Clone Name	rbasd16i15
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AK102721.1| Oryza sativa (japonica cultivar-group) cDNA clon...	561	e-156
2	dbj|AK059309.1| Oryza sativa (japonica cultivar-group) cDNA clon...	561	e-156
3	gb|AY103679.1| Zea mays PCO152526 mRNA sequence	464	e-127
4	gb|AF542969.2| Triticum aestivum ribosomal protein L19 mRNA, com...	454	e-124
5	gb|BT016919.1| Zea mays clone E04912701B11.c mRNA sequence	438	e-119
6	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	436	e-119
7	gb|AC134885.1| Genomic sequence for Oryza sativa, Nipponbare str...	436	e-119
8	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	436	e-119
9	gb|BT019233.1| Zea mays clone Contig906.F mRNA sequence	406	e-110
10	gb|BT016537.1| Zea mays clone Contig370 mRNA sequence	406	e-110
11	gb|AY103638.1| Zea mays PCO153348 mRNA sequence	406	e-110
12	gb|BT016443.1| Zea mays clone Contig276 mRNA sequence	385	e-103
13	gb|AC147962.1| Oryza sativa chromosome 3 BAC OSJNBa0083K01 genom...	381	e-102
14	gb|AC128645.5| Oryza sativa chromosome 3 BAC OSJNBb0016P23 genom...	381	e-102
15	gb|AY104244.1| Zea mays PCO075323 mRNA sequence	353	5e-94
16	gb|AY489023.1| Capsicum annuum ribosomal protein L19 mRNA, compl...	248	2e-62
17	gb|AY485789.1| Capsicum annuum 60S ribosomal protein L19 mRNA, c...	248	2e-62
18	gb|AY389581.1| Hyacinthus orientalis ribosomal protein L19 (RPL1...	228	2e-56
19	ref|NM_112551.2| Arabidopsis thaliana structural constituent of ...	218	2e-53
20	gb|AY090335.1| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, comp...	218	2e-53
21	gb|AY045610.1| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, comp...	218	2e-53
22	gb|AY089073.1| Arabidopsis thaliana clone 27978 mRNA, complete s...	218	2e-53
23	emb|Z31720.1|NTL19RIB N.tabacum (cv.Samsun NN) L19 mRNA for ribo...	218	2e-53
24	gb|DQ294277.1| Solanum tuberosum clone 172G04 60S ribosomal prot...	216	7e-53
25	dbj|AB022217.1| Arabidopsis thaliana genomic DNA, chromosome 3, ...	210	4e-51
26	dbj|D21304.1|RICSS504 Oryza sativa SS504 mRNA for ribosomal prot...	196	7e-47
27	gb|AY488031.1| Capsicum annuum ribosomal protein L19 mRNA, parti...	190	4e-45
28	gb|AC152751.22| Medicago truncatula clone mth2-18n7, complete se...	176	6e-41
29	ref|NM_100157.2| Arabidopsis thaliana EMB2386; structural consti...	168	2e-38
30	ref|NM_116456.2| Arabidopsis thaliana structural constituent of ...	168	2e-38
31	gb|AC009525.3| Arabidopsis thaliana chromosome I BAC F22D16 geno...	168	2e-38
32	gb|BT010178.1| Arabidopsis thaliana At1g02780/T14P4_3 mRNA, comp...	168	2e-38
33	emb|AL161494.2|ATCHRIV6 Arabidopsis thaliana DNA chromosome 4, c...	168	2e-38
34	gb|AY072494.1| Arabidopsis thaliana similar to 60S ribosome prot...	168	2e-38
35	gb|AF462835.1|AF462835 Arabidopsis thaliana At1g02780/T14P4_3 mR...	168	2e-38
36	gb|AF424580.1|AF424580 Arabidopsis thaliana At1g02780/T14P4_3 mR...	168	2e-38
37	gb|AF386993.1|AF386993 Arabidopsis thaliana Similar to 60S ribos...	168	2e-38
38	emb|BX816202.1|CNS0AE3J Arabidopsis thaliana Full-length cDNA Co...	168	2e-38
39	emb|BX816956.1|CNS0AD7Y Arabidopsis thaliana Full-length cDNA Co...	168	2e-38
40	emb|BX816918.1|CNS0ADAO Arabidopsis thaliana Full-length cDNA Co...	168	2e-38
