ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd16j21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF542969.2| Triticum aestivum ribosomal protein L19 mRNA, com... 872 0.0
2dbj|AK102721.1| Oryza sativa (japonica cultivar-group) cDNA clon... 529 e-147
3dbj|AK059309.1| Oryza sativa (japonica cultivar-group) cDNA clon... 529 e-147
4gb|AY103679.1| Zea mays PCO152526 mRNA sequence 513 e-142
5gb|BT019233.1| Zea mays clone Contig906.F mRNA sequence 480 e-132
6gb|BT016537.1| Zea mays clone Contig370 mRNA sequence 480 e-132
7gb|AY103638.1| Zea mays PCO153348 mRNA sequence 480 e-132
8gb|BT016919.1| Zea mays clone E04912701B11.c mRNA sequence 470 e-129
9gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 444 e-121
10gb|AC134885.1| Genomic sequence for Oryza sativa, Nipponbare str... 444 e-121
11dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 444 e-121
12gb|AC147962.1| Oryza sativa chromosome 3 BAC OSJNBa0083K01 genom... 420 e-114
13gb|AC128645.5| Oryza sativa chromosome 3 BAC OSJNBb0016P23 genom... 420 e-114
14gb|BT016443.1| Zea mays clone Contig276 mRNA sequence 402 e-109
15gb|AY104244.1| Zea mays PCO075323 mRNA sequence 389 e-105
16gb|AY389581.1| Hyacinthus orientalis ribosomal protein L19 (RPL1... 258 2e-65
17gb|AY089073.1| Arabidopsis thaliana clone 27978 mRNA, complete s... 256 7e-65
18ref|NM_112551.2| Arabidopsis thaliana structural constituent of ... 250 5e-63
19gb|AY090335.1| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, comp... 250 5e-63
20gb|AY045610.1| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, comp... 250 5e-63
21emb|Z31720.1|NTL19RIB N.tabacum (cv.Samsun NN) L19 mRNA for ribo... 236 7e-59
22gb|AC152751.22| Medicago truncatula clone mth2-18n7, complete se... 234 3e-58
23gb|AY489023.1| Capsicum annuum ribosomal protein L19 mRNA, compl... 218 2e-53
24gb|AY485789.1| Capsicum annuum 60S ribosomal protein L19 mRNA, c... 218 2e-53
25dbj|AB022217.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 216 6e-53
26ref|NM_100157.2| Arabidopsis thaliana EMB2386; structural consti... 184 2e-43
27gb|BT010178.1| Arabidopsis thaliana At1g02780/T14P4_3 mRNA, comp... 184 2e-43
28gb|AF424580.1|AF424580 Arabidopsis thaliana At1g02780/T14P4_3 mR... 184 2e-43
29emb|BX816202.1|CNS0AE3J Arabidopsis thaliana Full-length cDNA Co... 184 2e-43
30emb|BX816956.1|CNS0AD7Y Arabidopsis thaliana Full-length cDNA Co... 184 2e-43
31emb|BX816918.1|CNS0ADAO Arabidopsis thaliana Full-length cDNA Co... 184 2e-43
32emb|BX815921.1|CNS0AD0X Arabidopsis thaliana Full-length cDNA Co... 184 2e-43
33emb|BX817746.1|CNS0ACMV Arabidopsis thaliana Full-length cDNA Co... 184 2e-43
34emb|BX813821.1|CNS0AAUL Arabidopsis thaliana Full-length cDNA Co... 184 2e-43
35gb|DQ294277.1| Solanum tuberosum clone 172G04 60S ribosomal prot... 182 9e-43
36gb|AF462835.1|AF462835 Arabidopsis thaliana At1g02780/T14P4_3 mR... 176 5e-41
37emb|BX815471.1|CNS0ACXF Arabidopsis thaliana Full-length cDNA Co... 176 5e-41
38gb|AY086882.1| Arabidopsis thaliana clone 2906 mRNA, complete se... 168 1e-38
39emb|BX842172.1|CNS09YDA Arabidopsis thaliana Full-length cDNA Co... 167 5e-38
40gb|AC009525.3| Arabidopsis thaliana chromosome I BAC F22D16 geno... 163 8e-37
41dbj|D21304.1|RICSS504 Oryza sativa SS504 mRNA for ribosomal prot... 163 8e-37
42gb|AC022521.4|AC022521 Arabidopsis thaliana chromosome I BAC T14... 163 8e-37
43emb|BX816648.1|CNS0AD9N Arabidopsis thaliana Full-length cDNA Co... 151 3e-33
44emb|BX818275.1|CNS0ACJX Arabidopsis thaliana Full-length cDNA Co... 149 1e-32
45ref|NM_116456.2| Arabidopsis thaliana structural constituent of ... 145 2e-31
46gb|AY488031.1| Capsicum annuum ribosomal protein L19 mRNA, parti... 145 2e-31
47gb|AY072494.1| Arabidopsis thaliana similar to 60S ribosome prot... 145 2e-31
48gb|AF386993.1|AF386993 Arabidopsis thaliana Similar to 60S ribos... 145 2e-31
49emb|AL161494.2|ATCHRIV6 Arabidopsis thaliana DNA chromosome 4, c... 139 1e-29
50dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 139 1e-29
51gb|AF075597.1|T2H3 Arabidopsis thaliana BAC T2H3 139 1e-29
52dbj|AP004300.3| Oryza sativa (japonica cultivar-group) genomic D... 139 1e-29
53dbj|D29721.1|RICYK34 Oryza sativa mRNA, partial homologous to ri... 131 3e-27
54dbj|AK110270.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 2e-22
55ref|XM_479458.1| Oryza sativa (japonica cultivar-group), mRNA 103 7e-19
56gb|DQ066293.1| Ixodes scapularis isolate is-all-397 ribosomal pr... 94 6e-16
57emb|X74776.1|DMRPL19 D.melanogaster rpL19 gene for ribosomal pro... 86 2e-13
58gb|L32181.1|DRORPL19X Drosophila melanogaster ribosomal protein ... 86 2e-13
59gb|AY232030.1| Drosophila yakuba clone yak-ad_RpL19 mRNA sequence 78 4e-11
60ref|NM_206219.1| Drosophila melanogaster Ribosomal protein L19 C... 78 4e-11
61ref|NM_057283.4| Drosophila melanogaster Ribosomal protein L19 C... 78 4e-11
62gb|AC007884.5|AC007884 Drosophila melanogaster, chromosome 2R, r... 78 4e-11
63gb|AY061217.1| Drosophila melanogaster LD16326 full insert cDNA 78 4e-11
64gb|BT024264.1| Drosophila melanogaster IP15818 full insert cDNA 78 4e-11
65gb|AE003465.3| Drosophila melanogaster chromosome 2R, section 72... 78 4e-11
66gb|AY393838.1| Gallus gallus ribosomal protein L19 mRNA, partial... 76 1e-10
67ref|NM_001030929.1| Gallus gallus ribosomal protein L19 (RPL19),... 74 6e-10
68emb|AJ720076.1| Gallus gallus mRNA for hypothetical protein, clo... 74 6e-10
69gb|AY130357.1| Petromyzon marinus ribosomal protein L19 mRNA, pa... 74 6e-10
70gb|AF401574.1| Ictalurus punctatus ribosomal protein L19 mRNA, c... 72 2e-09
71gb|AY168759.1| Branchiostoma belcheri tsingtaunese ribosomal pro... 68 4e-08
72ref|NM_001040516.1| Bos taurus similar to ribosomal protein L19 ... 66 1e-07
73gb|BC041546.1| Xenopus laevis ribosomal protein L19, mRNA (cDNA ... 66 1e-07
74gb|BC102223.1| Bos taurus similar to ribosomal protein L19, mRNA... 66 1e-07
75ref|XM_793320.1| PREDICTED: Strongylocentrotus purpuratus simila... 64 6e-07
76gb|AY648758.1| Danio rerio 60s ribosomal protein L19 mRNA, compl... 62 2e-06
77ref|NM_213208.1| Danio rerio ribosomal protein L19 (rpl19), mRNA 62 2e-06
78emb|AM049066.1| Sphaerius sp. APV-2005 mRNA for ribosomal protei... 62 2e-06
79gb|BC062844.1| Danio rerio ribosomal protein L19, mRNA (cDNA clo... 62 2e-06
80emb|BX814021.1|CNS0ADSF Arabidopsis thaliana Full-length cDNA Co... 60 9e-06
81emb|CR725299.2|CNS0GML5 Tetraodon nigroviridis full-length cDNA 58 3e-05
82emb|CR707866.2|CNS0G952 Tetraodon nigroviridis full-length cDNA 58 3e-05
83gb|AY829780.1| Lonomia obliqua ribosomal protein L19e mRNA, part... 58 3e-05
84ref|XM_962282.1| PREDICTED: Tribolium castaneum similar to CG274... 58 3e-05
85gb|AY130453.1| Branchiostoma lanceolatum ribosomal protein L19 m... 58 3e-05
86gb|AY158223.1| Ovis aries ribosomal protein L19 gene, partial cds 58 3e-05
87emb|AL929142.6| Mouse DNA sequence from clone RP23-340A13 on chr... 58 3e-05
88emb|BX072418.1|CNS09S1I Single read from an extremity of a full-... 54 5e-04
89emb|BX072399.1|CNS09S0Z Single read from an extremity of a full-... 54 5e-04
90emb|BX072398.1|CNS09S0Y Single read from an extremity of a full-... 54 5e-04
91emb|BX072218.1|CNS09RVY Single read from an extremity of a full-... 54 5e-04
92emb|BX072217.1|CNS09RVX Single read from an extremity of a full-... 54 5e-04
93emb|BX072184.1|CNS09RV0 Single read from an extremity of a full-... 54 5e-04
94emb|BX072183.1|CNS09RUZ Single read from an extremity of a full-... 54 5e-04
95emb|BX071678.1|CNS09RGY Single read from an extremity of a full-... 54 5e-04
96emb|BX066612.1|CNS09NK8 Single read from an extremity of a full-... 54 5e-04
97emb|BX066611.1|CNS09NK7 Single read from an extremity of a full-... 54 5e-04
98emb|BX059159.1|CNS09HT7 Single read from an extremity of a full-... 54 5e-04
99emb|BX055496.1|CNS09EZG Single read from an extremity of a full-... 54 5e-04
100emb|BX054547.1|CNS09E93 Single read from an extremity of a full-... 54 5e-04
101emb|BX054546.1|CNS09E92 Single read from an extremity of a full-... 54 5e-04
102emb|BX052331.1|CNS09CJJ Single read from an extremity of a full-... 54 5e-04
103emb|BX030921.1|CNS08W0T Single read from an extremity of a full-... 54 5e-04
104emb|BX030866.1|CNS08VZA Single read from an extremity of a full-... 54 5e-04
105emb|BX041770.1|CNS094E6 Single read from an extremity of a full-... 54 5e-04
106emb|BX039610.1|CNS092Q6 Single read from an extremity of a full-... 54 5e-04
107emb|BX039182.1|CNS092EA Single read from an extremity of a full-... 54 5e-04
108emb|BX039161.1|CNS092DP Single read from an extremity of a full-... 54 5e-04
109emb|BX038823.1|CNS0924B Single read from an extremity of a full-... 54 5e-04
110emb|BX038377.1|CNS091RX Single read from an extremity of a full-... 54 5e-04
111emb|BX038376.1|CNS091RW Single read from an extremity of a full-... 54 5e-04
112emb|BX038311.1|CNS091Q3 Single read from an extremity of a full-... 54 5e-04
113emb|BX038155.1|CNS091LR Single read from an extremity of a full-... 54 5e-04
114emb|BX038154.1|CNS091LQ Single read from an extremity of a full-... 54 5e-04
115emb|BX038058.1|CNS091J2 Single read from an extremity of a full-... 54 5e-04
116emb|BX038043.1|CNS091IN Single read from an extremity of a full-... 54 5e-04
117emb|BX038006.1|CNS091HM Single read from an extremity of a full-... 54 5e-04
118emb|BX037816.1|CNS091CC Single read from an extremity of a full-... 54 5e-04
119emb|BX037762.1|CNS091AU Single read from an extremity of a full-... 54 5e-04
120emb|BX037761.1|CNS091AT Single read from an extremity of a full-... 54 5e-04
121emb|BX037665.1|CNS09185 Single read from an extremity of a full-... 54 5e-04
122emb|BX037664.1|CNS09184 Single read from an extremity of a full-... 54 5e-04
123emb|BX036410.1|CNS0909A Single read from an extremity of a full-... 54 5e-04
124emb|BX035051.1|CNS08Z7J Single read from an extremity of a full-... 54 5e-04
125emb|BX033776.1|CNS08Y84 Single read from an extremity of a full-... 54 5e-04
126emb|BX033726.1|CNS08Y6Q Single read from an extremity of a full-... 54 5e-04
127emb|BX032914.1|CNS08XK6 Single read from an extremity of a full-... 54 5e-04
128emb|BX032913.1|CNS08XK5 Single read from an extremity of a full-... 54 5e-04
129emb|BX032397.1|CNS08X5T Single read from an extremity of a full-... 54 5e-04
130emb|BX031307.1|CNS08WBJ Single read from an extremity of a full-... 54 5e-04
131emb|BX030422.1|CNS08VMY Single read from an extremity of a full-... 54 5e-04
132emb|BX030094.1|CNS08VDU Single read from an extremity of a full-... 54 5e-04
133emb|BX028661.1|CNS08UA1 Single read from an extremity of a full-... 54 5e-04
134emb|BX027462.1|CNS08TCQ Single read from an extremity of a full-... 54 5e-04
135emb|BX026971.1|CNS08SZ3 Single read from an extremity of a full-... 54 5e-04
136emb|BX026323.1|CNS08SH3 Single read from an extremity of a full-... 54 5e-04
137emb|BX026099.1|CNS08SAV Single read from an extremity of a full-... 54 5e-04
138emb|BX025970.1|CNS08S7A Single read from an extremity of a full-... 54 5e-04
139emb|BX022898.1|CNS08PTY Single read from an extremity of a full-... 54 5e-04
140emb|BX022814.1|CNS08PRM Single read from an extremity of a full-... 54 5e-04
141emb|BX024692.1|CNS08R7S Single read from an extremity of a full-... 54 5e-04
142emb|BX024544.1|CNS08R3O Single read from an extremity of a full-... 54 5e-04
143emb|BX023626.1|CNS08QE6 Single read from an extremity of a full-... 54 5e-04
144emb|BX023558.1|CNS08QCA Single read from an extremity of a full-... 54 5e-04
145emb|BX022499.1|CNS08PIV Single read from an extremity of a full-... 54 5e-04
146emb|BX020965.1|CNS08OC9 Single read from an extremity of a full-... 54 5e-04
147emb|BX020716.1|CNS08O5C Single read from an extremity of a full-... 54 5e-04
148emb|BX018850.1|CNS08MPI Single read from an extremity of a full-... 54 5e-04
149emb|BX015711.1|CNS08KAB Single read from an extremity of a full-... 54 5e-04
150emb|BX013211.1|CNS08ICV Single read from an extremity of a full-... 54 5e-04
151emb|BX011390.1|CNS08GYA Single read from an extremity of a full-... 54 5e-04
152emb|BX010223.1|CNS08G1V Single read from an extremity of a full-... 54 5e-04
153emb|BX007556.1|CNS08DZS Single read from an extremity of a full-... 54 5e-04
154emb|BX007498.1|CNS08DY6 Single read from an extremity of a full-... 54 5e-04
155emb|BX007416.1|CNS08DVW Single read from an extremity of a full-... 54 5e-04
156emb|BX007311.1|CNS08DSZ Single read from an extremity of a full-... 54 5e-04
157emb|BX007293.1|CNS08DSH Single read from an extremity of a full-... 54 5e-04
158ref|XM_313705.2| Anopheles gambiae str. PEST ENSANGP00000017616 ... 54 5e-04
159gb|AY389933.1| Latimeria chalumnae ribosomal protein L19 mRNA, p... 52 0.002
160ref|XM_549228.2| PREDICTED: Canis familiaris similar to ribosoma... 52 0.002
161ref|XR_002471.1| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.008
162ref|XM_141608.7| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.008
163ref|XM_906720.2| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.008
164ref|XR_002473.1| PREDICTED: Mus musculus hypothetical LOC631067 ... 50 0.008
165ref|XM_983446.1| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.008
166ref|XM_905487.2| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.008
167ref|XM_356705.5| PREDICTED: Mus musculus similar to ribosomal pr... 50 0.008
168ref|XM_752688.1| Ustilago maydis 521 hypothetical protein (UM016... 50 0.008
169ref|XM_572717.1| Cryptococcus neoformans var. neoformans JEC21 6... 50 0.008
170gb|AC122290.4| Mus musculus BAC clone RP23-254P19 from chromosom... 50 0.008
171emb|BX465866.13| Mouse DNA sequence from clone RP23-128L16 on ch... 50 0.008
172gb|AC171681.1| Mus musculus BAC clone RP24-530O2 from chromosome... 50 0.008
173gb|AC123611.7| Mus musculus chromosome 15, clone RP23-345H23, co... 50 0.008
174ref|XM_859015.1| PREDICTED: Canis familiaris Ribosomal protein L... 48 0.033
175ref|XM_858990.1| PREDICTED: Canis familiaris Ribosomal protein L... 48 0.033
176ref|XM_858974.1| PREDICTED: Canis familiaris Ribosomal protein L... 48 0.033
177ref|XM_537655.2| PREDICTED: Canis familiaris Ribosomal protein L... 48 0.033
178emb|AM049064.1| Curculio glandium partial mRNA for ribosomal pro... 48 0.033
179emb|BX063837.1|CNS09LF5 Single read from an extremity of a full-... 48 0.033
180emb|BX063836.1|CNS09LF4 Single read from an extremity of a full-... 48 0.033
181emb|BX059860.1|CNS09ICO Single read from an extremity of a full-... 48 0.033
182emb|BX033777.1|CNS08Y85 Single read from an extremity of a full-... 48 0.033
183emb|BX033086.1|CNS08XOY Single read from an extremity of a full-... 48 0.033
184emb|BX032398.1|CNS08X5U Single read from an extremity of a full-... 48 0.033
185emb|BX022839.1|CNS08PSB Single read from an extremity of a full-... 48 0.033
186emb|BX022610.1|CNS08PLY Single read from an extremity of a full-... 48 0.033
187emb|BX018223.1|CNS08M83 Single read from an extremity of a full-... 48 0.033
188gb|DQ122884.1| Chlamydomonas incerta mitochondrial carrier prote... 48 0.033
189gb|AC024599.9| Homo sapiens chromosome 10 clone RP11-159H3, comp... 48 0.033
190gb|AC012690.17| Homo sapiens chromosome 10 clone RP11-127B19, co... 48 0.033
191gb|AY857433.1| Suberites domuncula L19 mRNA, complete cds 48 0.033
192emb|AJ563476.1|CGI563476 Crassostrea gigas partial mRNA for ribo... 48 0.033
193gb|AC102895.7| Mus musculus chromosome 15, clone RP24-356D22, co... 48 0.033
194emb|AJ388522.1|CFA388522 Canis familiaris mRNA for partial Ribos... 48 0.033
195ref|XM_964097.1| PREDICTED: Tribolium castaneum similar to CG274... 46 0.13
196emb|BX036409.1|CNS09099 Single read from an extremity of a full-... 46 0.13
197emb|BX030095.1|CNS08VDV Single read from an extremity of a full-... 46 0.13
198emb|BX021000.1|CNS08OD8 Single read from an extremity of a full-... 46 0.13
199emb|BX019823.1|CNS08NGJ Single read from an extremity of a full-... 46 0.13
200emb|BX013212.1|CNS08ICW Single read from an extremity of a full-... 46 0.13
201gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chr... 44 0.52
202ref|XM_420503.1| PREDICTED: Gallus gallus similar to KIAA1546 pr... 44 0.52
203ref|XM_652630.1| Aspergillus nidulans FGSC A4 dynein heavy chain... 44 0.52
204emb|AM049063.1| Cicindela campestris mRNA for ribosomal protein ... 44 0.52
205emb|CR730601.2|CNS0GQOE Tetraodon nigroviridis full-length cDNA 44 0.52
206emb|CR725565.1|CNS0GMSJ Tetraodon nigroviridis full-length cDNA 44 0.52
207emb|CR701659.2|CNS0G4CN Tetraodon nigroviridis full-length cDNA 44 0.52
208emb|CR670272.2|CNS0FG5I Tetraodon nigroviridis full-length cDNA 44 0.52
209emb|CR666708.2|CNS0FDEI Tetraodon nigroviridis full-length cDNA 44 0.52
210emb|CR666702.1|CNS0FDEC Tetraodon nigroviridis full-length cDNA 44 0.52
211emb|CR665691.2|CNS0FCM9 Tetraodon nigroviridis full-length cDNA 44 0.52
212emb|CR663076.2|CNS0FALM Tetraodon nigroviridis full-length cDNA 44 0.52
213emb|AL161742.7| Human DNA sequence from clone RP4-597J3 on chrom... 44 0.52
214emb|BX056472.1|CNS09FQK Single read from an extremity of a full-... 44 0.52
215emb|BX050811.1|CNS09BDB Single read from an extremity of a full-... 44 0.52
216emb|BX039609.1|CNS092Q5 Single read from an extremity of a full-... 44 0.52
217emb|BX019178.1|CNS08MYM Single read from an extremity of a full-... 44 0.52
218emb|BX018222.1|CNS08M82 Single read from an extremity of a full-... 44 0.52
219ref|XM_578500.1| PREDICTED: Rattus norvegicus similar to novel p... 44 0.52
220gb|U03904.1|ENU03904 Emericella nidulans cytoplasmic dynein gene... 44 0.52
221ref|XM_516790.1| PREDICTED: Pan troglodytes similar to Transcrip... 42 2.1
222gb|BC083131.1| Mus musculus ribosomal protein L19, mRNA (cDNA cl... 42 2.1
223gb|AC158308.4| Mus musculus chromosome 3, clone RP23-182M12, com... 42 2.1
224gb|BC077657.1| Xenopus tropicalis MGC89675 protein, mRNA (cDNA c... 42 2.1
225gb|AY658253.1| Synthetic construct Peudomonas aeruginosa clone F... 42 2.1
226gb|BC058135.1| Rattus norvegicus ribosomal protein L19, mRNA (cD... 42 2.1
227gb|BC010710.1| Mus musculus ribosomal protein L19, mRNA (cDNA cl... 42 2.1
228ref|NM_009078.1| Mus musculus ribosomal protein L19 (Rpl19), mRNA 42 2.1
229ref|XR_005084.1| PREDICTED: Mus musculus hypothetical protein LO... 42 2.1
230ref|XR_002967.1| PREDICTED: Mus musculus hypothetical protein LO... 42 2.1
231ref|XR_001792.1| PREDICTED: Mus musculus hypothetical protein LO... 42 2.1
232ref|XM_994659.1| PREDICTED: Mus musculus similar to ribosomal pr... 42 2.1
233ref|XM_916280.2| PREDICTED: Mus musculus similar to ribosomal pr... 42 2.1
234ref|XM_001005252.1| PREDICTED: Mus musculus similar to ribosomal... 42 2.1
235ref|XM_757154.1| Ustilago maydis 521 hypothetical protein (UM061... 42 2.1
236gb|AC126807.4| Mus musculus BAC clone RP23-306D4 from chromosome... 42 2.1
237emb|CR674700.2|CNS0FJKI Tetraodon nigroviridis full-length cDNA 42 2.1
238gb|BC090329.1| Rattus norvegicus cDNA clone IMAGE:7300763, **** ... 42 2.1
239ref|XM_502020.1| Yarrowia lipolytica CLIB122, YALI0C19668g predi... 42 2.1
240emb|AL646051.19| Mouse DNA sequence from clone RP23-222M22 on ch... 42 2.1
241emb|AL646095.27| Mouse DNA sequence from clone RP23-17P18 on chr... 42 2.1
242gb|AC064800.8| Homo sapiens chromosome 18, clone CTD-2001I24, co... 42 2.1
243dbj|AK168481.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 42 2.1
