 ttgtggatactctccataagcaccctcttgttcttgaaggcgttacctttgaccttcatg 559 Query: 404 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 463 ||||||||||| |||||||||||||| |||||||| |||||||| |||||||| ||||| Sbjct: 558 tacatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcggagaagg 499 Query: 464 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 523 |||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||||| Sbjct: 498 cgcctcagcacacgcatcctcctcatccacagaaccttggtgggtagcctagcctccctg 439 Query: 524 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctcatgtgccctc 583 ||||||||||||||||||||||| ||||| || ||||| |||||||| ||||||||||| Sbjct: 438 gtacccctacgcttaccatatcctgagtggcgtcccttttgcttggcgtcatgtgccctt 379 Query: 584 cttgcacgagacctggagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||||| || || ||||||||||| ||||||||| ||||||| || |||||||| Sbjct: 378 cttgcacgggatctagagtggatcttatgaggcttcttgatgataaacccatcctt 323
>gb|AY103638.1| Zea mays PCO153348 mRNA sequence Length = 1258 Score = 507 bits (256), Expect = e-140 Identities = 376/416 (90%) Strand = Plus / Minus Query: 224 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 283 ||||||||||| |||||||||||||| || ||||||||||| | ||| |||||||||||| Sbjct: 933 ccctgggccaacctctcctccctcctagcgatcttcctctcacggctcgccttgctcttg 874 Query: 284 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 343 || ||||||||||||||||||||||| || ||||||||||| |||||||||||||||||| Sbjct: 873 gcgcgcttggcctcaaactggtcagaaagtgtcttctctctggccttctcagccttggac 814 Query: 344 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 403 ||||||||||||||||| || ||||||||||||||||| |||||| |||||||||| | Sbjct: 813 ttgtggatactctccataagcaccctcttgttcttgaaggcgttacctttgaccttcatg 754 Query: 404 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 463 ||||||||||| |||||||||||||| |||||||| |||||||| |||||||| ||||| Sbjct: 753 tacatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcggagaagg 694 Query: 464 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 523 |||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||||| Sbjct: 693 cgcctcagcacacgcatcctcctcatccacagaaccttggtgggtagcctagcctccctg 634 Query: 524 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctcatgtgccctc 583 ||||||||||||||||||||||| ||||| || ||||| |||||||| ||||||||||| Sbjct: 633 gtacccctacgcttaccatatcctgagtggcgtcccttttgcttggcgtcatgtgccctt 574 Query: 584 cttgcacgagacctggagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||||| || || ||||||||||| ||||||||| ||||||| || |||||||| Sbjct: 573 cttgcacgggatctagagtggatcttatgaggcttcttgatgataaacccatcctt 518
>gb|BT016919.1| Zea mays clone E04912701B11.c mRNA sequence Length = 974 Score = 505 bits (255), Expect = e-140 Identities = 378/419 (90%) Strand = Plus / Plus Query: 221 gggccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctc 280 ||||||||||||| || ||||||||||| | ||||||||| || | | ||||||||||| Sbjct: 329 gggccctgggccagcctttcctccctcctagaaatcttcctttcacgggttgccttgctc 388 Query: 281 ttggcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttg 340 || |||||||||||||||||||| ||| | || ||||||||||| ||||||||||||||| Sbjct: 389 tttgcacgcttggcctcaaactgatcaaaaagtgtcttctctctggccttctcagccttg 448 Query: 341 gacttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttc 400 |||||||||||||||||||| || |||||||||||||| ||||| ||||||||||||||| Sbjct: 449 gacttgtggatactctccataagcaccctcttgttcttaaacatattacccttgaccttc 508 Query: 401 aggtacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcaga 460 | |||||||||||| |||||||||||| |||||||||| ||||||||||||||||| || Sbjct: 509 atgtacatgtcatgatacatgtgcttggcgatcttcttggcctcacggtacttgcggagc 568 Query: 461 agacgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctcc 520 || |||||||| ||||||||||||| ||||||||| |||||||||||||||||||||||| Sbjct: 569 aggcgcctcagaacacgcatcctcctcatccacagaatcttggtggggagcctagcctcc 628 Query: 521 ctggtacccctacgcttaccatatccagagtgacggcccttctgcttggcctcatgtgcc 580 ||||||||||| ||||| |||||||||||||| | |||||||||||||||||||||||| Sbjct: 629 ctggtacccctgcgcttgccatatccagagtgccttcccttctgcttggcctcatgtgcc 688 Query: 581 ctccttgcacgagacctggagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 || |||||||| ||||| ||||| | ||||||||||||||||||||| || |||||||| Sbjct: 689 cttcttgcacgggacctagagtgaaccttctgaggcttcctgatgataaacccatcctt 747
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 444 bits (224), Expect = e-121 Identities = 293/316 (92%) Strand = Plus / Plus Query: 225 cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 284 |||| ||||| ||||||||||||||||||||||||||||| | ||||||||||||||||| Sbjct: 12517448 cctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttgctcttgg 12517507 Query: 285 cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 344 ||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 12517508 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 12517567 Query: 345 tgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggt 404 |||||||||| ||||| || || | |||||||||||||||||||||||||||||||| || Sbjct: 12517568 tgtggatactttccataagaacacgcttgttcttgaacatgttacccttgaccttcatgt 12517627 Query: 405 acatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagac 464 |||||||||| |||||||||||||| |||||||| |||||||| ||||||||||| | || Sbjct: 12517628 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 12517687 Query: 465 gcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctgg 524 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| | Sbjct: 12517688 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctcccttg 12517747 Query: 525 tacccctacgcttacc 540 |||||||||||||||| Sbjct: 12517748 tacccctacgcttacc 12517763 Score = 420 bits (212), Expect = e-114 Identities = 290/316 (91%) Strand = Plus / Plus Query: 225 cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 284 |||| ||||| ||||| || | |||||||||||||||||| | || ||||||||||||| Sbjct: 21047190 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 21047249 Query: 285 cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 344 ||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 21047250 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 21047309 Query: 345 tgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggt 404 |||||||||| |||||||| || | |||||||||||||||||||||||||||||||| || Sbjct: 21047310 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 21047369 Query: 405 acatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagac 464 |||||||||| |||||||||||||| |||||||| |||||||| ||||||||||| | || Sbjct: 21047370 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 21047429 Query: 465 gcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctgg 524 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 21047430 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 21047489 Query: 525 tacccctacgcttacc 540 |||||||||||||||| Sbjct: 21047490 tacccctacgcttacc 21047505 Score = 115 bits (58), Expect = 2e-22 Identities = 91/102 (89%) Strand = Plus / Plus Query: 538 accatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct 597 |||||| ||||||||||| |||||||||||||||||||| || |||| |||||| ||||| Sbjct: 21047582 accatagccagagtgacgtcccttctgcttggcctcatgggctctccgtgcacgggacct 21047641 Query: 598 ggagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||| |||||||| |||||| |||| ||||| |||||||| Sbjct: 21047642 ggagtgaatcttctggggcttcttgataatgaacccatcctt 21047683 Score = 107 bits (54), Expect = 4e-20 Identities = 90/102 (88%) Strand = Plus / Plus Query: 538 accatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct 597 |||||| ||||||||||| ||||||||||| |||||||| || |||| ||| || ||||| Sbjct: 12517843 accatagccagagtgacgtcccttctgcttagcctcatgggctctccgtgctcgggacct 12517902 Query: 598 ggagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||| |||||||| |||||| |||||||||| |||||||| Sbjct: 12517903 ggagtgaatcttctggggcttcttgatgatgaatccatcctt 12517944
>gb|AC134885.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1125B03, from chromosome 3, complete sequence Length = 124550 Score = 444 bits (224), Expect = e-121 Identities = 293/316 (92%) Strand = Plus / Minus Query: 225 cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 284 |||| ||||| ||||||||||||||||||||||||||||| | ||||||||||||||||| Sbjct: 70493 cctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttgctcttgg 70434 Query: 285 cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 344 ||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 70433 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 70374 Query: 345 tgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggt 404 |||||||||| ||||| || || | |||||||||||||||||||||||||||||||| || Sbjct: 70373 tgtggatactttccataagaacacgcttgttcttgaacatgttacccttgaccttcatgt 70314 Query: 405 acatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagac 464 |||||||||| |||||||||||||| |||||||| |||||||| ||||||||||| | || Sbjct: 70313 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 70254 Query: 465 gcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctgg 524 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| | Sbjct: 70253 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctcccttg 70194 Query: 525 tacccctacgcttacc 540 |||||||||||||||| Sbjct: 70193 tacccctacgcttacc 70178 Score = 107 bits (54), Expect = 4e-20 Identities = 90/102 (88%) Strand = Plus / Minus Query: 538 accatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct 597 |||||| ||||||||||| ||||||||||| |||||||| || |||| ||| || ||||| Sbjct: 70098 accatagccagagtgacgtcccttctgcttagcctcatgggctctccgtgctcgggacct 70039 Query: 598 ggagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||| |||||||| |||||| |||||||||| |||||||| Sbjct: 70038 ggagtgaatcttctggggcttcttgatgatgaatccatcctt 69997
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 444 bits (224), Expect = e-121 Identities = 293/316 (92%) Strand = Plus / Plus Query: 225 cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 284 |||| ||||| ||||||||||||||||||||||||||||| | ||||||||||||||||| Sbjct: 12514211 cctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttgctcttgg 12514270 Query: 285 cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 344 ||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 12514271 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 12514330 Query: 345 tgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggt 404 |||||||||| ||||| || || | |||||||||||||||||||||||||||||||| || Sbjct: 12514331 tgtggatactttccataagaacacgcttgttcttgaacatgttacccttgaccttcatgt 12514390 Query: 405 acatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagac 464 |||||||||| |||||||||||||| |||||||| |||||||| ||||||||||| | || Sbjct: 12514391 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 12514450 Query: 465 gcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctgg 524 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| | Sbjct: 12514451 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctcccttg 12514510 Query: 525 tacccctacgcttacc 540 |||||||||||||||| Sbjct: 12514511 tacccctacgcttacc 12514526 Score = 420 bits (212), Expect = e-114 Identities = 290/316 (91%) Strand = Plus / Plus Query: 225 cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 284 |||| ||||| ||||| || | |||||||||||||||||| | || ||||||||||||| Sbjct: 21040219 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 21040278 Query: 285 cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 344 ||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 21040279 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 21040338 Query: 345 tgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggt 404 |||||||||| |||||||| || | |||||||||||||||||||||||||||||||| || Sbjct: 21040339 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 21040398 Query: 405 acatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagac 464 |||||||||| |||||||||||||| |||||||| |||||||| ||||||||||| | || Sbjct: 21040399 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 21040458 Query: 465 gcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctgg 524 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 21040459 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 21040518 Query: 525 tacccctacgcttacc 540 |||||||||||||||| Sbjct: 21040519 tacccctacgcttacc 21040534 Score = 115 bits (58), Expect = 2e-22 Identities = 91/102 (89%) Strand = Plus / Plus Query: 538 accatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct 597 |||||| ||||||||||| |||||||||||||||||||| || |||| |||||| ||||| Sbjct: 21040611 accatagccagagtgacgtcccttctgcttggcctcatgggctctccgtgcacgggacct 21040670 Query: 598 ggagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||| |||||||| |||||| |||| ||||| |||||||| Sbjct: 21040671 ggagtgaatcttctggggcttcttgataatgaacccatcctt 21040712 Score = 107 bits (54), Expect = 4e-20 Identities = 90/102 (88%) Strand = Plus / Plus Query: 538 accatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct 597 |||||| ||||||||||| ||||||||||| |||||||| || |||| ||| || ||||| Sbjct: 12514606 accatagccagagtgacgtcccttctgcttagcctcatgggctctccgtgctcgggacct 12514665 Query: 598 ggagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||| |||||||| |||||| |||||||||| |||||||| Sbjct: 12514666 ggagtgaatcttctggggcttcttgatgatgaatccatcctt 12514707
>gb|BT016443.1| Zea mays clone Contig276 mRNA sequence Length = 779 Score = 430 bits (217), Expect = e-117 Identities = 373/425 (87%) Strand = Plus / Minus Query: 215 tctctggggccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgcc 274 ||||| ||||||||||||| ||||| |||||||| ||| |||||||||| | || ||| Sbjct: 592 tctcttgggccctgggccagcctctcttccctcctagcattcttcctctcgcgactcgcc 533 Query: 275 ttgctcttggcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctca 334 ||||||||||| ||| ||||||| ||||| || || || |||||||| || ||||||||| Sbjct: 532 ttgctcttggcgcgcctggcctcgaactgatcggagagcgtcttctccctggccttctca 473 Query: 335 gccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttg 394 ||||||||||||||||| |||||||| || |||||||||||||||||| |||||| ||| Sbjct: 472 gccttggacttgtggatgctctccataagcaccctcttgttcttgaacgagttacctttg 413 Query: 395 accttcaggtacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttg 454 ||||||| |||||| || |||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 412 accttcatgtacatatcgtggtacatgtgcttgtcgatcttcttggcctcgcggtacttg 353 Query: 455 cgcagaagacgcctcagcacacgcatcctccgcatccacaggatcttggtggggagccta 514 || || || ||||||||||| |||||||||| ||||||||| | |||||||||||||||| Sbjct: 352 cggagcaggcgcctcagcacgcgcatcctcctcatccacagtaccttggtggggagccta 293 Query: 515 gcctccctggtacccctacgcttaccatatccagagtgacggcccttctgcttggcctca 574 |||||||||||||| |||||||| |||||||| ||||| || ||||||||||| ||||| Sbjct: 292 gcctccctggtacctctacgcttcccatatcctgagtgccgtcccttctgcttagcctcg 233 Query: 575 tgtgccctccttgcacgagacctggagtggatcttctgaggcttcctgatgatgaaacca 634 || ||||| ||||||||||| || |||||||| |||||||||||| ||||||| || ||| Sbjct: 232 tgcgcccttcttgcacgagatctagagtggattttctgaggcttcttgatgataaaccca 173 Query: 635 tcctt 639 ||||| Sbjct: 172 tcctt 168
>gb|AC147962.1| Oryza sativa chromosome 3 BAC OSJNBa0083K01 genomic sequence, complete sequence Length = 167239 Score = 420 bits (212), Expect = e-114 Identities = 290/316 (91%) Strand = Plus / Minus Query: 225 cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 284 |||| ||||| ||||| || | |||||||||||||||||| | || ||||||||||||| Sbjct: 38088 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 38029 Query: 285 cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 344 ||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 38028 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 37969 Query: 345 tgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggt 404 |||||||||| |||||||| || | |||||||||||||||||||||||||||||||| || Sbjct: 37968 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 37909 Query: 405 acatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagac 464 |||||||||| |||||||||||||| |||||||| |||||||| ||||||||||| | || Sbjct: 37908 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 37849 Query: 465 gcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctgg 524 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 37848 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 37789 Query: 525 tacccctacgcttacc 540 |||||||||||||||| Sbjct: 37788 tacccctacgcttacc 37773 Score = 115 bits (58), Expect = 2e-22 Identities = 91/102 (89%) Strand = Plus / Minus Query: 538 accatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct 597 |||||| ||||||||||| |||||||||||||||||||| || |||| |||||| ||||| Sbjct: 37696 accatagccagagtgacgtcccttctgcttggcctcatgggctctccgtgcacgggacct 37637 Query: 598 ggagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||| |||||||| |||||| |||| ||||| |||||||| Sbjct: 37636 ggagtgaatcttctggggcttcttgataatgaacccatcctt 37595
>gb|AC128645.5| Oryza sativa chromosome 3 BAC OSJNBb0016P23 genomic sequence, complete sequence Length = 131250 Score = 420 bits (212), Expect = e-114 Identities = 290/316 (91%) Strand = Plus / Plus Query: 225 cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 284 |||| ||||| ||||| || | |||||||||||||||||| | || ||||||||||||| Sbjct: 24946 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 25005 Query: 285 cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 344 ||||||| ||||||||||||||||| || |||||||||||||||||||||||||| |||| Sbjct: 25006 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 25065 Query: 345 tgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggt 404 |||||||||| |||||||| || | |||||||||||||||||||||||||||||||| || Sbjct: 25066 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 25125 Query: 405 acatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagac 464 |||||||||| |||||||||||||| |||||||| |||||||| ||||||||||| | || Sbjct: 25126 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 25185 Query: 465 gcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctgg 524 |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 25186 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 25245 Query: 525 tacccctacgcttacc 540 |||||||||||||||| Sbjct: 25246 tacccctacgcttacc 25261 Score = 115 bits (58), Expect = 2e-22 Identities = 91/102 (89%) Strand = Plus / Plus Query: 538 accatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct 597 |||||| ||||||||||| |||||||||||||||||||| || |||| |||||| ||||| Sbjct: 25338 accatagccagagtgacgtcccttctgcttggcctcatgggctctccgtgcacgggacct 25397 Query: 598 ggagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||| |||||||| |||||| |||| ||||| |||||||| Sbjct: 25398 ggagtgaatcttctggggcttcttgataatgaacccatcctt 25439