41	emb|BX815921.1|CNS0AD0X Arabidopsis thaliana Full-length cDNA Co...	168	2e-38
42	emb|BX817746.1|CNS0ACMV Arabidopsis thaliana Full-length cDNA Co...	168	2e-38
43	emb|BX813821.1|CNS0AAUL Arabidopsis thaliana Full-length cDNA Co...	168	2e-38
44	gb|AC022521.4|AC022521 Arabidopsis thaliana chromosome I BAC T14...	168	2e-38
45	gb|AF075597.1|T2H3 Arabidopsis thaliana BAC T2H3	168	2e-38
46	emb|BX818275.1|CNS0ACJX Arabidopsis thaliana Full-length cDNA Co...	165	2e-37
47	emb|BX815471.1|CNS0ACXF Arabidopsis thaliana Full-length cDNA Co...	161	4e-36
48	emb|BX842172.1|CNS09YDA Arabidopsis thaliana Full-length cDNA Co...	159	1e-35
49	gb|AY086882.1| Arabidopsis thaliana clone 2906 mRNA, complete se...	153	9e-34
50	emb|BX816648.1|CNS0AD9N Arabidopsis thaliana Full-length cDNA Co...	149	1e-32
51	dbj|D29721.1|RICYK34 Oryza sativa mRNA, partial homologous to ri...	139	1e-29
52	dbj|AK110270.1| Oryza sativa (japonica cultivar-group) cDNA clon...	113	8e-22
53	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	100	1e-17
54	dbj|AP004300.3| Oryza sativa (japonica cultivar-group) genomic D...	100	1e-17
55	gb|DQ066293.1| Ixodes scapularis isolate is-all-397 ribosomal pr...	96	2e-16
56	emb|BX814021.1|CNS0ADSF Arabidopsis thaliana Full-length cDNA Co...	86	2e-13
57	ref|NM_001030929.1| Gallus gallus ribosomal protein L19 (RPL19),...	82	3e-12
58	emb|AJ720076.1| Gallus gallus mRNA for hypothetical protein, clo...	82	3e-12
59	emb|AM049066.1| Sphaerius sp. APV-2005 mRNA for ribosomal protei...	78	4e-11
60	gb|AY393838.1| Gallus gallus ribosomal protein L19 mRNA, partial...	74	7e-10
61	gb|AY232030.1| Drosophila yakuba clone yak-ad_RpL19 mRNA sequence	70	1e-08
62	ref|XM_793320.1| PREDICTED: Strongylocentrotus purpuratus simila...	70	1e-08
63	emb|X74776.1|DMRPL19 D.melanogaster rpL19 gene for ribosomal pro...	70	1e-08
64	gb|L32181.1|DRORPL19X Drosophila melanogaster ribosomal protein ...	70	1e-08
65	gb|M95065.1|MZEORFF Zea mays putative ribosomal protein L19 mRNA...	68	4e-08
66	ref|XM_479458.1| Oryza sativa (japonica cultivar-group), mRNA	64	6e-07
67	ref|XM_752688.1| Ustilago maydis 521 hypothetical protein (UM016...	64	6e-07
68	gb|BC041546.1| Xenopus laevis ribosomal protein L19, mRNA (cDNA ...	64	6e-07
69	gb|AF401574.1| Ictalurus punctatus ribosomal protein L19 mRNA, c...	64	6e-07
70	gb|AY168759.1| Branchiostoma belcheri tsingtaunese ribosomal pro...	64	6e-07
71	emb|AM049063.1| Cicindela campestris mRNA for ribosomal protein ...	62	3e-06
72	ref|NM_206219.1| Drosophila melanogaster Ribosomal protein L19 C...	62	3e-06
73	ref|NM_057283.4| Drosophila melanogaster Ribosomal protein L19 C...	62	3e-06
74	gb|AC007884.5|AC007884 Drosophila melanogaster, chromosome 2R, r...	62	3e-06
75	gb|AY130453.1| Branchiostoma lanceolatum ribosomal protein L19 m...	62	3e-06
76	gb|AY061217.1| Drosophila melanogaster LD16326 full insert cDNA	62	3e-06
77	gb|BT024264.1| Drosophila melanogaster IP15818 full insert cDNA	62	3e-06
78	gb|AE003465.3| Drosophila melanogaster chromosome 2R, section 72...	62	3e-06
79	gb|AY648758.1| Danio rerio 60s ribosomal protein L19 mRNA, compl...	60	1e-05
80	ref|NM_213208.1| Danio rerio ribosomal protein L19 (rpl19), mRNA	60	1e-05