244dbj|AK168232.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 42 2.1
245dbj|AK010440.1| Mus musculus ES cells cDNA, RIKEN full-length en... 42 2.1
246gb|BC089549.1| Mus musculus ribosomal protein L19, mRNA (cDNA cl... 42 2.1
247ref|NM_031103.1| Rattus norvegicus ribosomal protein L19 (Rpl19)... 42 2.1
248gb|AC102600.11| Mus musculus chromosome 3, clone RP23-376E16, co... 42 2.1
249gb|BC092539.1| Mus musculus ribosomal protein L19, mRNA (cDNA cl... 42 2.1
250ref|NM_001005122.1| Xenopus tropicalis MGC89675 protein (MGC8967... 42 2.1
251gb|AC133435.2| Homo sapiens 3 BAC RP11-343B5 (Roswell Park Cance... 42 2.1
252gb|AE004744.1| Pseudomonas aeruginosa PAO1, section 305 of 529 o... 42 2.1
253ref|XM_579004.1| PREDICTED: Rattus norvegicus similar to LRRGT00... 42 2.1
254ref|XM_228526.3| PREDICTED: Rattus norvegicus similar to ribosom... 42 2.1
255ref|XM_212869.3| PREDICTED: Rattus norvegicus similar to ribosom... 42 2.1
256dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 42 2.1
257gb|BC087961.1| Mus musculus ribosomal protein L19, mRNA (cDNA cl... 42 2.1
258emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 42 2.1
259emb|X82202.1|RNL19RP R.norvegicus RPL19 gene 42 2.1
260gb|AC121131.14| Mus musculus chromosome 8, clone RP23-187D7, com... 42 2.1
261gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge... 42 2.1
262emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB1... 42 2.1
263gb|M62952.1|MUSL19RP Mus musculus ribosomal protein L19, complet... 42 2.1
264emb|AL591209.17| Mouse DNA sequence from clone RP23-309H19 on ch... 42 2.1
265gb|AC167036.6| Mus musculus chromosome 1, clone RP23-76P9, compl... 42 2.1
266gb|J02650.1|RATRPL19 Rat ribosomal protein L19 mRNA, complete cds 42 2.1
267gb|M30264.1|RATL19RP1 Rat ribosomal protein L19 gene, partial cds 42 2.1
268ref|XM_511450.1| PREDICTED: Pan troglodytes similar to ribosomal... 40 8.1
269ref|NM_197431.1| Oryza sativa (japonica cultivar-group) hypothet... 40 8.1
270ref|NM_007252.2| Homo sapiens POU domain, class 6, transcription... 40 8.1
271gb|AY769289.1| Bombyx mori ribosomal protein L19 (RpL19) mRNA, c... 40 8.1
272gb|AC078894.11| Oryza sativa (japonica cultivar-group) chromosom... 40 8.1
273gb|BC082247.1| Homo sapiens ribosomal protein L19, mRNA (cDNA cl... 40 8.1
274gb|BT015257.1| Drosophila melanogaster LP04173 full insert cDNA 40 8.1
275ref|XM_425588.1| PREDICTED: Gallus gallus similar to insulin rec... 40 8.1
276gb|DQ443429.1| Bombyx mori PDP protein mRNA, complete cds 40 8.1
277gb|BC000530.2| Homo sapiens ribosomal protein L19, mRNA (cDNA cl... 40 8.1
278gb|AC148878.2| Chlamydomonas reinhardtii clone cr-29B2, complete... 40 8.1
279gb|AY292618.1| Oikopleura dioica 60S ribosomal protein L19 (RL19... 40 8.1
280gb|DQ379381.1| Latrodectus hesperus major ampullate spidroin 1 g... 40 8.1
281gb|AC115037.16| Mus musculus chromosome 12, clone RP24-276C17, c... 40 8.1
282gb|AF303735.4| Homo sapiens chromosome 8 clone CTD-2320G14 map q... 40 8.1
283gb|AC154422.2| Mus musculus BAC clone RP24-218O2 from chromosome... 40 8.1
284ref|XM_985864.1| PREDICTED: Mus musculus similar to ribosomal pr... 40 8.1
285ref|XM_917964.2| PREDICTED: Mus musculus similar to ribosomal pr... 40 8.1
286ref|XM_888601.2| PREDICTED: Mus musculus similar to ribosomal pr... 40 8.1
287gb|AC134439.4| Mus musculus BAC clone RP24-494I18 from chromosom... 40 8.1
288gb|AC005483.1| Homo sapiens PAC clone RP4-806A17 from 7, complet... 40 8.1
289ref|XM_534494.2| PREDICTED: Canis familiaris similar to cyclin A... 40 8.1
290gb|BC052607.1| Homo sapiens ribosomal protein L19, mRNA (cDNA cl... 40 8.1
291gb|AC123833.3| Mus musculus BAC clone RP24-127A22 from chromosom... 40 8.1
292emb|AM049061.1| Biphyllus lunatus partial mRNA for ribosomal pro... 40 8.1
293emb|CR734938.2|CNS0GTUX Tetraodon nigroviridis full-length cDNA 40 8.1
294emb|CR734860.2|CNS0GTSR Tetraodon nigroviridis full-length cDNA 40 8.1
295emb|CR734745.2|CNS0GTPK Tetraodon nigroviridis full-length cDNA 40 8.1
296emb|CR734619.2|CNS0GTM2 Tetraodon nigroviridis full-length cDNA 40 8.1
297emb|CR734317.2|CNS0GTDO Tetraodon nigroviridis full-length cDNA 40 8.1
298emb|CR734201.2|CNS0GTAG Tetraodon nigroviridis full-length cDNA 40 8.1
299emb|CR674675.2|CNS0FJJT Tetraodon nigroviridis full-length cDNA 40 8.1
300emb|CR669989.2|CNS0FFXN Tetraodon nigroviridis full-length cDNA 40 8.1
301emb|CR665304.2|CNS0FCBI Tetraodon nigroviridis full-length cDNA 40 8.1
302emb|CR663336.2|CNS0FASU Tetraodon nigroviridis full-length cDNA 40 8.1
303emb|CR679070.2|CNS0FMX6 Tetraodon nigroviridis full-length cDNA 40 8.1
304emb|CR678868.2|CNS0FMRK Tetraodon nigroviridis full-length cDNA 40 8.1
305emb|CR675606.2|CNS0FK9O Tetraodon nigroviridis full-length cDNA 40 8.1
306emb|CR733921.2|CNS0GT2O Tetraodon nigroviridis full-length cDNA 40 8.1
307emb|CR733890.2|CNS0GT1T Tetraodon nigroviridis full-length cDNA 40 8.1
308emb|CR733527.2|CNS0GSRQ Tetraodon nigroviridis full-length cDNA 40 8.1
309emb|CR733521.2|CNS0GSRK Tetraodon nigroviridis full-length cDNA 40 8.1
310emb|CR733736.2|CNS0GSXJ Tetraodon nigroviridis full-length cDNA 40 8.1
311emb|CR733705.2|CNS0GSWO Tetraodon nigroviridis full-length cDNA 40 8.1
312emb|CR733407.2|CNS0GSOO Tetraodon nigroviridis full-length cDNA 40 8.1
313emb|CR733171.2|CNS0GSL0 Tetraodon nigroviridis full-length cDNA 40 8.1
314emb|CR733146.2|CNS0GSKM Tetraodon nigroviridis full-length cDNA 40 8.1
315emb|CR732834.2|CNS0GSDY Tetraodon nigroviridis full-length cDNA 40 8.1
316emb|CR732787.2|CNS0GSCU Tetraodon nigroviridis full-length cDNA 40 8.1
317emb|CR733017.1|CNS0GSI9 Tetraodon nigroviridis full-length cDNA 40 8.1
318emb|CR733000.1|CNS0GSHV Tetraodon nigroviridis full-length cDNA 40 8.1
319emb|CR732678.2|CNS0GSA2 Tetraodon nigroviridis full-length cDNA 40 8.1
320emb|CR732624.2|CNS0GS8L Tetraodon nigroviridis full-length cDNA 40 8.1
321emb|CR732541.2|CNS0GS6A Tetraodon nigroviridis full-length cDNA 40 8.1
322emb|CR732527.2|CNS0GS5W Tetraodon nigroviridis full-length cDNA 40 8.1
323emb|CR732475.2|CNS0GS4G Tetraodon nigroviridis full-length cDNA 40 8.1
324emb|CR732352.2|CNS0GS11 Tetraodon nigroviridis full-length cDNA 40 8.1
325emb|CR732285.2|CNS0GRZ6 Tetraodon nigroviridis full-length cDNA 40 8.1
326emb|CR732550.1|CNS0GS6J Tetraodon nigroviridis full-length cDNA 40 8.1
327emb|CR732516.1|CNS0GS5L Tetraodon nigroviridis full-length cDNA 40 8.1
328emb|CR732234.2|CNS0GRXR Tetraodon nigroviridis full-length cDNA 40 8.1
329emb|CR732116.2|CNS0GRUH Tetraodon nigroviridis full-length cDNA 40 8.1
330emb|CR732086.2|CNS0GRTN Tetraodon nigroviridis full-length cDNA 40 8.1
331emb|CR732006.2|CNS0GRRF Tetraodon nigroviridis full-length cDNA 40 8.1
332emb|CR731943.2|CNS0GRPO Tetraodon nigroviridis full-length cDNA 40 8.1
333emb|CR731942.2|CNS0GRPN Tetraodon nigroviridis full-length cDNA 40 8.1
334emb|CR731863.2|CNS0GRNG Tetraodon nigroviridis full-length cDNA 40 8.1
335emb|CR731768.2|CNS0GRKT Tetraodon nigroviridis full-length cDNA 40 8.1
336emb|CR731748.2|CNS0GRK9 Tetraodon nigroviridis full-length cDNA 40 8.1
337emb|CR731913.1|CNS0GROU Tetraodon nigroviridis full-length cDNA 40 8.1
338emb|CR731709.2|CNS0GRJ6 Tetraodon nigroviridis full-length cDNA 40 8.1
339emb|CR731490.2|CNS0GRD3 Tetraodon nigroviridis full-length cDNA 40 8.1
340emb|CR731489.2|CNS0GRD2 Tetraodon nigroviridis full-length cDNA 40 8.1
341emb|CR731487.2|CNS0GRD0 Tetraodon nigroviridis full-length cDNA 40 8.1
342emb|CR731350.2|CNS0GR97 Tetraodon nigroviridis full-length cDNA 40 8.1
343emb|CR731274.2|CNS0GR73 Tetraodon nigroviridis full-length cDNA 40 8.1
344emb|CR731259.2|CNS0GR6O Tetraodon nigroviridis full-length cDNA 40 8.1
345emb|CR731697.1|CNS0GRIU Tetraodon nigroviridis full-length cDNA 40 8.1
346emb|CR731209.2|CNS0GR5A Tetraodon nigroviridis full-length cDNA 40 8.1
347emb|CR731161.2|CNS0GR3Y Tetraodon nigroviridis full-length cDNA 40 8.1
348emb|CR731122.2|CNS0GR2V Tetraodon nigroviridis full-length cDNA 40 8.1
349emb|CR731059.2|CNS0GR14 Tetraodon nigroviridis full-length cDNA 40 8.1
350emb|CR730764.2|CNS0GQSX Tetraodon nigroviridis full-length cDNA 40 8.1
351emb|CR730736.2|CNS0GQS5 Tetraodon nigroviridis full-length cDNA 40 8.1
352emb|CR730730.2|CNS0GQRZ Tetraodon nigroviridis full-length cDNA 40 8.1
353emb|CR730636.2|CNS0GQPD Tetraodon nigroviridis full-length cDNA 40 8.1
354emb|CR730453.2|CNS0GQKA Tetraodon nigroviridis full-length cDNA 40 8.1
355emb|CR730445.2|CNS0GQK2 Tetraodon nigroviridis full-length cDNA 40 8.1
356emb|CR730400.2|CNS0GQIT Tetraodon nigroviridis full-length cDNA 40 8.1
357emb|CR730359.2|CNS0GQHO Tetraodon nigroviridis full-length cDNA 40 8.1
358emb|CR730352.2|CNS0GQHH Tetraodon nigroviridis full-length cDNA 40 8.1
359emb|CR730543.1|CNS0GQMS Tetraodon nigroviridis full-length cDNA 40 8.1
360emb|CR730350.1|CNS0GQHF Tetraodon nigroviridis full-length cDNA 40 8.1
361emb|CR730237.1|CNS0GQEB Tetraodon nigroviridis full-length cDNA 40 8.1
362emb|CR730101.2|CNS0GQAJ Tetraodon nigroviridis full-length cDNA 40 8.1
363emb|CR730023.2|CNS0GQ8D Tetraodon nigroviridis full-length cDNA 40 8.1
364emb|CR729895.2|CNS0GQ4T Tetraodon nigroviridis full-length cDNA 40 8.1
365emb|CR729802.2|CNS0GQ28 Tetraodon nigroviridis full-length cDNA 40 8.1
366emb|CR729759.2|CNS0GQ11 Tetraodon nigroviridis full-length cDNA 40 8.1
367emb|CR730008.1|CNS0GQ7Y Tetraodon nigroviridis full-length cDNA 40 8.1
368emb|CR729595.2|CNS0GPWH Tetraodon nigroviridis full-length cDNA 40 8.1
369emb|CR729540.2|CNS0GPUY Tetraodon nigroviridis full-length cDNA 40 8.1
370emb|CR729523.2|CNS0GPUH Tetraodon nigroviridis full-length cDNA 40 8.1
371emb|CR729479.2|CNS0GPT9 Tetraodon nigroviridis full-length cDNA 40 8.1
372emb|CR729476.2|CNS0GPT6 Tetraodon nigroviridis full-length cDNA 40 8.1
373emb|CR729461.2|CNS0GPSR Tetraodon nigroviridis full-length cDNA 40 8.1
374emb|CR729392.2|CNS0GPQU Tetraodon nigroviridis full-length cDNA 40 8.1
375emb|CR729384.2|CNS0GPQM Tetraodon nigroviridis full-length cDNA 40 8.1
376emb|CR729353.2|CNS0GPPR Tetraodon nigroviridis full-length cDNA 40 8.1
377emb|CR729321.2|CNS0GPOV Tetraodon nigroviridis full-length cDNA 40 8.1
378emb|CR729208.2|CNS0GPLQ Tetraodon nigroviridis full-length cDNA 40 8.1
379emb|CR729126.2|CNS0GPJG Tetraodon nigroviridis full-length cDNA 40 8.1
380emb|CR729048.2|CNS0GPHA Tetraodon nigroviridis full-length cDNA 40 8.1
381emb|CR728810.2|CNS0GPAO Tetraodon nigroviridis full-length cDNA 40 8.1
382emb|CR728802.2|CNS0GPAG Tetraodon nigroviridis full-length cDNA 40 8.1
383emb|CR728751.2|CNS0GP91 Tetraodon nigroviridis full-length cDNA 40 8.1
384emb|CR728744.2|CNS0GP8U Tetraodon nigroviridis full-length cDNA 40 8.1
385emb|CR728704.2|CNS0GP7Q Tetraodon nigroviridis full-length cDNA 40 8.1
386emb|CR728853.1|CNS0GPBV Tetraodon nigroviridis full-length cDNA 40 8.1
387emb|CR728729.1|CNS0GP8F Tetraodon nigroviridis full-length cDNA 40 8.1
388emb|CR728599.2|CNS0GP4T Tetraodon nigroviridis full-length cDNA 40 8.1
389emb|CR728477.2|CNS0GP1F Tetraodon nigroviridis full-length cDNA 40 8.1
390emb|CR728401.2|CNS0GOZB Tetraodon nigroviridis full-length cDNA 40 8.1
391emb|CR728366.2|CNS0GOYC Tetraodon nigroviridis full-length cDNA 40 8.1
392emb|CR728355.2|CNS0GOY1 Tetraodon nigroviridis full-length cDNA 40 8.1
393emb|CR728273.2|CNS0GOVR Tetraodon nigroviridis full-length cDNA 40 8.1
394emb|CR728246.2|CNS0GOV0 Tetraodon nigroviridis full-length cDNA 40 8.1
395emb|CR728233.2|CNS0GOUN Tetraodon nigroviridis full-length cDNA 40 8.1
396emb|CR728363.1|CNS0GOY9 Tetraodon nigroviridis full-length cDNA 40 8.1
397emb|CR728131.2|CNS0GORT Tetraodon nigroviridis full-length cDNA 40 8.1
398emb|CR728120.2|CNS0GORI Tetraodon nigroviridis full-length cDNA 40 8.1
399emb|CR728090.2|CNS0GOQO Tetraodon nigroviridis full-length cDNA 40 8.1
400emb|CR728077.2|CNS0GOQB Tetraodon nigroviridis full-length cDNA 40 8.1
401emb|CR727845.2|CNS0GOJV Tetraodon nigroviridis full-length cDNA 40 8.1
402emb|CR727809.2|CNS0GOIV Tetraodon nigroviridis full-length cDNA 40 8.1
403emb|CR727774.2|CNS0GOHW Tetraodon nigroviridis full-length cDNA 40 8.1
404emb|CR727770.2|CNS0GOHS Tetraodon nigroviridis full-length cDNA 40 8.1
405emb|CR727768.2|CNS0GOHQ Tetraodon nigroviridis full-length cDNA 40 8.1
406emb|CR727700.2|CNS0GOFU Tetraodon nigroviridis full-length cDNA 40 8.1
407emb|CR727698.2|CNS0GOFS Tetraodon nigroviridis full-length cDNA 40 8.1
408emb|CR727855.1|CNS0GOK5 Tetraodon nigroviridis full-length cDNA 40 8.1
409emb|CR727511.2|CNS0GOAL Tetraodon nigroviridis full-length cDNA 40 8.1
410emb|CR727452.2|CNS0GO8Y Tetraodon nigroviridis full-length cDNA 40 8.1
411emb|CR727328.2|CNS0GO5I Tetraodon nigroviridis full-length cDNA 40 8.1
412emb|CR727264.2|CNS0GO3Q Tetraodon nigroviridis full-length cDNA 40 8.1
413emb|CR727230.2|CNS0GO2S Tetraodon nigroviridis full-length cDNA 40 8.1
414emb|CR727197.2|CNS0GO1V Tetraodon nigroviridis full-length cDNA 40 8.1
415emb|CR727468.1|CNS0GO9E Tetraodon nigroviridis full-length cDNA 40 8.1
416emb|CR727082.2|CNS0GNYO Tetraodon nigroviridis full-length cDNA 40 8.1
417emb|CR727060.2|CNS0GNY2 Tetraodon nigroviridis full-length cDNA 40 8.1
418emb|CR726968.2|CNS0GNVI Tetraodon nigroviridis full-length cDNA 40 8.1
419emb|CR726930.2|CNS0GNUG Tetraodon nigroviridis full-length cDNA 40 8.1
420emb|CR726905.2|CNS0GNTR Tetraodon nigroviridis full-length cDNA 40 8.1
421emb|CR726785.2|CNS0GNQF Tetraodon nigroviridis full-length cDNA 40 8.1
422emb|CR726748.2|CNS0GNPE Tetraodon nigroviridis full-length cDNA 40 8.1
423emb|CR726769.1|CNS0GNPZ Tetraodon nigroviridis full-length cDNA 40 8.1
424emb|CR726597.2|CNS0GNL7 Tetraodon nigroviridis full-length cDNA 40 8.1
425emb|CR726514.2|CNS0GNIW Tetraodon nigroviridis full-length cDNA 40 8.1
426emb|CR726461.2|CNS0GNHF Tetraodon nigroviridis full-length cDNA 40 8.1
427emb|CR726437.2|CNS0GNGR Tetraodon nigroviridis full-length cDNA 40 8.1
428emb|CR726399.2|CNS0GNFP Tetraodon nigroviridis full-length cDNA 40 8.1
429emb|CR726381.2|CNS0GNF7 Tetraodon nigroviridis full-length cDNA 40 8.1
430emb|CR726309.2|CNS0GND7 Tetraodon nigroviridis full-length cDNA 40 8.1
431emb|CR726206.2|CNS0GNAC Tetraodon nigroviridis full-length cDNA 40 8.1
432emb|CR726196.2|CNS0GNA2 Tetraodon nigroviridis full-length cDNA 40 8.1
433emb|CR726132.2|CNS0GN8A Tetraodon nigroviridis full-length cDNA 40 8.1
434emb|CR726077.2|CNS0GN6R Tetraodon nigroviridis full-length cDNA 40 8.1
435emb|CR725958.2|CNS0GN3G Tetraodon nigroviridis full-length cDNA 40 8.1
436emb|CR725938.2|CNS0GN2W Tetraodon nigroviridis full-length cDNA 40 8.1
437emb|CR725897.2|CNS0GN1R Tetraodon nigroviridis full-length cDNA 40 8.1
438emb|CR725343.2|CNS0GMMD Tetraodon nigroviridis full-length cDNA 40 8.1
439emb|CR725771.2|CNS0GMY9 Tetraodon nigroviridis full-length cDNA 40 8.1
440emb|CR725738.2|CNS0GMXC Tetraodon nigroviridis full-length cDNA 40 8.1
441emb|CR725654.2|CNS0GMV0 Tetraodon nigroviridis full-length cDNA 40 8.1
442emb|CR725159.2|CNS0GMH9 Tetraodon nigroviridis full-length cDNA 40 8.1
443emb|CR725155.2|CNS0GMH5 Tetraodon nigroviridis full-length cDNA 40 8.1
444emb|CR725112.2|CNS0GMFY Tetraodon nigroviridis full-length cDNA 40 8.1
445emb|CR725078.2|CNS0GMF0 Tetraodon nigroviridis full-length cDNA 40 8.1
446emb|CR725138.1|CNS0GMGO Tetraodon nigroviridis full-length cDNA 40 8.1
447emb|CR725006.2|CNS0GMD0 Tetraodon nigroviridis full-length cDNA 40 8.1
448emb|CR724070.2|CNS0GLN0 Tetraodon nigroviridis full-length cDNA 40 8.1
449emb|CR724338.1|CNS0GLUG Tetraodon nigroviridis full-length cDNA 40 8.1
450emb|CR724015.2|CNS0GLLH Tetraodon nigroviridis full-length cDNA 40 8.1
451emb|CR724596.2|CNS0GM1M Tetraodon nigroviridis full-length cDNA 40 8.1
452emb|CR724667.1|CNS0GM3L Tetraodon nigroviridis full-length cDNA 40 8.1
453emb|CR724565.1|CNS0GM0R Tetraodon nigroviridis full-length cDNA 40 8.1
454emb|CR724528.2|CNS0GLZQ Tetraodon nigroviridis full-length cDNA 40 8.1
455emb|CR724360.2|CNS0GLV2 Tetraodon nigroviridis full-length cDNA 40 8.1
456emb|CR724300.2|CNS0GLTE Tetraodon nigroviridis full-length cDNA 40 8.1
457emb|CR724282.2|CNS0GLSW Tetraodon nigroviridis full-length cDNA 40 8.1
458emb|CR724280.2|CNS0GLSU Tetraodon nigroviridis full-length cDNA 40 8.1
459emb|CR724253.2|CNS0GLS3 Tetraodon nigroviridis full-length cDNA 40 8.1
460emb|CR724251.2|CNS0GLS1 Tetraodon nigroviridis full-length cDNA 40 8.1
461emb|CR724205.2|CNS0GLQR Tetraodon nigroviridis full-length cDNA 40 8.1
462emb|CR724188.2|CNS0GLQA Tetraodon nigroviridis full-length cDNA 40 8.1
463emb|CR724181.2|CNS0GLQ3 Tetraodon nigroviridis full-length cDNA 40 8.1
464emb|CR724168.2|CNS0GLPQ Tetraodon nigroviridis full-length cDNA 40 8.1
465emb|CR723912.2|CNS0GLIM Tetraodon nigroviridis full-length cDNA 40 8.1
466emb|CR723911.2|CNS0GLIL Tetraodon nigroviridis full-length cDNA 40 8.1
467emb|CR723764.2|CNS0GLEI Tetraodon nigroviridis full-length cDNA 40 8.1
468emb|CR723745.2|CNS0GLDZ Tetraodon nigroviridis full-length cDNA 40 8.1
469emb|CR723671.2|CNS0GLBX Tetraodon nigroviridis full-length cDNA 40 8.1
470emb|CR723564.2|CNS0GL8Y Tetraodon nigroviridis full-length cDNA 40 8.1
471emb|CR723560.2|CNS0GL8U Tetraodon nigroviridis full-length cDNA 40 8.1
472emb|CR723534.2|CNS0GL84 Tetraodon nigroviridis full-length cDNA 40 8.1
473emb|CR723422.2|CNS0GL50 Tetraodon nigroviridis full-length cDNA 40 8.1
474emb|CR723376.2|CNS0GL3Q Tetraodon nigroviridis full-length cDNA 40 8.1
475emb|CR723358.2|CNS0GL38 Tetraodon nigroviridis full-length cDNA 40 8.1
476emb|CR723250.2|CNS0GL08 Tetraodon nigroviridis full-length cDNA 40 8.1
477emb|CR723440.1|CNS0GL5I Tetraodon nigroviridis full-length cDNA 40 8.1
478gb|AC107862.10| Mus musculus chromosome 7, clone RP23-378D16, co... 40 8.1
479ref|XM_763259.1| Giardia lamblia ATCC 50803 hypothetical protein... 40 8.1
480ref|XM_763260.1| Giardia lamblia ATCC 50803 60S ribosomal protei... 40 8.1
481emb|CR704785.2|CNS0G6RH Tetraodon nigroviridis full-length cDNA 40 8.1
482emb|CR704638.2|CNS0G6NE Tetraodon nigroviridis full-length cDNA 40 8.1
483emb|CR704437.2|CNS0G6HT Tetraodon nigroviridis full-length cDNA 40 8.1
484emb|CR704152.2|CNS0G69W Tetraodon nigroviridis full-length cDNA 40 8.1
485emb|CR704013.2|CNS0G661 Tetraodon nigroviridis full-length cDNA 40 8.1
486emb|CR703966.2|CNS0G64Q Tetraodon nigroviridis full-length cDNA 40 8.1
487emb|CR703408.2|CNS0G5P8 Tetraodon nigroviridis full-length cDNA 40 8.1
488emb|CR702969.2|CNS0G5D1 Tetraodon nigroviridis full-length cDNA 40 8.1
489emb|CR702718.2|CNS0G562 Tetraodon nigroviridis full-length cDNA 40 8.1
490emb|CR701374.2|CNS0G44Q Tetraodon nigroviridis full-length cDNA 40 8.1
491emb|CR699783.2|CNS0G2WJ Tetraodon nigroviridis full-length cDNA 40 8.1
492emb|CR700355.1|CNS0G3CF Tetraodon nigroviridis full-length cDNA 40 8.1
493emb|CR699574.2|CNS0G2QQ Tetraodon nigroviridis full-length cDNA 40 8.1
494emb|CR699486.2|CNS0G2OA Tetraodon nigroviridis full-length cDNA 40 8.1
495emb|CR699308.2|CNS0G2JC Tetraodon nigroviridis full-length cDNA 40 8.1
496emb|CR699110.2|CNS0G2DU Tetraodon nigroviridis full-length cDNA 40 8.1
497emb|CR699082.2|CNS0G2D2 Tetraodon nigroviridis full-length cDNA 40 8.1
498emb|CR698802.2|CNS0G25A Tetraodon nigroviridis full-length cDNA 40 8.1
499emb|CR698139.2|CNS0G1MV Tetraodon nigroviridis full-length cDNA 40 8.1
500emb|CR697716.2|CNS0G1B4 Tetraodon nigroviridis full-length cDNA 40 8.1