>gb|AY104244.1| Zea mays PCO075323 mRNA sequence Length = 924 Score = 402 bits (203), Expect = e-109 Identities = 365/419 (87%) Strand = Plus / Minus Query: 221 gggccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctc 280 |||||||| |||||||||||||||||||| |||||||| ||||| | | ||||||||| Sbjct: 626 gggccctgagccaatctctcctccctccttgcaatctttctctcacgggaagccttgctc 567 Query: 281 ttggcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttg 340 ||||| ||||||||||||||||| || || || ||||||||||| |||||||| ||||| Sbjct: 566 ttggctcgcttggcctcaaactgatccgagagagtcttctctctggccttctcggccttt 507 Query: 341 gacttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttc 400 ||||||||||| ||||||||||| |||||||| || || |||||||| || || || ||| Sbjct: 506 gacttgtggatgctctccatgagtaccctcttatttttaaacatgtttccttttactttc 447 Query: 401 aggtacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcaga 460 | ||||| || ||||||||||| |||||||| |||||||| ||||| ||||||||||| Sbjct: 446 atatacatatcgtggtacatgtgtttgtcgattttctttgcttcacgatacttgcgcagc 387 Query: 461 agacgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctcc 520 |||||||| || ||||||||||| |||||||| ||||||||||||||||||||||||||| Sbjct: 386 agacgcctgaggacacgcatcctgcgcatccaaaggatcttggtggggagcctagcctcc 327 Query: 521 ctggtacccctacgcttaccatatccagagtgacggcccttctgcttggcctcatgtgcc 580 ||||||||||| |||||||| || |||||||| | |||||||||||||||||||| ||| Sbjct: 326 ctggtacccctgcgcttaccgtaaccagagtgcctccccttctgcttggcctcatgggcc 267 Query: 581 ctccttgcacgagacctggagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||||| || ||||| |||||||| ||||| |||||| | || ||||| |||||||| Sbjct: 266 ctccttgcccgggaccttgagtggattttctgtggcttcttaattatgaatccatcctt 208 Score = 46.1 bits (23), Expect = 0.14 Identities = 29/31 (93%) Strand = Plus / Minus Query: 144 ttcacttcttggccttctttggtgccgctgc 174 |||||||||| |||||||||||||| ||||| Sbjct: 700 ttcacttcttcgccttctttggtgcagctgc 670
>gb|AY389581.1| Hyacinthus orientalis ribosomal protein L19 (RPL19) mRNA, complete cds Length = 664 Score = 266 bits (134), Expect = 8e-68 Identities = 335/402 (83%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| || Sbjct: 557 ctcctccctcctggcaatctttctctctctgcttgccttgctcttggcacgcttggcttc 498 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 357 |||||| ||||||| |||||||| |||||||||||||| ||||| ||||| || ||||| Sbjct: 497 aaactgatcagatatagtcttctcccttgccttctcagctttggatttgtgaatgctctc 438 Query: 358 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 417 ||| || |||||||||||||| |||| |||||||| || |||| |||||| |||||||| Sbjct: 437 catcagcaccctcttgttcttaaacacattacccttcactttcatgtacatatcatggta 378 Query: 418 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 477 |||||| ||||| || ||||| | || |||||||| | ||| | ||| | ||| || || Sbjct: 377 catgtgtttgtcaattttcttggattctcggtacttcctcagcaaacgtcgcagaactcg 318 Query: 478 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 537 |||||||| |||||| || | |||||| ||||||||||| |||||||||||| | ||||| Sbjct: 317 catcctcctcatccaaagaaccttggttgggagcctagcttccctggtacccttgcgctt 258 Query: 538 accatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct 597 || || ||||| ||||| || ||| ||| ||||| || | |||||| ||||| | Sbjct: 257 tccgtagccagaatgacgccctttcctctttgcctccatagctcgccttgcgcgagaacg 198 Query: 598 ggagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 ||||| |||||||| |||||||| ||||| || |||||||| Sbjct: 197 cgagtgaatcttctggggcttcctaatgataaatccatcctt 156
>gb|AY089073.1| Arabidopsis thaliana clone 27978 mRNA, complete sequence Length = 812 Score = 256 bits (129), Expect = 8e-65 Identities = 294/349 (84%) Strand = Plus / Minus Query: 224 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 283 ||||| || ||||||||||| || ||||||| ||| ||||||||||| |||||| |||| Sbjct: 606 ccctgagctaatctctcctctcttctggcaaactttctctccctgctagccttgttctta 547 Query: 284 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 343 ||||||||||||||||||||||| |||||||||||||| |||||||||||||| | Sbjct: 546 atacgcttggcctcaaactggtcagcgagggtcttctctctagccttctcagccttcatc 487 Query: 344 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 403 |||||||| |||||||| || || | |||||||||||| | |||||||| || |||| | Sbjct: 486 ttgtggatgctctccataagcacacgcttgttcttgaaaacattacccttcactttcatg 427 Query: 404 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 463 ||||||||||||||||||||| | || |||||||||| |||||||||||||| || | | Sbjct: 426 tacatgtcatggtacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaa 367 Query: 464 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 523 ||||||| ||| | ||| |||| |||||| || |||||||| || ||||| ||||| || Sbjct: 366 cgcctcaacaccctcattctcctcatccaaagaatcttggttggtagccttgcctctctt 307 Query: 524 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcct 572 |||||| | | |||||| |||||||||||||| ||||| ||||||||| Sbjct: 306 gtaccctttctcttaccgtatccagagtgacgaccctttcgcttggcct 258 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 599 gagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 ||||||||||| |||||||||||| |||||||||||||| Sbjct: 233 gagtggatcttagtaggcttcctgataatgaaaccatcctt 193
>ref|NM_112551.2| Arabidopsis thaliana structural constituent of ribosome AT3G16780 mRNA, complete cds Length = 847 Score = 250 bits (126), Expect = 5e-63 Identities = 294/350 (84%) Strand = Plus / Minus Query: 224 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 283 ||||| || ||||||||||| || ||||||| ||| ||||||||||| |||||| |||| Sbjct: 608 ccctgagctaatctctcctctcttctggcaaactttctctccctgctagccttgttctta 549 Query: 284 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 343 ||||||||||||||||||||||| || ||||||||||| |||||||||||||| | Sbjct: 548 atacgcttggcctcaaactggtcagcgagagtcttctctctagccttctcagccttcatc 489 Query: 344 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 403 |||||||| |||||||| || || | |||||||||||| | |||||||| || |||| | Sbjct: 488 ttgtggatgctctccataagcacacgcttgttcttgaaaacattacccttcactttcatg 429 Query: 404 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 463 ||||||||||||||||||||| | || |||||||||| |||||||||||||| || | | Sbjct: 428 tacatgtcatggtacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaa 369 Query: 464 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 523 ||||||| ||| | ||| |||| |||||| || |||||||| || ||||| ||||| || Sbjct: 368 cgcctcaacaccctcattctcctcatccaaagaatcttggttggtagccttgcctctctt 309 Query: 524 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctc 573 |||||| | | |||||| |||||||||||||| ||||| |||||||||| Sbjct: 308 gtaccctttctcttaccgtatccagagtgacgaccctttcgcttggcctc 259 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 599 gagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 ||||||||||| |||||||||||| |||||||||||||| Sbjct: 233 gagtggatcttagtaggcttcctgataatgaaaccatcctt 193
>gb|AY090335.1| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, complete cds Length = 630 Score = 250 bits (126), Expect = 5e-63 Identities = 294/350 (84%) Strand = Plus / Minus Query: 224 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 283 ||||| || ||||||||||| || ||||||| ||| ||||||||||| |||||| |||| Sbjct: 551 ccctgagctaatctctcctctcttctggcaaactttctctccctgctagccttgttctta 492 Query: 284 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 343 ||||||||||||||||||||||| || ||||||||||| |||||||||||||| | Sbjct: 491 atacgcttggcctcaaactggtcagcgagagtcttctctctagccttctcagccttcatc 432 Query: 344 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 403 |||||||| |||||||| || || | |||||||||||| | |||||||| || |||| | Sbjct: 431 ttgtggatgctctccataagcacacgcttgttcttgaaaacattacccttcactttcatg 372 Query: 404 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 463 ||||||||||||||||||||| | || |||||||||| |||||||||||||| || | | Sbjct: 371 tacatgtcatggtacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaa 312 Query: 464 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 523 ||||||| ||| | ||| |||| |||||| || |||||||| || ||||| ||||| || Sbjct: 311 cgcctcaacaccctcattctcctcatccaaagaatcttggttggtagccttgcctctctt 252 Query: 524 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctc 573 |||||| | | |||||| |||||||||||||| ||||| |||||||||| Sbjct: 251 gtaccctttctcttaccgtatccagagtgacgaccctttcgcttggcctc 202 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 599 gagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 ||||||||||| |||||||||||| |||||||||||||| Sbjct: 176 gagtggatcttagtaggcttcctgataatgaaaccatcctt 136
>gb|AY045610.1| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, complete cds Length = 814 Score = 250 bits (126), Expect = 5e-63 Identities = 294/350 (84%) Strand = Plus / Minus Query: 224 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 283 ||||| || ||||||||||| || ||||||| ||| ||||||||||| |||||| |||| Sbjct: 594 ccctgagctaatctctcctctcttctggcaaactttctctccctgctagccttgttctta 535 Query: 284 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 343 ||||||||||||||||||||||| || ||||||||||| |||||||||||||| | Sbjct: 534 atacgcttggcctcaaactggtcagcgagagtcttctctctagccttctcagccttcatc 475 Query: 344 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 403 |||||||| |||||||| || || | |||||||||||| | |||||||| || |||| | Sbjct: 474 ttgtggatgctctccataagcacacgcttgttcttgaaaacattacccttcactttcatg 415 Query: 404 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 463 ||||||||||||||||||||| | || |||||||||| |||||||||||||| || | | Sbjct: 414 tacatgtcatggtacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaa 355 Query: 464 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 523 ||||||| ||| | ||| |||| |||||| || |||||||| || ||||| ||||| || Sbjct: 354 cgcctcaacaccctcattctcctcatccaaagaatcttggttggtagccttgcctctctt 295 Query: 524 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctc 573 |||||| | | |||||| |||||||||||||| ||||| |||||||||| Sbjct: 294 gtaccctttctcttaccgtatccagagtgacgaccctttcgcttggcctc 245 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 599 gagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 ||||||||||| |||||||||||| |||||||||||||| Sbjct: 219 gagtggatcttagtaggcttcctgataatgaaaccatcctt 179
>emb|Z31720.1|NTL19RIB N.tabacum (cv.Samsun NN) L19 mRNA for ribosomal protein L19 Length = 1597 Score = 236 bits (119), Expect = 7e-59 Identities = 284/339 (83%) Strand = Plus / Minus Query: 224 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 283 ||||| ||||||| ||||||||||| |||| |||||| |||||||| || ||| |||| Sbjct: 1347 ccctgtgccaatcgttcctccctcctagcaaacttcctttccctgctggctttgttcttt 1288 Query: 284 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 343 || | | |||||||||| || ||||| | |||||||||||| ||||| |||||||| | Sbjct: 1287 gccctcctggcctcaaattgatcagacaaggtcttctctctagccttttcagcctttgtt 1228 Query: 344 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 403 ||||| || | ||||||||||| | |||||||||||| | |||||||| ||||||| | Sbjct: 1227 ttgtgaatgttttccatgaggacacgcttgttcttgaaaacattacccttcaccttcatg 1168 Query: 404 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 463 ||||||||||| ||||||||| ||||||||||||| | ||| | ||||||||| || | | Sbjct: 1167 tacatgtcatgatacatgtgcctgtcgatcttcttggactccctgtacttgcgaagcaaa 1108 Query: 464 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 523 ||||| || || | |||||||| ||||||||| | ||| || || | ||||||||||||| Sbjct: 1107 cgcctgagaactctcatcctcctcatccacagcacctttgttggcaacctagcctccctg 1048 Query: 524 gtacccctacgcttaccatatccagagtgacggcccttc 562 |||||| ||||||||||||||||||||||||| |||||| Sbjct: 1047 gtacccttacgcttaccatatccagagtgacgacccttc 1009 Score = 40.1 bits (20), Expect = 8.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 617 ttcctgatgatgaaaccatc 636 |||||||||||||||||||| Sbjct: 954 ttcctgatgatgaaaccatc 935
>gb|AC152751.22| Medicago truncatula clone mth2-18n7, complete sequence Length = 117170 Score = 234 bits (118), Expect = 3e-58 Identities = 235/274 (85%) Strand = Plus / Plus Query: 256 cttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggt 315 |||||| |||||||| ||||| |||| || | ||||||||||||||| ||||||| || Sbjct: 101677 cttcctttccctgctagccttattcttcgccctcttggcctcaaactgatcagataatgt 101736 Query: 316 cttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctcttgtt 375 |||||| || ||||||||||||||||| ||||| ||||||||||| ||||| |||||||| Sbjct: 101737 cttctccctagccttctcagccttggatttgtgaatactctccataaggactctcttgtt 101796 Query: 376 cttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatctt 435 |||||| | || ||||| ||||||| |||||| ||||| ||||| || ||||| ||||| Sbjct: 101797 cttgaagacatttcccttcaccttcatgtacatatcatgatacatatgtttgtcaatctt 101856 Query: 436 ctttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccacag 495 ||||||||| ||||||||||| || | |||||| || |||||||| |||| |||||| || Sbjct: 101857 ctttgcctctcggtacttgcgaagcaaacgcctgaggacacgcattctcctcatccaaag 101916 Query: 496 gatcttggtggggagcctagcctccctggtaccc 529 ||| |||||||||||||||||||| || |||||| Sbjct: 101917 gattttggtggggagcctagcctctcttgtaccc 101950 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Plus Query: 537 taccatatccagagtgacggcccttctgcttggcctc 573 ||||||||||||| ||||| |||||| ||||||||| Sbjct: 102398 taccatatccagaatgacgtcccttcctcttggcctc 102434
>gb|AY489023.1| Capsicum annuum ribosomal protein L19 mRNA, complete sequence Length = 719 Score = 218 bits (110), Expect = 2e-53 Identities = 290/350 (82%) Strand = Plus / Minus Query: 224 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 283 ||||| ||||| | |||||||| ||| || | |||||| || | |||||||||| |||| Sbjct: 564 ccctgagccaaacgctcctcccgcctagcgaacttcctttctcggcttgccttgttcttt 505 Query: 284 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 343 || | | | |||||||| ||||| || | |||||||||||| |||||||||||||| | | Sbjct: 504 gctctcctagcctcaaattggtcggacaaggtcttctctctagccttctcagcctttgtc 445 Query: 344 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 403 ||||||||| | ||||| || || | |||||||||||| | |||||||| ||||||| | Sbjct: 444 ttgtggatattttccatcagcacacgcttgttcttgaagacattacccttcaccttcatg 385 Query: 404 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 463 ||||||||||| ||||||||||||||||||||||||| || | ||||||||| || | | Sbjct: 384 tacatgtcatgatacatgtgcttgtcgatcttctttgattccctgtacttgcgaagcaaa 325 Query: 464 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 523 ||||| || || | ||| |||| |||||| || | |||||| || || |||||||||||| Sbjct: 324 cgcctgaggactctcattctcctcatccaaagcaccttggtaggcagtctagcctccctg 265 Query: 524 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctc 573 ||||| | |||||||| ||||||||||||||||||||| ||||||||| Sbjct: 264 gtacctttgcgcttaccgtatccagagtgacggcccttcctcttggcctc 215 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 617 ttcctgatgatgaaaccatcctt 639 ||||||||||||||||||||||| Sbjct: 171 ttcctgatgatgaaaccatcctt 149
>gb|AY485789.1| Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds Length = 831 Score = 218 bits (110), Expect = 2e-53 Identities = 290/350 (82%) Strand = Plus / Minus Query: 224 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 283 ||||| ||||| | |||||||| ||| || | |||||| || | |||||||||| |||| Sbjct: 577 ccctgagccaaacgctcctcccgcctagcgaacttcctttctcggcttgccttgttcttt 518 Query: 284 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 343 || | | | |||||||| ||||| || | |||||||||||| |||||||||||||| | | Sbjct: 517 gctctcctagcctcaaattggtcggacaaggtcttctctctagccttctcagcctttgtc 458 Query: 344 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 403 ||||||||| | ||||| || || | |||||||||||| | |||||||| ||||||| | Sbjct: 457 ttgtggatattttccatcagcacacgcttgttcttgaagacattacccttcaccttcatg 398 Query: 404 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 463 ||||||||||| ||||||||||||||||||||||||| || | ||||||||| || | | Sbjct: 397 tacatgtcatgatacatgtgcttgtcgatcttctttgattccctgtacttgcgaagcaaa 338 Query: 464 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 523 ||||| || || | ||| |||| |||||| || | |||||| || || |||||||||||| Sbjct: 337 cgcctgaggactctcattctcctcatccaaagcaccttggtaggcagtctagcctccctg 278 Query: 524 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctc 573 ||||| | |||||||| ||||||||||||||||||||| ||||||||| Sbjct: 277 gtacctttgcgcttaccgtatccagagtgacggcccttcctcttggcctc 228 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 617 ttcctgatgatgaaaccatcctt 639 ||||||||||||||||||||||| Sbjct: 184 ttcctgatgatgaaaccatcctt 162
>dbj|AB022217.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGL6 Length = 79459 Score = 216 bits (109), Expect = 7e-53 Identities = 250/297 (84%) Strand = Plus / Minus Query: 233 aatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttg 292 ||||||||||| || ||||||| ||| ||||||||||| |||||| |||| ||||||| Sbjct: 76034 aatctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttg 75975 Query: 293 gcctcaaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggata 352 |||||||||||||||| || ||||||||||| |||||||||||||| ||||||||| Sbjct: 75974 gcctcaaactggtcagcgagagtcttctctctagccttctcagccttcatcttgtggatg 75915 Query: 353 ctctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtca 412 |||||||| || || | |||||||||||| | |||||||| || |||| |||||||||| Sbjct: 75914 ctctccataagcacacgcttgttcttgaaaacattacccttcactttcatgtacatgtca 75855 Query: 413 tggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagc 472 |||||||||||| | || |||||||||| |||||||||||||| || | |||||||| | Sbjct: 75854 tggtacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaacgcctcaac 75795 Query: 473 acacgcatcctccgcatccacaggatcttggtggggagcctagcctccctggtaccc 529 || | ||| |||| |||||| || |||||||| || ||||| ||||| || |||||| Sbjct: 75794 accctcattctcctcatccaaagaatcttggttggtagccttgcctctcttgtaccc 75738 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 599 gagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 ||||||||||| |||||||||||| |||||||||||||| Sbjct: 75573 gagtggatcttagtaggcttcctgataatgaaaccatcctt 75533 Score = 44.1 bits (22), Expect = 0.56 Identities = 34/38 (89%) Strand = Plus / Minus Query: 536 ttaccatatccagagtgacggcccttctgcttggcctc 573 ||||| |||||||||||||| ||||| |||||||||| Sbjct: 75636 ttaccgtatccagagtgacgaccctttcgcttggcctc 75599