81	gb|BC062844.1| Danio rerio ribosomal protein L19, mRNA (cDNA clo...	60	1e-05
82	emb|CR388097.9| Zebrafish DNA sequence from clone CH211-10J9 in ...	60	1e-05
83	ref|NM_117696.1| Arabidopsis thaliana structural constituent of ...	58	4e-05
84	emb|AM049062.1| Carabus granulatus partial mRNA for ribosomal pr...	58	4e-05
85	gb|BT010624.1| Arabidopsis thaliana At4g16030 gene, complete cds	58	4e-05
86	gb|AF548014.1| Spodoptera frugiperda ribosomal protein L19 mRNA,...	58	4e-05
87	emb|Z97340.2|ATFCA5 Arabidopsis thaliana DNA chromosome 4, ESSA ...	58	4e-05
88	emb|AL161543.2|ATCHRIV43 Arabidopsis thaliana DNA chromosome 4, ...	58	4e-05
89	dbj|AK175808.1| Arabidopsis thaliana mRNA for probable ribosomal...	58	4e-05
90	dbj|AK175588.1| Arabidopsis thaliana mRNA for probable ribosomal...	58	4e-05
91	emb|CR725299.2|CNS0GML5 Tetraodon nigroviridis full-length cDNA	56	2e-04
92	emb|CR707866.2|CNS0G952 Tetraodon nigroviridis full-length cDNA	56	2e-04
93	gb|AY829780.1| Lonomia obliqua ribosomal protein L19e mRNA, part...	56	2e-04
94	gb|AY769289.1| Bombyx mori ribosomal protein L19 (RpL19) mRNA, c...	52	0.002
95	gb|DQ443429.1| Bombyx mori PDP protein mRNA, complete cds	52	0.002
96	gb|AY431470.1| Aedes aegypti ASAP ID: 35661 cytosolic large ribo...	50	0.010
97	gb|AY389933.1| Latimeria chalumnae ribosomal protein L19 mRNA, p...	50	0.010
98	gb|DQ440220.1| Aedes aegypti clone AET-2449 ribosomal protein L1...	50	0.010
99	emb|CR938671.1| Single read from an extremity of a full-length c...	50	0.010
100	emb|CR938382.1| Single read from an extremity of a full-length c...	50	0.010
101	emb|CR938187.1| Single read from an extremity of a full-length c...	50	0.010
102	emb|CR938174.1| Single read from an extremity of a full-length c...	50	0.010
103	emb|CR938138.1| Single read from an extremity of a full-length c...	50	0.010
104	emb|CR938033.1| Single read from an extremity of a full-length c...	50	0.010
105	gb|AY130357.1| Petromyzon marinus ribosomal protein L19 mRNA, pa...	50	0.010
106	gb|BC077657.1| Xenopus tropicalis MGC89675 protein, mRNA (cDNA c...	48	0.038
107	ref|NM_001005122.1| Xenopus tropicalis MGC89675 protein (MGC8967...	48	0.038
108	gb|AY439425.1| Armigeres subalbatus ASAP ID: 39837 cytosolic lar...	46	0.15
109	ref|XM_549228.2| PREDICTED: Canis familiaris similar to ribosoma...	46	0.15
110	ref|XM_572717.1| Cryptococcus neoformans var. neoformans JEC21 6...	46	0.15
111	ref|XM_859015.1| PREDICTED: Canis familiaris Ribosomal protein L...	46	0.15
112	ref|XM_858990.1| PREDICTED: Canis familiaris Ribosomal protein L...	46	0.15
113	ref|XM_858974.1| PREDICTED: Canis familiaris Ribosomal protein L...	46	0.15
114	ref|XM_537655.2| PREDICTED: Canis familiaris Ribosomal protein L...	46	0.15
115	emb|BX072418.1|CNS09S1I Single read from an extremity of a full-...	46	0.15
116	emb|BX072399.1|CNS09S0Z Single read from an extremity of a full-...	46	0.15
117	emb|BX072398.1|CNS09S0Y Single read from an extremity of a full-...	46	0.15
118	emb|BX072218.1|CNS09RVY Single read from an extremity of a full-...	46	0.15
119	emb|BX072217.1|CNS09RVX Single read from an extremity of a full-...	46	0.15
120	emb|BX072184.1|CNS09RV0 Single read from an extremity of a full-...	46	0.15