>gb|AF542969.2| Triticum aestivum ribosomal protein L19 mRNA, complete cds
          Length = 854

 Score =  872 bits (440), Expect = 0.0
 Identities = 564/602 (93%), Gaps = 13/602 (2%)
 Strand = Plus / Minus

                                                                       
Query: 1   atatttaagg-tatctgacaagttgacacaaacacgatattgcacaggnaaacagttctg 59
           |||||||||| ||| ||||| |||||||||| || || |||| |||||||||||||||||
Sbjct: 770 atatttaagggtatntgacacgttgacacaancaagaaattggacaggnaaacagttctg 711

                                                                       
Query: 60  aacttctgatgttcc-aaaattagg-ctaacccttgatgataccagnaaagctaaagctt 117
           ||||| ||||||||| ||||||||| |||||| || ||  |||||| || ||||||||||
Sbjct: 710 aacttntgatgttcccaaaattagggctaacctttcatagtaccagaaaggctaaagctt 651

                                                                       
Query: 118 caagtcagaccttcacttcttggccttctttggtgccgctgctgccggagctggagctgc 177
           || |||||| |||||||||||||||||||||||||||||         ||||||||||||
Sbjct: 650 catgtcagaacttcacttcttggccttctttggtgccgc---------agctggagctgc 600

                                                                       
Query: 178 agccgctggtgccggtgcatgatctctggggccctggg-ccaatctctcctccctcctgg 236
           |||||||||||| |||||||||||||| ||||| |||| |||||||||||||||||||||
Sbjct: 599 agccgctggtgctggtgcatgatctctcgggccntggggccaatctctcctccctcctgg 540

                                                                       
Query: 237 caatcttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtcagata 296
           |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
Sbjct: 539 caatcttcctctccctgcttgccttgctcttggcgcgcttggcctcaaactggtcagaga 480

                                                                       
Query: 297 gggtcttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctct 356
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 479 gggtcttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctct 420

                                                                       
Query: 357 tgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcga 416
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 419 tgttcttgaacatgttacctttgaccttcaggtacatgtcatggtacatgtgcttgtcga 360

                                                                       
Query: 417 tcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatcc 476
           ||||||| ||||||||||||||||||||||| |||||||| || ||||||||||||||||
Sbjct: 359 tcttcttggcctcacggtacttgcgcagaaggcgcctcaggacgcgcatcctccgcatcc 300

                                                                       
Query: 477 acaggatcttggtggggagcctagcctccctggtacccctacgcttaccatatccagagt 536
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 299 acaggatcttggtggggagcctagcctccctggtacccctacgcttaccatatccagagt 240

                                                                       
Query: 537 gacggcccttctgcttggcctcatgtgccctccttgcacgagacctggagtggatcttct 596
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 239 gacggcccttctgcttggcctcatgtgccctccttgcacgagacctggagtggatcttct 180

             
Query: 597 ga 598
           ||
Sbjct: 179 ga 178



to top

>dbj|AK102721.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033105G07, full
           insert sequence
          Length = 914

 Score =  529 bits (267), Expect = e-147
 Identities = 419/469 (89%), Gaps = 3/469 (0%)
 Strand = Plus / Minus

                                                                       
Query: 129 ttcacttcttggccttctttggtgccgctgctgccggagctggagctgcagccgctggtg 188
           |||||||||| |||||||| ||||||||||| |   |||| |||||||| || || || |
Sbjct: 720 ttcacttctttgccttcttaggtgccgctgcagtttgagcaggagctgccgctgcaggag 661

                                                                       
Query: 189 ccggtgcatgatctctggggccctgggccaatctctcctccctcctggcaatcttcctct 248
           | | ||   | ||||| |||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 660 ctgctg---gctctcttgggccctgagccaacctctcctccctcctggcaatcttcctct 604

                                                                       
Query: 249 ccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtcttctctc 308
           | | |||||||||||||||||||||||| ||||||||||||||||| || ||||||||||
Sbjct: 603 cacggcttgccttgctcttggcacgcttagcctcaaactggtcagagagtgtcttctctc 544

                                                                       
Query: 309 ttgccttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaaca 368
           |||||||||||||||| |||||||||||||| ||||| || || | ||||||||||||||
Sbjct: 543 ttgccttctcagccttagacttgtggatactttccataagaacacgcttgttcttgaaca 484

                                                                       
Query: 369 tgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctttgcct 428
           |||||||||||||||||| |||||||||||| |||||||||||||| |||||||| ||||
Sbjct: 483 tgttacccttgaccttcatgtacatgtcatgatacatgtgcttgtcaatcttcttggcct 424

                                                                       
Query: 429 cacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccacaggatcttgg 488
           |||| ||||||||||| | |||||| |||||||||||||||| |||||||||||||||||
Sbjct: 423 cacgatacttgcgcagcaaacgcctgagcacacgcatcctcctcatccacaggatcttgg 364

                                                                       
Query: 489 tggggagcctagcctccctggtacccctacgcttaccatatccagagtgacggcccttct 548
           ||||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||
Sbjct: 363 tggggagcctagcctcccttgtacccctacgcttaccatagccagagtgacgtcccttct 304

                                                            
Query: 549 gcttggcctcatgtgccctccttgcacgagacctggagtggatcttctg 597
           |||| |||||||| || |||| ||| || ||||||||||| ||||||||
Sbjct: 303 gcttagcctcatgggctctccgtgctcgggacctggagtgaatcttctg 255



to top

>dbj|AK059309.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-G06, full
           insert sequence
          Length = 1121

 Score =  529 bits (267), Expect = e-147
 Identities = 419/469 (89%), Gaps = 3/469 (0%)
 Strand = Plus / Minus

                                                                       
Query: 129 ttcacttcttggccttctttggtgccgctgctgccggagctggagctgcagccgctggtg 188
           |||||||||| |||||||| ||||||||||| |   |||| |||||||| || || || |
Sbjct: 721 ttcacttctttgccttcttaggtgccgctgcagtttgagcaggagctgccgctgcaggag 662

                                                                       
Query: 189 ccggtgcatgatctctggggccctgggccaatctctcctccctcctggcaatcttcctct 248
           | | ||   | ||||| |||||||| ||||| ||||||||||||||||||||||||||||
Sbjct: 661 ctgctg---gctctcttgggccctgagccaacctctcctccctcctggcaatcttcctct 605

                                                                       
Query: 249 ccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtcttctctc 308
           | | |||||||||||||||||||||||| ||||||||||||||||| || ||||||||||
Sbjct: 604 cacggcttgccttgctcttggcacgcttagcctcaaactggtcagagagtgtcttctctc 545

                                                                       
Query: 309 ttgccttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaaca 368
           |||||||||||||||| |||||||||||||| ||||| || || | ||||||||||||||
Sbjct: 544 ttgccttctcagccttagacttgtggatactttccataagaacacgcttgttcttgaaca 485

                                                                       
Query: 369 tgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctttgcct 428
           |||||||||||||||||| |||||||||||| |||||||||||||| |||||||| ||||
Sbjct: 484 tgttacccttgaccttcatgtacatgtcatgatacatgtgcttgtcaatcttcttggcct 425

                                                                       
Query: 429 cacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccacaggatcttgg 488
           |||| ||||||||||| | |||||| |||||||||||||||| |||||||||||||||||
Sbjct: 424 cacgatacttgcgcagcaaacgcctgagcacacgcatcctcctcatccacaggatcttgg 365

                                                                       
Query: 489 tggggagcctagcctccctggtacccctacgcttaccatatccagagtgacggcccttct 548
           ||||||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||
Sbjct: 364 tggggagcctagcctcccttgtacccctacgcttaccatagccagagtgacgtcccttct 305

                                                            
Query: 549 gcttggcctcatgtgccctccttgcacgagacctggagtggatcttctg 597
           |||| |||||||| || |||| ||| || ||||||||||| ||||||||
Sbjct: 304 gcttagcctcatgggctctccgtgctcgggacctggagtgaatcttctg 256



to top

>gb|AY103679.1| Zea mays PCO152526 mRNA sequence
          Length = 1051

 Score =  513 bits (259), Expect = e-142
 Identities = 364/399 (91%)
 Strand = Plus / Minus

                                                                       
Query: 200 tctctggggccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgcc 259
           ||||| |||||||||||||  |||||||||||||| |||||||||||||| | |||||||
Sbjct: 638 tctcttgggccctgggccagcctctcctccctcctagcaatcttcctctcacggcttgcc 579

                                                                       
Query: 260 ttgctcttggcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctca 319
           |||||||| |||||||||||||||||||| ||||| || ||||||||||| |||||||||
Sbjct: 578 ttgctctttgcacgcttggcctcaaactgatcagaaagtgtcttctctctggccttctca 519

                                                                       
Query: 320 gccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttg 379
           |||||||||||||||||||||||||| || |||||||||||||| ||||| |||||||||
Sbjct: 518 gccttggacttgtggatactctccataagcaccctcttgttcttaaacatattacccttg 459

                                                                       
Query: 380 accttcaggtacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttg 439
           ||||||| |||||||||||| ||||||||||||||||||||||| |||||||||||||||
Sbjct: 458 accttcatgtacatgtcatgatacatgtgcttgtcgatcttcttggcctcacggtacttg 399

                                                                       
Query: 440 cgcagaagacgcctcagcacacgcatcctccgcatccacaggatcttggtggggagccta 499
           || || || |||||||| ||||||||||||| ||||||||| ||||||||||||||||||
Sbjct: 398 cggagcaggcgcctcagaacacgcatcctcctcatccacagaatcttggtggggagccta 339

                                                                       
Query: 500 gcctccctggtacccctacgcttaccatatccagagtgacggcccttctgcttggcctca 559
           ||||||||||||||||| ||||| || ||||||||||| |  ||||||||||||||||||
Sbjct: 338 gcctccctggtacccctgcgcttgccgtatccagagtgccttcccttctgcttggcctca 279

                                                  
Query: 560 tgtgccctccttgcacgagacctggagtggatcttctga 598
           |||||||| |||||||| ||||| ||||| | |||||||
Sbjct: 278 tgtgcccttcttgcacgggacctagagtgaaccttctga 240



to top

>gb|BT019233.1| Zea mays clone Contig906.F mRNA sequence
          Length = 1470

 Score =  480 bits (242), Expect = e-132
 Identities = 350/386 (90%)
 Strand = Plus / Plus

                                                                       
Query: 209 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 268
           ||||||||||| |||||||||||||| || ||||||||||| | ||| ||||||||||||
Sbjct: 278 ccctgggccaacctctcctccctcctagcgatcttcctctcacggctcgccttgctcttg 337

                                                                       
Query: 269 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 328
           || ||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 338 gcgcgcttggcctcaaactggtcagaaagtgtcttctctctggccttctcagccttggac 397

                                                                       
Query: 329 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 388
           ||||||||||||||||| || |||||||||||||||||   |||||| |||||||||| |
Sbjct: 398 ttgtggatactctccataagcaccctcttgttcttgaaggcgttacctttgaccttcatg 457

                                                                       
Query: 389 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 448
           ||||||||||| |||||||||||||| |||||||| |||||||| |||||||| ||||| 
Sbjct: 458 tacatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcggagaagg 517

                                                                       
Query: 449 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 508
           |||||||||||||||||||||| ||||||||| | ||||||||| |||||||||||||||
Sbjct: 518 cgcctcagcacacgcatcctcctcatccacagaaccttggtgggtagcctagcctccctg 577

                                                                       
Query: 509 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctcatgtgccctc 568
           ||||||||||||||||||||||| ||||| || ||||| |||||||| ||||||||||| 
Sbjct: 578 gtacccctacgcttaccatatcctgagtggcgtcccttttgcttggcgtcatgtgccctt 637

                                     
Query: 569 cttgcacgagacctggagtggatctt 594
           |||||||| || || |||||||||||
Sbjct: 638 cttgcacgggatctagagtggatctt 663



to top

>gb|BT016537.1| Zea mays clone Contig370 mRNA sequence
          Length = 956

 Score =  480 bits (242), Expect = e-132
 Identities = 350/386 (90%)
 Strand = Plus / Minus

                                                                       
Query: 209 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 268
           ||||||||||| |||||||||||||| || ||||||||||| | ||| ||||||||||||
Sbjct: 738 ccctgggccaacctctcctccctcctagcgatcttcctctcacggctcgccttgctcttg 679

                                                                       
Query: 269 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 328
           || ||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 678 gcgcgcttggcctcaaactggtcagaaagtgtcttctctctggccttctcagccttggac 619

                                                                       
Query: 329 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 388
           ||||||||||||||||| || |||||||||||||||||   |||||| |||||||||| |
Sbjct: 618 ttgtggatactctccataagcaccctcttgttcttgaaggcgttacctttgaccttcatg 559

                                                                       
Query: 389 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 448
           ||||||||||| |||||||||||||| |||||||| |||||||| |||||||| ||||| 
Sbjct: 558 tacatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcggagaagg 499

                                                                       
Query: 449 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 508
           |||||||||||||||||||||| ||||||||| | ||||||||| |||||||||||||||
Sbjct: 498 cgcctcagcacacgcatcctcctcatccacagaaccttggtgggtagcctagcctccctg 439

                                                                       
Query: 509 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctcatgtgccctc 568
           ||||||||||||||||||||||| ||||| || ||||| |||||||| ||||||||||| 
Sbjct: 438 gtacccctacgcttaccatatcctgagtggcgtcccttttgcttggcgtcatgtgccctt 379

                                     
Query: 569 cttgcacgagacctggagtggatctt 594
           |||||||| || || |||||||||||
Sbjct: 378 cttgcacgggatctagagtggatctt 353



to top

>gb|AY103638.1| Zea mays PCO153348 mRNA sequence
          Length = 1258

 Score =  480 bits (242), Expect = e-132
 Identities = 350/386 (90%)
 Strand = Plus / Minus

                                                                       
Query: 209 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 268
           ||||||||||| |||||||||||||| || ||||||||||| | ||| ||||||||||||
Sbjct: 933 ccctgggccaacctctcctccctcctagcgatcttcctctcacggctcgccttgctcttg 874

                                                                       
Query: 269 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 328
           || ||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||
Sbjct: 873 gcgcgcttggcctcaaactggtcagaaagtgtcttctctctggccttctcagccttggac 814

                                                                       
Query: 329 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 388
           ||||||||||||||||| || |||||||||||||||||   |||||| |||||||||| |
Sbjct: 813 ttgtggatactctccataagcaccctcttgttcttgaaggcgttacctttgaccttcatg 754

                                                                       
Query: 389 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 448
           ||||||||||| |||||||||||||| |||||||| |||||||| |||||||| ||||| 
Sbjct: 753 tacatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcggagaagg 694

                                                                       
Query: 449 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 508
           |||||||||||||||||||||| ||||||||| | ||||||||| |||||||||||||||
Sbjct: 693 cgcctcagcacacgcatcctcctcatccacagaaccttggtgggtagcctagcctccctg 634

                                                                       
Query: 509 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctcatgtgccctc 568
           ||||||||||||||||||||||| ||||| || ||||| |||||||| ||||||||||| 
Sbjct: 633 gtacccctacgcttaccatatcctgagtggcgtcccttttgcttggcgtcatgtgccctt 574

                                     
Query: 569 cttgcacgagacctggagtggatctt 594
           |||||||| || || |||||||||||
Sbjct: 573 cttgcacgggatctagagtggatctt 548



to top

>gb|BT016919.1| Zea mays clone E04912701B11.c mRNA sequence
          Length = 974

 Score =  470 bits (237), Expect = e-129
 Identities = 354/393 (90%)
 Strand = Plus / Plus

                                                                       
Query: 206 gggccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctc 265
           |||||||||||||  || ||||||||||| | ||||||||| || | | |||||||||||
Sbjct: 329 gggccctgggccagcctttcctccctcctagaaatcttcctttcacgggttgccttgctc 388

                                                                       
Query: 266 ttggcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttg 325
           || |||||||||||||||||||| ||| | || ||||||||||| |||||||||||||||
Sbjct: 389 tttgcacgcttggcctcaaactgatcaaaaagtgtcttctctctggccttctcagccttg 448

                                                                       
Query: 326 gacttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttc 385
           |||||||||||||||||||| || |||||||||||||| ||||| |||||||||||||||
Sbjct: 449 gacttgtggatactctccataagcaccctcttgttcttaaacatattacccttgaccttc 508

                                                                       
Query: 386 aggtacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcaga 445
           | |||||||||||| |||||||||||| |||||||||| ||||||||||||||||| || 
Sbjct: 509 atgtacatgtcatgatacatgtgcttggcgatcttcttggcctcacggtacttgcggagc 568

                                                                       
Query: 446 agacgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctcc 505
           || |||||||| ||||||||||||| ||||||||| ||||||||||||||||||||||||
Sbjct: 569 aggcgcctcagaacacgcatcctcctcatccacagaatcttggtggggagcctagcctcc 628

                                                                       
Query: 506 ctggtacccctacgcttaccatatccagagtgacggcccttctgcttggcctcatgtgcc 565
           ||||||||||| ||||| |||||||||||||| |  ||||||||||||||||||||||||
Sbjct: 629 ctggtacccctgcgcttgccatatccagagtgccttcccttctgcttggcctcatgtgcc 688

                                            
Query: 566 ctccttgcacgagacctggagtggatcttctga 598
           || |||||||| ||||| ||||| | |||||||
Sbjct: 689 cttcttgcacgggacctagagtgaaccttctga 721



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  444 bits (224), Expect = e-121
 Identities = 293/316 (92%)
 Strand = Plus / Plus

                                                                            
Query: 210      cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 269
                |||| ||||| ||||||||||||||||||||||||||||| | |||||||||||||||||
Sbjct: 12517448 cctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttgctcttgg 12517507

                                                                            
Query: 270      cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 329
                ||||||| ||||||||||||||||| || |||||||||||||||||||||||||| ||||
Sbjct: 12517508 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 12517567

                                                                            
Query: 330      tgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggt 389
                |||||||||| ||||| || || | |||||||||||||||||||||||||||||||| ||
Sbjct: 12517568 tgtggatactttccataagaacacgcttgttcttgaacatgttacccttgaccttcatgt 12517627

                                                                            
Query: 390      acatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagac 449
                |||||||||| |||||||||||||| |||||||| |||||||| ||||||||||| | ||
Sbjct: 12517628 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 12517687

                                                                            
Query: 450      gcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctgg 509
                |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
Sbjct: 12517688 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctcccttg 12517747

                                
Query: 510      tacccctacgcttacc 525
                ||||||||||||||||
Sbjct: 12517748 tacccctacgcttacc 12517763



 Score =  420 bits (212), Expect = e-114
 Identities = 290/316 (91%)
 Strand = Plus / Plus

                                                                            
Query: 210      cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 269
                |||| ||||| ||||| || | |||||||||||||||||| |  || |||||||||||||
Sbjct: 21047190 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 21047249

                                                                            
Query: 270      cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 329
                ||||||| ||||||||||||||||| || |||||||||||||||||||||||||| ||||
Sbjct: 21047250 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 21047309

                                                                            
Query: 330      tgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggt 389
                |||||||||| |||||||| || | |||||||||||||||||||||||||||||||| ||
Sbjct: 21047310 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 21047369

                                                                            
Query: 390      acatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagac 449
                |||||||||| |||||||||||||| |||||||| |||||||| ||||||||||| | ||
Sbjct: 21047370 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 21047429

                                                                            
Query: 450      gcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctgg 509
                |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 21047430 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 21047489

                                
Query: 510      tacccctacgcttacc 525
                ||||||||||||||||
Sbjct: 21047490 tacccctacgcttacc 21047505



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 68/75 (90%)
 Strand = Plus / Plus