>ref|NM_100157.2| Arabidopsis thaliana EMB2386; structural constituent of ribosome AT1G02780 (EMB2386) mRNA, complete cds Length = 988 Score = 184 bits (93), Expect = 2e-43 Identities = 267/325 (82%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 |||||| ||||| ||| |||||| || | ||| |||||| |||| || | ||| ||||| Sbjct: 581 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 522 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 357 |||||| ||||| || |||||||| || |||||||||||||| ||||||||||||||||| Sbjct: 521 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 462 Query: 358 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 417 ||| | ||| | |||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 461 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 402 Query: 418 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 477 |||||||||||| |||||||| | ||| | ||| || || |||||||| || ||||| Sbjct: 401 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 342 Query: 478 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 537 |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | ||| Sbjct: 341 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 282 Query: 538 accatatccagagtgacggcccttc 562 ||| |||||||||||||| |||||| Sbjct: 281 accgtatccagagtgacgacccttc 257 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||||||||||||||| Sbjct: 205 ggcttcctgatgatgaaaccatcctt 180
>gb|BT010178.1| Arabidopsis thaliana At1g02780/T14P4_3 mRNA, complete cds Length = 645 Score = 184 bits (93), Expect = 2e-43 Identities = 267/325 (82%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 |||||| ||||| ||| |||||| || | ||| |||||| |||| || | ||| ||||| Sbjct: 537 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 478 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 357 |||||| ||||| || |||||||| || |||||||||||||| ||||||||||||||||| Sbjct: 477 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 418 Query: 358 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 417 ||| | ||| | |||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 417 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 358 Query: 418 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 477 |||||||||||| |||||||| | ||| | ||| || || |||||||| || ||||| Sbjct: 357 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 298 Query: 478 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 537 |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | ||| Sbjct: 297 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 238 Query: 538 accatatccagagtgacggcccttc 562 ||| |||||||||||||| |||||| Sbjct: 237 accgtatccagagtgacgacccttc 213 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||||||||||||||| Sbjct: 161 ggcttcctgatgatgaaaccatcctt 136
>gb|AF424580.1|AF424580 Arabidopsis thaliana At1g02780/T14P4_3 mRNA, complete cds Length = 897 Score = 184 bits (93), Expect = 2e-43 Identities = 267/325 (82%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 |||||| ||||| ||| |||||| || | ||| |||||| |||| || | ||| ||||| Sbjct: 580 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 521 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 357 |||||| ||||| || |||||||| || |||||||||||||| ||||||||||||||||| Sbjct: 520 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 461 Query: 358 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 417 ||| | ||| | |||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 460 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 401 Query: 418 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 477 |||||||||||| |||||||| | ||| | ||| || || |||||||| || ||||| Sbjct: 400 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 341 Query: 478 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 537 |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | ||| Sbjct: 340 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 281 Query: 538 accatatccagagtgacggcccttc 562 ||| |||||||||||||| |||||| Sbjct: 280 accgtatccagagtgacgacccttc 256 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||||||||||||||| Sbjct: 204 ggcttcctgatgatgaaaccatcctt 179
>emb|BX816202.1|CNS0AE3J Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH34ZA05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 872 Score = 184 bits (93), Expect = 2e-43 Identities = 267/325 (82%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 |||||| ||||| ||| |||||| || | ||| |||||| |||| || | ||| ||||| Sbjct: 557 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 498 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 357 |||||| ||||| || |||||||| || |||||||||||||| ||||||||||||||||| Sbjct: 497 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 438 Query: 358 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 417 ||| | ||| | |||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 437 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 378 Query: 418 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 477 |||||||||||| |||||||| | ||| | ||| || || |||||||| || ||||| Sbjct: 377 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 318 Query: 478 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 537 |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | ||| Sbjct: 317 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 258 Query: 538 accatatccagagtgacggcccttc 562 ||| |||||||||||||| |||||| Sbjct: 257 accgtatccagagtgacgacccttc 233 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||||||||||||||| Sbjct: 181 ggcttcctgatgatgaaaccatcctt 156
>emb|BX816956.1|CNS0AD7Y Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH78ZF01 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 848 Score = 184 bits (93), Expect = 2e-43 Identities = 267/325 (82%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 |||||| ||||| ||| |||||| || | ||| |||||| |||| || | ||| ||||| Sbjct: 566 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 507 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 357 |||||| ||||| || |||||||| || |||||||||||||| ||||||||||||||||| Sbjct: 506 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 447 Query: 358 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 417 ||| | ||| | |||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 446 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 387 Query: 418 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 477 |||||||||||| |||||||| | ||| | ||| || || |||||||| || ||||| Sbjct: 386 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 327 Query: 478 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 537 |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | ||| Sbjct: 326 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 267 Query: 538 accatatccagagtgacggcccttc 562 ||| |||||||||||||| |||||| Sbjct: 266 accgtatccagagtgacgacccttc 242 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||||||||||||||| Sbjct: 190 ggcttcctgatgatgaaaccatcctt 165
>emb|BX816918.1|CNS0ADAO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH76ZE12 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 865 Score = 184 bits (93), Expect = 2e-43 Identities = 267/325 (82%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 |||||| ||||| ||| |||||| || | ||| |||||| |||| || | ||| ||||| Sbjct: 568 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 509 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 357 |||||| ||||| || |||||||| || |||||||||||||| ||||||||||||||||| Sbjct: 508 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 449 Query: 358 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 417 ||| | ||| | |||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 448 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 389 Query: 418 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 477 |||||||||||| |||||||| | ||| | ||| || || |||||||| || ||||| Sbjct: 388 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 329 Query: 478 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 537 |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | ||| Sbjct: 328 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 269 Query: 538 accatatccagagtgacggcccttc 562 ||| |||||||||||||| |||||| Sbjct: 268 accgtatccagagtgacgacccttc 244 Score = 54.0 bits (27), Expect = 6e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatccttt 640 ||||||||||||||||||||||||||| Sbjct: 192 ggcttcctgatgatgaaaccatccttt 166
>emb|BX815921.1|CNS0AD0X Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH16ZH11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 813 Score = 184 bits (93), Expect = 2e-43 Identities = 267/325 (82%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 |||||| ||||| ||| |||||| || | ||| |||||| |||| || | ||| ||||| Sbjct: 563 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 504 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 357 |||||| ||||| || |||||||| || |||||||||||||| ||||||||||||||||| Sbjct: 503 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 444 Query: 358 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 417 ||| | ||| | |||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 443 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 384 Query: 418 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 477 |||||||||||| |||||||| | ||| | ||| || || |||||||| || ||||| Sbjct: 383 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 324 Query: 478 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 537 |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | ||| Sbjct: 323 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 264 Query: 538 accatatccagagtgacggcccttc 562 ||| |||||||||||||| |||||| Sbjct: 263 accgtatccagagtgacgacccttc 239 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||||||||||||||| Sbjct: 187 ggcttcctgatgatgaaaccatcctt 162
>emb|BX817746.1|CNS0ACMV Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL3ZA09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 873 Score = 184 bits (93), Expect = 2e-43 Identities = 267/325 (82%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 |||||| ||||| ||| |||||| || | ||| |||||| |||| || | ||| ||||| Sbjct: 558 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 499 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 357 |||||| ||||| || |||||||| || |||||||||||||| ||||||||||||||||| Sbjct: 498 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 439 Query: 358 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 417 ||| | ||| | |||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 438 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 379 Query: 418 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 477 |||||||||||| |||||||| | ||| | ||| || || |||||||| || ||||| Sbjct: 378 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 319 Query: 478 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 537 |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | ||| Sbjct: 318 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 259 Query: 538 accatatccagagtgacggcccttc 562 ||| |||||||||||||| |||||| Sbjct: 258 accgtatccagagtgacgacccttc 234 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||||||||||||||| Sbjct: 182 ggcttcctgatgatgaaaccatcctt 157
>emb|BX813821.1|CNS0AAUL Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB41ZA10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 184 bits (93), Expect = 2e-43 Identities = 267/325 (82%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 |||||| ||||| ||| |||||| || | ||| |||||| |||| || | ||| ||||| Sbjct: 564 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 505 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 357 |||||| ||||| || |||||||| || |||||||||||||| ||||||||||||||||| Sbjct: 504 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 445 Query: 358 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 417 ||| | ||| | |||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 444 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 385 Query: 418 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 477 |||||||||||| |||||||| | ||| | ||| || || |||||||| || ||||| Sbjct: 384 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 325 Query: 478 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 537 |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | ||| Sbjct: 324 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 265 Query: 538 accatatccagagtgacggcccttc 562 ||| |||||||||||||| |||||| Sbjct: 264 accgtatccagagtgacgacccttc 240 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||||||||||||||| Sbjct: 188 ggcttcctgatgatgaaaccatcctt 163
>gb|DQ294277.1| Solanum tuberosum clone 172G04 60S ribosomal protein L19-like protein mRNA, complete cds Length = 759 Score = 182 bits (92), Expect = 9e-43 Identities = 272/332 (81%) Strand = Plus / Minus Query: 242 tccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctcaaac 301 |||||||| |||| ||| || || |||||||||||| |||| || | | | |||||||| Sbjct: 543 tccctccttgcaaactttctttctctgcttgccttgttctttgccctcctagcctcaaat 484 Query: 302 tggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctccatg 361 ||||| || | |||||||||||| || ||||||||||| | |||||||||| | ||||| Sbjct: 483 tggtcggacaaggtcttctctctagctttctcagcctttgtcttgtggatattttccatc 424 Query: 362 aggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatg 421 || || | |||||||||||| | |||||||| ||||||| |||||||||||| |||||| Sbjct: 423 agcacacgcttgttcttgaaaacattacccttcaccttcatgtacatgtcatgatacatg 364 Query: 422 tgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcatc 481 || ||||| |||||||||| || | |||||||| || | |||||| || || | || Sbjct: 363 tgtttgtcaatcttctttgattccctatacttgcgaagcaaacgcctgaggactctcaat 304 Query: 482 ctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgcttacca 541 |||| |||||| || | |||||| || || ||||||||||||||||| | ||||||||| Sbjct: 303 ctcctcatccaaagcaccttggtaggcagtctagcctccctggtacctttgcgcttacca 244 Query: 542 tatccagagtgacggcccttctgcttggcctc 573 ||||||||||||||||| ||| ||||||||| Sbjct: 243 tatccagagtgacggcctttcctcttggcctc 212 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Minus Query: 617 ttcctgatgatgaaaccatcctt 639 ||||||||||||||||||||||| Sbjct: 168 ttcctgatgatgaaaccatcctt 146
>gb|AF462835.1|AF462835 Arabidopsis thaliana At1g02780/T14P4_3 mRNA, complete cds Length = 847 Score = 176 bits (89), Expect = 6e-41 Identities = 266/325 (81%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 |||||| ||||| ||| |||||| || | ||| |||||| |||| || | ||| ||||| Sbjct: 580 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 521 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 357 |||||| ||||| || |||||||| || |||||||||||||| ||||||||||||||||| Sbjct: 520 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 461 Query: 358 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 417 ||| | ||| | |||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 460 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 401 Query: 418 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 477 |||||||||||| |||||||| | ||| | ||| || || |||||||| || ||||| Sbjct: 400 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 341 Query: 478 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 537 |||||| ||||||||||| | ||| || || | |||||| || | |||| || | | ||| Sbjct: 340 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtagccttcctctt 281 Query: 538 accatatccagagtgacggcccttc 562 ||| |||||||||||||| |||||| Sbjct: 280 accgtatccagagtgacgacccttc 256 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||||||||||||||| Sbjct: 204 ggcttcctgatgatgaaaccatcctt 179
>emb|BX815471.1|CNS0ACXF Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS63ZB09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 870 Score = 176 bits (89), Expect = 6e-41 Identities = 266/325 (81%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 |||||| ||||| ||| |||||| || | ||| |||||| |||| || | ||| ||||| Sbjct: 566 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 507 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 357 |||||| ||||| || |||||||| || |||||||||||||| ||||||||||||||||| Sbjct: 506 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 447 Query: 358 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 417 ||| | ||| | |||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 446 catcaagacacgcttgttcttgaacacattacccttcacacgcatgtacatgtcatggta 387 Query: 418 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 477 ||||||||| || |||||||| | ||| | ||| || || |||||||| || ||||| Sbjct: 386 catgtgcttctcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 327 Query: 478 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 537 |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | ||| Sbjct: 326 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 267 Query: 538 accatatccagagtgacggcccttc 562 ||| |||||||||||||| |||||| Sbjct: 266 accgtatccagagtgacgacccttc 242 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||||||||||||||| Sbjct: 190 ggcttcctgatgatgaaaccatcctt 165
>gb|AY086882.1| Arabidopsis thaliana clone 2906 mRNA, complete sequence Length = 898 Score = 168 bits (85), Expect = 1e-38 Identities = 265/325 (81%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 |||||| ||||| ||| |||||| || | ||| |||||| |||| || | ||| ||||| Sbjct: 581 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 522 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 357 |||| ||||| || |||||||| || |||||||||||||| ||||||||||||||||| Sbjct: 521 ctactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 462 Query: 358 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 417 ||| | ||| | |||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 461 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 402 Query: 418 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 477 |||||||||||| |||||||| | ||| | ||| || || |||||||| || ||||| Sbjct: 401 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 342 Query: 478 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 537 |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | ||| Sbjct: 341 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 282 Query: 538 accatatccagagtgacggcccttc 562 ||| |||||||||||||| |||||| Sbjct: 281 accgtatccagagtgacgacccttc 257 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||||||||||||||| Sbjct: 205 ggcttcctgatgatgaaaccatcctt 180