121	emb|BX072183.1|CNS09RUZ Single read from an extremity of a full-...	46	0.15
122	emb|BX071678.1|CNS09RGY Single read from an extremity of a full-...	46	0.15
123	emb|BX071677.1|CNS09RGX Single read from an extremity of a full-...	46	0.15
124	emb|BX066612.1|CNS09NK8 Single read from an extremity of a full-...	46	0.15
125	emb|BX066611.1|CNS09NK7 Single read from an extremity of a full-...	46	0.15
126	emb|BX063837.1|CNS09LF5 Single read from an extremity of a full-...	46	0.15
127	emb|BX063836.1|CNS09LF4 Single read from an extremity of a full-...	46	0.15
128	emb|BX059860.1|CNS09ICO Single read from an extremity of a full-...	46	0.15
129	emb|BX059159.1|CNS09HT7 Single read from an extremity of a full-...	46	0.15
130	emb|BX057349.1|CNS09GEX Single read from an extremity of a full-...	46	0.15
131	emb|BX056471.1|CNS09FQJ Single read from an extremity of a full-...	46	0.15
132	emb|BX055496.1|CNS09EZG Single read from an extremity of a full-...	46	0.15
133	emb|BX054547.1|CNS09E93 Single read from an extremity of a full-...	46	0.15
134	emb|BX054546.1|CNS09E92 Single read from an extremity of a full-...	46	0.15
135	emb|BX052331.1|CNS09CJJ Single read from an extremity of a full-...	46	0.15
136	emb|BX050811.1|CNS09BDB Single read from an extremity of a full-...	46	0.15
137	emb|BX030921.1|CNS08W0T Single read from an extremity of a full-...	46	0.15
138	emb|BX030866.1|CNS08VZA Single read from an extremity of a full-...	46	0.15
139	emb|BX041770.1|CNS094E6 Single read from an extremity of a full-...	46	0.15
140	emb|BX039610.1|CNS092Q6 Single read from an extremity of a full-...	46	0.15
141	emb|BX039182.1|CNS092EA Single read from an extremity of a full-...	46	0.15
142	emb|BX039161.1|CNS092DP Single read from an extremity of a full-...	46	0.15
143	emb|BX038823.1|CNS0924B Single read from an extremity of a full-...	46	0.15
144	emb|BX038377.1|CNS091RX Single read from an extremity of a full-...	46	0.15
145	emb|BX038376.1|CNS091RW Single read from an extremity of a full-...	46	0.15
146	emb|BX038311.1|CNS091Q3 Single read from an extremity of a full-...	46	0.15
147	emb|BX038155.1|CNS091LR Single read from an extremity of a full-...	46	0.15
148	emb|BX038154.1|CNS091LQ Single read from an extremity of a full-...	46	0.15
149	emb|BX038058.1|CNS091J2 Single read from an extremity of a full-...	46	0.15
150	emb|BX038043.1|CNS091IN Single read from an extremity of a full-...	46	0.15
151	emb|BX038006.1|CNS091HM Single read from an extremity of a full-...	46	0.15
152	emb|BX037816.1|CNS091CC Single read from an extremity of a full-...	46	0.15
153	emb|BX037762.1|CNS091AU Single read from an extremity of a full-...	46	0.15
154	emb|BX037761.1|CNS091AT Single read from an extremity of a full-...	46	0.15
155	emb|BX037665.1|CNS09185 Single read from an extremity of a full-...	46	0.15
156	emb|BX037664.1|CNS09184 Single read from an extremity of a full-...	46	0.15
157	emb|BX036410.1|CNS0909A Single read from an extremity of a full-...	46	0.15
158	emb|BX036409.1|CNS09099 Single read from an extremity of a full-...	46	0.15
159	emb|BX035051.1|CNS08Z7J Single read from an extremity of a full-...	46	0.15
160	emb|BX033777.1|CNS08Y85 Single read from an extremity of a full-...	46	0.15