                                                                            
Query: 523      accatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct 582
                |||||| ||||||||||| |||||||||||||||||||| || |||| |||||| |||||
Sbjct: 21047582 accatagccagagtgacgtcccttctgcttggcctcatgggctctccgtgcacgggacct 21047641

                               
Query: 583      ggagtggatcttctg 597
                |||||| ||||||||
Sbjct: 21047642 ggagtgaatcttctg 21047656



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                            
Query: 523      accatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct 582
                |||||| ||||||||||| ||||||||||| |||||||| || |||| ||| || |||||
Sbjct: 12517843 accatagccagagtgacgtcccttctgcttagcctcatgggctctccgtgctcgggacct 12517902

                               
Query: 583      ggagtggatcttctg 597
                |||||| ||||||||
Sbjct: 12517903 ggagtgaatcttctg 12517917



to top

>gb|AC134885.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1125B03,
             from chromosome 3, complete sequence
          Length = 124550

 Score =  444 bits (224), Expect = e-121
 Identities = 293/316 (92%)
 Strand = Plus / Minus

                                                                         
Query: 210   cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 269
             |||| ||||| ||||||||||||||||||||||||||||| | |||||||||||||||||
Sbjct: 70493 cctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttgctcttgg 70434

                                                                         
Query: 270   cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 329
             ||||||| ||||||||||||||||| || |||||||||||||||||||||||||| ||||
Sbjct: 70433 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 70374

                                                                         
Query: 330   tgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggt 389
             |||||||||| ||||| || || | |||||||||||||||||||||||||||||||| ||
Sbjct: 70373 tgtggatactttccataagaacacgcttgttcttgaacatgttacccttgaccttcatgt 70314

                                                                         
Query: 390   acatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagac 449
             |||||||||| |||||||||||||| |||||||| |||||||| ||||||||||| | ||
Sbjct: 70313 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 70254

                                                                         
Query: 450   gcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctgg 509
             |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
Sbjct: 70253 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctcccttg 70194

                             
Query: 510   tacccctacgcttacc 525
             ||||||||||||||||
Sbjct: 70193 tacccctacgcttacc 70178



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 66/75 (88%)
 Strand = Plus / Minus

                                                                         
Query: 523   accatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct 582
             |||||| ||||||||||| ||||||||||| |||||||| || |||| ||| || |||||
Sbjct: 70098 accatagccagagtgacgtcccttctgcttagcctcatgggctctccgtgctcgggacct 70039

                            
Query: 583   ggagtggatcttctg 597
             |||||| ||||||||
Sbjct: 70038 ggagtgaatcttctg 70024



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  444 bits (224), Expect = e-121
 Identities = 293/316 (92%)
 Strand = Plus / Plus

                                                                            
Query: 210      cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 269
                |||| ||||| ||||||||||||||||||||||||||||| | |||||||||||||||||
Sbjct: 12514211 cctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttgctcttgg 12514270

                                                                            
Query: 270      cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 329
                ||||||| ||||||||||||||||| || |||||||||||||||||||||||||| ||||
Sbjct: 12514271 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 12514330

                                                                            
Query: 330      tgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggt 389
                |||||||||| ||||| || || | |||||||||||||||||||||||||||||||| ||
Sbjct: 12514331 tgtggatactttccataagaacacgcttgttcttgaacatgttacccttgaccttcatgt 12514390

                                                                            
Query: 390      acatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagac 449
                |||||||||| |||||||||||||| |||||||| |||||||| ||||||||||| | ||
Sbjct: 12514391 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 12514450

                                                                            
Query: 450      gcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctgg 509
                |||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| |
Sbjct: 12514451 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctcccttg 12514510

                                
Query: 510      tacccctacgcttacc 525
                ||||||||||||||||
Sbjct: 12514511 tacccctacgcttacc 12514526



 Score =  420 bits (212), Expect = e-114
 Identities = 290/316 (91%)
 Strand = Plus / Plus

                                                                            
Query: 210      cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 269
                |||| ||||| ||||| || | |||||||||||||||||| |  || |||||||||||||
Sbjct: 21040219 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 21040278

                                                                            
Query: 270      cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 329
                ||||||| ||||||||||||||||| || |||||||||||||||||||||||||| ||||
Sbjct: 21040279 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 21040338

                                                                            
Query: 330      tgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggt 389
                |||||||||| |||||||| || | |||||||||||||||||||||||||||||||| ||
Sbjct: 21040339 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 21040398

                                                                            
Query: 390      acatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagac 449
                |||||||||| |||||||||||||| |||||||| |||||||| ||||||||||| | ||
Sbjct: 21040399 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 21040458

                                                                            
Query: 450      gcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctgg 509
                |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 21040459 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 21040518

                                
Query: 510      tacccctacgcttacc 525
                ||||||||||||||||
Sbjct: 21040519 tacccctacgcttacc 21040534



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 68/75 (90%)
 Strand = Plus / Plus

                                                                            
Query: 523      accatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct 582
                |||||| ||||||||||| |||||||||||||||||||| || |||| |||||| |||||
Sbjct: 21040611 accatagccagagtgacgtcccttctgcttggcctcatgggctctccgtgcacgggacct 21040670

                               
Query: 583      ggagtggatcttctg 597
                |||||| ||||||||
Sbjct: 21040671 ggagtgaatcttctg 21040685



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 66/75 (88%)
 Strand = Plus / Plus

                                                                            
Query: 523      accatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct 582
                |||||| ||||||||||| ||||||||||| |||||||| || |||| ||| || |||||
Sbjct: 12514606 accatagccagagtgacgtcccttctgcttagcctcatgggctctccgtgctcgggacct 12514665

                               
Query: 583      ggagtggatcttctg 597
                |||||| ||||||||
Sbjct: 12514666 ggagtgaatcttctg 12514680



to top

>gb|AC147962.1| Oryza sativa chromosome 3 BAC OSJNBa0083K01 genomic sequence, complete
             sequence
          Length = 167239

 Score =  420 bits (212), Expect = e-114
 Identities = 290/316 (91%)
 Strand = Plus / Minus

                                                                         
Query: 210   cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 269
             |||| ||||| ||||| || | |||||||||||||||||| |  || |||||||||||||
Sbjct: 38088 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 38029

                                                                         
Query: 270   cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 329
             ||||||| ||||||||||||||||| || |||||||||||||||||||||||||| ||||
Sbjct: 38028 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 37969

                                                                         
Query: 330   tgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggt 389
             |||||||||| |||||||| || | |||||||||||||||||||||||||||||||| ||
Sbjct: 37968 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 37909

                                                                         
Query: 390   acatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagac 449
             |||||||||| |||||||||||||| |||||||| |||||||| ||||||||||| | ||
Sbjct: 37908 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 37849

                                                                         
Query: 450   gcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctgg 509
             |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 37848 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 37789

                             
Query: 510   tacccctacgcttacc 525
             ||||||||||||||||
Sbjct: 37788 tacccctacgcttacc 37773



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 68/75 (90%)
 Strand = Plus / Minus

                                                                         
Query: 523   accatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct 582
             |||||| ||||||||||| |||||||||||||||||||| || |||| |||||| |||||
Sbjct: 37696 accatagccagagtgacgtcccttctgcttggcctcatgggctctccgtgcacgggacct 37637

                            
Query: 583   ggagtggatcttctg 597
             |||||| ||||||||
Sbjct: 37636 ggagtgaatcttctg 37622



to top

>gb|AC128645.5| Oryza sativa chromosome 3 BAC OSJNBb0016P23 genomic sequence, complete
             sequence
          Length = 131250

 Score =  420 bits (212), Expect = e-114
 Identities = 290/316 (91%)
 Strand = Plus / Plus

                                                                         
Query: 210   cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 269
             |||| ||||| ||||| || | |||||||||||||||||| |  || |||||||||||||
Sbjct: 24946 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 25005

                                                                         
Query: 270   cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 329
             ||||||| ||||||||||||||||| || |||||||||||||||||||||||||| ||||
Sbjct: 25006 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 25065

                                                                         
Query: 330   tgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggt 389
             |||||||||| |||||||| || | |||||||||||||||||||||||||||||||| ||
Sbjct: 25066 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 25125

                                                                         
Query: 390   acatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagac 449
             |||||||||| |||||||||||||| |||||||| |||||||| ||||||||||| | ||
Sbjct: 25126 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 25185

                                                                         
Query: 450   gcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctgg 509
             |||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 25186 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 25245

                             
Query: 510   tacccctacgcttacc 525
             ||||||||||||||||
Sbjct: 25246 tacccctacgcttacc 25261



 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 68/75 (90%)
 Strand = Plus / Plus

                                                                         
Query: 523   accatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagacct 582
             |||||| ||||||||||| |||||||||||||||||||| || |||| |||||| |||||
Sbjct: 25338 accatagccagagtgacgtcccttctgcttggcctcatgggctctccgtgcacgggacct 25397

                            
Query: 583   ggagtggatcttctg 597
             |||||| ||||||||
Sbjct: 25398 ggagtgaatcttctg 25412



to top

>gb|BT016443.1| Zea mays clone Contig276 mRNA sequence
          Length = 779

 Score =  402 bits (203), Expect = e-109
 Identities = 350/399 (87%)
 Strand = Plus / Minus

                                                                       
Query: 200 tctctggggccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgcc 259
           ||||| |||||||||||||  ||||| |||||||| ||| |||||||||| |  || |||
Sbjct: 592 tctcttgggccctgggccagcctctcttccctcctagcattcttcctctcgcgactcgcc 533

                                                                       
Query: 260 ttgctcttggcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctca 319
           ||||||||||| ||| ||||||| ||||| || || || |||||||| || |||||||||
Sbjct: 532 ttgctcttggcgcgcctggcctcgaactgatcggagagcgtcttctccctggccttctca 473

                                                                       
Query: 320 gccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttg 379
           ||||||||||||||||| |||||||| || ||||||||||||||||||  |||||| |||
Sbjct: 472 gccttggacttgtggatgctctccataagcaccctcttgttcttgaacgagttacctttg 413

                                                                       
Query: 380 accttcaggtacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttg 439
           ||||||| |||||| || |||||||||||||||||||||||||| ||||| |||||||||
Sbjct: 412 accttcatgtacatatcgtggtacatgtgcttgtcgatcttcttggcctcgcggtacttg 353

                                                                       
Query: 440 cgcagaagacgcctcagcacacgcatcctccgcatccacaggatcttggtggggagccta 499
           || || || ||||||||||| |||||||||| ||||||||| | ||||||||||||||||
Sbjct: 352 cggagcaggcgcctcagcacgcgcatcctcctcatccacagtaccttggtggggagccta 293

                                                                       
Query: 500 gcctccctggtacccctacgcttaccatatccagagtgacggcccttctgcttggcctca 559
           |||||||||||||| |||||||| |||||||| ||||| || ||||||||||| ||||| 
Sbjct: 292 gcctccctggtacctctacgcttcccatatcctgagtgccgtcccttctgcttagcctcg 233

                                                  
Query: 560 tgtgccctccttgcacgagacctggagtggatcttctga 598
           || ||||| ||||||||||| || |||||||| ||||||
Sbjct: 232 tgcgcccttcttgcacgagatctagagtggattttctga 194



to top

>gb|AY104244.1| Zea mays PCO075323 mRNA sequence
          Length = 924

 Score =  389 bits (196), Expect = e-105
 Identities = 343/392 (87%)
 Strand = Plus / Minus

                                                                       
Query: 206 gggccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctc 265
           |||||||| |||||||||||||||||||| |||||||| ||||| | |   |||||||||
Sbjct: 626 gggccctgagccaatctctcctccctccttgcaatctttctctcacgggaagccttgctc 567

                                                                       
Query: 266 ttggcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttg 325
           ||||| ||||||||||||||||| || || || ||||||||||| |||||||| ||||| 
Sbjct: 566 ttggctcgcttggcctcaaactgatccgagagagtcttctctctggccttctcggccttt 507

                                                                       
Query: 326 gacttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttc 385
           ||||||||||| ||||||||||| |||||||| || || |||||||| || || || |||
Sbjct: 506 gacttgtggatgctctccatgagtaccctcttatttttaaacatgtttccttttactttc 447

                                                                       
Query: 386 aggtacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcaga 445
           |  ||||| || ||||||||||| |||||||| |||||||| ||||| ||||||||||| 
Sbjct: 446 atatacatatcgtggtacatgtgtttgtcgattttctttgcttcacgatacttgcgcagc 387

                                                                       
Query: 446 agacgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctcc 505
           |||||||| || ||||||||||| |||||||| |||||||||||||||||||||||||||
Sbjct: 386 agacgcctgaggacacgcatcctgcgcatccaaaggatcttggtggggagcctagcctcc 327

                                                                       
Query: 506 ctggtacccctacgcttaccatatccagagtgacggcccttctgcttggcctcatgtgcc 565
           ||||||||||| |||||||| || |||||||| |  |||||||||||||||||||| |||
Sbjct: 326 ctggtacccctgcgcttaccgtaaccagagtgcctccccttctgcttggcctcatgggcc 267

                                           
Query: 566 ctccttgcacgagacctggagtggatcttctg 597
           |||||||| || ||||| |||||||| |||||
Sbjct: 266 ctccttgcccgggaccttgagtggattttctg 235



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 129 ttcacttcttggccttctttggtgccgctgc 159
           |||||||||| |||||||||||||| |||||
Sbjct: 700 ttcacttcttcgccttctttggtgcagctgc 670



to top

>gb|AY389581.1| Hyacinthus orientalis ribosomal protein L19 (RPL19) mRNA, complete
           cds
          Length = 664

 Score =  258 bits (130), Expect = 2e-65
 Identities = 271/318 (85%)
 Strand = Plus / Minus

                                                                       
Query: 223 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
           ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||
Sbjct: 557 ctcctccctcctggcaatctttctctctctgcttgccttgctcttggcacgcttggcttc 498

                                                                       
Query: 283 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 342
           |||||| |||||||  |||||||| |||||||||||||| ||||| ||||| || |||||
Sbjct: 497 aaactgatcagatatagtcttctcccttgccttctcagctttggatttgtgaatgctctc 438

                                                                       
Query: 343 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 402
           ||| || |||||||||||||| ||||  |||||||| || |||| |||||| ||||||||
Sbjct: 437 catcagcaccctcttgttcttaaacacattacccttcactttcatgtacatatcatggta 378

                                                                       
Query: 403 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 462
           |||||| ||||| || ||||| |  || |||||||| | ||| | ||| | ||| || ||
Sbjct: 377 catgtgtttgtcaattttcttggattctcggtacttcctcagcaaacgtcgcagaactcg 318

                                                                       
Query: 463 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 522
           |||||||| |||||| || | |||||| ||||||||||| |||||||||||| | |||||
Sbjct: 317 catcctcctcatccaaagaaccttggttgggagcctagcttccctggtacccttgcgctt 258

                             
Query: 523 accatatccagagtgacg 540
            || || ||||| |||||
Sbjct: 257 tccgtagccagaatgacg 240



to top

>gb|AY089073.1| Arabidopsis thaliana clone 27978 mRNA, complete sequence
          Length = 812

 Score =  256 bits (129), Expect = 7e-65
 Identities = 294/349 (84%)
 Strand = Plus / Minus

                                                                       
Query: 209 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 268
           ||||| || ||||||||||| || ||||||| ||| ||||||||||| |||||| |||| 
Sbjct: 606 ccctgagctaatctctcctctcttctggcaaactttctctccctgctagccttgttctta 547

                                                                       
Query: 269 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 328
             |||||||||||||||||||||||  |||||||||||||| ||||||||||||||   |
Sbjct: 546 atacgcttggcctcaaactggtcagcgagggtcttctctctagccttctcagccttcatc 487

                                                                       
Query: 329 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 388
           |||||||| |||||||| || || | |||||||||||| |  |||||||| || |||| |
Sbjct: 486 ttgtggatgctctccataagcacacgcttgttcttgaaaacattacccttcactttcatg 427

                                                                       
Query: 389 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 448
           ||||||||||||||||||||| | || |||||||||| |||||||||||||| ||  | |
Sbjct: 426 tacatgtcatggtacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaa 367

                                                                       
Query: 449 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 508
           ||||||| ||| | ||| |||| |||||| || |||||||| || ||||| ||||| || 
Sbjct: 366 cgcctcaacaccctcattctcctcatccaaagaatcttggttggtagccttgcctctctt 307

                                                            
Query: 509 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcct 557
           |||||| | | |||||| |||||||||||||| |||||  |||||||||
Sbjct: 306 gtaccctttctcttaccgtatccagagtgacgaccctttcgcttggcct 258



to top

>ref|NM_112551.2| Arabidopsis thaliana structural constituent of ribosome AT3G16780
           mRNA, complete cds
          Length = 847

 Score =  250 bits (126), Expect = 5e-63
 Identities = 294/350 (84%)
 Strand = Plus / Minus

                                                                       
Query: 209 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 268
           ||||| || ||||||||||| || ||||||| ||| ||||||||||| |||||| |||| 
Sbjct: 608 ccctgagctaatctctcctctcttctggcaaactttctctccctgctagccttgttctta 549

                                                                       
Query: 269 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 328
             |||||||||||||||||||||||  || ||||||||||| ||||||||||||||   |
Sbjct: 548 atacgcttggcctcaaactggtcagcgagagtcttctctctagccttctcagccttcatc 489

                                                                       
Query: 329 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 388
           |||||||| |||||||| || || | |||||||||||| |  |||||||| || |||| |
Sbjct: 488 ttgtggatgctctccataagcacacgcttgttcttgaaaacattacccttcactttcatg 429

                                                                       
Query: 389 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 448
           ||||||||||||||||||||| | || |||||||||| |||||||||||||| ||  | |
Sbjct: 428 tacatgtcatggtacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaa 369

                                                                       
Query: 449 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 508
           ||||||| ||| | ||| |||| |||||| || |||||||| || ||||| ||||| || 
Sbjct: 368 cgcctcaacaccctcattctcctcatccaaagaatcttggttggtagccttgcctctctt 309

                                                             
Query: 509 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctc 558
           |||||| | | |||||| |||||||||||||| |||||  ||||||||||
Sbjct: 308 gtaccctttctcttaccgtatccagagtgacgaccctttcgcttggcctc 259



to top

>gb|AY090335.1| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, complete cds
          Length = 630

 Score =  250 bits (126), Expect = 5e-63
 Identities = 294/350 (84%)
 Strand = Plus / Minus

                                                                       
Query: 209 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 268
           ||||| || ||||||||||| || ||||||| ||| ||||||||||| |||||| |||| 
Sbjct: 551 ccctgagctaatctctcctctcttctggcaaactttctctccctgctagccttgttctta 492

                                                                       
Query: 269 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 328
             |||||||||||||||||||||||  || ||||||||||| ||||||||||||||   |
Sbjct: 491 atacgcttggcctcaaactggtcagcgagagtcttctctctagccttctcagccttcatc 432

                                                                       
Query: 329 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 388
           |||||||| |||||||| || || | |||||||||||| |  |||||||| || |||| |
Sbjct: 431 ttgtggatgctctccataagcacacgcttgttcttgaaaacattacccttcactttcatg 372

                                                                       
Query: 389 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 448
           ||||||||||||||||||||| | || |||||||||| |||||||||||||| ||  | |
Sbjct: 371 tacatgtcatggtacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaa 312

                                                                       
Query: 449 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 508
           ||||||| ||| | ||| |||| |||||| || |||||||| || ||||| ||||| || 
Sbjct: 311 cgcctcaacaccctcattctcctcatccaaagaatcttggttggtagccttgcctctctt 252

                                                             
Query: 509 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctc 558
           |||||| | | |||||| |||||||||||||| |||||  ||||||||||
Sbjct: 251 gtaccctttctcttaccgtatccagagtgacgaccctttcgcttggcctc 202



to top

>gb|AY045610.1| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, complete cds
          Length = 814

 Score =  250 bits (126), Expect = 5e-63
 Identities = 294/350 (84%)
 Strand = Plus / Minus

                                                                       
Query: 209 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 268
           ||||| || ||||||||||| || ||||||| ||| ||||||||||| |||||| |||| 
Sbjct: 594 ccctgagctaatctctcctctcttctggcaaactttctctccctgctagccttgttctta 535

                                                                       
Query: 269 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 328
             |||||||||||||||||||||||  || ||||||||||| ||||||||||||||   |
Sbjct: 534 atacgcttggcctcaaactggtcagcgagagtcttctctctagccttctcagccttcatc 475

                                                                       
Query: 329 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 388
           |||||||| |||||||| || || | |||||||||||| |  |||||||| || |||| |
Sbjct: 474 ttgtggatgctctccataagcacacgcttgttcttgaaaacattacccttcactttcatg 415

                                                                       
Query: 389 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 448
           ||||||||||||||||||||| | || |||||||||| |||||||||||||| ||  | |
Sbjct: 414 tacatgtcatggtacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaa 355

                                                                       
Query: 449 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 508
           ||||||| ||| | ||| |||| |||||| || |||||||| || ||||| ||||| || 
Sbjct: 354 cgcctcaacaccctcattctcctcatccaaagaatcttggttggtagccttgcctctctt 295

                                                             
Query: 509 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctc 558
           |||||| | | |||||| |||||||||||||| |||||  ||||||||||
Sbjct: 294 gtaccctttctcttaccgtatccagagtgacgaccctttcgcttggcctc 245



to top

>emb|Z31720.1|NTL19RIB N.tabacum (cv.Samsun NN) L19 mRNA for ribosomal protein L19
          Length = 1597

 Score =  236 bits (119), Expect = 7e-59
 Identities = 284/339 (83%)
 Strand = Plus / Minus

                                                                        
Query: 209  ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 268
            ||||| |||||||  ||||||||||| |||| |||||| |||||||| || ||| |||| 
Sbjct: 1347 ccctgtgccaatcgttcctccctcctagcaaacttcctttccctgctggctttgttcttt 1288

                                                                        
Query: 269  gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 328
            || | | |||||||||| || ||||| | |||||||||||| ||||| |||||||| |  
Sbjct: 1287 gccctcctggcctcaaattgatcagacaaggtcttctctctagccttttcagcctttgtt 1228

                                                                        
Query: 329  ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 388
            ||||| ||  | ||||||||||| | |||||||||||| |  |||||||| ||||||| |
Sbjct: 1227 ttgtgaatgttttccatgaggacacgcttgttcttgaaaacattacccttcaccttcatg 1168

                                                                        
Query: 389  tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 448
            ||||||||||| ||||||||| ||||||||||||| | ||| | ||||||||| || | |
Sbjct: 1167 tacatgtcatgatacatgtgcctgtcgatcttcttggactccctgtacttgcgaagcaaa 1108

                                                                        
Query: 449  cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 508
            ||||| || || | |||||||| ||||||||| | ||| || || | |||||||||||||
Sbjct: 1107 cgcctgagaactctcatcctcctcatccacagcacctttgttggcaacctagcctccctg 1048

                                                   
Query: 509  gtacccctacgcttaccatatccagagtgacggcccttc 547
            |||||| ||||||||||||||||||||||||| ||||||
Sbjct: 1047 gtacccttacgcttaccatatccagagtgacgacccttc 1009



to top

>gb|AC152751.22| Medicago truncatula clone mth2-18n7, complete sequence
          Length = 117170

 Score =  234 bits (118), Expect = 3e-58
 Identities = 235/274 (85%)
 Strand = Plus / Plus

                                                                          
Query: 241    cttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggt 300
              |||||| |||||||| |||||  |||| || | ||||||||||||||| |||||||  ||
Sbjct: 101677 cttcctttccctgctagccttattcttcgccctcttggcctcaaactgatcagataatgt 101736

                                                                          
Query: 301    cttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctcttgtt 360
              |||||| || ||||||||||||||||| ||||| ||||||||||| ||||| ||||||||
Sbjct: 101737 cttctccctagccttctcagccttggatttgtgaatactctccataaggactctcttgtt 101796