>emb|BX842172.1|CNS09YDA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL16ZB09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 729 Score = 167 bits (84), Expect = 6e-38 Identities = 294/356 (82%), Gaps = 6/356 (1%) Strand = Plus / Minus Query: 224 ccctgggccaatctctcctccctcctggcaatc-ttcctctccctgcttgccttgctctt 282 ||||| || ||||||||||| || ||||||| | || ||||||||||| |||||| |||| Sbjct: 590 ccctgagctaatctctcctctcttctggcaaacatttctctccctgctagccttgttctt 531 Query: 283 ggcacgcttggcctcaaactggtcagatagggtcttctctcttgcctt-ctcagcctt-g 340 ||||||||||||||||||||||| || ||||||||||| ||||| ||||||||| Sbjct: 530 aatacgcttggcctcaaactggtcagcgagagtcttctctctagccttactcagccttca 471 Query: 341 gacttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttc 400 ||||||||| |||||||| || || | |||||||||||| | |||||||| || ||| Sbjct: 470 tccttgtggatgctctccataagcacacgcttgttcttgaaaacattacccttcactttc 411 Query: 401 aggtacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgc-ag 459 | |||||||||||||||||||||| | || |||||||||| |||||||||||||| | || Sbjct: 410 atgtacatgtcatggtacatgtgcctatcaatcttctttgactcacggtacttgctcaag 351 Query: 460 aagacgcctcagcacacgcatcctcc-gcatc-cacaggatcttggtggggagcctagcc 517 || |||||| ||| | ||| |||| |||| || || |||||||| || ||||| ||| Sbjct: 350 aaacagcctcaacaccctcattctccatcatcacaaagaatcttggttggtagccttgcc 291 Query: 518 tccctggtacccctacgcttaccatatccagagtgacggcccttctgcttggcctc 573 || || |||||| | | |||||| |||||||||||||| ||||| |||||||||| Sbjct: 290 tctcttgtaccctttctcttaccgtatccagagtgacgaccctttcgcttggcctc 235 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 599 gagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 ||||||||||| |||||||||||| |||||||||||||| Sbjct: 209 gagtggatcttagtaggcttcctgataatgaaaccatcctt 169
>gb|AC009525.3| Arabidopsis thaliana chromosome I BAC F22D16 genomic sequence, complete sequence Length = 100239 Score = 163 bits (82), Expect = 9e-37 Identities = 214/258 (82%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 |||||| ||||| ||| |||||| || | ||| |||||| |||| || | ||| ||||| Sbjct: 84067 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 84008 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 357 |||||| ||||| || |||||||| || |||||||||||||| ||||||||||||||||| Sbjct: 84007 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 83948 Query: 358 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 417 ||| | ||| | |||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 83947 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 83888 Query: 418 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 477 |||||||||||| |||||||| | ||| | ||| || || |||||||| || ||||| Sbjct: 83887 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 83828 Query: 478 catcctccgcatccacag 495 |||||| ||||||||||| Sbjct: 83827 catcctacgcatccacag 83810 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||||||||||||||| Sbjct: 83587 ggcttcctgatgatgaaaccatcctt 83562
>dbj|D21304.1|RICSS504 Oryza sativa SS504 mRNA for ribosomal protein L19, partial sequence Length = 153 Score = 163 bits (82), Expect = 9e-37 Identities = 125/141 (88%) Strand = Plus / Minus Query: 268 gcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtcttctctcttgc 327 ||||||||||||||||||| |||| |||| |||||||||||| || ||||||| ||||| Sbjct: 146 gcttgccttgctcttggcaagcttagcctnaaactggtcagagagtgtcttctnncttgc 87 Query: 328 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 387 |||||||||||| ||||||||||||| ||||| || || |||||||||||||||||| Sbjct: 86 cttctcagccttanacttgtggatactttccataagaacangcttgttcttgaacatgtt 27 Query: 388 acccttgaccttcaggtacat 408 |||||||||||||| |||||| Sbjct: 26 acccttgaccttcatgtacat 6
>gb|AC022521.4|AC022521 Arabidopsis thaliana chromosome I BAC T14P4 genomic sequence, complete sequence Length = 121668 Score = 163 bits (82), Expect = 9e-37 Identities = 214/258 (82%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 |||||| ||||| ||| |||||| || | ||| |||||| |||| || | ||| ||||| Sbjct: 9427 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 9368 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 357 |||||| ||||| || |||||||| || |||||||||||||| ||||||||||||||||| Sbjct: 9367 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 9308 Query: 358 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 417 ||| | ||| | |||||||||||||| |||||||| || || ||||||||||||||| Sbjct: 9307 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 9248 Query: 418 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 477 |||||||||||| |||||||| | ||| | ||| || || |||||||| || ||||| Sbjct: 9247 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 9188 Query: 478 catcctccgcatccacag 495 |||||| ||||||||||| Sbjct: 9187 catcctacgcatccacag 9170 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||||||||||||||| Sbjct: 8947 ggcttcctgatgatgaaaccatcctt 8922
>emb|BX816648.1|CNS0AD9N Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH60ZC04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 819 Score = 151 bits (76), Expect = 3e-33 Identities = 239/292 (81%), Gaps = 1/292 (0%) Strand = Plus / Minus Query: 272 gccttgctcttggcacgcttggcctcaaactggtcagatagggtcttctctcttgccttc 331 |||||| |||| || | ||| ||||||||||| ||||| || |||||||| || |||||| Sbjct: 468 gccttgttcttcgccctcttagcctcaaactgatcagacagagtcttctccctagccttc 409 Query: 332 tcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgttaccc 391 |||||||| |||||||||||||||||||| | ||| | |||||||||||||| |||||| Sbjct: 408 tcagcctttgacttgtggatactctccatcaagacacgcttgttcttgaacacattaccc 349 Query: 392 ttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtac 451 || || || |||||||||||||||||||||||| | |||||||| | ||| | ||| Sbjct: 348 ttaacacgcatgtacatgtcatggtacatgtgcttataaatcttcttcgtctctctgtat 289 Query: 452 ttgcgcagaagacgcctcagcacacgcatcctccgcatccacaggatcttggtggggagc 511 || || |||||||| || ||||||||||| ||||||||||| | ||| || || | | Sbjct: 288 ttcttcaacagacgcctaagaacacgcatcctacgcatccacagtacctttgttggcaac 229 Query: 512 ctagcctccctggtacccctacgcttaccatatccag-agtgacggcccttc 562 ||||| || | ||||||| | | |||||| ||||||| ||||||| |||||| Sbjct: 228 ctagcttcacgggtacccttcctcttaccgtatccagcagtgacgacccttc 177 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||||||||||||||| Sbjct: 125 ggcttcctgatgatgaaaccatcctt 100
>emb|BX818275.1|CNS0ACJX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL6ZG09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 830 Score = 149 bits (75), Expect = 1e-32 Identities = 237/291 (81%) Strand = Plus / Minus Query: 272 gccttgctcttggcacgcttggcctcaaactggtcagatagggtcttctctcttgccttc 331 |||||| |||| || | ||| ||||||||||| ||||| || |||||||| || |||||| Sbjct: 532 gccttgttcttcgccctcttagcctcaaactgatcagacagagtcttctccctagccttc 473 Query: 332 tcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgttaccc 391 |||||||| |||||||||||||||||||| | || | |||||||||||||| |||||| Sbjct: 472 tcagcctttgacttgtggatactctccatcaagagacgcttgttcttgaacacattaccc 413 Query: 392 ttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtac 451 || || || ||||||||||||||||||||||||||| |||||||| | ||| | ||| Sbjct: 412 ttcacacgcatgtacatgtcatggtacatgtgcttgtcaatcttcttcgtctctctgtat 353 Query: 452 ttgcgcagaagacgcctcagcacacgcatcctccgcatccacaggatcttggtggggagc 511 || || |||||||| || |||||||| | ||||||||||| | ||| || || | | Sbjct: 352 ttcttcaacagacgcctaagaacacgcatgcgacgcatccacagtacctttgttggcaac 293 Query: 512 ctagcctccctggtacccctacgcttaccatatccagagtgacggcccttc 562 ||||| || | ||||||| | | |||||| |||||||||| ||| |||||| Sbjct: 292 ctagcttcacgggtacccttcctcttaccgtatccagagttacgacccttc 242 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||||||||||||||| Sbjct: 190 ggcttcctgatgatgaaaccatcctt 165
>ref|NM_116456.2| Arabidopsis thaliana structural constituent of ribosome AT4G02230 mRNA, complete cds Length = 816 Score = 145 bits (73), Expect = 2e-31 Identities = 247/305 (80%) Strand = Plus / Minus Query: 257 ttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtc 316 |||||||| | ||| |||||| |||| || | ||| ||||||||||||||||| | ||| Sbjct: 545 ttcctctctcggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtc 486 Query: 317 ttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctcttgttc 376 |||||||| ||||||||||||||||| ||||| ||||| ||||| | || | ||||||| Sbjct: 485 ttctctctagccttctcagccttggatttgtgaatactttccatcaacacacgcttgttc 426 Query: 377 ttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttc 436 ||||| | ||| |||||||| |||| |||||||||||||||||| || |||| |||||| Sbjct: 425 ttgaagacgtttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttc 366 Query: 437 tttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccacagg 496 || | ||| | ||||| || |||||||||||||| | |||||||| |||||||| Sbjct: 365 ttggtctccctatacttcttcaacagacgcctcagcactctcatcctcctcatccacaaa 306 Query: 497 atcttggtggggagcctagcctccctggtacccctacgcttaccatatccagagtgacgg 556 | || || || | ||| ||||| | ||||||| | | ||||||||| ||||||||||| Sbjct: 305 acttttgttggcaaccttgcctctcgggtacccttcctcttaccataaccagagtgacgt 246 Query: 557 ccctt 561 ||||| Sbjct: 245 ccctt 241 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 599 gagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||||||||| ||||||||||||||||| |||||||| Sbjct: 203 gagtggatcttcgttggcttcctgatgatgaatccatcctt 163
>gb|AY488031.1| Capsicum annuum ribosomal protein L19 mRNA, partial sequence Length = 526 Score = 145 bits (73), Expect = 2e-31 Identities = 181/217 (83%) Strand = Plus / Minus Query: 224 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 283 ||||| ||||| | |||||||| ||| || | |||||| || | |||||||||| |||| Sbjct: 271 ccctgagccaaacgctcctcccgcctagcgaacttcctttctcggcttgccttgttcttt 212 Query: 284 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 343 || | | | |||||||| ||||| || | |||||||||||| |||||||||||||| | | Sbjct: 211 gctctcctagcctcaaattggtcggacaaggtcttctctctagccttctcagcctttgtc 152 Query: 344 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 403 ||||||||| | ||||| || || | |||||||||||| | |||||||| ||||||| | Sbjct: 151 ttgtggatattttccatcagcacacgcttgttcttgaagacattacccttcaccttcatg 92 Query: 404 tacatgtcatggtacatgtgcttgtcgatcttctttg 440 ||||||||||| ||| ||||||||||||||||||||| Sbjct: 91 tacatgtcatgatacgtgtgcttgtcgatcttctttg 55
>gb|AY072494.1| Arabidopsis thaliana similar to 60S ribosome protein L19 (At4g02230; T2H3.3) mRNA, complete cds Length = 677 Score = 145 bits (73), Expect = 2e-31 Identities = 247/305 (80%) Strand = Plus / Minus Query: 257 ttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtc 316 |||||||| | ||| |||||| |||| || | ||| ||||||||||||||||| | ||| Sbjct: 518 ttcctctctcggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtc 459 Query: 317 ttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctcttgttc 376 |||||||| ||||||||||||||||| ||||| ||||| ||||| | || | ||||||| Sbjct: 458 ttctctctagccttctcagccttggatttgtgaatactttccatcaacacacgcttgttc 399 Query: 377 ttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttc 436 ||||| | ||| |||||||| |||| |||||||||||||||||| || |||| |||||| Sbjct: 398 ttgaagacgtttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttc 339 Query: 437 tttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccacagg 496 || | ||| | ||||| || |||||||||||||| | |||||||| |||||||| Sbjct: 338 ttggtctccctatacttcttcaacagacgcctcagcactctcatcctcctcatccacaaa 279 Query: 497 atcttggtggggagcctagcctccctggtacccctacgcttaccatatccagagtgacgg 556 | || || || | ||| ||||| | ||||||| | | ||||||||| ||||||||||| Sbjct: 278 acttttgttggcaaccttgcctctcgggtacccttcctcttaccataaccagagtgacgt 219 Query: 557 ccctt 561 ||||| Sbjct: 218 ccctt 214 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 599 gagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||||||||| ||||||||||||||||| |||||||| Sbjct: 176 gagtggatcttcgttggcttcctgatgatgaatccatcctt 136
>gb|AF386993.1|AF386993 Arabidopsis thaliana Similar to 60S ribosome protein L19 (T2H3.3) mRNA, complete cds Length = 804 Score = 145 bits (73), Expect = 2e-31 Identities = 247/305 (80%) Strand = Plus / Minus Query: 257 ttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtc 316 |||||||| | ||| |||||| |||| || | ||| ||||||||||||||||| | ||| Sbjct: 545 ttcctctctcggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtc 486 Query: 317 ttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctcttgttc 376 |||||||| ||||||||||||||||| ||||| ||||| ||||| | || | ||||||| Sbjct: 485 ttctctctagccttctcagccttggatttgtgaatactttccatcaacacacgcttgttc 426 Query: 377 ttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttc 436 ||||| | ||| |||||||| |||| |||||||||||||||||| || |||| |||||| Sbjct: 425 ttgaagacgtttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttc 366 Query: 437 tttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccacagg 496 || | ||| | ||||| || |||||||||||||| | |||||||| |||||||| Sbjct: 365 ttggtctccctatacttcttcaacagacgcctcagcactctcatcctcctcatccacaaa 306 Query: 497 atcttggtggggagcctagcctccctggtacccctacgcttaccatatccagagtgacgg 556 | || || || | ||| ||||| | ||||||| | | ||||||||| ||||||||||| Sbjct: 305 acttttgttggcaaccttgcctctcgggtacccttcctcttaccataaccagagtgacgt 246 Query: 557 ccctt 561 ||||| Sbjct: 245 ccctt 241 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 599 gagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||||||||| ||||||||||||||||| |||||||| Sbjct: 203 gagtggatcttcgttggcttcctgatgatgaatccatcctt 163
>emb|AL161494.2|ATCHRIV6 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 6 Length = 194892 Score = 139 bits (70), Expect = 1e-29 Identities = 196/238 (82%) Strand = Plus / Plus Query: 257 ttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtc 316 |||||||| | ||| |||||| |||| || | ||| ||||||||||||||||| | ||| Sbjct: 15234 ttcctctctcggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtc 15293 Query: 317 ttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctcttgttc 376 |||||||| ||||||||||||||||| ||||| ||||| ||||| | || | ||||||| Sbjct: 15294 ttctctctagccttctcagccttggatttgtgaatactttccatcaacacacgcttgttc 15353 Query: 377 ttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttc 436 ||||| | ||| |||||||| |||| |||||||||||||||||| || |||| |||||| Sbjct: 15354 ttgaagacgtttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttc 15413 Query: 437 tttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccaca 494 || | ||| | ||||| || |||||||||||||| | |||||||| |||||||| Sbjct: 15414 ttggtctccctatacttcttcaacagacgcctcagcactctcatcctcctcatccaca 15471 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Plus Query: 599 gagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||||||||| ||||||||||||||||| |||||||| Sbjct: 15656 gagtggatcttcgttggcttcctgatgatgaatccatcctt 15696
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 139 bits (70), Expect = 1e-29 Identities = 165/194 (85%), Gaps = 2/194 (1%) Strand = Plus / Minus Query: 225 cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 284 |||| ||||| ||||||| |||||||| ||||||||| || ||||||| ||||||||| Sbjct: 28305978 cctgagccaacctctcctacctcctggaaatcttcctttcttggcttgccatgctcttgg 28305919 Query: 285 cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 344 || ||||||| ||||||||||| || || || ||| || || ||||||| |||| ||| Sbjct: 28305918 caagcttggcttcaaactggtcggaaagagttctcttcctagctttctcag-cttgcact 28305860 Query: 345 tgtggatactctccatgagg-accctcttgttcttgaacatgttacccttgaccttcagg 403 |||||||||||||||| ||| |||||||||| |||| |||||||||||||||||||| Sbjct: 28305859 tgtggatactctccataaggtcccctcttgttgttgagcatgttacccttgaccttcatt 28305800 Query: 404 tacatgtcatggta 417 |||||||||||||| Sbjct: 28305799 tacatgtcatggta 28305786 Score = 46.1 bits (23), Expect = 0.14 Identities = 48/55 (87%), Gaps = 1/55 (1%) Strand = Plus / Minus Query: 478 catcctccgcatccacaggatcttggtggggagcctagcctccctggtaccccta 532 |||||||| ||||||||| |||||||| ||||| | | ||||||||| ||||||| Sbjct: 28305712 catcctcctcatccacagaatcttggt-gggagtccaccctccctggaaccccta 28305659
>gb|AF075597.1|T2H3 Arabidopsis thaliana BAC T2H3 Length = 48689 Score = 139 bits (70), Expect = 1e-29 Identities = 196/238 (82%) Strand = Plus / Minus Query: 257 ttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtc 316 |||||||| | ||| |||||| |||| || | ||| ||||||||||||||||| | ||| Sbjct: 37044 ttcctctctcggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtc 36985 Query: 317 ttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctcttgttc 376 |||||||| ||||||||||||||||| ||||| ||||| ||||| | || | ||||||| Sbjct: 36984 ttctctctagccttctcagccttggatttgtgaatactttccatcaacacacgcttgttc 36925 Query: 377 ttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttc 436 ||||| | ||| |||||||| |||| |||||||||||||||||| || |||| |||||| Sbjct: 36924 ttgaagacgtttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttc 36865 Query: 437 tttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccaca 494 || | ||| | ||||| || |||||||||||||| | |||||||| |||||||| Sbjct: 36864 ttggtctccctatacttcttcaacagacgcctcagcactctcatcctcctcatccaca 36807 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 599 gagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 |||||||||||| ||||||||||||||||| |||||||| Sbjct: 36622 gagtggatcttcgttggcttcctgatgatgaatccatcctt 36582
>dbj|AP004300.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0470D12 Length = 157248 Score = 139 bits (70), Expect = 1e-29 Identities = 165/194 (85%), Gaps = 2/194 (1%) Strand = Plus / Minus Query: 225 cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 284 |||| ||||| ||||||| |||||||| ||||||||| || ||||||| ||||||||| Sbjct: 31541 cctgagccaacctctcctacctcctggaaatcttcctttcttggcttgccatgctcttgg 31482 Query: 285 cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 344 || ||||||| ||||||||||| || || || ||| || || ||||||| |||| ||| Sbjct: 31481 caagcttggcttcaaactggtcggaaagagttctcttcctagctttctcag-cttgcact 31423 Query: 345 tgtggatactctccatgagg-accctcttgttcttgaacatgttacccttgaccttcagg 403 |||||||||||||||| ||| |||||||||| |||| |||||||||||||||||||| Sbjct: 31422 tgtggatactctccataaggtcccctcttgttgttgagcatgttacccttgaccttcatt 31363 Query: 404 tacatgtcatggta 417 |||||||||||||| Sbjct: 31362 tacatgtcatggta 31349 Score = 46.1 bits (23), Expect = 0.14 Identities = 48/55 (87%), Gaps = 1/55 (1%) Strand = Plus / Minus Query: 478 catcctccgcatccacaggatcttggtggggagcctagcctccctggtaccccta 532 |||||||| ||||||||| |||||||| ||||| | | ||||||||| ||||||| Sbjct: 31275 catcctcctcatccacagaatcttggt-gggagtccaccctccctggaaccccta 31222