161	emb|BX033776.1|CNS08Y84 Single read from an extremity of a full-...	46	0.15
162	emb|BX033726.1|CNS08Y6Q Single read from an extremity of a full-...	46	0.15
163	emb|BX033086.1|CNS08XOY Single read from an extremity of a full-...	46	0.15
164	emb|BX032914.1|CNS08XK6 Single read from an extremity of a full-...	46	0.15
165	emb|BX032913.1|CNS08XK5 Single read from an extremity of a full-...	46	0.15
166	emb|BX032398.1|CNS08X5U Single read from an extremity of a full-...	46	0.15
167	emb|BX032397.1|CNS08X5T Single read from an extremity of a full-...	46	0.15
168	emb|BX031307.1|CNS08WBJ Single read from an extremity of a full-...	46	0.15
169	emb|BX030422.1|CNS08VMY Single read from an extremity of a full-...	46	0.15
170	emb|BX030095.1|CNS08VDV Single read from an extremity of a full-...	46	0.15
171	emb|BX030094.1|CNS08VDU Single read from an extremity of a full-...	46	0.15
172	emb|BX028661.1|CNS08UA1 Single read from an extremity of a full-...	46	0.15
173	emb|BX027463.1|CNS08TCR Single read from an extremity of a full-...	46	0.15
174	emb|BX027462.1|CNS08TCQ Single read from an extremity of a full-...	46	0.15
175	emb|BX026971.1|CNS08SZ3 Single read from an extremity of a full-...	46	0.15
176	emb|BX026323.1|CNS08SH3 Single read from an extremity of a full-...	46	0.15
177	emb|BX026099.1|CNS08SAV Single read from an extremity of a full-...	46	0.15
178	emb|BX025970.1|CNS08S7A Single read from an extremity of a full-...	46	0.15
179	emb|BX022898.1|CNS08PTY Single read from an extremity of a full-...	46	0.15
180	emb|BX022839.1|CNS08PSB Single read from an extremity of a full-...	46	0.15
181	emb|BX022814.1|CNS08PRM Single read from an extremity of a full-...	46	0.15
182	emb|BX024692.1|CNS08R7S Single read from an extremity of a full-...	46	0.15
183	emb|BX024544.1|CNS08R3O Single read from an extremity of a full-...	46	0.15
184	emb|BX023626.1|CNS08QE6 Single read from an extremity of a full-...	46	0.15
185	emb|BX023558.1|CNS08QCA Single read from an extremity of a full-...	46	0.15
186	emb|BX022610.1|CNS08PLY Single read from an extremity of a full-...	46	0.15
187	emb|BX022499.1|CNS08PIV Single read from an extremity of a full-...	46	0.15
188	emb|BX021000.1|CNS08OD8 Single read from an extremity of a full-...	46	0.15
189	emb|BX020965.1|CNS08OC9 Single read from an extremity of a full-...	46	0.15
190	emb|BX020716.1|CNS08O5C Single read from an extremity of a full-...	46	0.15
191	emb|BX019823.1|CNS08NGJ Single read from an extremity of a full-...	46	0.15
192	emb|BX019178.1|CNS08MYM Single read from an extremity of a full-...	46	0.15
193	emb|BX018850.1|CNS08MPI Single read from an extremity of a full-...	46	0.15
194	emb|BX018223.1|CNS08M83 Single read from an extremity of a full-...	46	0.15
195	emb|BX018222.1|CNS08M82 Single read from an extremity of a full-...	46	0.15
196	emb|BX016569.1|CNS08KY5 Single read from an extremity of a full-...	46	0.15
197	emb|BX015711.1|CNS08KAB Single read from an extremity of a full-...	46	0.15
198	emb|BX013212.1|CNS08ICW Single read from an extremity of a full-...	46	0.15
199	emb|BX013211.1|CNS08ICV Single read from an extremity of a full-...	46	0.15
200	emb|BX011390.1|CNS08GYA Single read from an extremity of a full-...	46	0.15