                                                                          
Query: 361    cttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatctt 420
              |||||| |  || ||||| ||||||| |||||| ||||| ||||| || ||||| |||||
Sbjct: 101797 cttgaagacatttcccttcaccttcatgtacatatcatgatacatatgtttgtcaatctt 101856

                                                                          
Query: 421    ctttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccacag 480
              ||||||||| ||||||||||| || | |||||| || |||||||| |||| |||||| ||
Sbjct: 101857 ctttgcctctcggtacttgcgaagcaaacgcctgaggacacgcattctcctcatccaaag 101916

                                                
Query: 481    gatcttggtggggagcctagcctccctggtaccc 514
              ||| |||||||||||||||||||| || ||||||
Sbjct: 101917 gattttggtggggagcctagcctctcttgtaccc 101950



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                   
Query: 522    taccatatccagagtgacggcccttctgcttggcctc 558
              ||||||||||||| ||||| ||||||  |||||||||
Sbjct: 102398 taccatatccagaatgacgtcccttcctcttggcctc 102434



to top

>gb|AY489023.1| Capsicum annuum ribosomal protein L19 mRNA, complete sequence
          Length = 719

 Score =  218 bits (110), Expect = 2e-53
 Identities = 290/350 (82%)
 Strand = Plus / Minus

                                                                       
Query: 209 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 268
           ||||| ||||| | |||||||| ||| || | |||||| || | |||||||||| |||| 
Sbjct: 564 ccctgagccaaacgctcctcccgcctagcgaacttcctttctcggcttgccttgttcttt 505

                                                                       
Query: 269 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 328
           || | | | |||||||| ||||| || | |||||||||||| |||||||||||||| | |
Sbjct: 504 gctctcctagcctcaaattggtcggacaaggtcttctctctagccttctcagcctttgtc 445

                                                                       
Query: 329 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 388
           ||||||||| | ||||| || || | |||||||||||| |  |||||||| ||||||| |
Sbjct: 444 ttgtggatattttccatcagcacacgcttgttcttgaagacattacccttcaccttcatg 385

                                                                       
Query: 389 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 448
           ||||||||||| |||||||||||||||||||||||||  || | ||||||||| || | |
Sbjct: 384 tacatgtcatgatacatgtgcttgtcgatcttctttgattccctgtacttgcgaagcaaa 325

                                                                       
Query: 449 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 508
           ||||| || || | ||| |||| |||||| || | |||||| || || ||||||||||||
Sbjct: 324 cgcctgaggactctcattctcctcatccaaagcaccttggtaggcagtctagcctccctg 265

                                                             
Query: 509 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctc 558
           |||||  | |||||||| |||||||||||||||||||||  |||||||||
Sbjct: 264 gtacctttgcgcttaccgtatccagagtgacggcccttcctcttggcctc 215



to top

>gb|AY485789.1| Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds
          Length = 831

 Score =  218 bits (110), Expect = 2e-53
 Identities = 290/350 (82%)
 Strand = Plus / Minus

                                                                       
Query: 209 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 268
           ||||| ||||| | |||||||| ||| || | |||||| || | |||||||||| |||| 
Sbjct: 577 ccctgagccaaacgctcctcccgcctagcgaacttcctttctcggcttgccttgttcttt 518

                                                                       
Query: 269 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 328
           || | | | |||||||| ||||| || | |||||||||||| |||||||||||||| | |
Sbjct: 517 gctctcctagcctcaaattggtcggacaaggtcttctctctagccttctcagcctttgtc 458

                                                                       
Query: 329 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 388
           ||||||||| | ||||| || || | |||||||||||| |  |||||||| ||||||| |
Sbjct: 457 ttgtggatattttccatcagcacacgcttgttcttgaagacattacccttcaccttcatg 398

                                                                       
Query: 389 tacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaaga 448
           ||||||||||| |||||||||||||||||||||||||  || | ||||||||| || | |
Sbjct: 397 tacatgtcatgatacatgtgcttgtcgatcttctttgattccctgtacttgcgaagcaaa 338

                                                                       
Query: 449 cgcctcagcacacgcatcctccgcatccacaggatcttggtggggagcctagcctccctg 508
           ||||| || || | ||| |||| |||||| || | |||||| || || ||||||||||||
Sbjct: 337 cgcctgaggactctcattctcctcatccaaagcaccttggtaggcagtctagcctccctg 278

                                                             
Query: 509 gtacccctacgcttaccatatccagagtgacggcccttctgcttggcctc 558
           |||||  | |||||||| |||||||||||||||||||||  |||||||||
Sbjct: 277 gtacctttgcgcttaccgtatccagagtgacggcccttcctcttggcctc 228



to top

>dbj|AB022217.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGL6
          Length = 79459

 Score =  216 bits (109), Expect = 6e-53
 Identities = 250/297 (84%)
 Strand = Plus / Minus

                                                                         
Query: 218   aatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttg 277
             ||||||||||| || ||||||| ||| ||||||||||| |||||| ||||   |||||||
Sbjct: 76034 aatctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttg 75975

                                                                         
Query: 278   gcctcaaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggata 337
             ||||||||||||||||  || ||||||||||| ||||||||||||||   ||||||||| 
Sbjct: 75974 gcctcaaactggtcagcgagagtcttctctctagccttctcagccttcatcttgtggatg 75915

                                                                         
Query: 338   ctctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtca 397
             |||||||| || || | |||||||||||| |  |||||||| || |||| ||||||||||
Sbjct: 75914 ctctccataagcacacgcttgttcttgaaaacattacccttcactttcatgtacatgtca 75855

                                                                         
Query: 398   tggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagc 457
             |||||||||||| | || |||||||||| |||||||||||||| ||  | |||||||| |
Sbjct: 75854 tggtacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaacgcctcaac 75795

                                                                      
Query: 458   acacgcatcctccgcatccacaggatcttggtggggagcctagcctccctggtaccc 514
             || | ||| |||| |||||| || |||||||| || ||||| ||||| || ||||||
Sbjct: 75794 accctcattctcctcatccaaagaatcttggttggtagccttgcctctcttgtaccc 75738



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 521   ttaccatatccagagtgacggcccttctgcttggcctc 558
             ||||| |||||||||||||| |||||  ||||||||||
Sbjct: 75636 ttaccgtatccagagtgacgaccctttcgcttggcctc 75599



to top

>ref|NM_100157.2| Arabidopsis thaliana EMB2386; structural constituent of ribosome
           AT1G02780 (EMB2386) mRNA, complete cds
          Length = 988

 Score =  184 bits (93), Expect = 2e-43
 Identities = 267/325 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
           |||||| ||||| |||  |||||| || | ||| |||||| |||| || | ||| |||||
Sbjct: 581 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 522

                                                                       
Query: 283 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 342
           |||||| ||||| || |||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 521 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 462

                                                                       
Query: 343 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 402
           ||| | ||| | ||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 461 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 402

                                                                       
Query: 403 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 462
           |||||||||||| |||||||| | ||| | ||| ||   ||  |||||||| || |||||
Sbjct: 401 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 342

                                                                       
Query: 463 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 522
           |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | |||
Sbjct: 341 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 282

                                    
Query: 523 accatatccagagtgacggcccttc 547
           ||| |||||||||||||| ||||||
Sbjct: 281 accgtatccagagtgacgacccttc 257



to top

>gb|BT010178.1| Arabidopsis thaliana At1g02780/T14P4_3 mRNA, complete cds
          Length = 645

 Score =  184 bits (93), Expect = 2e-43
 Identities = 267/325 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
           |||||| ||||| |||  |||||| || | ||| |||||| |||| || | ||| |||||
Sbjct: 537 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 478

                                                                       
Query: 283 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 342
           |||||| ||||| || |||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 477 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 418

                                                                       
Query: 343 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 402
           ||| | ||| | ||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 417 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 358

                                                                       
Query: 403 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 462
           |||||||||||| |||||||| | ||| | ||| ||   ||  |||||||| || |||||
Sbjct: 357 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 298

                                                                       
Query: 463 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 522
           |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | |||
Sbjct: 297 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 238

                                    
Query: 523 accatatccagagtgacggcccttc 547
           ||| |||||||||||||| ||||||
Sbjct: 237 accgtatccagagtgacgacccttc 213



to top

>gb|AF424580.1|AF424580 Arabidopsis thaliana At1g02780/T14P4_3 mRNA, complete cds
          Length = 897

 Score =  184 bits (93), Expect = 2e-43
 Identities = 267/325 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
           |||||| ||||| |||  |||||| || | ||| |||||| |||| || | ||| |||||
Sbjct: 580 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 521

                                                                       
Query: 283 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 342
           |||||| ||||| || |||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 520 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 461

                                                                       
Query: 343 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 402
           ||| | ||| | ||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 460 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 401

                                                                       
Query: 403 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 462
           |||||||||||| |||||||| | ||| | ||| ||   ||  |||||||| || |||||
Sbjct: 400 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 341

                                                                       
Query: 463 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 522
           |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | |||
Sbjct: 340 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 281

                                    
Query: 523 accatatccagagtgacggcccttc 547
           ||| |||||||||||||| ||||||
Sbjct: 280 accgtatccagagtgacgacccttc 256



to top

>emb|BX816202.1|CNS0AE3J Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH34ZA05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 872

 Score =  184 bits (93), Expect = 2e-43
 Identities = 267/325 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
           |||||| ||||| |||  |||||| || | ||| |||||| |||| || | ||| |||||
Sbjct: 557 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 498

                                                                       
Query: 283 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 342
           |||||| ||||| || |||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 497 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 438

                                                                       
Query: 343 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 402
           ||| | ||| | ||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 437 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 378

                                                                       
Query: 403 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 462
           |||||||||||| |||||||| | ||| | ||| ||   ||  |||||||| || |||||
Sbjct: 377 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 318

                                                                       
Query: 463 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 522
           |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | |||
Sbjct: 317 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 258

                                    
Query: 523 accatatccagagtgacggcccttc 547
           ||| |||||||||||||| ||||||
Sbjct: 257 accgtatccagagtgacgacccttc 233



to top

>emb|BX816956.1|CNS0AD7Y Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH78ZF01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 848

 Score =  184 bits (93), Expect = 2e-43
 Identities = 267/325 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
           |||||| ||||| |||  |||||| || | ||| |||||| |||| || | ||| |||||
Sbjct: 566 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 507

                                                                       
Query: 283 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 342
           |||||| ||||| || |||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 506 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 447

                                                                       
Query: 343 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 402
           ||| | ||| | ||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 446 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 387

                                                                       
Query: 403 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 462
           |||||||||||| |||||||| | ||| | ||| ||   ||  |||||||| || |||||
Sbjct: 386 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 327

                                                                       
Query: 463 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 522
           |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | |||
Sbjct: 326 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 267

                                    
Query: 523 accatatccagagtgacggcccttc 547
           ||| |||||||||||||| ||||||
Sbjct: 266 accgtatccagagtgacgacccttc 242



to top

>emb|BX816918.1|CNS0ADAO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH76ZE12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 865

 Score =  184 bits (93), Expect = 2e-43
 Identities = 267/325 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
           |||||| ||||| |||  |||||| || | ||| |||||| |||| || | ||| |||||
Sbjct: 568 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 509

                                                                       
Query: 283 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 342
           |||||| ||||| || |||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 508 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 449

                                                                       
Query: 343 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 402
           ||| | ||| | ||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 448 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 389

                                                                       
Query: 403 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 462
           |||||||||||| |||||||| | ||| | ||| ||   ||  |||||||| || |||||
Sbjct: 388 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 329

                                                                       
Query: 463 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 522
           |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | |||
Sbjct: 328 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 269

                                    
Query: 523 accatatccagagtgacggcccttc 547
           ||| |||||||||||||| ||||||
Sbjct: 268 accgtatccagagtgacgacccttc 244



to top

>emb|BX815921.1|CNS0AD0X Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH16ZH11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 813

 Score =  184 bits (93), Expect = 2e-43
 Identities = 267/325 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
           |||||| ||||| |||  |||||| || | ||| |||||| |||| || | ||| |||||
Sbjct: 563 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 504

                                                                       
Query: 283 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 342
           |||||| ||||| || |||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 503 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 444

                                                                       
Query: 343 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 402
           ||| | ||| | ||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 443 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 384

                                                                       
Query: 403 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 462
           |||||||||||| |||||||| | ||| | ||| ||   ||  |||||||| || |||||
Sbjct: 383 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 324

                                                                       
Query: 463 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 522
           |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | |||
Sbjct: 323 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 264

                                    
Query: 523 accatatccagagtgacggcccttc 547
           ||| |||||||||||||| ||||||
Sbjct: 263 accgtatccagagtgacgacccttc 239



to top

>emb|BX817746.1|CNS0ACMV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL3ZA09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 873

 Score =  184 bits (93), Expect = 2e-43
 Identities = 267/325 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
           |||||| ||||| |||  |||||| || | ||| |||||| |||| || | ||| |||||
Sbjct: 558 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 499

                                                                       
Query: 283 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 342
           |||||| ||||| || |||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 498 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 439

                                                                       
Query: 343 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 402
           ||| | ||| | ||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 438 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 379

                                                                       
Query: 403 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 462
           |||||||||||| |||||||| | ||| | ||| ||   ||  |||||||| || |||||
Sbjct: 378 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 319

                                                                       
Query: 463 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 522
           |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | |||
Sbjct: 318 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 259

                                    
Query: 523 accatatccagagtgacggcccttc 547
           ||| |||||||||||||| ||||||
Sbjct: 258 accgtatccagagtgacgacccttc 234



to top

>emb|BX813821.1|CNS0AAUL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZA10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 885

 Score =  184 bits (93), Expect = 2e-43
 Identities = 267/325 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
           |||||| ||||| |||  |||||| || | ||| |||||| |||| || | ||| |||||
Sbjct: 564 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 505

                                                                       
Query: 283 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 342
           |||||| ||||| || |||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 504 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 445

                                                                       
Query: 343 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 402
           ||| | ||| | ||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 444 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 385

                                                                       
Query: 403 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 462
           |||||||||||| |||||||| | ||| | ||| ||   ||  |||||||| || |||||
Sbjct: 384 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 325

                                                                       
Query: 463 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 522
           |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | |||
Sbjct: 324 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 265

                                    
Query: 523 accatatccagagtgacggcccttc 547
           ||| |||||||||||||| ||||||
Sbjct: 264 accgtatccagagtgacgacccttc 240



to top

>gb|DQ294277.1| Solanum tuberosum clone 172G04 60S ribosomal protein L19-like
           protein mRNA, complete cds
          Length = 759

 Score =  182 bits (92), Expect = 9e-43
 Identities = 272/332 (81%)
 Strand = Plus / Minus

                                                                       
Query: 227 tccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctcaaac 286
           |||||||| |||| ||| || || |||||||||||| |||| || | | | |||||||| 
Sbjct: 543 tccctccttgcaaactttctttctctgcttgccttgttctttgccctcctagcctcaaat 484

                                                                       
Query: 287 tggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctccatg 346
           ||||| || | |||||||||||| || ||||||||||| | |||||||||| | ||||| 
Sbjct: 483 tggtcggacaaggtcttctctctagctttctcagcctttgtcttgtggatattttccatc 424

                                                                       
Query: 347 aggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatg 406
           || || | |||||||||||| |  |||||||| ||||||| |||||||||||| ||||||
Sbjct: 423 agcacacgcttgttcttgaaaacattacccttcaccttcatgtacatgtcatgatacatg 364

                                                                       
Query: 407 tgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcatc 466
           || ||||| ||||||||||  || |  |||||||| || | |||||| || || | ||  
Sbjct: 363 tgtttgtcaatcttctttgattccctatacttgcgaagcaaacgcctgaggactctcaat 304

                                                                       
Query: 467 ctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgcttacca 526
           |||| |||||| || | |||||| || || |||||||||||||||||  | |||||||||
Sbjct: 303 ctcctcatccaaagcaccttggtaggcagtctagcctccctggtacctttgcgcttacca 244

                                           
Query: 527 tatccagagtgacggcccttctgcttggcctc 558
           ||||||||||||||||| |||  |||||||||
Sbjct: 243 tatccagagtgacggcctttcctcttggcctc 212



to top

>gb|AF462835.1|AF462835 Arabidopsis thaliana At1g02780/T14P4_3 mRNA, complete cds
          Length = 847

 Score =  176 bits (89), Expect = 5e-41
 Identities = 266/325 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
           |||||| ||||| |||  |||||| || | ||| |||||| |||| || | ||| |||||
Sbjct: 580 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 521

                                                                       
Query: 283 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 342
           |||||| ||||| || |||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 520 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 461

                                                                       
Query: 343 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 402
           ||| | ||| | ||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 460 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 401

                                                                       
Query: 403 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 462
           |||||||||||| |||||||| | ||| | ||| ||   ||  |||||||| || |||||
Sbjct: 400 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 341

                                                                       
Query: 463 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 522
           |||||| ||||||||||| | ||| || || | |||||| || | |||| || | | |||
Sbjct: 340 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtagccttcctctt 281

                                    
Query: 523 accatatccagagtgacggcccttc 547
           ||| |||||||||||||| ||||||
Sbjct: 280 accgtatccagagtgacgacccttc 256



to top

>emb|BX815471.1|CNS0ACXF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS63ZB09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 870

 Score =  176 bits (89), Expect = 5e-41
 Identities = 266/325 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
           |||||| ||||| |||  |||||| || | ||| |||||| |||| || | ||| |||||
Sbjct: 566 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 507

                                                                       
Query: 283 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 342
           |||||| ||||| || |||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 506 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 447

                                                                       
Query: 343 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 402
           ||| | ||| | ||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 446 catcaagacacgcttgttcttgaacacattacccttcacacgcatgtacatgtcatggta 387

                                                                       
Query: 403 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 462
           ||||||||| || |||||||| | ||| | ||| ||   ||  |||||||| || |||||
Sbjct: 386 catgtgcttctcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 327

                                                                       
Query: 463 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 522
           |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | |||
Sbjct: 326 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 267

                                    
Query: 523 accatatccagagtgacggcccttc 547
           ||| |||||||||||||| ||||||
Sbjct: 266 accgtatccagagtgacgacccttc 242



to top

>gb|AY086882.1| Arabidopsis thaliana clone 2906 mRNA, complete sequence
          Length = 898

 Score =  168 bits (85), Expect = 1e-38
 Identities = 265/325 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
           |||||| ||||| |||  |||||| || | ||| |||||| |||| || | ||| |||||
Sbjct: 581 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 522

                                                                       
Query: 283 aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 342
             |||| ||||| || |||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 521 ctactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 462

                                                                       
Query: 343 catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 402
           ||| | ||| | ||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 461 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 402

                                                                       
Query: 403 catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 462
           |||||||||||| |||||||| | ||| | ||| ||   ||  |||||||| || |||||
Sbjct: 401 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 342

                                                                       
Query: 463 catcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgctt 522
           |||||| ||||||||||| | ||| || || | |||||| || | ||||||| | | |||
Sbjct: 341 catcctacgcatccacagtacctttgttggcaacctagcttcacgggtacccttcctctt 282

                                    
Query: 523 accatatccagagtgacggcccttc 547
           ||| |||||||||||||| ||||||
Sbjct: 281 accgtatccagagtgacgacccttc 257



to top

>emb|BX842172.1|CNS09YDA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL16ZB09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 729

 Score =  167 bits (84), Expect = 5e-38
 Identities = 294/356 (82%), Gaps = 6/356 (1%)
 Strand = Plus / Minus

                                                                       
Query: 209 ccctgggccaatctctcctccctcctggcaatc-ttcctctccctgcttgccttgctctt 267
           ||||| || ||||||||||| || ||||||| | || ||||||||||| |||||| ||||
Sbjct: 590 ccctgagctaatctctcctctcttctggcaaacatttctctccctgctagccttgttctt 531

                                                                       
Query: 268 ggcacgcttggcctcaaactggtcagatagggtcttctctcttgcctt-ctcagcctt-g 325
              |||||||||||||||||||||||  || ||||||||||| ||||| |||||||||  
Sbjct: 530 aatacgcttggcctcaaactggtcagcgagagtcttctctctagccttactcagccttca 471

                                                                       
Query: 326 gacttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttc 385
             ||||||||| |||||||| || || | |||||||||||| |  |||||||| || |||
Sbjct: 470 tccttgtggatgctctccataagcacacgcttgttcttgaaaacattacccttcactttc 411

                                                                       
Query: 386 aggtacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtacttgcgc-ag 444
           | |||||||||||||||||||||| | || |||||||||| |||||||||||||| | ||
Sbjct: 410 atgtacatgtcatggtacatgtgcctatcaatcttctttgactcacggtacttgctcaag 351

                                                                       
Query: 445 aagacgcctcagcacacgcatcctcc-gcatc-cacaggatcttggtggggagcctagcc 502
           ||   |||||| ||| | ||| ||||  |||| || || |||||||| || ||||| |||
Sbjct: 350 aaacagcctcaacaccctcattctccatcatcacaaagaatcttggttggtagccttgcc 291

                                                                   
Query: 503 tccctggtacccctacgcttaccatatccagagtgacggcccttctgcttggcctc 558
           || || |||||| | | |||||| |||||||||||||| |||||  ||||||||||
Sbjct: 290 tctcttgtaccctttctcttaccgtatccagagtgacgaccctttcgcttggcctc 235



to top

>gb|AC009525.3| Arabidopsis thaliana chromosome I BAC F22D16 genomic sequence, complete
             sequence
          Length = 100239

 Score =  163 bits (82), Expect = 8e-37
 Identities = 214/258 (82%)
 Strand = Plus / Minus

                                                                         
Query: 223   ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
             |||||| ||||| |||  |||||| || | ||| |||||| |||| || | ||| |||||
Sbjct: 84067 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 84008

                                                                         
Query: 283   aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 342
             |||||| ||||| || |||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 84007 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 83948

                                                                         
Query: 343   catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 402
             ||| | ||| | ||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 83947 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 83888

                                                                         
Query: 403   catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 462
             |||||||||||| |||||||| | ||| | ||| ||   ||  |||||||| || |||||
Sbjct: 83887 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 83828

                               
Query: 463   catcctccgcatccacag 480
             |||||| |||||||||||
Sbjct: 83827 catcctacgcatccacag 83810



to top

>dbj|D21304.1|RICSS504 Oryza sativa SS504 mRNA for ribosomal protein L19, partial sequence
          Length = 153

 Score =  163 bits (82), Expect = 8e-37
 Identities = 125/141 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 gcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtcttctctcttgc 312
           ||||||||||||||||||| |||| |||| |||||||||||| || |||||||  |||||
Sbjct: 146 gcttgccttgctcttggcaagcttagcctnaaactggtcagagagtgtcttctnncttgc 87

                                                                       
Query: 313 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 372
           ||||||||||||  ||||||||||||| ||||| || ||   ||||||||||||||||||
Sbjct: 86  cttctcagccttanacttgtggatactttccataagaacangcttgttcttgaacatgtt 27

                                
Query: 373 acccttgaccttcaggtacat 393
           |||||||||||||| ||||||
Sbjct: 26  acccttgaccttcatgtacat 6



to top

>gb|AC022521.4|AC022521 Arabidopsis thaliana chromosome I BAC T14P4 genomic sequence,
            complete sequence
          Length = 121668

 Score =  163 bits (82), Expect = 8e-37
 Identities = 214/258 (82%)
 Strand = Plus / Minus

                                                                        
Query: 223  ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
            |||||| ||||| |||  |||||| || | ||| |||||| |||| || | ||| |||||
Sbjct: 9427 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 9368

                                                                        
Query: 283  aaactggtcagatagggtcttctctcttgccttctcagccttggacttgtggatactctc 342
            |||||| ||||| || |||||||| || |||||||||||||| |||||||||||||||||
Sbjct: 9367 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 9308