>dbj|D29721.1|RICYK34 Oryza sativa mRNA, partial homologous to ribosomal protein L19 gene Length = 369 Score = 131 bits (66), Expect = 3e-27 Identities = 169/199 (84%), Gaps = 6/199 (3%) Strand = Plus / Plus Query: 144 ttcacttcttggccttctttggtgccgctgctgccggagctggagctgcagccgctggtg 203 |||||||||| |||||||| ||||||||||| | |||| |||||||| || || || | Sbjct: 170 ttcacttctttgccttcttaggtgccgctgcagtttgagcaggagctgccgctgcaggag 229 Query: 204 ccggtgcatgatctctggggccctgggccaatctctcctccctcctggcaatcttcctct 263 | | || | ||||| |||||||| ||||| ||||||| |||||||||||||||||||| Sbjct: 230 ctgctg---gctctcttgggccctgagccaacctctcctncctcctggcaatcttcctct 286 Query: 264 c-cctgcttgccttgctcttggcacgcttggcctcaaac-tggtcagatagggtcttctc 321 | | | |||||||||||||||||||||| ||||||||| |||||||| || |||||||| Sbjct: 287 cacgggtttgccttgctcttggcacgcttagcctcaaacttggtcagagagtgtcttctc 346 Query: 322 tctt-gccttctcagcctt 339 |||| |||||||||||||| Sbjct: 347 tcttggccttctcagcctt 365
>dbj|AK110270.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-C08, full insert sequence Length = 1089 Score = 115 bits (58), Expect = 2e-22 Identities = 109/126 (86%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatg 414 ||||||||| || | |||||||||||| | ||||||||||||||||| ||| | || || Sbjct: 499 ctccatgagcacacgcttgttcttgaagacgttacccttgaccttcatgtagagctcgtg 440 Query: 415 gtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcac 474 |||| |||||||||||||||||| ||||||||||||||||| ||||| | ||| ||||| Sbjct: 439 gtacgagtgcttgtcgatcttcttggcctcacggtacttgcggagaagcctcctgagcac 380 Query: 475 acgcat 480 |||||| Sbjct: 379 acgcat 374
>ref|XM_479458.1| Oryza sativa (japonica cultivar-group), mRNA Length = 165 Score = 103 bits (52), Expect = 7e-19 Identities = 132/156 (84%), Gaps = 2/156 (1%) Strand = Plus / Minus Query: 247 cctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtc 306 ||||| ||||||||| || ||||||| ||||||||||| ||||||| ||||||||||| Sbjct: 156 cctggaaatcttcctttcttggcttgccatgctcttggcaagcttggcttcaaactggtc 97 Query: 307 agatagggtcttctctcttgccttctcagccttggacttgtggatactctccatgagg-a 365 || || || ||| || || ||||||| |||| ||||||||||||||||||| ||| Sbjct: 96 ggaaagagttctcttcctagctttctcag-cttgcacttgtggatactctccataaggtc 38 Query: 366 ccctcttgttcttgaacatgttacccttgaccttca 401 |||||||||| |||| |||||||||||||||||||| Sbjct: 37 ccctcttgttgttgagcatgttacccttgaccttca 2
>gb|DQ066293.1| Ixodes scapularis isolate is-all-397 ribosomal protein L19 mRNA, complete cds Length = 597 Score = 93.7 bits (47), Expect = 7e-16 Identities = 86/99 (86%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatg 414 |||||||||||| | |||||||||||||| ||| ||||| |||||| ||||| |||||| Sbjct: 420 ctccatgaggacacgcttgttcttgaacacgttgcccttagccttcaagtacaggtcatg 361 Query: 415 gtacatgtgcttgtcgatcttctttgcctcacggtactt 453 ||||| ||||||||||||||| || ||||| | |||||| Sbjct: 360 gtacaggtgcttgtcgatctttttggcctccctgtactt 322
>emb|X74776.1|DMRPL19 D.melanogaster rpL19 gene for ribosomal protein L19 Length = 1022 Score = 85.7 bits (43), Expect = 2e-13 Identities = 94/111 (84%) Strand = Plus / Minus Query: 328 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 387 |||||||||||| ||||||||| |||||||||||| | |||||||||||||| ||| Sbjct: 788 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaacacgtt 729 Query: 388 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 438 ||||||| ||||| ||||| ||| ||||||| |||| |||| |||||||| Sbjct: 728 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 678
>gb|L32181.1|DRORPL19X Drosophila melanogaster ribosomal protein L19 mRNA Length = 723 Score = 85.7 bits (43), Expect = 2e-13 Identities = 94/111 (84%) Strand = Plus / Minus Query: 328 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 387 |||||||||||| ||||||||| |||||||||||| | |||||||||||||| ||| Sbjct: 466 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaacacgtt 407 Query: 388 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 438 ||||||| ||||| ||||| ||| ||||||| |||| |||| |||||||| Sbjct: 406 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 356
>gb|AY232030.1| Drosophila yakuba clone yak-ad_RpL19 mRNA sequence Length = 582 Score = 77.8 bits (39), Expect = 4e-11 Identities = 93/111 (83%) Strand = Plus / Minus Query: 328 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 387 |||||||||||| ||||||||| |||||| ||||| | |||||||||||||| ||| Sbjct: 447 cttctcagccttcttcttgtggatgtactccatcaggacgcgcttgttcttgaacacgtt 388 Query: 388 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 438 ||||||| ||||| ||||| ||| ||||||| |||| |||| |||||||| Sbjct: 387 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 337
>ref|NM_206219.1| Drosophila melanogaster Ribosomal protein L19 CG2746-RB, transcript variant B (RpL19), mRNA Length = 751 Score = 77.8 bits (39), Expect = 4e-11 Identities = 93/111 (83%) Strand = Plus / Minus Query: 328 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 387 |||||||||||| ||||||||| |||||||||||| | |||||||||||| | ||| Sbjct: 479 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaatacgtt 420 Query: 388 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 438 ||||||| ||||| ||||| ||| ||||||| |||| |||| |||||||| Sbjct: 419 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 369
>ref|NM_057283.4| Drosophila melanogaster Ribosomal protein L19 CG2746-RA, transcript variant A (RpL19), mRNA Length = 793 Score = 77.8 bits (39), Expect = 4e-11 Identities = 93/111 (83%) Strand = Plus / Minus Query: 328 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 387 |||||||||||| ||||||||| |||||||||||| | |||||||||||| | ||| Sbjct: 521 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaatacgtt 462 Query: 388 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 438 ||||||| ||||| ||||| ||| ||||||| |||| |||| |||||||| Sbjct: 461 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 411
>gb|AC007884.5|AC007884 Drosophila melanogaster, chromosome 2R, region 60F-60F, BAC clone BACR08I14, complete sequence Length = 190616 Score = 77.8 bits (39), Expect = 4e-11 Identities = 93/111 (83%) Strand = Plus / Plus Query: 328 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 387 |||||||||||| ||||||||| |||||||||||| | |||||||||||| | ||| Sbjct: 129009 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaatacgtt 129068 Query: 388 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 438 ||||||| ||||| ||||| ||| ||||||| |||| |||| |||||||| Sbjct: 129069 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 129119
>gb|AY061217.1| Drosophila melanogaster LD16326 full insert cDNA Length = 793 Score = 77.8 bits (39), Expect = 4e-11 Identities = 93/111 (83%) Strand = Plus / Minus Query: 328 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 387 |||||||||||| ||||||||| |||||||||||| | |||||||||||| | ||| Sbjct: 503 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaatacgtt 444 Query: 388 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 438 ||||||| ||||| ||||| ||| ||||||| |||| |||| |||||||| Sbjct: 443 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 393
>gb|BT024264.1| Drosophila melanogaster IP15818 full insert cDNA Length = 748 Score = 77.8 bits (39), Expect = 4e-11 Identities = 93/111 (83%) Strand = Plus / Minus Query: 328 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 387 |||||||||||| ||||||||| |||||||||||| | |||||||||||| | ||| Sbjct: 463 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaatacgtt 404 Query: 388 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 438 ||||||| ||||| ||||| ||| ||||||| |||| |||| |||||||| Sbjct: 403 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 353
>gb|AE003465.3| Drosophila melanogaster chromosome 2R, section 72 of 73 of the complete sequence Length = 343833 Score = 77.8 bits (39), Expect = 4e-11 Identities = 93/111 (83%) Strand = Plus / Plus Query: 328 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 387 |||||||||||| ||||||||| |||||||||||| | |||||||||||| | ||| Sbjct: 281313 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaatacgtt 281372 Query: 388 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 438 ||||||| ||||| ||||| ||| ||||||| |||| |||| |||||||| Sbjct: 281373 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 281423
>gb|AY393838.1| Gallus gallus ribosomal protein L19 mRNA, partial cds Length = 523 Score = 75.8 bits (38), Expect = 2e-10 Identities = 113/138 (81%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatg 414 |||||| |||| || |||||||||||||| ||||||||||||||||||||||| | || Sbjct: 397 ctccatcaggatccgcttgttcttgaacacgttacccttgaccttcaggtacaggctgtg 338 Query: 415 gtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcac 474 |||||| || |||||||||||| | ||| | ||| |||| || |||||||| || | Sbjct: 337 gtacatatggcggtcgatcttcttggactccctgtatctgcggagcagacgcctgagaat 278 Query: 475 acgcatcctccgcatcca 492 |||||||||| |||||| Sbjct: 277 ccgcatcctcctcatcca 260
>ref|NM_001030929.1| Gallus gallus ribosomal protein L19 (RPL19), mRNA Length = 706 Score = 73.8 bits (37), Expect = 6e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 |||||| |||| || |||||||||||||| ||||||||||||||||||||||| Sbjct: 452 ctccatcaggatccgcttgttcttgaacacgttacccttgaccttcaggtaca 400
>emb|AJ720076.1| Gallus gallus mRNA for hypothetical protein, clone 10e3 Length = 706 Score = 73.8 bits (37), Expect = 6e-10 Identities = 49/53 (92%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 |||||| |||| || |||||||||||||| ||||||||||||||||||||||| Sbjct: 452 ctccatcaggatccgcttgttcttgaacacgttacccttgaccttcaggtaca 400
>gb|AY130357.1| Petromyzon marinus ribosomal protein L19 mRNA, partial cds Length = 539 Score = 73.8 bits (37), Expect = 6e-10 Identities = 103/125 (82%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| |||||| || || |||||||||| | ||||||||||| || Sbjct: 379 cttgttcttgaacacgttacctttcactttcaggtacagattgtggtacatgtggcgatc 320 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcat 489 ||||||||| ||||| |||||||||||||| ||||| | ||| | ||||| | |||||| Sbjct: 319 gatcttcttggcctcgcggtacttgcgcaggagacggcgcagaatccgcatgcgccgcat 260 Query: 490 ccaca 494 ||||| Sbjct: 259 ccaca 255
>gb|AF401574.1| Ictalurus punctatus ribosomal protein L19 mRNA, complete cds Length = 640 Score = 71.9 bits (36), Expect = 2e-09 Identities = 72/84 (85%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatg 414 ||||||||||| | |||||||||||||| |||||| ||| || ||||||||| | || Sbjct: 430 ctccatgaggatacgcttgttcttgaacacgttacctttggccctcaggtacaggctgtg 371 Query: 415 gtacatgtgcttgtcgatcttctt 438 |||||||||| ||||||||||||| Sbjct: 370 gtacatgtgcctgtcgatcttctt 347
>gb|AY168759.1| Branchiostoma belcheri tsingtaunese ribosomal protein L19 mRNA, complete cds Length = 728 Score = 67.9 bits (34), Expect = 4e-08 Identities = 76/90 (84%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| |||||||||| |||||| ||||| | ||||||| |||||||| Sbjct: 435 cttgttcttgaacacgttacccttggccttcatgtacagctggtggtacagatgcttgtc 376 Query: 430 gatcttctttgcctcacggtacttgcgcag 459 ||| ||||| | ||||||||| || ||||| Sbjct: 375 gattttcttggactcacggtatttccgcag 346
>ref|NM_001040516.1| Bos taurus similar to ribosomal protein L19 (LOC510615), mRNA Length = 754 Score = 65.9 bits (33), Expect = 2e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 343 cttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcag 402 |||||||||| |||||||||| || |||||| ||||||| ||||||||| |||||||| Sbjct: 466 cttgtggatatgttccatgaggatccgcttgtttttgaacacgttacccttcaccttcag 407 Query: 403 gtaca 407 ||||| Sbjct: 406 gtaca 402
>gb|BC041546.1| Xenopus laevis ribosomal protein L19, mRNA (cDNA clone MGC:53844 IMAGE:5542707), complete cds Length = 688 Score = 65.9 bits (33), Expect = 2e-07 Identities = 60/69 (86%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| || |||||||||| | |||||||||||| |||| Sbjct: 412 cttgttcttgaacacgttaccctttactttcaggtacaggctgtggtacatgtgcctgtc 353 Query: 430 gatcttctt 438 |||||||| Sbjct: 352 aatcttctt 344
>gb|BC102223.1| Bos taurus similar to ribosomal protein L19, mRNA (cDNA clone MGC:127270 IMAGE:7946447), complete cds Length = 754 Score = 65.9 bits (33), Expect = 2e-07 Identities = 57/65 (87%) Strand = Plus / Minus Query: 343 cttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcag 402 |||||||||| |||||||||| || |||||| ||||||| ||||||||| |||||||| Sbjct: 466 cttgtggatatgttccatgaggatccgcttgtttttgaacacgttacccttcaccttcag 407 Query: 403 gtaca 407 ||||| Sbjct: 406 gtaca 402
>ref|XM_793320.1| PREDICTED: Strongylocentrotus purpuratus similar to CG2746-PA, isoform A (LOC593861), mRNA Length = 1296 Score = 63.9 bits (32), Expect = 6e-07 Identities = 71/84 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatg 414 ||||||||| || | |||||||||||| | |||||||||||||||| ||||| || || Sbjct: 441 ctccatgagaacacgcttgttcttgaagacattacccttgaccttcatgtacagctcgtg 382 Query: 415 gtacatgtgcttgtcgatcttctt 438 ||||| ||| ||||||||||||| Sbjct: 381 gtacagatgcctgtcgatcttctt 358
>gb|AY648758.1| Danio rerio 60s ribosomal protein L19 mRNA, complete cds Length = 701 Score = 61.9 bits (31), Expect = 2e-06 Identities = 64/75 (85%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| || |||| |||| | |||||||||||| |||| Sbjct: 435 cttgttcttgaacacgttaccctttgccctcagatacaggctgtggtacatgtgcctgtc 376 Query: 430 gatcttctttgcctc 444 ||||||||| ||||| Sbjct: 375 gatcttcttggcctc 361
>ref|NM_213208.1| Danio rerio ribosomal protein L19 (rpl19), mRNA Length = 762 Score = 61.9 bits (31), Expect = 2e-06 Identities = 64/75 (85%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| || |||| |||| | |||||||||||| |||| Sbjct: 429 cttgttcttgaacacgttaccctttgccctcagatacaggctgtggtacatgtgcctgtc 370 Query: 430 gatcttctttgcctc 444 ||||||||| ||||| Sbjct: 369 gatcttcttggcctc 355
>emb|AM049066.1| Sphaerius sp. APV-2005 mRNA for ribosomal protein L19e (rpL19e gene) Length = 600 Score = 61.9 bits (31), Expect = 2e-06 Identities = 106/131 (80%) Strand = Plus / Minus Query: 326 gccttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatg 385 |||||||| ||||| ||||||||| |||||| ||||| | ||||||||||||| | Sbjct: 449 gccttctccgccttcttcttgtggatgtactccatcaggacgcgtttgttcttgaacacg 390 Query: 386 ttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctttgcctca 445 |||||||| |||||| ||||| ||||||| | |||| ||||||| ||||| || | | Sbjct: 389 ttacccttcgccttcatgtacagcgcatggtagaggtgcctgtcgattttcttcgcttga 330 Query: 446 cggtacttgcg 456 ||||||||||| Sbjct: 329 cggtacttgcg 319
>gb|BC062844.1| Danio rerio ribosomal protein L19, mRNA (cDNA clone MGC:77733 IMAGE:7000768), complete cds Length = 762 Score = 61.9 bits (31), Expect = 2e-06 Identities = 64/75 (85%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| || |||| |||| | |||||||||||| |||| Sbjct: 429 cttgttcttgaacacgttaccctttgccctcagatacaggctgtggtacatgtgcctgtc 370 Query: 430 gatcttctttgcctc 444 ||||||||| ||||| Sbjct: 369 gatcttcttggcctc 355
>emb|BX814021.1|CNS0ADSF Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB52ZE12 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 425 Score = 60.0 bits (30), Expect = 9e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 238 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 297 |||||| ||||| ||| |||||| || | ||| |||||| |||| || | ||| ||||| Sbjct: 110 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 51 Query: 298 aaactggtcagatagggtcttctctcttgccttctcagcctt 339 |||||| ||||| || |||||||| || |||||||||||||| Sbjct: 50 aaactgatcagacagagtcttctccctagccttctcagcctt 9
>emb|CR725299.2|CNS0GML5 Tetraodon nigroviridis full-length cDNA Length = 337 Score = 58.0 bits (29), Expect = 4e-05 Identities = 59/69 (85%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 ||||||||| |||| ||||||||| |||||||||||| | |||||||||||| |||| Sbjct: 85 cttgttcttaaacacattacccttggccttcaggtacaggctgtggtacatgtgcctgtc 26 Query: 430 gatcttctt 438 |||||||| Sbjct: 25 aatcttctt 17
>emb|CR707866.2|CNS0G952 Tetraodon nigroviridis full-length cDNA Length = 335 Score = 58.0 bits (29), Expect = 4e-05 Identities = 59/69 (85%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 ||||||||| |||| ||||||||| |||||||||||| | |||||||||||| |||| Sbjct: 85 cttgttcttaaacacattacccttggccttcaggtacaggctgtggtacatgtgcctgtc 26 Query: 430 gatcttctt 438 |||||||| Sbjct: 25 aatcttctt 17
>gb|AY829780.1| Lonomia obliqua ribosomal protein L19e mRNA, partial cds Length = 333 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 |||||||||||| | |||||||||||||| |||||||| ||||||| ||||| Sbjct: 150 ctccatgaggacacgcttgttcttgaacacattacccttcaccttcatgtaca 98
>ref|XM_962282.1| PREDICTED: Tribolium castaneum similar to CG2746-PA, isoform A (LOC655723), mRNA Length = 685 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||||||||||||||||||| | |||||| || |||||| ||||| Sbjct: 454 ctccatgaggaccctcttgttcttgaagacgttacctttcgccttcatgtaca 402
>gb|AY130453.1| Branchiostoma lanceolatum ribosomal protein L19 mRNA, partial cds Length = 588 Score = 58.0 bits (29), Expect = 4e-05 Identities = 59/69 (85%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| |||||| ||||| | ||||||| |||||||| Sbjct: 405 cttgttcttgaacacgttacccttcgccttcatgtacagctggtggtacagatgcttgtc 346 Query: 430 gatcttctt 438 ||||||||| Sbjct: 345 gatcttctt 337
>gb|AY158223.1| Ovis aries ribosomal protein L19 gene, partial cds Length = 522 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 343 cttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcag 402 |||||||||| |||||||| | || |||||| ||||||| ||||||||| |||||||| Sbjct: 376 cttgtggatatgttccatgagaatccgcttgtttttgaacacgttacccttcaccttcag 317 Query: 403 gtaca 407 ||||| Sbjct: 316 gtaca 312
>emb|AL929142.6| Mouse DNA sequence from clone RP23-340A13 on chromosome 2, complete sequence Length = 207823 Score = 58.0 bits (29), Expect = 4e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 343 cttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcag 402 |||||||||| ||||||||||| || |||||| ||||||| || || ||||||||||| Sbjct: 185122 cttgtggatatgctccatgaggatccacttgtttttgaacacattccctttgaccttcag 185063 Query: 403 gtaca 407 ||||| Sbjct: 185062 gtaca 185058
>emb|BX072418.1|CNS09S1I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1BC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 615 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285
>emb|BX072399.1|CNS09S0Z Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 530 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285
>emb|BX072398.1|CNS09S0Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAD1BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 637 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 458 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 399 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 398 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 348
>emb|BX072218.1|CNS09RVY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1AC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 468 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtactttttcagcagacgacgcagcacacgcat 285
>emb|BX072217.1|CNS09RVX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAD1AC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 712 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 460 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 401 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 400 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 350
>emb|BX072184.1|CNS09RV0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAD1AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 511 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285
>emb|BX072183.1|CNS09RUZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAD1AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 615 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 455 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 396 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 395 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 345
>emb|BX071678.1|CNS09RGY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 745 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 248 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 307 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 308 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 358
>emb|BX066612.1|CNS09NK8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC5DH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 929 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 636 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 695 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 696 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 746
>emb|BX066611.1|CNS09NK7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 442 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 383 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 382 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 332
>emb|BX059159.1|CNS09HT7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DE05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 673 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285
>emb|BX055496.1|CNS09EZG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34AE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 771 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 441 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 382 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 381 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 331
>emb|BX054547.1|CNS09E93 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC32DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 675 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285
>emb|BX054546.1|CNS09E92 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC32DA06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 443 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 384 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 383 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 333
>emb|BX052331.1|CNS09CJJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC3BE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 749 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 437 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 378 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 377 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 327
>emb|BX030921.1|CNS08W0T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46AF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 430 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 371 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 370 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 320
>emb|BX030866.1|CNS08VZA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46AD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 434 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 375 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 374 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 324
>emb|BX041770.1|CNS094E6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC13BF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 754 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 436 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 377 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 376 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 326
>emb|BX039610.1|CNS092Q6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC10AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 291 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285
>emb|BX039182.1|CNS092EA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3DF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 653 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285
>emb|BX039161.1|CNS092DP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB3DE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 310 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285
>emb|BX038823.1|CNS0924B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB3BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 662 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 457 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 398 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 397 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 347
>emb|BX038377.1|CNS091RX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB2DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 609 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285
>emb|BX038376.1|CNS091RW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 734 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 443 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 384 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 383 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 333
>emb|BX038311.1|CNS091Q3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 454 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 395 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 394 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 344
>emb|BX038155.1|CNS091LR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB2BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 339 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtactttttcagcagacgacgcagcacacgcat 285
>emb|BX038154.1|CNS091LQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2BF12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 750 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 464 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 405 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 404 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 354
>emb|BX038058.1|CNS091J2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2BB02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 683 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 455 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 396 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 395 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 345
>emb|BX038043.1|CNS091IN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2BA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 756 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 456 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 397 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 396 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 346
>emb|BX038006.1|CNS091HM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB2AG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 746 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 456 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 397 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 396 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 346
>emb|BX037816.1|CNS091CC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB1BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 601 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 463 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 404 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 403 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 353
>emb|BX037762.1|CNS091AU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB1BD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 535 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285
>emb|BX037761.1|CNS091AT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB1BD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 649 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 455 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 396 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 395 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 345
>emb|BX037665.1|CNS09185 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAB1AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 551 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285
>emb|BX037664.1|CNS09184 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAB1AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 634 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 459 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 400 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 399 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 349
>emb|BX036410.1|CNS0909A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA8BB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 680 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285
>emb|BX035051.1|CNS08Z7J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA6AH07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 616 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 428 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 369 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 368 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 318
>emb|BX033776.1|CNS08Y84 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA5BF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 748 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 429 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 370 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 369 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 319
>emb|BX033726.1|CNS08Y6Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA5BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 757 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 444 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 385 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 384 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 334
>emb|BX032914.1|CNS08XK6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA49AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 645 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285
>emb|BX032913.1|CNS08XK5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 736 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 427 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 368 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 367 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 317
>emb|BX032397.1|CNS08X5T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA48BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 464 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 393 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 334 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 333 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 283
>emb|BX031307.1|CNS08WBJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA46CG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 764 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 439 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 380 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 379 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 329
>emb|BX030422.1|CNS08VMY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA45BF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 742 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 428 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 369 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 368 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 318
>emb|BX030094.1|CNS08VDU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA44DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 745 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 430 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 371 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 370 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 320
>emb|BX028661.1|CNS08UA1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA42DC08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 431 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 372 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 371 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 321
>emb|BX027462.1|CNS08TCQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA41AE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 515 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 445 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 386 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 385 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 335
>emb|BX026971.1|CNS08SZ3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA40BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 525 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 207 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 148 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 147 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 97
>emb|BX026323.1|CNS08SH3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA4CC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 618 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 432 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 373 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 372 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 322
>emb|BX026099.1|CNS08SAV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA4BA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 746 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 437 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 378 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 377 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 327
>emb|BX025970.1|CNS08S7A Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA4AB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 749 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 424 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 365 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 364 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 314
>emb|BX022898.1|CNS08PTY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA35AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 631 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 448 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 389 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 388 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 338
>emb|BX022814.1|CNS08PRM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA34DE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 624 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 449 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 390 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 389 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 339
>emb|BX024692.1|CNS08R7S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37DB12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 754 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 433 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 374 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 373 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 323
>emb|BX024544.1|CNS08R3O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA37BH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 694 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 403 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 344 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 343 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 293
>emb|BX023626.1|CNS08QE6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA36AD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 771 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 441 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 382 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 381 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 331
>emb|BX023558.1|CNS08QCA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA36AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 768 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 442 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 383 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 382 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 332
>emb|BX022499.1|CNS08PIV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA34BG09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 705 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 392 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 333 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 332 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 282
>emb|BX020965.1|CNS08OC9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA31AA04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 636 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 445 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 386 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 385 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 335