                                                                        
Query: 343  catgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatggta 402
            ||| | ||| | ||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 9307 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 9248

                                                                        
Query: 403  catgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacg 462
            |||||||||||| |||||||| | ||| | ||| ||   ||  |||||||| || |||||
Sbjct: 9247 catgtgcttgtcaatcttcttcgtctctctgtatttcttcaacagacgcctaagaacacg 9188

                              
Query: 463  catcctccgcatccacag 480
            |||||| |||||||||||
Sbjct: 9187 catcctacgcatccacag 9170



to top

>emb|BX816648.1|CNS0AD9N Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH60ZC04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 819

 Score =  151 bits (76), Expect = 3e-33
 Identities = 239/292 (81%), Gaps = 1/292 (0%)
 Strand = Plus / Minus

                                                                       
Query: 257 gccttgctcttggcacgcttggcctcaaactggtcagatagggtcttctctcttgccttc 316
           |||||| |||| || | ||| ||||||||||| ||||| || |||||||| || ||||||
Sbjct: 468 gccttgttcttcgccctcttagcctcaaactgatcagacagagtcttctccctagccttc 409

                                                                       
Query: 317 tcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgttaccc 376
           |||||||| |||||||||||||||||||| | ||| | ||||||||||||||  ||||||
Sbjct: 408 tcagcctttgacttgtggatactctccatcaagacacgcttgttcttgaacacattaccc 349

                                                                       
Query: 377 ttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtac 436
           || ||   || |||||||||||||||||||||||| |  |||||||| | ||| | ||| 
Sbjct: 348 ttaacacgcatgtacatgtcatggtacatgtgcttataaatcttcttcgtctctctgtat 289

                                                                       
Query: 437 ttgcgcagaagacgcctcagcacacgcatcctccgcatccacaggatcttggtggggagc 496
           ||   ||  |||||||| || ||||||||||| ||||||||||| | ||| || || | |
Sbjct: 288 ttcttcaacagacgcctaagaacacgcatcctacgcatccacagtacctttgttggcaac 229

                                                               
Query: 497 ctagcctccctggtacccctacgcttaccatatccag-agtgacggcccttc 547
           ||||| || | ||||||| | | |||||| ||||||| ||||||| ||||||
Sbjct: 228 ctagcttcacgggtacccttcctcttaccgtatccagcagtgacgacccttc 177



to top

>emb|BX818275.1|CNS0ACJX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL6ZG09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 830

 Score =  149 bits (75), Expect = 1e-32
 Identities = 237/291 (81%)
 Strand = Plus / Minus

                                                                       
Query: 257 gccttgctcttggcacgcttggcctcaaactggtcagatagggtcttctctcttgccttc 316
           |||||| |||| || | ||| ||||||||||| ||||| || |||||||| || ||||||
Sbjct: 532 gccttgttcttcgccctcttagcctcaaactgatcagacagagtcttctccctagccttc 473

                                                                       
Query: 317 tcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgttaccc 376
           |||||||| |||||||||||||||||||| | ||  | ||||||||||||||  ||||||
Sbjct: 472 tcagcctttgacttgtggatactctccatcaagagacgcttgttcttgaacacattaccc 413

                                                                       
Query: 377 ttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctttgcctcacggtac 436
           || ||   || ||||||||||||||||||||||||||| |||||||| | ||| | ||| 
Sbjct: 412 ttcacacgcatgtacatgtcatggtacatgtgcttgtcaatcttcttcgtctctctgtat 353

                                                                       
Query: 437 ttgcgcagaagacgcctcagcacacgcatcctccgcatccacaggatcttggtggggagc 496
           ||   ||  |||||||| || |||||||| |  ||||||||||| | ||| || || | |
Sbjct: 352 ttcttcaacagacgcctaagaacacgcatgcgacgcatccacagtacctttgttggcaac 293

                                                              
Query: 497 ctagcctccctggtacccctacgcttaccatatccagagtgacggcccttc 547
           ||||| || | ||||||| | | |||||| |||||||||| ||| ||||||
Sbjct: 292 ctagcttcacgggtacccttcctcttaccgtatccagagttacgacccttc 242



to top

>ref|NM_116456.2| Arabidopsis thaliana structural constituent of ribosome AT4G02230
           mRNA, complete cds
          Length = 816

 Score =  145 bits (73), Expect = 2e-31
 Identities = 247/305 (80%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtc 301
           |||||||| | ||| |||||| |||| || | ||| ||||||||||||||||| |  |||
Sbjct: 545 ttcctctctcggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtc 486

                                                                       
Query: 302 ttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctcttgttc 361
           |||||||| ||||||||||||||||| ||||| ||||| ||||| |  || | |||||||
Sbjct: 485 ttctctctagccttctcagccttggatttgtgaatactttccatcaacacacgcttgttc 426

                                                                       
Query: 362 ttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttc 421
           ||||| | ||| |||||||| |||| |||||||||||||||||| ||  |||| ||||||
Sbjct: 425 ttgaagacgtttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttc 366

                                                                       
Query: 422 tttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccacagg 481
           || | ||| |  |||||   ||  |||||||||||||| | |||||||| ||||||||  
Sbjct: 365 ttggtctccctatacttcttcaacagacgcctcagcactctcatcctcctcatccacaaa 306

                                                                       
Query: 482 atcttggtggggagcctagcctccctggtacccctacgcttaccatatccagagtgacgg 541
           |  || || || | ||| ||||| | ||||||| | | ||||||||| ||||||||||| 
Sbjct: 305 acttttgttggcaaccttgcctctcgggtacccttcctcttaccataaccagagtgacgt 246

                
Query: 542 ccctt 546
           |||||
Sbjct: 245 ccctt 241



to top

>gb|AY488031.1| Capsicum annuum ribosomal protein L19 mRNA, partial sequence
          Length = 526

 Score =  145 bits (73), Expect = 2e-31
 Identities = 181/217 (83%)
 Strand = Plus / Minus

                                                                       
Query: 209 ccctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttg 268
           ||||| ||||| | |||||||| ||| || | |||||| || | |||||||||| |||| 
Sbjct: 271 ccctgagccaaacgctcctcccgcctagcgaacttcctttctcggcttgccttgttcttt 212

                                                                       
Query: 269 gcacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggac 328
           || | | | |||||||| ||||| || | |||||||||||| |||||||||||||| | |
Sbjct: 211 gctctcctagcctcaaattggtcggacaaggtcttctctctagccttctcagcctttgtc 152

                                                                       
Query: 329 ttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcagg 388
           ||||||||| | ||||| || || | |||||||||||| |  |||||||| ||||||| |
Sbjct: 151 ttgtggatattttccatcagcacacgcttgttcttgaagacattacccttcaccttcatg 92

                                                
Query: 389 tacatgtcatggtacatgtgcttgtcgatcttctttg 425
           ||||||||||| ||| |||||||||||||||||||||
Sbjct: 91  tacatgtcatgatacgtgtgcttgtcgatcttctttg 55



to top

>gb|AY072494.1| Arabidopsis thaliana similar to 60S ribosome protein L19
           (At4g02230; T2H3.3) mRNA, complete cds
          Length = 677

 Score =  145 bits (73), Expect = 2e-31
 Identities = 247/305 (80%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtc 301
           |||||||| | ||| |||||| |||| || | ||| ||||||||||||||||| |  |||
Sbjct: 518 ttcctctctcggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtc 459

                                                                       
Query: 302 ttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctcttgttc 361
           |||||||| ||||||||||||||||| ||||| ||||| ||||| |  || | |||||||
Sbjct: 458 ttctctctagccttctcagccttggatttgtgaatactttccatcaacacacgcttgttc 399

                                                                       
Query: 362 ttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttc 421
           ||||| | ||| |||||||| |||| |||||||||||||||||| ||  |||| ||||||
Sbjct: 398 ttgaagacgtttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttc 339

                                                                       
Query: 422 tttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccacagg 481
           || | ||| |  |||||   ||  |||||||||||||| | |||||||| ||||||||  
Sbjct: 338 ttggtctccctatacttcttcaacagacgcctcagcactctcatcctcctcatccacaaa 279

                                                                       
Query: 482 atcttggtggggagcctagcctccctggtacccctacgcttaccatatccagagtgacgg 541
           |  || || || | ||| ||||| | ||||||| | | ||||||||| ||||||||||| 
Sbjct: 278 acttttgttggcaaccttgcctctcgggtacccttcctcttaccataaccagagtgacgt 219

                
Query: 542 ccctt 546
           |||||
Sbjct: 218 ccctt 214



to top

>gb|AF386993.1|AF386993 Arabidopsis thaliana Similar to 60S ribosome protein L19 (T2H3.3)
           mRNA, complete cds
          Length = 804

 Score =  145 bits (73), Expect = 2e-31
 Identities = 247/305 (80%)
 Strand = Plus / Minus

                                                                       
Query: 242 ttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtc 301
           |||||||| | ||| |||||| |||| || | ||| ||||||||||||||||| |  |||
Sbjct: 545 ttcctctctcggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtc 486

                                                                       
Query: 302 ttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctcttgttc 361
           |||||||| ||||||||||||||||| ||||| ||||| ||||| |  || | |||||||
Sbjct: 485 ttctctctagccttctcagccttggatttgtgaatactttccatcaacacacgcttgttc 426

                                                                       
Query: 362 ttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttc 421
           ||||| | ||| |||||||| |||| |||||||||||||||||| ||  |||| ||||||
Sbjct: 425 ttgaagacgtttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttc 366

                                                                       
Query: 422 tttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccacagg 481
           || | ||| |  |||||   ||  |||||||||||||| | |||||||| ||||||||  
Sbjct: 365 ttggtctccctatacttcttcaacagacgcctcagcactctcatcctcctcatccacaaa 306

                                                                       
Query: 482 atcttggtggggagcctagcctccctggtacccctacgcttaccatatccagagtgacgg 541
           |  || || || | ||| ||||| | ||||||| | | ||||||||| ||||||||||| 
Sbjct: 305 acttttgttggcaaccttgcctctcgggtacccttcctcttaccataaccagagtgacgt 246

                
Query: 542 ccctt 546
           |||||
Sbjct: 245 ccctt 241



to top

>emb|AL161494.2|ATCHRIV6 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 6
          Length = 194892

 Score =  139 bits (70), Expect = 1e-29
 Identities = 196/238 (82%)
 Strand = Plus / Plus

                                                                         
Query: 242   ttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtc 301
             |||||||| | ||| |||||| |||| || | ||| ||||||||||||||||| |  |||
Sbjct: 15234 ttcctctctcggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtc 15293

                                                                         
Query: 302   ttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctcttgttc 361
             |||||||| ||||||||||||||||| ||||| ||||| ||||| |  || | |||||||
Sbjct: 15294 ttctctctagccttctcagccttggatttgtgaatactttccatcaacacacgcttgttc 15353

                                                                         
Query: 362   ttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttc 421
             ||||| | ||| |||||||| |||| |||||||||||||||||| ||  |||| ||||||
Sbjct: 15354 ttgaagacgtttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttc 15413

                                                                       
Query: 422   tttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccaca 479
             || | ||| |  |||||   ||  |||||||||||||| | |||||||| ||||||||
Sbjct: 15414 ttggtctccctatacttcttcaacagacgcctcagcactctcatcctcctcatccaca 15471



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  139 bits (70), Expect = 1e-29
 Identities = 165/194 (85%), Gaps = 2/194 (1%)
 Strand = Plus / Minus

                                                                            
Query: 210      cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 269
                |||| ||||| ||||||| |||||||| ||||||||| ||   ||||||| |||||||||
Sbjct: 28305978 cctgagccaacctctcctacctcctggaaatcttcctttcttggcttgccatgctcttgg 28305919

                                                                            
Query: 270      cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 329
                || ||||||| ||||||||||| || || ||  |||  || || ||||||| |||| |||
Sbjct: 28305918 caagcttggcttcaaactggtcggaaagagttctcttcctagctttctcag-cttgcact 28305860

                                                                            
Query: 330      tgtggatactctccatgagg-accctcttgttcttgaacatgttacccttgaccttcagg 388
                |||||||||||||||| |||  |||||||||| |||| ||||||||||||||||||||  
Sbjct: 28305859 tgtggatactctccataaggtcccctcttgttgttgagcatgttacccttgaccttcatt 28305800

                              
Query: 389      tacatgtcatggta 402
                ||||||||||||||
Sbjct: 28305799 tacatgtcatggta 28305786



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 48/55 (87%), Gaps = 1/55 (1%)
 Strand = Plus / Minus

                                                                       
Query: 463      catcctccgcatccacaggatcttggtggggagcctagcctccctggtaccccta 517
                |||||||| ||||||||| |||||||| ||||| | | ||||||||| |||||||
Sbjct: 28305712 catcctcctcatccacagaatcttggt-gggagtccaccctccctggaaccccta 28305659



to top

>gb|AF075597.1|T2H3 Arabidopsis thaliana BAC T2H3
          Length = 48689

 Score =  139 bits (70), Expect = 1e-29
 Identities = 196/238 (82%)
 Strand = Plus / Minus

                                                                         
Query: 242   ttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtcagatagggtc 301
             |||||||| | ||| |||||| |||| || | ||| ||||||||||||||||| |  |||
Sbjct: 37044 ttcctctctcggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtc 36985

                                                                         
Query: 302   ttctctcttgccttctcagccttggacttgtggatactctccatgaggaccctcttgttc 361
             |||||||| ||||||||||||||||| ||||| ||||| ||||| |  || | |||||||
Sbjct: 36984 ttctctctagccttctcagccttggatttgtgaatactttccatcaacacacgcttgttc 36925

                                                                         
Query: 362   ttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttc 421
             ||||| | ||| |||||||| |||| |||||||||||||||||| ||  |||| ||||||
Sbjct: 36924 ttgaagacgtttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttc 36865

                                                                       
Query: 422   tttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcatccaca 479
             || | ||| |  |||||   ||  |||||||||||||| | |||||||| ||||||||
Sbjct: 36864 ttggtctccctatacttcttcaacagacgcctcagcactctcatcctcctcatccaca 36807



to top

>dbj|AP004300.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0470D12
          Length = 157248

 Score =  139 bits (70), Expect = 1e-29
 Identities = 165/194 (85%), Gaps = 2/194 (1%)
 Strand = Plus / Minus

                                                                         
Query: 210   cctgggccaatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttgg 269
             |||| ||||| ||||||| |||||||| ||||||||| ||   ||||||| |||||||||
Sbjct: 31541 cctgagccaacctctcctacctcctggaaatcttcctttcttggcttgccatgctcttgg 31482

                                                                         
Query: 270   cacgcttggcctcaaactggtcagatagggtcttctctcttgccttctcagccttggact 329
             || ||||||| ||||||||||| || || ||  |||  || || ||||||| |||| |||
Sbjct: 31481 caagcttggcttcaaactggtcggaaagagttctcttcctagctttctcag-cttgcact 31423

                                                                         
Query: 330   tgtggatactctccatgagg-accctcttgttcttgaacatgttacccttgaccttcagg 388
             |||||||||||||||| |||  |||||||||| |||| ||||||||||||||||||||  
Sbjct: 31422 tgtggatactctccataaggtcccctcttgttgttgagcatgttacccttgaccttcatt 31363

                           
Query: 389   tacatgtcatggta 402
             ||||||||||||||
Sbjct: 31362 tacatgtcatggta 31349



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 48/55 (87%), Gaps = 1/55 (1%)
 Strand = Plus / Minus

                                                                    
Query: 463   catcctccgcatccacaggatcttggtggggagcctagcctccctggtaccccta 517
             |||||||| ||||||||| |||||||| ||||| | | ||||||||| |||||||
Sbjct: 31275 catcctcctcatccacagaatcttggt-gggagtccaccctccctggaaccccta 31222



to top

>dbj|D29721.1|RICYK34 Oryza sativa mRNA, partial homologous to ribosomal protein L19 gene
          Length = 369

 Score =  131 bits (66), Expect = 3e-27
 Identities = 169/199 (84%), Gaps = 6/199 (3%)
 Strand = Plus / Plus

                                                                       
Query: 129 ttcacttcttggccttctttggtgccgctgctgccggagctggagctgcagccgctggtg 188
           |||||||||| |||||||| ||||||||||| |   |||| |||||||| || || || |
Sbjct: 170 ttcacttctttgccttcttaggtgccgctgcagtttgagcaggagctgccgctgcaggag 229

                                                                       
Query: 189 ccggtgcatgatctctggggccctgggccaatctctcctccctcctggcaatcttcctct 248
           | | ||   | ||||| |||||||| ||||| ||||||| ||||||||||||||||||||
Sbjct: 230 ctgctg---gctctcttgggccctgagccaacctctcctncctcctggcaatcttcctct 286

                                                                       
Query: 249 c-cctgcttgccttgctcttggcacgcttggcctcaaac-tggtcagatagggtcttctc 306
           | |  | |||||||||||||||||||||| ||||||||| |||||||| || ||||||||
Sbjct: 287 cacgggtttgccttgctcttggcacgcttagcctcaaacttggtcagagagtgtcttctc 346

                              
Query: 307 tctt-gccttctcagcctt 324
           |||| ||||||||||||||
Sbjct: 347 tcttggccttctcagcctt 365



to top

>dbj|AK110270.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-C08, full
           insert sequence
          Length = 1089

 Score =  115 bits (58), Expect = 2e-22
 Identities = 109/126 (86%)
 Strand = Plus / Minus

                                                                       
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatg 399
           ||||||||| || | |||||||||||| | ||||||||||||||||| ||| |  || ||
Sbjct: 499 ctccatgagcacacgcttgttcttgaagacgttacccttgaccttcatgtagagctcgtg 440

                                                                       
Query: 400 gtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcac 459
           ||||  |||||||||||||||||| ||||||||||||||||| ||||| | ||| |||||
Sbjct: 439 gtacgagtgcttgtcgatcttcttggcctcacggtacttgcggagaagcctcctgagcac 380

                 
Query: 460 acgcat 465
           ||||||
Sbjct: 379 acgcat 374



to top

>ref|XM_479458.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 165

 Score =  103 bits (52), Expect = 7e-19
 Identities = 132/156 (84%), Gaps = 2/156 (1%)
 Strand = Plus / Minus

                                                                       
Query: 232 cctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctcaaactggtc 291
           ||||| ||||||||| ||   ||||||| ||||||||||| ||||||| |||||||||||
Sbjct: 156 cctggaaatcttcctttcttggcttgccatgctcttggcaagcttggcttcaaactggtc 97

                                                                       
Query: 292 agatagggtcttctctcttgccttctcagccttggacttgtggatactctccatgagg-a 350
            || || ||  |||  || || ||||||| |||| ||||||||||||||||||| |||  
Sbjct: 96  ggaaagagttctcttcctagctttctcag-cttgcacttgtggatactctccataaggtc 38

                                               
Query: 351 ccctcttgttcttgaacatgttacccttgaccttca 386
           |||||||||| |||| ||||||||||||||||||||
Sbjct: 37  ccctcttgttgttgagcatgttacccttgaccttca 2



to top

>gb|DQ066293.1| Ixodes scapularis isolate is-all-397 ribosomal protein L19 mRNA,
           complete cds
          Length = 597

 Score = 93.7 bits (47), Expect = 6e-16
 Identities = 86/99 (86%)
 Strand = Plus / Minus

                                                                       
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatg 399
           |||||||||||| | |||||||||||||| ||| |||||  |||||| ||||| ||||||
Sbjct: 420 ctccatgaggacacgcttgttcttgaacacgttgcccttagccttcaagtacaggtcatg 361

                                                  
Query: 400 gtacatgtgcttgtcgatcttctttgcctcacggtactt 438
           ||||| ||||||||||||||| || ||||| | ||||||
Sbjct: 360 gtacaggtgcttgtcgatctttttggcctccctgtactt 322



to top

>emb|X74776.1|DMRPL19 D.melanogaster rpL19 gene for ribosomal protein L19
          Length = 1022

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 94/111 (84%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 372
           ||||||||||||   |||||||||   |||||||||||| | |||||||||||||| |||
Sbjct: 788 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaacacgtt 729

                                                              
Query: 373 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 423
           |||||||  ||||| ||||| ||| ||||||| |||| |||| ||||||||
Sbjct: 728 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 678



to top

>gb|L32181.1|DRORPL19X Drosophila melanogaster ribosomal protein L19 mRNA
          Length = 723

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 94/111 (84%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 372
           ||||||||||||   |||||||||   |||||||||||| | |||||||||||||| |||
Sbjct: 466 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaacacgtt 407

                                                              
Query: 373 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 423
           |||||||  ||||| ||||| ||| ||||||| |||| |||| ||||||||
Sbjct: 406 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 356



to top

>gb|AY232030.1| Drosophila yakuba clone yak-ad_RpL19 mRNA sequence
          Length = 582

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 93/111 (83%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 372
           ||||||||||||   |||||||||   |||||| ||||| | |||||||||||||| |||
Sbjct: 447 cttctcagccttcttcttgtggatgtactccatcaggacgcgcttgttcttgaacacgtt 388

                                                              
Query: 373 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 423
           |||||||  ||||| ||||| ||| ||||||| |||| |||| ||||||||
Sbjct: 387 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 337



to top

>ref|NM_206219.1| Drosophila melanogaster Ribosomal protein L19 CG2746-RB, transcript
           variant B (RpL19), mRNA
          Length = 751

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 93/111 (83%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 372
           ||||||||||||   |||||||||   |||||||||||| | |||||||||||| | |||
Sbjct: 479 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaatacgtt 420

                                                              
Query: 373 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 423
           |||||||  ||||| ||||| ||| ||||||| |||| |||| ||||||||
Sbjct: 419 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 369



to top

>ref|NM_057283.4| Drosophila melanogaster Ribosomal protein L19 CG2746-RA, transcript
           variant A (RpL19), mRNA
          Length = 793

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 93/111 (83%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 372
           ||||||||||||   |||||||||   |||||||||||| | |||||||||||| | |||
Sbjct: 521 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaatacgtt 462

                                                              
Query: 373 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 423
           |||||||  ||||| ||||| ||| ||||||| |||| |||| ||||||||
Sbjct: 461 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 411



to top

>gb|AC007884.5|AC007884 Drosophila melanogaster, chromosome 2R, region 60F-60F, BAC clone
              BACR08I14, complete sequence
          Length = 190616

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 93/111 (83%)
 Strand = Plus / Plus

                                                                          
Query: 313    cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 372
              ||||||||||||   |||||||||   |||||||||||| | |||||||||||| | |||
Sbjct: 129009 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaatacgtt 129068

                                                                 
Query: 373    acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 423
              |||||||  ||||| ||||| ||| ||||||| |||| |||| ||||||||
Sbjct: 129069 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 129119



to top

>gb|AY061217.1| Drosophila melanogaster LD16326 full insert cDNA
          Length = 793

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 93/111 (83%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 372
           ||||||||||||   |||||||||   |||||||||||| | |||||||||||| | |||
Sbjct: 503 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaatacgtt 444

                                                              
Query: 373 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 423
           |||||||  ||||| ||||| ||| ||||||| |||| |||| ||||||||
Sbjct: 443 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 393



to top

>gb|BT024264.1| Drosophila melanogaster IP15818 full insert cDNA
          Length = 748

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 93/111 (83%)
 Strand = Plus / Minus

                                                                       
Query: 313 cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 372
           ||||||||||||   |||||||||   |||||||||||| | |||||||||||| | |||
Sbjct: 463 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaatacgtt 404

                                                              
Query: 373 acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 423
           |||||||  ||||| ||||| ||| ||||||| |||| |||| ||||||||
Sbjct: 403 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 353



to top

>gb|AE003465.3| Drosophila melanogaster chromosome 2R, section 72 of 73 of the complete
              sequence
          Length = 343833

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 93/111 (83%)
 Strand = Plus / Plus