>emb|BX020716.1|CNS08O5C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA30CB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 659 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 437 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 378 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 377 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 327
>emb|BX018850.1|CNS08MPI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA28CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 744 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 425 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 366 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 365 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 315
>emb|BX015711.1|CNS08KAB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA23CD05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 449 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 439 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 380 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 379 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 329
>emb|BX013211.1|CNS08ICV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA2DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 745 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 431 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 372 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 371 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 321
>emb|BX011390.1|CNS08GYA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA18AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 663 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 439 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 380 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 379 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 329
>emb|BX010223.1|CNS08G1V Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA16BH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 523 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 216 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 157 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 156 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 106
>emb|BX007556.1|CNS08DZS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA12CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 769 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 448 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 389 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 388 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 338
>emb|BX007498.1|CNS08DY6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA12CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 754 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 434 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 375 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 374 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 324
>emb|BX007416.1|CNS08DVW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA12BE11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 507 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 183 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 124 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 123 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 73
>emb|BX007311.1|CNS08DSZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA12BA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 659 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 337 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 278 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 277 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 227
>emb|BX007293.1|CNS08DSH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA12AH03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 737 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 423 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 364 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 363 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 313
>ref|XM_313705.2| Anopheles gambiae str. PEST ENSANGP00000017616 (ENSANGG00000015127), partial mRNA Length = 662 Score = 54.0 bits (27), Expect = 6e-04 Identities = 90/111 (81%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 458 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 399 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 398 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 348
>gb|AY389933.1| Latimeria chalumnae ribosomal protein L19 mRNA, partial cds Length = 520 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtaca 407 |||||||||||||| |||||||| ||||||||||||| Sbjct: 379 cttgttcttgaacacattacccttaaccttcaggtaca 342
>ref|XM_549228.2| PREDICTED: Canis familiaris similar to ribosomal protein L19 (LOC492107), mRNA Length = 473 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtaca 407 |||||||||||||| ||||||||| || |||||||||| Sbjct: 213 cttgttcttgaacacgttacccttcactttcaggtaca 176
>ref|XR_002471.1| PREDICTED: Mus musculus similar to ribosomal protein L19 (LOC669319), mRNA Length = 3434 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| || |||||| ||||||| || || |||||||||||||||| Sbjct: 3188 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 3136
>ref|XM_141608.7| PREDICTED: Mus musculus similar to ribosomal protein L19 (LOC208428), mRNA Length = 1051 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| || |||||| ||||||| || || |||||||||||||||| Sbjct: 805 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 753
>ref|XM_906720.2| PREDICTED: Mus musculus similar to ribosomal protein L19 (LOC208428), mRNA Length = 1051 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| || |||||| ||||||| || || |||||||||||||||| Sbjct: 805 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 753
>ref|XR_002473.1| PREDICTED: Mus musculus hypothetical LOC631067 (LOC631067), mRNA Length = 744 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| | |||||| ||||||| || ||||||||||||||||||| Sbjct: 458 ctccatgaggatgcgcttgtttttgaacacattccccttgaccttcaggtaca 406
>ref|XM_983446.1| PREDICTED: Mus musculus similar to ribosomal protein L19 (LOC631615), mRNA Length = 609 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| || |||||| ||||||| || || |||||||||||||||| Sbjct: 363 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 311
>ref|XM_905487.2| PREDICTED: Mus musculus similar to ribosomal protein L19 (LOC631615), mRNA Length = 609 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| || |||||| ||||||| || || |||||||||||||||| Sbjct: 363 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 311
>ref|XM_356705.5| PREDICTED: Mus musculus similar to ribosomal protein L19 (LOC382844), mRNA Length = 702 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| || |||||| ||||||| || || |||||||||||||||| Sbjct: 456 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 404
>ref|XM_752688.1| Ustilago maydis 521 hypothetical protein (UM01634.1) partial mRNA Length = 588 Score = 50.1 bits (25), Expect = 0.009 Identities = 82/101 (81%) Strand = Plus / Minus Query: 335 gccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttg 394 ||||||| ||||||||| |||||| || || | |||||||||||| | ||||||||| Sbjct: 440 gccttggccttgtggatgtgctccataagcacacgcttgttcttgaaaacgttacccttc 381 Query: 395 accttcaggtacatgtcatggtacatgtgcttgtcgatctt 435 ||| ||||| | || ||||||| ||||||||||||||| Sbjct: 380 gacttgaggtaaagctcgtggtacaggtgcttgtcgatctt 340
>ref|XM_572717.1| Cryptococcus neoformans var. neoformans JEC21 60S ribosomal protein L19 (CNI01090) partial mRNA Length = 677 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 413 tggtacatgtgcttgtcgatcttctttgcctcacggtactt 453 ||||||||||||||||||||||| |||||||||||||| Sbjct: 377 tggtacatgtgcttgtcgatcttgccggcctcacggtactt 337
>gb|AC122290.4| Mus musculus BAC clone RP23-254P19 from chromosome 14, complete sequence Length = 163287 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| || |||||| ||||||| || || |||||||||||||||| Sbjct: 19785 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 19733
>emb|BX465866.13| Mouse DNA sequence from clone RP23-128L16 on chromosome X, complete sequence Length = 62496 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| || |||||| ||||||| || || |||||||||||||||| Sbjct: 55876 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 55824
>gb|M95065.1|MZEORFF Zea mays putative ribosomal protein L19 mRNA, partial cds Length = 189 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Minus Query: 599 gagtggatcttctgaggcttcctgatgatgaaaccatcctt 639 ||||||||||| ||||||||| ||||||| || |||||||| Sbjct: 168 gagtggatcttatgaggcttcttgatgataaacccatcctt 128
>gb|AC171681.1| Mus musculus BAC clone RP24-530O2 from chromosome 14, complete sequence Length = 198038 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| || |||||| ||||||| || || |||||||||||||||| Sbjct: 181519 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 181467
>gb|AC123611.7| Mus musculus chromosome 15, clone RP23-345H23, complete sequence Length = 209792 Score = 50.1 bits (25), Expect = 0.009 Identities = 46/53 (86%) Strand = Plus / Plus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| | |||||| ||||||| || ||||||||||||||||||| Sbjct: 105878 ctccatgaggatgcgcttgtttttgaacacattccccttgaccttcaggtaca 105930
>ref|XM_859015.1| PREDICTED: Canis familiaris Ribosomal protein L19, transcript variant 4 (RPL19), mRNA Length = 706 Score = 48.1 bits (24), Expect = 0.036 Identities = 45/52 (86%) Strand = Plus / Minus Query: 356 tccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 |||||||| | || |||||||||||||| |||||||| || |||||||||| Sbjct: 446 tccatgagaatccgcttgttcttgaacacattacccttcactttcaggtaca 395
>ref|XM_858990.1| PREDICTED: Canis familiaris Ribosomal protein L19, transcript variant 3 (RPL19), mRNA Length = 578 Score = 48.1 bits (24), Expect = 0.036 Identities = 45/52 (86%) Strand = Plus / Minus Query: 356 tccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 |||||||| | || |||||||||||||| |||||||| || |||||||||| Sbjct: 318 tccatgagaatccgcttgttcttgaacacattacccttcactttcaggtaca 267
>ref|XM_858974.1| PREDICTED: Canis familiaris Ribosomal protein L19, transcript variant 2 (RPL19), mRNA Length = 702 Score = 48.1 bits (24), Expect = 0.036 Identities = 45/52 (86%) Strand = Plus / Minus Query: 356 tccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 |||||||| | || |||||||||||||| |||||||| || |||||||||| Sbjct: 445 tccatgagaatccgcttgttcttgaacacattacccttcactttcaggtaca 394
>ref|XM_537655.2| PREDICTED: Canis familiaris Ribosomal protein L19, transcript variant 1 (RPL19), mRNA Length = 735 Score = 48.1 bits (24), Expect = 0.036 Identities = 45/52 (86%) Strand = Plus / Minus Query: 356 tccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 |||||||| | || |||||||||||||| |||||||| || |||||||||| Sbjct: 475 tccatgagaatccgcttgttcttgaacacattacccttcactttcaggtaca 424
>emb|AM049064.1| Curculio glandium partial mRNA for ribosomal protein L19e (rpL19e gene) Length = 414 Score = 48.1 bits (24), Expect = 0.036 Identities = 36/40 (90%) Strand = Plus / Minus Query: 368 ctcttgttcttgaacatgttacccttgaccttcaggtaca 407 |||||||||||||||| ||||||||| |||||| ||||| Sbjct: 407 ctcttgttcttgaacacgttacccttacccttcatgtaca 368
>emb|BX063837.1|CNS09LF5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45DE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 584 Score = 48.1 bits (24), Expect = 0.036 Identities = 69/84 (82%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 267 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 326 Query: 430 gatcttctttgcctcacggtactt 453 ||| ||||| |||||||||||||| Sbjct: 327 gattttcttcgcctcacggtactt 350
>emb|BX063836.1|CNS09LF4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45DE10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1016 Score = 48.1 bits (24), Expect = 0.036 Identities = 69/84 (82%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 745 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 686 Query: 430 gatcttctttgcctcacggtactt 453 ||| ||||| |||||||||||||| Sbjct: 685 gattttcttcgcctcacggtactt 662
>emb|BX059860.1|CNS09ICO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4DH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 626 Score = 48.1 bits (24), Expect = 0.036 Identities = 69/84 (82%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 319 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 260 Query: 430 gatcttctttgcctcacggtactt 453 ||| ||||| |||||||||||||| Sbjct: 259 gattttcttcgcctcacggtactt 236
>emb|BX033777.1|CNS08Y85 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA5BF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 660 Score = 48.1 bits (24), Expect = 0.036 Identities = 69/84 (82%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtactt 453 ||| ||||| |||||||||||||| Sbjct: 235 gattttcttcgcctcacggtactt 258
>emb|BX033086.1|CNS08XOY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA49BE02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 751 Score = 48.1 bits (24), Expect = 0.036 Identities = 69/84 (82%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 434 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 375 Query: 430 gatcttctttgcctcacggtactt 453 ||| ||||| |||||||||||||| Sbjct: 374 gattttcttcgcctcacggtactt 351
>emb|BX032398.1|CNS08X5U Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA48BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 272 Score = 48.1 bits (24), Expect = 0.036 Identities = 69/84 (82%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtactt 453 ||| ||||| |||||||||||||| Sbjct: 235 gattttcttcgcctcacggtactt 258
>emb|BX022839.1|CNS08PSB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA34DG02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 169 Score = 48.1 bits (24), Expect = 0.036 Identities = 69/84 (82%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 105 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 46 Query: 430 gatcttctttgcctcacggtactt 453 ||| ||||| |||||||||||||| Sbjct: 45 gattttcttcgcctcacggtactt 22
>emb|BX022610.1|CNS08PLY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA34CD08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 553 Score = 48.1 bits (24), Expect = 0.036 Identities = 69/84 (82%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 450 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 391 Query: 430 gatcttctttgcctcacggtactt 453 ||| ||||| |||||||||||||| Sbjct: 390 gattttcttcgcctcacggtactt 367
>emb|BX018223.1|CNS08M83 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA27CD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 318 Score = 48.1 bits (24), Expect = 0.036 Identities = 69/84 (82%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtactt 453 ||| ||||| |||||||||||||| Sbjct: 235 gattttcttcgcctcacggtactt 258
>gb|DQ122884.1| Chlamydomonas incerta mitochondrial carrier protein CR057 mRNA, complete cds; nuclear gene for mitochondrial product Length = 1745 Score = 48.1 bits (24), Expect = 0.036 Identities = 27/28 (96%) Strand = Plus / Plus Query: 167 gccgctgctgccggagctggagctgcag 194 ||||||||| |||||||||||||||||| Sbjct: 1182 gccgctgcttccggagctggagctgcag 1209
>gb|AC024599.9| Homo sapiens chromosome 10 clone RP11-159H3, complete sequence Length = 173391 Score = 48.1 bits (24), Expect = 0.036 Identities = 45/52 (86%) Strand = Plus / Plus Query: 356 tccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 |||||||||| || |||||| ||||||| || ||||| ||||||||||||| Sbjct: 51245 tccatgaggatccgcttgtttttgaacacattccccttcaccttcaggtaca 51296
>gb|AC012690.17| Homo sapiens chromosome 10 clone RP11-127B19, complete sequence Length = 161276 Score = 48.1 bits (24), Expect = 0.036 Identities = 45/52 (86%) Strand = Plus / Plus Query: 356 tccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 |||||||||| || |||||| ||||||| || ||||| ||||||||||||| Sbjct: 140593 tccatgaggatccgcttgtttttgaacacattccccttcaccttcaggtaca 140644
>gb|AY857433.1| Suberites domuncula L19 mRNA, complete cds Length = 600 Score = 48.1 bits (24), Expect = 0.036 Identities = 57/68 (83%) Strand = Plus / Minus Query: 329 ttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtta 388 ||||||||||| |||||||||| ||||||||| || | |||||||| |||| |||| Sbjct: 446 ttctcagccttcttcttgtggataaactccatgagtacacgtttgttcttaaacacgtta 387 Query: 389 cccttgac 396 |||||||| Sbjct: 386 cccttgac 379
>emb|AJ563476.1|CGI563476 Crassostrea gigas partial mRNA for ribosomal protein L19 (rpls gene) Length = 604 Score = 48.1 bits (24), Expect = 0.036 Identities = 69/84 (82%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatg 414 |||||| | ||| |||||||||||||| |||||| ||| ||||| ||||| ||||| Sbjct: 427 ctccatcaagactctcttgttcttgaatccgttacctttgctcttcatgtacagttcatg 368 Query: 415 gtacatgtgcttgtcgatcttctt 438 ||| | |||||||||||| ||||| Sbjct: 367 gtataagtgcttgtcgattttctt 344
>gb|AC102895.7| Mus musculus chromosome 15, clone RP24-356D22, complete sequence Length = 165778 Score = 48.1 bits (24), Expect = 0.036 Identities = 24/24 (100%) Strand = Plus / Minus Query: 566 ttggcctcatgtgccctccttgca 589 |||||||||||||||||||||||| Sbjct: 35953 ttggcctcatgtgccctccttgca 35930
>emb|AJ388522.1|CFA388522 Canis familiaris mRNA for partial Ribosomal protein L19 (rpL19 gene) Length = 342 Score = 48.1 bits (24), Expect = 0.036 Identities = 45/52 (86%) Strand = Plus / Minus Query: 356 tccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 |||||||| | || |||||||||||||| |||||||| || |||||||||| Sbjct: 330 tccatgagaatccgcttgttcttgaacacattacccttcactttcaggtaca 279
>ref|XM_964097.1| PREDICTED: Tribolium castaneum similar to CG2746-PA, isoform A (LOC657650), mRNA Length = 739 Score = 46.1 bits (23), Expect = 0.14 Identities = 41/47 (87%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttca 401 |||||| || ||||||||||||||||| | ||| |||||| |||||| Sbjct: 505 ctccataagaaccctcttgttcttgaagacgttgcccttggccttca 459
>emb|BX036409.1|CNS09099 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA8BB05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 725 Score = 46.1 bits (23), Expect = 0.14 Identities = 89/111 (80%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||| ||| ||| ||| Sbjct: 427 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggaacaggtgacggtc 368 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 367 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 317