                                                                          
Query: 313    cttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtt 372
              ||||||||||||   |||||||||   |||||||||||| | |||||||||||| | |||
Sbjct: 281313 cttctcagccttcttcttgtggatgtactccatgaggacgcgcttgttcttgaatacgtt 281372

                                                                 
Query: 373    acccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctt 423
              |||||||  ||||| ||||| ||| ||||||| |||| |||| ||||||||
Sbjct: 281373 acccttgcacttcatgtacaggtcgtggtacaggtgcctgtcaatcttctt 281423



to top

>gb|AY393838.1| Gallus gallus ribosomal protein L19 mRNA, partial cds
          Length = 523

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 113/138 (81%)
 Strand = Plus / Minus

                                                                       
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatg 399
           |||||| |||| || |||||||||||||| ||||||||||||||||||||||| |   ||
Sbjct: 397 ctccatcaggatccgcttgttcttgaacacgttacccttgaccttcaggtacaggctgtg 338

                                                                       
Query: 400 gtacatgtgcttgtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcac 459
           |||||| ||   |||||||||||| | ||| | |||  |||| || |||||||| || | 
Sbjct: 337 gtacatatggcggtcgatcttcttggactccctgtatctgcggagcagacgcctgagaat 278

                             
Query: 460 acgcatcctccgcatcca 477
            |||||||||| ||||||
Sbjct: 277 ccgcatcctcctcatcca 260



to top

>ref|NM_001030929.1| Gallus gallus ribosomal protein L19 (RPL19), mRNA
          Length = 706

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||| |||| || |||||||||||||| |||||||||||||||||||||||
Sbjct: 452 ctccatcaggatccgcttgttcttgaacacgttacccttgaccttcaggtaca 400



to top

>emb|AJ720076.1| Gallus gallus mRNA for hypothetical protein, clone 10e3
          Length = 706

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 49/53 (92%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||| |||| || |||||||||||||| |||||||||||||||||||||||
Sbjct: 452 ctccatcaggatccgcttgttcttgaacacgttacccttgaccttcaggtaca 400



to top

>gb|AY130357.1| Petromyzon marinus ribosomal protein L19 mRNA, partial cds
          Length = 539

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 103/125 (82%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||| || || ||||||||||  |  |||||||||||    ||
Sbjct: 379 cttgttcttgaacacgttacctttcactttcaggtacagattgtggtacatgtggcgatc 320

                                                                       
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcatcctccgcat 474
           ||||||||| ||||| |||||||||||||| ||||| | ||| |  ||||| | ||||||
Sbjct: 319 gatcttcttggcctcgcggtacttgcgcaggagacggcgcagaatccgcatgcgccgcat 260

                
Query: 475 ccaca 479
           |||||
Sbjct: 259 ccaca 255



to top

>gb|AF401574.1| Ictalurus punctatus ribosomal protein L19 mRNA, complete cds
          Length = 640

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 72/84 (85%)
 Strand = Plus / Minus

                                                                       
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatg 399
           |||||||||||  | |||||||||||||| |||||| ||| || ||||||||| |   ||
Sbjct: 430 ctccatgaggatacgcttgttcttgaacacgttacctttggccctcaggtacaggctgtg 371

                                   
Query: 400 gtacatgtgcttgtcgatcttctt 423
           |||||||||| |||||||||||||
Sbjct: 370 gtacatgtgcctgtcgatcttctt 347



to top

>gb|AY168759.1| Branchiostoma belcheri tsingtaunese ribosomal protein L19 mRNA,
           complete cds
          Length = 728

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 76/90 (84%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||| |||||| |||||  |  |||||||  ||||||||
Sbjct: 435 cttgttcttgaacacgttacccttggccttcatgtacagctggtggtacagatgcttgtc 376

                                         
Query: 415 gatcttctttgcctcacggtacttgcgcag 444
           ||| ||||| | ||||||||| || |||||
Sbjct: 375 gattttcttggactcacggtatttccgcag 346



to top

>ref|NM_001040516.1| Bos taurus similar to ribosomal protein L19 (LOC510615), mRNA
          Length = 754

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 328 cttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcag 387
           ||||||||||   |||||||||| || |||||| ||||||| ||||||||| ||||||||
Sbjct: 466 cttgtggatatgttccatgaggatccgcttgtttttgaacacgttacccttcaccttcag 407

                
Query: 388 gtaca 392
           |||||
Sbjct: 406 gtaca 402



to top

>gb|BC041546.1| Xenopus laevis ribosomal protein L19, mRNA (cDNA clone MGC:53844
           IMAGE:5542707), complete cds
          Length = 688

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| ||||||||| || |||||||||| |   |||||||||||| ||||
Sbjct: 412 cttgttcttgaacacgttaccctttactttcaggtacaggctgtggtacatgtgcctgtc 353

                    
Query: 415 gatcttctt 423
            ||||||||
Sbjct: 352 aatcttctt 344



to top

>gb|BC102223.1| Bos taurus similar to ribosomal protein L19, mRNA (cDNA clone
           MGC:127270 IMAGE:7946447), complete cds
          Length = 754

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                       
Query: 328 cttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcag 387
           ||||||||||   |||||||||| || |||||| ||||||| ||||||||| ||||||||
Sbjct: 466 cttgtggatatgttccatgaggatccgcttgtttttgaacacgttacccttcaccttcag 407

                
Query: 388 gtaca 392
           |||||
Sbjct: 406 gtaca 402



to top

>ref|XM_793320.1| PREDICTED: Strongylocentrotus purpuratus similar to CG2746-PA,
           isoform A (LOC593861), mRNA
          Length = 1296

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                       
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatg 399
           ||||||||| || | |||||||||||| |  |||||||||||||||| |||||  || ||
Sbjct: 441 ctccatgagaacacgcttgttcttgaagacattacccttgaccttcatgtacagctcgtg 382

                                   
Query: 400 gtacatgtgcttgtcgatcttctt 423
           |||||  ||| |||||||||||||
Sbjct: 381 gtacagatgcctgtcgatcttctt 358



to top

>gb|AY648758.1| Danio rerio 60s ribosomal protein L19 mRNA, complete cds
          Length = 701

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  || |||| |||| |   |||||||||||| ||||
Sbjct: 435 cttgttcttgaacacgttaccctttgccctcagatacaggctgtggtacatgtgcctgtc 376

                          
Query: 415 gatcttctttgcctc 429
           ||||||||| |||||
Sbjct: 375 gatcttcttggcctc 361



to top

>ref|NM_213208.1| Danio rerio ribosomal protein L19 (rpl19), mRNA
          Length = 762

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  || |||| |||| |   |||||||||||| ||||
Sbjct: 429 cttgttcttgaacacgttaccctttgccctcagatacaggctgtggtacatgtgcctgtc 370

                          
Query: 415 gatcttctttgcctc 429
           ||||||||| |||||
Sbjct: 369 gatcttcttggcctc 355



to top

>emb|AM049066.1| Sphaerius sp. APV-2005 mRNA for ribosomal protein L19e (rpL19e
           gene)
          Length = 600

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 106/131 (80%)
 Strand = Plus / Minus

                                                                       
Query: 311 gccttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatg 370
           |||||||| |||||   |||||||||   |||||| ||||| |  ||||||||||||| |
Sbjct: 449 gccttctccgccttcttcttgtggatgtactccatcaggacgcgtttgttcttgaacacg 390

                                                                       
Query: 371 ttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatcttctttgcctca 430
           ||||||||  |||||| |||||   ||||||| | |||| ||||||| ||||| || | |
Sbjct: 389 ttacccttcgccttcatgtacagcgcatggtagaggtgcctgtcgattttcttcgcttga 330

                      
Query: 431 cggtacttgcg 441
           |||||||||||
Sbjct: 329 cggtacttgcg 319



to top

>gb|BC062844.1| Danio rerio ribosomal protein L19, mRNA (cDNA clone MGC:77733
           IMAGE:7000768), complete cds
          Length = 762

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  || |||| |||| |   |||||||||||| ||||
Sbjct: 429 cttgttcttgaacacgttaccctttgccctcagatacaggctgtggtacatgtgcctgtc 370

                          
Query: 415 gatcttctttgcctc 429
           ||||||||| |||||
Sbjct: 369 gatcttcttggcctc 355



to top

>emb|BX814021.1|CNS0ADSF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB52ZE12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 425

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 84/102 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcctc 282
           |||||| ||||| |||  |||||| || | ||| |||||| |||| || | ||| |||||
Sbjct: 110 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 51

                                                     
Query: 283 aaactggtcagatagggtcttctctcttgccttctcagcctt 324
           |||||| ||||| || |||||||| || ||||||||||||||
Sbjct: 50  aaactgatcagacagagtcttctccctagccttctcagcctt 9



to top

>emb|CR725299.2|CNS0GML5 Tetraodon nigroviridis full-length cDNA
          Length = 337

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           ||||||||| ||||  ||||||||| |||||||||||| |   |||||||||||| ||||
Sbjct: 85  cttgttcttaaacacattacccttggccttcaggtacaggctgtggtacatgtgcctgtc 26

                    
Query: 415 gatcttctt 423
            ||||||||
Sbjct: 25  aatcttctt 17



to top

>emb|CR707866.2|CNS0G952 Tetraodon nigroviridis full-length cDNA
          Length = 335

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           ||||||||| ||||  ||||||||| |||||||||||| |   |||||||||||| ||||
Sbjct: 85  cttgttcttaaacacattacccttggccttcaggtacaggctgtggtacatgtgcctgtc 26

                    
Query: 415 gatcttctt 423
            ||||||||
Sbjct: 25  aatcttctt 17



to top

>gb|AY829780.1| Lonomia obliqua ribosomal protein L19e mRNA, partial cds
          Length = 333

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||||||| | ||||||||||||||  |||||||| ||||||| |||||
Sbjct: 150 ctccatgaggacacgcttgttcttgaacacattacccttcaccttcatgtaca 98



to top

>ref|XM_962282.1| PREDICTED: Tribolium castaneum similar to CG2746-PA, isoform A
           (LOC655723), mRNA
          Length = 685

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           ||||||||||||||||||||||||||| | |||||| ||  |||||| |||||
Sbjct: 454 ctccatgaggaccctcttgttcttgaagacgttacctttcgccttcatgtaca 402



to top

>gb|AY130453.1| Branchiostoma lanceolatum ribosomal protein L19 mRNA, partial cds
          Length = 588

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 59/69 (85%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |||||| |||||  |  |||||||  ||||||||
Sbjct: 405 cttgttcttgaacacgttacccttcgccttcatgtacagctggtggtacagatgcttgtc 346

                    
Query: 415 gatcttctt 423
           |||||||||
Sbjct: 345 gatcttctt 337



to top

>gb|AY158223.1| Ovis aries ribosomal protein L19 gene, partial cds
          Length = 522

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 328 cttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcag 387
           ||||||||||   |||||||| | || |||||| ||||||| ||||||||| ||||||||
Sbjct: 376 cttgtggatatgttccatgagaatccgcttgtttttgaacacgttacccttcaccttcag 317

                
Query: 388 gtaca 392
           |||||
Sbjct: 316 gtaca 312



to top

>emb|AL929142.6| Mouse DNA sequence from clone RP23-340A13 on chromosome 2, complete
              sequence
          Length = 207823

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                          
Query: 328    cttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttgaccttcag 387
              ||||||||||  ||||||||||| || |||||| |||||||  || || |||||||||||
Sbjct: 185122 cttgtggatatgctccatgaggatccacttgtttttgaacacattccctttgaccttcag 185063

                   
Query: 388    gtaca 392
              |||||
Sbjct: 185062 gtaca 185058



to top

>emb|BX072418.1|CNS09S1I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 615

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285



to top

>emb|BX072399.1|CNS09S0Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 530

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285



to top

>emb|BX072398.1|CNS09S0Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 637

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 458 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 399

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 398 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 348



to top

>emb|BX072218.1|CNS09RVY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 468

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtactttttcagcagacgacgcagcacacgcat 285



to top

>emb|BX072217.1|CNS09RVX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 712

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 460 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 401

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 400 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 350



to top

>emb|BX072184.1|CNS09RV0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285



to top

>emb|BX072183.1|CNS09RUZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 615

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 455 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 396

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 395 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 345



to top

>emb|BX071678.1|CNS09RGY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 745

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 248 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 307

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 308 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 358



to top

>emb|BX066612.1|CNS09NK8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 636 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 695

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 696 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 746



to top

>emb|BX066611.1|CNS09NK7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 442 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 383

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 382 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 332



to top

>emb|BX059159.1|CNS09HT7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 673

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285



to top

>emb|BX055496.1|CNS09EZG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 771

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 441 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 382

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 381 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 331



to top

>emb|BX054547.1|CNS09E93 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 675

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285



to top

>emb|BX054546.1|CNS09E92 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 443 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 384

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 383 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 333



to top

>emb|BX052331.1|CNS09CJJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 437 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 378

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 377 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 327



to top

>emb|BX030921.1|CNS08W0T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 430 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 371

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 370 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 320



to top

>emb|BX030866.1|CNS08VZA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 434 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 375

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 374 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 324



to top

>emb|BX041770.1|CNS094E6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 436 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 377

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 376 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 326



to top

>emb|BX039610.1|CNS092Q6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 291

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285



to top

>emb|BX039182.1|CNS092EA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 653

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285



to top

>emb|BX039161.1|CNS092DP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 310

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285



to top

>emb|BX038823.1|CNS0924B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 662

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 457 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 398

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 397 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 347



to top

>emb|BX038377.1|CNS091RX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 609

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285



to top

>emb|BX038376.1|CNS091RW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 734

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 443 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 384

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 383 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 333



to top

>emb|BX038311.1|CNS091Q3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 454 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 395

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 394 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 344



to top

>emb|BX038155.1|CNS091LR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 339

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtactttttcagcagacgacgcagcacacgcat 285



to top

>emb|BX038154.1|CNS091LQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 750

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 464 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 405

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 404 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 354



to top

>emb|BX038058.1|CNS091J2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2BB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 683

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 455 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 396

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 395 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 345



to top

>emb|BX038043.1|CNS091IN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 756

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 456 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 397

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 396 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 346



to top

>emb|BX038006.1|CNS091HM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2AG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 746

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 456 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 397

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 396 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 346



to top

>emb|BX037816.1|CNS091CC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 601

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 463 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 404

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 403 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 353



to top

>emb|BX037762.1|CNS091AU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 535

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285



to top

>emb|BX037761.1|CNS091AT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 649

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 455 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 396

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 395 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 345



to top

>emb|BX037665.1|CNS09185 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 551

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285



to top

>emb|BX037664.1|CNS09184 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 634

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 459 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 400

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 399 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 349



to top

>emb|BX036410.1|CNS0909A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 680

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285



to top

>emb|BX035051.1|CNS08Z7J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 616

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 428 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 369

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 368 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 318



to top

>emb|BX033776.1|CNS08Y84 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5BF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 748

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 429 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 370

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 369 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 319



to top

>emb|BX033726.1|CNS08Y6Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 757

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 444 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 385

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 384 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 334



to top

>emb|BX032914.1|CNS08XK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 645

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285



to top

>emb|BX032913.1|CNS08XK5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 736

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 427 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 368

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 367 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 317



to top

>emb|BX032397.1|CNS08X5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 464

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 393 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 334

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 333 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 283



to top

>emb|BX031307.1|CNS08WBJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 439 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 380

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 379 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 329



to top

>emb|BX030422.1|CNS08VMY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 742

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 428 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 369

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 368 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 318



to top

>emb|BX030094.1|CNS08VDU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 745

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 430 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 371

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 370 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 320



to top

>emb|BX028661.1|CNS08UA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 431 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 372

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 371 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 321



to top

>emb|BX027462.1|CNS08TCQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 515

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 445 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 386

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 385 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 335



to top

>emb|BX026971.1|CNS08SZ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 525

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 207 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 148

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 147 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 97



to top

>emb|BX026323.1|CNS08SH3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 618

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 432 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 373

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 372 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 322



to top

>emb|BX026099.1|CNS08SAV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 746

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 437 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 378

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 377 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 327



to top

>emb|BX025970.1|CNS08S7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 424 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 365

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 364 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 314



to top

>emb|BX022898.1|CNS08PTY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 631

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 448 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 389

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 388 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 338



to top

>emb|BX022814.1|CNS08PRM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 624

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 449 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 390

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 389 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 339



to top

>emb|BX024692.1|CNS08R7S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 433 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 374

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 373 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 323



to top

>emb|BX024544.1|CNS08R3O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 403 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 344

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 343 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 293



to top

>emb|BX023626.1|CNS08QE6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 771

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 441 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 382

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 381 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 331



to top

>emb|BX023558.1|CNS08QCA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 768

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 442 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 383

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 382 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 332



to top

>emb|BX022499.1|CNS08PIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 705

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 392 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 333

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 332 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 282



to top

>emb|BX020965.1|CNS08OC9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 636

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 445 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 386

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 385 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 335



to top

>emb|BX020716.1|CNS08O5C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 659

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 437 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 378

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 377 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 327



to top

>emb|BX018850.1|CNS08MPI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 744

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 425 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 366

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 365 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 315



to top

>emb|BX015711.1|CNS08KAB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 449

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 439 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 380

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 379 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 329



to top

>emb|BX013211.1|CNS08ICV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 745

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 431 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 372

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 371 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 321



to top

>emb|BX011390.1|CNS08GYA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 663

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 439 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 380

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 379 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 329



to top

>emb|BX010223.1|CNS08G1V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 523

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 216 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 157

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 156 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 106



to top

>emb|BX007556.1|CNS08DZS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 769

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 448 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 389

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 388 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 338



to top

>emb|BX007498.1|CNS08DY6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 434 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 375

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 374 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 324



to top

>emb|BX007416.1|CNS08DVW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 507

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 183 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 124

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 123 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 73



to top

>emb|BX007311.1|CNS08DSZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 659

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 337 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 278

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 277 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 227



to top

>emb|BX007293.1|CNS08DSH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12AH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 737

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 423 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 364

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 363 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 313



to top

>ref|XM_313705.2| Anopheles gambiae str. PEST ENSANGP00000017616
           (ENSANGG00000015127), partial mRNA
          Length = 662

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 458 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 399

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 398 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 348



to top

>gb|AY389933.1| Latimeria chalumnae ribosomal protein L19 mRNA, partial cds
          Length = 520

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtaca 392
           ||||||||||||||  |||||||| |||||||||||||
Sbjct: 379 cttgttcttgaacacattacccttaaccttcaggtaca 342



to top

>ref|XM_549228.2| PREDICTED: Canis familiaris similar to ribosomal protein L19
           (LOC492107), mRNA
          Length = 473

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||||||||| ||||||||| || ||||||||||
Sbjct: 213 cttgttcttgaacacgttacccttcactttcaggtaca 176



to top

>ref|XR_002471.1| PREDICTED: Mus musculus similar to ribosomal protein L19 (LOC669319),
            mRNA
          Length = 3434

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 340  ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
            ||||||||||| || |||||| |||||||  || || ||||||||||||||||
Sbjct: 3188 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 3136



to top

>ref|XM_141608.7| PREDICTED: Mus musculus similar to ribosomal protein L19
           (LOC208428), mRNA
          Length = 1051

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           ||||||||||| || |||||| |||||||  || || ||||||||||||||||
Sbjct: 805 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 753



to top

>ref|XM_906720.2| PREDICTED: Mus musculus similar to ribosomal protein L19
           (LOC208428), mRNA
          Length = 1051

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           ||||||||||| || |||||| |||||||  || || ||||||||||||||||
Sbjct: 805 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 753



to top

>ref|XR_002473.1| PREDICTED: Mus musculus hypothetical LOC631067 (LOC631067), mRNA
          Length = 744

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||||||  | |||||| |||||||  || |||||||||||||||||||
Sbjct: 458 ctccatgaggatgcgcttgtttttgaacacattccccttgaccttcaggtaca 406



to top

>ref|XM_983446.1| PREDICTED: Mus musculus similar to ribosomal protein L19
           (LOC631615), mRNA
          Length = 609

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           ||||||||||| || |||||| |||||||  || || ||||||||||||||||
Sbjct: 363 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 311



to top

>ref|XM_905487.2| PREDICTED: Mus musculus similar to ribosomal protein L19
           (LOC631615), mRNA
          Length = 609

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           ||||||||||| || |||||| |||||||  || || ||||||||||||||||
Sbjct: 363 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 311



to top

>ref|XM_356705.5| PREDICTED: Mus musculus similar to ribosomal protein L19
           (LOC382844), mRNA
          Length = 702

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           ||||||||||| || |||||| |||||||  || || ||||||||||||||||
Sbjct: 456 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 404



to top

>ref|XM_752688.1| Ustilago maydis 521 hypothetical protein (UM01634.1) partial mRNA
          Length = 588

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 82/101 (81%)
 Strand = Plus / Minus

                                                                       
Query: 320 gccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgttacccttg 379
           ||||||| |||||||||   |||||| || || | |||||||||||| | ||||||||| 
Sbjct: 440 gccttggccttgtggatgtgctccataagcacacgcttgttcttgaaaacgttacccttc 381

                                                    
Query: 380 accttcaggtacatgtcatggtacatgtgcttgtcgatctt 420
             ||| ||||| |  || ||||||| |||||||||||||||
Sbjct: 380 gacttgaggtaaagctcgtggtacaggtgcttgtcgatctt 340



to top

>ref|XM_572717.1| Cryptococcus neoformans var. neoformans JEC21 60S ribosomal protein
           L19 (CNI01090) partial mRNA
          Length = 677

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 398 tggtacatgtgcttgtcgatcttctttgcctcacggtactt 438
           |||||||||||||||||||||||    ||||||||||||||
Sbjct: 377 tggtacatgtgcttgtcgatcttgccggcctcacggtactt 337



to top

>gb|AC122290.4| Mus musculus BAC clone RP23-254P19 from chromosome 14, complete
             sequence
          Length = 163287

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                  
Query: 340   ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
             ||||||||||| || |||||| |||||||  || || ||||||||||||||||
Sbjct: 19785 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 19733



to top

>emb|BX465866.13| Mouse DNA sequence from clone RP23-128L16 on chromosome X, complete
             sequence
          Length = 62496

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                  
Query: 340   ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
             ||||||||||| || |||||| |||||||  || || ||||||||||||||||
Sbjct: 55876 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 55824



to top

>gb|AC171681.1| Mus musculus BAC clone RP24-530O2 from chromosome 14, complete sequence
          Length = 198038

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                   
Query: 340    ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
              ||||||||||| || |||||| |||||||  || || ||||||||||||||||
Sbjct: 181519 ctccatgaggatccgcttgtttttgaacacattccctttgaccttcaggtaca 181467



to top

>gb|AC123611.7| Mus musculus chromosome 15, clone RP23-345H23, complete sequence
          Length = 209792

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                   
Query: 340    ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
              |||||||||||  | |||||| |||||||  || |||||||||||||||||||
Sbjct: 105878 ctccatgaggatgcgcttgtttttgaacacattccccttgaccttcaggtaca 105930



to top

>ref|XM_859015.1| PREDICTED: Canis familiaris Ribosomal protein L19, transcript
           variant 4 (RPL19), mRNA
          Length = 706

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 341 tccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||| | || ||||||||||||||  |||||||| || ||||||||||
Sbjct: 446 tccatgagaatccgcttgttcttgaacacattacccttcactttcaggtaca 395



to top

>ref|XM_858990.1| PREDICTED: Canis familiaris Ribosomal protein L19, transcript
           variant 3 (RPL19), mRNA
          Length = 578

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 341 tccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||| | || ||||||||||||||  |||||||| || ||||||||||
Sbjct: 318 tccatgagaatccgcttgttcttgaacacattacccttcactttcaggtaca 267



to top

>ref|XM_858974.1| PREDICTED: Canis familiaris Ribosomal protein L19, transcript
           variant 2 (RPL19), mRNA
          Length = 702