>emb|BX030095.1|CNS08VDV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA44DG08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 668 Score = 46.1 bits (23), Expect = 0.14 Identities = 89/111 (80%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || || || ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtccaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285
>emb|BX021000.1|CNS08OD8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA31AC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 767 Score = 46.1 bits (23), Expect = 0.14 Identities = 89/111 (80%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || ||||| ||| ||||||| ||| ||| Sbjct: 452 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 393 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| ||||||||| |||| ||| ||||| | |||||||||||| Sbjct: 392 gattttcttcgcctcacggcacttcttcagcagacgacgcagcacacgcat 342
>emb|BX019823.1|CNS08NGJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA3BA01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 740 Score = 46.1 bits (23), Expect = 0.14 Identities = 89/111 (80%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || |||| | || ||||||| ||| ||| Sbjct: 423 cttgttcttgaacacgttacccttcgcacgcatgtacttatcgtggtacaggtgacggtc 364 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 363 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 313
>emb|BX013212.1|CNS08ICW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAA2DF05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 665 Score = 46.1 bits (23), Expect = 0.14 Identities = 89/111 (80%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 429 |||||||||||||| ||||||||| | || || || ||| ||||||| ||| ||| Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgttcaggtcgtggtacaggtgacggtc 234 Query: 430 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 ||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285
>gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 9, complete sequence Length = 1178688 Score = 44.1 bits (22), Expect = 0.56 Identities = 34/38 (89%) Strand = Plus / Minus Query: 416 tacatgtgcttgtcgatcttctttgcctcacggtactt 453 |||||||||||||||||||| |||||||||||||| Sbjct: 273528 tacatgtgcttgtcgatcttgccggcctcacggtactt 273491
>ref|XM_420503.1| PREDICTED: Gallus gallus similar to KIAA1546 protein (LOC422540), mRNA Length = 7572 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 316 cttctctcttgccttctcagcc 337 |||||||||||||||||||||| Sbjct: 7347 cttctctcttgccttctcagcc 7326
>ref|XM_652630.1| Aspergillus nidulans FGSC A4 dynein heavy chain (AN0118.2), mRNA Length = 13038 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Plus Query: 181 agctggagctgcagccgctggtgccg 206 ||||||||||||||||| |||||||| Sbjct: 1551 agctggagctgcagccgatggtgccg 1576
>emb|AM049063.1| Cicindela campestris mRNA for ribosomal protein L19e (rpL19e gene) Length = 600 Score = 44.1 bits (22), Expect = 0.56 Identities = 34/38 (89%) Strand = Plus / Minus Query: 356 tccatgaggaccctcttgttcttgaacatgttaccctt 393 ||||| ||||| | |||||||||||||| ||||||||| Sbjct: 419 tccataaggacacgcttgttcttgaacacgttaccctt 382
>emb|CR730601.2|CNS0GQOE Tetraodon nigroviridis full-length cDNA Length = 1252 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 148 cttcttggccttctttggtgcc 169 |||||||||||||||||||||| Sbjct: 82 cttcttggccttctttggtgcc 61
>emb|CR725565.1|CNS0GMSJ Tetraodon nigroviridis full-length cDNA Length = 1233 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 148 cttcttggccttctttggtgcc 169 |||||||||||||||||||||| Sbjct: 70 cttcttggccttctttggtgcc 49
>emb|CR701659.2|CNS0G4CN Tetraodon nigroviridis full-length cDNA Length = 528 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 148 cttcttggccttctttggtgcc 169 |||||||||||||||||||||| Sbjct: 84 cttcttggccttctttggtgcc 63
>emb|CR670272.2|CNS0FG5I Tetraodon nigroviridis full-length cDNA Length = 1038 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 148 cttcttggccttctttggtgcc 169 |||||||||||||||||||||| Sbjct: 55 cttcttggccttctttggtgcc 34
>emb|CR666708.2|CNS0FDEI Tetraodon nigroviridis full-length cDNA Length = 1237 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 148 cttcttggccttctttggtgcc 169 |||||||||||||||||||||| Sbjct: 78 cttcttggccttctttggtgcc 57
>emb|CR666702.1|CNS0FDEC Tetraodon nigroviridis full-length cDNA Length = 1081 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 148 cttcttggccttctttggtgcc 169 |||||||||||||||||||||| Sbjct: 79 cttcttggccttctttggtgcc 58
>emb|CR665691.2|CNS0FCM9 Tetraodon nigroviridis full-length cDNA Length = 1253 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 148 cttcttggccttctttggtgcc 169 |||||||||||||||||||||| Sbjct: 82 cttcttggccttctttggtgcc 61
>emb|CR663076.2|CNS0FALM Tetraodon nigroviridis full-length cDNA Length = 1252 Score = 44.1 bits (22), Expect = 0.56 Identities = 22/22 (100%) Strand = Plus / Minus Query: 148 cttcttggccttctttggtgcc 169 |||||||||||||||||||||| Sbjct: 82 cttcttggccttctttggtgcc 61
>emb|AL161742.7| Human DNA sequence from clone RP4-597J3 on chromosome 1p32.1-32.3 Contains the 5' end of the ROR1 gene for receptor tyrosine kinase-like orphan receptor 1, a ribosomal protein L19 (RPL19) pseudogene, a cofilin 1 (non-muscle) (CFL1) pseudogene and a CpG island, complete sequence Length = 114409 Score = 44.1 bits (22), Expect = 0.56 Identities = 34/38 (89%) Strand = Plus / Plus Query: 370 cttgttcttgaacatgttacccttgaccttcaggtaca 407 |||||| ||||||| ||| ||||| ||||||||||||| Sbjct: 40126 cttgtttttgaacacgttccccttaaccttcaggtaca 40163
>emb|BX056472.1|CNS09FQK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35DB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 118 Score = 44.1 bits (22), Expect = 0.56 Identities = 46/54 (85%) Strand = Plus / Plus Query: 427 gtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 |||||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 24 gtcgattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 77
>emb|BX050811.1|CNS09BDB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC27CA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 920 Score = 44.1 bits (22), Expect = 0.56 Identities = 46/54 (85%) Strand = Plus / Minus Query: 427 gtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 |||||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 381 gtcgattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 328 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttaccctt 393 |||||||||||||| ||||||||| Sbjct: 438 cttgttcttgaacacgttaccctt 415
>emb|BX039609.1|CNS092Q5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC10AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 403 Score = 44.1 bits (22), Expect = 0.56 Identities = 46/54 (85%) Strand = Plus / Minus Query: 427 gtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 |||||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 372 gtcgattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 319
>emb|BX019178.1|CNS08MYM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA29AG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 756 Score = 44.1 bits (22), Expect = 0.56 Identities = 46/54 (85%) Strand = Plus / Minus Query: 427 gtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 |||||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 381 gtcgattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 328 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttaccctt 393 |||||||||||||| ||||||||| Sbjct: 438 cttgttcttgaacacgttaccctt 415
>emb|BX018222.1|CNS08M82 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAA27CD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 754 Score = 44.1 bits (22), Expect = 0.56 Identities = 46/54 (85%) Strand = Plus / Minus Query: 427 gtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 480 |||||| ||||| |||||||||||||| ||| ||||| | |||||||||||| Sbjct: 389 gtcgattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 336 Score = 40.1 bits (20), Expect = 8.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 370 cttgttcttgaacatgttaccctt 393 |||||||||||||| ||||||||| Sbjct: 446 cttgttcttgaacacgttaccctt 423
>ref|XM_578500.1| PREDICTED: Rattus norvegicus similar to novel protein (LOC502992), mRNA Length = 1143 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Plus Query: 153 tggccttctttggtgccgctgctgcc 178 |||||||||||||||| ||||||||| Sbjct: 825 tggccttctttggtgctgctgctgcc 850
>emb|CT033560.1| Platynereis dumerilii EST IB0AAA18AG10FM1 Length = 731 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Plus Query: 614 ggcttcctgatgatgaaaccatcctt 639 |||||||||||||| ||||||||||| Sbjct: 543 ggcttcctgatgataaaaccatcctt 568
>gb|U03904.1|ENU03904 Emericella nidulans cytoplasmic dynein gene, complete cds Length = 13254 Score = 44.1 bits (22), Expect = 0.56 Identities = 25/26 (96%) Strand = Plus / Plus Query: 181 agctggagctgcagccgctggtgccg 206 ||||||||||||||||| |||||||| Sbjct: 1657 agctggagctgcagccgatggtgccg 1682
>ref|XM_516790.1| PREDICTED: Pan troglodytes similar to Transcription factor Dp-2 (E2F dimerization partner 2) (LOC460743), mRNA Length = 3654 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||| | || |||||| ||||||| || ||||| ||||||||||||| Sbjct: 2013 ctccatgagaatccgcttgtttttgaacacatttcccttcaccttcaggtaca 1961
>gb|BC083131.1| Mus musculus ribosomal protein L19, mRNA (cDNA clone MGC:103211 IMAGE:6442192), complete cds Length = 737 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| | |||||| ||||||| || || |||||||||||||||| Sbjct: 429 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 377
>gb|AC158308.4| Mus musculus chromosome 3, clone RP23-182M12, complete sequence Length = 176856 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Plus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| || |||||| || |||| || || |||||||||||||||| Sbjct: 143491 ctccatgaggatccgcttgttttttaacacattccctttgaccttcaggtaca 143543
>gb|BC077657.1| Xenopus tropicalis MGC89675 protein, mRNA (cDNA clone MGC:89675 IMAGE:7026279), complete cds Length = 709 Score = 42.1 bits (21), Expect = 2.2 Identities = 54/65 (83%) Strand = Plus / Minus Query: 374 ttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatc 433 |||||||||| ||| ||||| || ||||| |||| | |||||||||||| |||| ||| Sbjct: 426 ttcttgaacacgtttccctttactttcagatacaggctgtggtacatgtgcctgtcaatc 367 Query: 434 ttctt 438 ||||| Sbjct: 366 ttctt 362
>gb|AY658253.1| Synthetic construct Peudomonas aeruginosa clone FLH052548.01F PA3198 gene, partial cds Length = 753 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 170 gctgctgccggagctggagctgcag 194 ||||||||||||||||| ||||||| Sbjct: 390 gctgctgccggagctggcgctgcag 414
>gb|BC058135.1| Rattus norvegicus ribosomal protein L19, mRNA (cDNA clone MGC:72756 IMAGE:6918377), complete cds Length = 732 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||| | || |||||| ||||||| || || |||||||||||||||| Sbjct: 448 ctccatgagaatccgcttgtttttgaacacattccctttgaccttcaggtaca 396
>gb|BC010710.1| Mus musculus ribosomal protein L19, mRNA (cDNA clone MGC:6500 IMAGE:2648593), complete cds Length = 701 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| | |||||| ||||||| || || |||||||||||||||| Sbjct: 427 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 375
>ref|NM_009078.1| Mus musculus ribosomal protein L19 (Rpl19), mRNA Length = 673 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| | |||||| ||||||| || || |||||||||||||||| Sbjct: 420 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 368
>ref|XR_005084.1| PREDICTED: Mus musculus hypothetical protein LOC677551 (LOC677551), mRNA Length = 778 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| | |||||| ||||||| || || |||||||||||||||| Sbjct: 491 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 439
>ref|XR_002967.1| PREDICTED: Mus musculus hypothetical protein LOC670429 (LOC670429), mRNA Length = 777 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| | |||||| ||||||| || || |||||||||||||||| Sbjct: 491 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 439
>ref|XR_001792.1| PREDICTED: Mus musculus hypothetical protein LOC665813 (LOC665813), mRNA Length = 778 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| | |||||| ||||||| || || |||||||||||||||| Sbjct: 491 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 439
>ref|XM_994659.1| PREDICTED: Mus musculus similar to ribosomal protein L19 (LOC435754), mRNA Length = 720 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| || |||||| || |||| || || |||||||||||||||| Sbjct: 452 ctccatgaggatccgcttgttttttaacacattccctttgaccttcaggtaca 400
>ref|XM_916280.2| PREDICTED: Mus musculus similar to ribosomal protein L19 (LOC435754), mRNA Length = 720 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| || |||||| || |||| || || |||||||||||||||| Sbjct: 452 ctccatgaggatccgcttgttttttaacacattccctttgaccttcaggtaca 400
>ref|XM_001005252.1| PREDICTED: Mus musculus similar to ribosomal protein L19 (LOC668689), mRNA Length = 712 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| || |||||| || |||| || || |||||||||||||||| Sbjct: 444 ctccatgaggatccgcttgttttttaacacattccctttgaccttcaggtaca 392
>ref|XM_757154.1| Ustilago maydis 521 hypothetical protein (UM06100.1) partial mRNA Length = 837 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 166 tgccgctgctgccggagctgg 186 ||||||||||||||||||||| Sbjct: 11 tgccgctgctgccggagctgg 31
>gb|AC126807.4| Mus musculus BAC clone RP23-306D4 from chromosome 18, complete sequence Length = 244566 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| | |||||| ||||||| || || |||||||||||||||| Sbjct: 71678 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 71626
>emb|CR674700.2|CNS0FJKI Tetraodon nigroviridis full-length cDNA Length = 809 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 150 tcttggccttctttggtgccg 170 ||||||||||||||||||||| Sbjct: 156 tcttggccttctttggtgccg 136
>gb|BC090329.1| Rattus norvegicus cDNA clone IMAGE:7300763, **** WARNING: chimeric clone **** Length = 2055 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||| | || |||||| ||||||| || || |||||||||||||||| Sbjct: 1784 ctccatgagaatccgcttgtttttgaacacattccctttgaccttcaggtaca 1732
>ref|XM_502020.1| Yarrowia lipolytica CLIB122, YALI0C19668g predicted mRNA Length = 1074 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 173 gctgccggagctggagctgca 193 ||||||||||||||||||||| Sbjct: 799 gctgccggagctggagctgca 819 Score = 40.1 bits (20), Expect = 8.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 173 gctgccggagctggagctgcagccgctg 200 |||| |||||||||||||||| |||||| Sbjct: 775 gctgtcggagctggagctgcacccgctg 802
>emb|AL646051.19| Mouse DNA sequence from clone RP23-222M22 on chromosome 11 Contains the 5' end of the Hs3st3a gene for heparan sulfate (glucosamine) 3-O-sulfotransferase 3A and a CpG island, complete sequence Length = 144847 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 324 ttgccttctcagccttggact 344 ||||||||||||||||||||| Sbjct: 34971 ttgccttctcagccttggact 34951
>emb|AL646095.27| Mouse DNA sequence from clone RP23-17P18 on chromosome 11 Contains the 3' end of the Asb3 gene for ankyrin repeat and SOCS box-containing protein 3 and two zinc finger protein pseudogenes, complete sequence Length = 173655 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 260 ctctccctgcttgccttgctc 280 ||||||||||||||||||||| Sbjct: 73241 ctctccctgcttgccttgctc 73261
>gb|AC064800.8| Homo sapiens chromosome 18, clone CTD-2001I24, complete sequence Length = 131409 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 262 ctccctgcttgccttgctctt 282 ||||||||||||||||||||| Sbjct: 98973 ctccctgcttgccttgctctt 98993
>dbj|AK168481.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched library, clone:I920026E09 product:ribosomal protein L19, full insert sequence Length = 705 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| | |||||| ||||||| || || |||||||||||||||| Sbjct: 453 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 401
>dbj|AK168232.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library, clone:I730069N19 product:ribosomal protein L19, full insert sequence Length = 661 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| | |||||| ||||||| || || |||||||||||||||| Sbjct: 407 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 355
>dbj|AK010440.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:2410007J07 product:ribosomal protein L19, full insert sequence Length = 719 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| | |||||| ||||||| || || |||||||||||||||| Sbjct: 449 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 397
>gb|BC089549.1| Mus musculus ribosomal protein L19, mRNA (cDNA clone MGC:107301 IMAGE:6703351), complete cds Length = 733 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| | |||||| ||||||| || || |||||||||||||||| Sbjct: 449 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 397
>ref|NM_031103.1| Rattus norvegicus ribosomal protein L19 (Rpl19), mRNA Length = 703 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||| | || |||||| ||||||| || || |||||||||||||||| Sbjct: 448 ctccatgagaatccgcttgtttttgaacacattccctttgaccttcaggtaca 396
>gb|AC102600.11| Mus musculus chromosome 3, clone RP23-376E16, complete sequence Length = 131703 Score = 42.1 bits (21), Expect = 2.2 Identities = 45/53 (84%) Strand = Plus / Minus Query: 355 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 407 ||||||||||| || |||||| || |||| || || |||||||||||||||| Sbjct: 57618 ctccatgaggatccgcttgttttttaacacattccctttgaccttcaggtaca 57566 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,927,559 Number of Sequences: 3902068 Number of extensions: 5927559 Number of successful extensions: 171227 Number of sequences better than 10.0: 2640 Number of HSP's better than 10.0 without gapping: 2636 Number of HSP's successfully gapped in prelim test: 6 Number of HSP's that attempted gapping in prelim test: 167484 Number of HSP's gapped (non-prelim): 3636 length of query: 640 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 617 effective length of database: 17,143,297,704 effective search space: 10577414683368 effective search space used: 10577414683368 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