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 341 tccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||| | || ||||||||||||||  |||||||| || ||||||||||
Sbjct: 445 tccatgagaatccgcttgttcttgaacacattacccttcactttcaggtaca 394



to top

>ref|XM_537655.2| PREDICTED: Canis familiaris Ribosomal protein L19, transcript
           variant 1 (RPL19), mRNA
          Length = 735

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 341 tccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||| | || ||||||||||||||  |||||||| || ||||||||||
Sbjct: 475 tccatgagaatccgcttgttcttgaacacattacccttcactttcaggtaca 424



to top

>emb|AM049064.1| Curculio glandium partial mRNA for ribosomal protein L19e (rpL19e
           gene)
          Length = 414

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                   
Query: 353 ctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||||||||||| |||||||||  |||||| |||||
Sbjct: 407 ctcttgttcttgaacacgttacccttacccttcatgtaca 368



to top

>emb|BX063837.1|CNS09LF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 584

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 267 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 326

                                   
Query: 415 gatcttctttgcctcacggtactt 438
           ||| ||||| ||||||||||||||
Sbjct: 327 gattttcttcgcctcacggtactt 350



to top

>emb|BX063836.1|CNS09LF4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 745 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 686

                                   
Query: 415 gatcttctttgcctcacggtactt 438
           ||| ||||| ||||||||||||||
Sbjct: 685 gattttcttcgcctcacggtactt 662



to top

>emb|BX059860.1|CNS09ICO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 626

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 319 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 260

                                   
Query: 415 gatcttctttgcctcacggtactt 438
           ||| ||||| ||||||||||||||
Sbjct: 259 gattttcttcgcctcacggtactt 236



to top

>emb|BX033777.1|CNS08Y85 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5BF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 660

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                   
Query: 415 gatcttctttgcctcacggtactt 438
           ||| ||||| ||||||||||||||
Sbjct: 235 gattttcttcgcctcacggtactt 258



to top

>emb|BX033086.1|CNS08XOY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49BE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 434 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 375

                                   
Query: 415 gatcttctttgcctcacggtactt 438
           ||| ||||| ||||||||||||||
Sbjct: 374 gattttcttcgcctcacggtactt 351



to top

>emb|BX032398.1|CNS08X5U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 272

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                   
Query: 415 gatcttctttgcctcacggtactt 438
           ||| ||||| ||||||||||||||
Sbjct: 235 gattttcttcgcctcacggtactt 258



to top

>emb|BX022839.1|CNS08PSB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 169

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 105 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 46

                                   
Query: 415 gatcttctttgcctcacggtactt 438
           ||| ||||| ||||||||||||||
Sbjct: 45  gattttcttcgcctcacggtactt 22



to top

>emb|BX022610.1|CNS08PLY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 553

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 450 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 391

                                   
Query: 415 gatcttctttgcctcacggtactt 438
           ||| ||||| ||||||||||||||
Sbjct: 390 gattttcttcgcctcacggtactt 367



to top

>emb|BX018223.1|CNS08M83 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 318

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 234

                                   
Query: 415 gatcttctttgcctcacggtactt 438
           ||| ||||| ||||||||||||||
Sbjct: 235 gattttcttcgcctcacggtactt 258



to top

>gb|DQ122884.1| Chlamydomonas incerta mitochondrial carrier protein CR057 mRNA,
            complete cds; nuclear gene for mitochondrial product
          Length = 1745

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 152  gccgctgctgccggagctggagctgcag 179
            ||||||||| ||||||||||||||||||
Sbjct: 1182 gccgctgcttccggagctggagctgcag 1209



to top

>gb|AC024599.9| Homo sapiens chromosome 10 clone RP11-159H3, complete sequence
          Length = 173391

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                 
Query: 341   tccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
             |||||||||| || |||||| |||||||  || ||||| |||||||||||||
Sbjct: 51245 tccatgaggatccgcttgtttttgaacacattccccttcaccttcaggtaca 51296



to top

>gb|AC012690.17| Homo sapiens chromosome 10 clone RP11-127B19, complete sequence
          Length = 161276

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 45/52 (86%)
 Strand = Plus / Plus

                                                                  
Query: 341    tccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
              |||||||||| || |||||| |||||||  || ||||| |||||||||||||
Sbjct: 140593 tccatgaggatccgcttgtttttgaacacattccccttcaccttcaggtaca 140644



to top

>gb|AY857433.1| Suberites domuncula L19 mRNA, complete cds
          Length = 600

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                       
Query: 314 ttctcagccttggacttgtggatactctccatgaggaccctcttgttcttgaacatgtta 373
           |||||||||||   ||||||||||  ||||||||| || |  |||||||| |||| ||||
Sbjct: 446 ttctcagccttcttcttgtggataaactccatgagtacacgtttgttcttaaacacgtta 387

                   
Query: 374 cccttgac 381
           ||||||||
Sbjct: 386 cccttgac 379



to top

>emb|AJ563476.1|CGI563476 Crassostrea gigas partial mRNA for ribosomal protein L19 (rpls
           gene)
          Length = 604

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtacatgtcatg 399
           |||||| | ||| ||||||||||||||   |||||| |||  ||||| |||||  |||||
Sbjct: 427 ctccatcaagactctcttgttcttgaatccgttacctttgctcttcatgtacagttcatg 368

                                   
Query: 400 gtacatgtgcttgtcgatcttctt 423
           ||| | |||||||||||| |||||
Sbjct: 367 gtataagtgcttgtcgattttctt 344



to top

>gb|AC102895.7| Mus musculus chromosome 15, clone RP24-356D22, complete sequence
          Length = 165778

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 551   ttggcctcatgtgccctccttgca 574
             ||||||||||||||||||||||||
Sbjct: 35953 ttggcctcatgtgccctccttgca 35930



to top

>emb|AJ388522.1|CFA388522 Canis familiaris mRNA for partial Ribosomal protein L19 (rpL19
           gene)
          Length = 342

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 341 tccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||| | || ||||||||||||||  |||||||| || ||||||||||
Sbjct: 330 tccatgagaatccgcttgttcttgaacacattacccttcactttcaggtaca 279



to top

>ref|XM_964097.1| PREDICTED: Tribolium castaneum similar to CG2746-PA, isoform A
           (LOC657650), mRNA
          Length = 739

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttca 386
           |||||| || ||||||||||||||||| | ||| |||||| ||||||
Sbjct: 505 ctccataagaaccctcttgttcttgaagacgttgcccttggccttca 459



to top

>emb|BX036409.1|CNS09099 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 725

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 89/111 (80%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||| ||| |||   |||
Sbjct: 427 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggaacaggtgacggtc 368

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 367 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 317



to top

>emb|BX030095.1|CNS08VDV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 89/111 (80%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || || || ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgtccaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285



to top

>emb|BX021000.1|CNS08OD8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 89/111 (80%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   |||
Sbjct: 452 cttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacggtc 393

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||| ||||   ||| ||||| | ||||||||||||
Sbjct: 392 gattttcttcgcctcacggcacttcttcagcagacgacgcagcacacgcat 342



to top

>emb|BX019823.1|CNS08NGJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 89/111 (80%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || |||| | || ||||||| |||   |||
Sbjct: 423 cttgttcttgaacacgttacccttcgcacgcatgtacttatcgtggtacaggtgacggtc 364

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 363 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 313



to top

>emb|BX013212.1|CNS08ICW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 665

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 89/111 (80%)
 Strand = Plus / Plus

                                                                       
Query: 355 cttgttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtc 414
           |||||||||||||| |||||||||  |   || || || ||| ||||||| |||   |||
Sbjct: 175 cttgttcttgaacacgttacccttcgcacgcatgttcaggtcgtggtacaggtgacggtc 234

                                                              
Query: 415 gatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           ||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 235 gattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 285



to top

>gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 9, complete
              sequence
          Length = 1178688

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                    
Query: 401    tacatgtgcttgtcgatcttctttgcctcacggtactt 438
              ||||||||||||||||||||    ||||||||||||||
Sbjct: 273528 tacatgtgcttgtcgatcttgccggcctcacggtactt 273491



to top

>ref|XM_420503.1| PREDICTED: Gallus gallus similar to KIAA1546 protein (LOC422540),
            mRNA
          Length = 7572

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 301  cttctctcttgccttctcagcc 322
            ||||||||||||||||||||||
Sbjct: 7347 cttctctcttgccttctcagcc 7326



to top

>ref|XM_652630.1| Aspergillus nidulans FGSC A4 dynein heavy chain (AN0118.2), mRNA
          Length = 13038

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 166  agctggagctgcagccgctggtgccg 191
            ||||||||||||||||| ||||||||
Sbjct: 1551 agctggagctgcagccgatggtgccg 1576



to top

>emb|AM049063.1| Cicindela campestris mRNA for ribosomal protein L19e (rpL19e gene)
          Length = 600

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 341 tccatgaggaccctcttgttcttgaacatgttaccctt 378
           ||||| ||||| | |||||||||||||| |||||||||
Sbjct: 419 tccataaggacacgcttgttcttgaacacgttaccctt 382



to top

>emb|CR730601.2|CNS0GQOE Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 133 cttcttggccttctttggtgcc 154
           ||||||||||||||||||||||
Sbjct: 82  cttcttggccttctttggtgcc 61



to top

>emb|CR725565.1|CNS0GMSJ Tetraodon nigroviridis full-length cDNA
          Length = 1233

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 133 cttcttggccttctttggtgcc 154
           ||||||||||||||||||||||
Sbjct: 70  cttcttggccttctttggtgcc 49



to top

>emb|CR701659.2|CNS0G4CN Tetraodon nigroviridis full-length cDNA
          Length = 528

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 133 cttcttggccttctttggtgcc 154
           ||||||||||||||||||||||
Sbjct: 84  cttcttggccttctttggtgcc 63



to top

>emb|CR670272.2|CNS0FG5I Tetraodon nigroviridis full-length cDNA
          Length = 1038

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 133 cttcttggccttctttggtgcc 154
           ||||||||||||||||||||||
Sbjct: 55  cttcttggccttctttggtgcc 34



to top

>emb|CR666708.2|CNS0FDEI Tetraodon nigroviridis full-length cDNA
          Length = 1237

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 133 cttcttggccttctttggtgcc 154
           ||||||||||||||||||||||
Sbjct: 78  cttcttggccttctttggtgcc 57



to top

>emb|CR666702.1|CNS0FDEC Tetraodon nigroviridis full-length cDNA
          Length = 1081

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 133 cttcttggccttctttggtgcc 154
           ||||||||||||||||||||||
Sbjct: 79  cttcttggccttctttggtgcc 58



to top

>emb|CR665691.2|CNS0FCM9 Tetraodon nigroviridis full-length cDNA
          Length = 1253

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 133 cttcttggccttctttggtgcc 154
           ||||||||||||||||||||||
Sbjct: 82  cttcttggccttctttggtgcc 61



to top

>emb|CR663076.2|CNS0FALM Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 133 cttcttggccttctttggtgcc 154
           ||||||||||||||||||||||
Sbjct: 82  cttcttggccttctttggtgcc 61



to top

>emb|AL161742.7| Human DNA sequence from clone RP4-597J3 on chromosome 1p32.1-32.3
             Contains the 5' end of the ROR1 gene for receptor tyrosine
             kinase-like orphan receptor 1, a ribosomal protein L19
             (RPL19) pseudogene, a cofilin 1 (non-muscle) (CFL1)
             pseudogene and a CpG island, complete sequence
          Length = 114409

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 355   cttgttcttgaacatgttacccttgaccttcaggtaca 392
             |||||| ||||||| ||| ||||| |||||||||||||
Sbjct: 40126 cttgtttttgaacacgttccccttaaccttcaggtaca 40163



to top

>emb|BX056472.1|CNS09FQK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 118

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                 
Query: 412 gtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           |||||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 24  gtcgattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 77



to top

>emb|BX050811.1|CNS09BDB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 412 gtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           |||||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 381 gtcgattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 328



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 355 cttgttcttgaacatgttaccctt 378
           |||||||||||||| |||||||||
Sbjct: 438 cttgttcttgaacacgttaccctt 415



to top

>emb|BX039609.1|CNS092Q5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC10AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 403

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 412 gtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           |||||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 372 gtcgattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 319



to top

>emb|BX019178.1|CNS08MYM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 756

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 412 gtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           |||||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 381 gtcgattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 328



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 355 cttgttcttgaacatgttaccctt 378
           |||||||||||||| |||||||||
Sbjct: 438 cttgttcttgaacacgttaccctt 415



to top

>emb|BX018222.1|CNS08M82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                 
Query: 412 gtcgatcttctttgcctcacggtacttgcgcagaagacgcctcagcacacgcat 465
           |||||| ||||| ||||||||||||||   ||| ||||| | ||||||||||||
Sbjct: 389 gtcgattttcttcgcctcacggtacttcttcagcagacgacgcagcacacgcat 336



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 355 cttgttcttgaacatgttaccctt 378
           |||||||||||||| |||||||||
Sbjct: 446 cttgttcttgaacacgttaccctt 423



to top

>ref|XM_578500.1| PREDICTED: Rattus norvegicus similar to novel protein (LOC502992),
           mRNA
          Length = 1143

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 138 tggccttctttggtgccgctgctgcc 163
           |||||||||||||||| |||||||||
Sbjct: 825 tggccttctttggtgctgctgctgcc 850



to top

>gb|U03904.1|ENU03904 Emericella nidulans cytoplasmic dynein gene, complete cds
          Length = 13254

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 166  agctggagctgcagccgctggtgccg 191
            ||||||||||||||||| ||||||||
Sbjct: 1657 agctggagctgcagccgatggtgccg 1682



to top

>ref|XM_516790.1| PREDICTED: Pan troglodytes similar to Transcription factor Dp-2 (E2F
            dimerization partner 2) (LOC460743), mRNA
          Length = 3654

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                 
Query: 340  ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
            ||||||||| | || |||||| |||||||  || ||||| |||||||||||||
Sbjct: 2013 ctccatgagaatccgcttgtttttgaacacatttcccttcaccttcaggtaca 1961



to top

>gb|BC083131.1| Mus musculus ribosomal protein L19, mRNA (cDNA clone MGC:103211
           IMAGE:6442192), complete cds
          Length = 737

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||||||  | |||||| |||||||  || || ||||||||||||||||
Sbjct: 429 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 377



to top

>gb|AC158308.4| Mus musculus chromosome 3, clone RP23-182M12, complete sequence
          Length = 176856

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                   
Query: 340    ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
              ||||||||||| || |||||| || ||||  || || ||||||||||||||||
Sbjct: 143491 ctccatgaggatccgcttgttttttaacacattccctttgaccttcaggtaca 143543



to top

>gb|BC077657.1| Xenopus tropicalis MGC89675 protein, mRNA (cDNA clone MGC:89675
           IMAGE:7026279), complete cds
          Length = 709

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 359 ttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatc 418
           |||||||||| ||| ||||| || ||||| |||| |   |||||||||||| |||| |||
Sbjct: 426 ttcttgaacacgtttccctttactttcagatacaggctgtggtacatgtgcctgtcaatc 367

                
Query: 419 ttctt 423
           |||||
Sbjct: 366 ttctt 362



to top

>gb|AY658253.1| Synthetic construct Peudomonas aeruginosa clone FLH052548.01F
           PA3198 gene, partial cds
          Length = 753

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 155 gctgctgccggagctggagctgcag 179
           ||||||||||||||||| |||||||
Sbjct: 390 gctgctgccggagctggcgctgcag 414



to top

>gb|BC058135.1| Rattus norvegicus ribosomal protein L19, mRNA (cDNA clone MGC:72756
           IMAGE:6918377), complete cds
          Length = 732

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           ||||||||| | || |||||| |||||||  || || ||||||||||||||||
Sbjct: 448 ctccatgagaatccgcttgtttttgaacacattccctttgaccttcaggtaca 396



to top

>gb|BC010710.1| Mus musculus ribosomal protein L19, mRNA (cDNA clone MGC:6500
           IMAGE:2648593), complete cds
          Length = 701

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||||||  | |||||| |||||||  || || ||||||||||||||||
Sbjct: 427 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 375



to top

>ref|NM_009078.1| Mus musculus ribosomal protein L19 (Rpl19), mRNA
          Length = 673

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||||||  | |||||| |||||||  || || ||||||||||||||||
Sbjct: 420 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 368



to top

>ref|XR_005084.1| PREDICTED: Mus musculus hypothetical protein LOC677551 (LOC677551),
           mRNA
          Length = 778

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||||||  | |||||| |||||||  || || ||||||||||||||||
Sbjct: 491 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 439



to top

>ref|XR_002967.1| PREDICTED: Mus musculus hypothetical protein LOC670429 (LOC670429),
           mRNA
          Length = 777

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||||||  | |||||| |||||||  || || ||||||||||||||||
Sbjct: 491 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 439



to top

>ref|XR_001792.1| PREDICTED: Mus musculus hypothetical protein LOC665813 (LOC665813),
           mRNA
          Length = 778

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||||||  | |||||| |||||||  || || ||||||||||||||||
Sbjct: 491 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 439



to top

>ref|XM_994659.1| PREDICTED: Mus musculus similar to ribosomal protein L19
           (LOC435754), mRNA
          Length = 720

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           ||||||||||| || |||||| || ||||  || || ||||||||||||||||
Sbjct: 452 ctccatgaggatccgcttgttttttaacacattccctttgaccttcaggtaca 400



to top

>ref|XM_916280.2| PREDICTED: Mus musculus similar to ribosomal protein L19
           (LOC435754), mRNA
          Length = 720

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           ||||||||||| || |||||| || ||||  || || ||||||||||||||||
Sbjct: 452 ctccatgaggatccgcttgttttttaacacattccctttgaccttcaggtaca 400



to top

>ref|XM_001005252.1| PREDICTED: Mus musculus similar to ribosomal protein L19
           (LOC668689), mRNA
          Length = 712

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           ||||||||||| || |||||| || ||||  || || ||||||||||||||||
Sbjct: 444 ctccatgaggatccgcttgttttttaacacattccctttgaccttcaggtaca 392



to top

>ref|XM_757154.1| Ustilago maydis 521 hypothetical protein (UM06100.1) partial mRNA
          Length = 837

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 151 tgccgctgctgccggagctgg 171
           |||||||||||||||||||||
Sbjct: 11  tgccgctgctgccggagctgg 31



to top

>gb|AC126807.4| Mus musculus BAC clone RP23-306D4 from chromosome 18, complete sequence
          Length = 244566

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                  
Query: 340   ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
             |||||||||||  | |||||| |||||||  || || ||||||||||||||||
Sbjct: 71678 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 71626



to top

>emb|CR674700.2|CNS0FJKI Tetraodon nigroviridis full-length cDNA
          Length = 809

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 135 tcttggccttctttggtgccg 155
           |||||||||||||||||||||
Sbjct: 156 tcttggccttctttggtgccg 136



to top

>gb|BC090329.1| Rattus norvegicus cDNA clone IMAGE:7300763, **** WARNING: chimeric
            clone ****
          Length = 2055

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                 
Query: 340  ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
            ||||||||| | || |||||| |||||||  || || ||||||||||||||||
Sbjct: 1784 ctccatgagaatccgcttgtttttgaacacattccctttgaccttcaggtaca 1732



to top

>ref|XM_502020.1| Yarrowia lipolytica CLIB122, YALI0C19668g predicted mRNA
          Length = 1074

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 158 gctgccggagctggagctgca 178
           |||||||||||||||||||||
Sbjct: 799 gctgccggagctggagctgca 819



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 158 gctgccggagctggagctgcagccgctg 185
           |||| |||||||||||||||| ||||||
Sbjct: 775 gctgtcggagctggagctgcacccgctg 802



to top

>emb|AL646051.19| Mouse DNA sequence from clone RP23-222M22 on chromosome 11 Contains the
             5' end of the Hs3st3a gene for heparan sulfate
             (glucosamine) 3-O-sulfotransferase 3A and a CpG island,
             complete sequence
          Length = 144847

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 309   ttgccttctcagccttggact 329
             |||||||||||||||||||||
Sbjct: 34971 ttgccttctcagccttggact 34951



to top

>emb|AL646095.27| Mouse DNA sequence from clone RP23-17P18 on chromosome 11 Contains the
             3' end of the Asb3 gene for ankyrin repeat and SOCS
             box-containing protein 3 and two zinc finger protein
             pseudogenes, complete sequence
          Length = 173655

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 245   ctctccctgcttgccttgctc 265
             |||||||||||||||||||||
Sbjct: 73241 ctctccctgcttgccttgctc 73261



to top

>gb|AC064800.8| Homo sapiens chromosome 18, clone CTD-2001I24, complete sequence
          Length = 131409

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 247   ctccctgcttgccttgctctt 267
             |||||||||||||||||||||
Sbjct: 98973 ctccctgcttgccttgctctt 98993



to top

>dbj|AK168481.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:I920026E09 product:ribosomal protein L19,
           full insert sequence
          Length = 705

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||||||  | |||||| |||||||  || || ||||||||||||||||
Sbjct: 453 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 401



to top

>dbj|AK168232.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730069N19 product:ribosomal protein L19, full
           insert sequence
          Length = 661

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||||||  | |||||| |||||||  || || ||||||||||||||||
Sbjct: 407 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 355



to top

>dbj|AK010440.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410007J07 product:ribosomal protein L19, full
           insert sequence
          Length = 719

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||||||  | |||||| |||||||  || || ||||||||||||||||
Sbjct: 449 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 397



to top

>gb|BC089549.1| Mus musculus ribosomal protein L19, mRNA (cDNA clone MGC:107301
           IMAGE:6703351), complete cds
          Length = 733

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||||||  | |||||| |||||||  || || ||||||||||||||||
Sbjct: 449 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 397



to top

>ref|NM_031103.1| Rattus norvegicus ribosomal protein L19 (Rpl19), mRNA
          Length = 703

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           ||||||||| | || |||||| |||||||  || || ||||||||||||||||
Sbjct: 448 ctccatgagaatccgcttgtttttgaacacattccctttgaccttcaggtaca 396



to top

>gb|AC102600.11| Mus musculus chromosome 3, clone RP23-376E16, complete sequence
          Length = 131703

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                  
Query: 340   ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
             ||||||||||| || |||||| || ||||  || || ||||||||||||||||
Sbjct: 57618 ctccatgaggatccgcttgttttttaacacattccctttgaccttcaggtaca 57566



to top

>gb|BC092539.1| Mus musculus ribosomal protein L19, mRNA (cDNA clone MGC:107300
           IMAGE:6594084), complete cds
          Length = 746

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 340 ctccatgaggaccctcttgttcttgaacatgttacccttgaccttcaggtaca 392
           |||||||||||  | |||||| |||||||  || || ||||||||||||||||
Sbjct: 438 ctccatgaggatgcgcttgtttttgaacacattccctttgaccttcaggtaca 386



to top

>ref|NM_001005122.1| Xenopus tropicalis MGC89675 protein (MGC89675), mRNA
          Length = 709

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 359 ttcttgaacatgttacccttgaccttcaggtacatgtcatggtacatgtgcttgtcgatc 418
           |||||||||| ||| ||||| || ||||| |||| |   |||||||||||| |||| |||
Sbjct: 426 ttcttgaacacgtttccctttactttcagatacaggctgtggtacatgtgcctgtcaatc 367

                
Query: 419 ttctt 423
           |||||
Sbjct: 366 ttctt 362


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,561,336
Number of Sequences: 3902068
Number of extensions: 5561336
Number of successful extensions: 164046
Number of sequences better than 10.0: 2630
Number of HSP's better than 10.0 without gapping: 2626
Number of HSP's successfully gapped in prelim test: 6
Number of HSP's that attempted gapping in prelim test: 160387
Number of HSP's gapped (non-prelim): 3552
length of query: 598
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 575
effective length of database: 17,143,297,704
effective search space: 9857396179800
effective search space used: 9857396179800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top