201	emb|BX010651.1|CNS08GDR Single read from an extremity of a full-...	46	0.15
202	emb|BX010223.1|CNS08G1V Single read from an extremity of a full-...	46	0.15
203	emb|BX007556.1|CNS08DZS Single read from an extremity of a full-...	46	0.15
204	emb|BX007498.1|CNS08DY6 Single read from an extremity of a full-...	46	0.15
205	emb|BX007416.1|CNS08DVW Single read from an extremity of a full-...	46	0.15
206	emb|BX007311.1|CNS08DSZ Single read from an extremity of a full-...	46	0.15
207	emb|BX007293.1|CNS08DSH Single read from an extremity of a full-...	46	0.15
208	gb|AF526203.1| Argopecten irradians isolate iolsaicl5ct12cn12 ri...	46	0.15
209	emb|AJ563476.1|CGI563476 Crassostrea gigas partial mRNA for ribo...	46	0.15
210	ref|XM_313705.2| Anopheles gambiae str. PEST ENSANGP00000017616 ...	46	0.15
211	emb|AJ388522.1|CFA388522 Canis familiaris mRNA for partial Ribos...	46	0.15
212	gb|AY753669.1| Enterobacteria phage D6 immC region, complete seq...	44	0.59
213	emb|AM049064.1| Curculio glandium partial mRNA for ribosomal pro...	44	0.59
214	ref|XM_763259.1| Giardia lamblia ATCC 50803 hypothetical protein...	44	0.59
215	ref|XM_763260.1| Giardia lamblia ATCC 50803 60S ribosomal protei...	44	0.59
216	emb|CT010474.12| Mouse DNA sequence from clone RP23-199B14 on ch...	44	0.59
217	gb|AC131991.8| Mus musculus chromosome 12, clone RP24-190H17, co...	44	0.59
218	ref|XM_518463.1| PREDICTED: Pan troglodytes forkhead box P4 (LOC...	42	2.3
219	ref|NM_138457.2| Homo sapiens forkhead box P4 (FOXP4), transcrip...	42	2.3
220	ref|NM_001012427.1| Homo sapiens forkhead box P4 (FOXP4), transc...	42	2.3
221	ref|NM_001012426.1| Homo sapiens forkhead box P4 (FOXP4), transc...	42	2.3
222	emb|AM049065.1| Meladema coriacea mRNA for ribosomal protein L19...	42	2.3
223	emb|AM049061.1| Biphyllus lunatus partial mRNA for ribosomal pro...	42	2.3
224	emb|Z98949.1|HS125H2 Human DNA sequence from clone CTA-125H2 on ...	42	2.3
225	emb|AL445472.15| Human DNA sequence from clone RP13-137O5 on chr...	42	2.3
226	emb|AL139331.19| Human DNA sequence from clone RP11-328M4 on chr...	42	2.3
227	emb|X53633.1|CTPOX18 C.tropicalis POX18 gene	42	2.3
228	emb|AJ310932.1|HSA310932 Homo sapiens MYO18B gene for myosin hea...	42	2.3
229	gb|AC147541.8| Pan troglodytes clone rp43-31n2, complete sequence	42	2.3
230	gb|AY857433.1| Suberites domuncula L19 mRNA, complete cds	42	2.3
231	gb|AC096533.3| Homo sapiens chromosome 1 clone RP11-6B6, complet...	42	2.3
232	emb|BX120013.5| Zebrafish DNA sequence from clone DKEY-76H10, co...	42	2.3
233	gb|BC052803.1| Homo sapiens forkhead box P4, transcript variant ...	42	2.3
234	dbj|AB080747.1| Homo sapiens hFKHLA mRNA for fork head-related p...	42	2.3
235	gb|BC040962.1| Homo sapiens forkhead box P4, mRNA (cDNA clone MG...	42	2.3
236	gb|M24440.1|YSAPOX18A Candida tropicalis (ATCC 20336)small aleat...	42	2.3
237	dbj|D86472.1| Candida tropicalis pox18-2 gene for PXP-18, comple...	42	2.3
238	gb|AC152944.2| Mus musculus 10 BAC RP23-427I4 (Roswell Park Canc...	40	9.3
239	ref|XM_631874.1| Dictyostelium discoideum hypothetical protein (...	40	9.3
240	gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chr...	40	9.3
241	gb|BC068015.1| Danio rerio zgc:77348, mRNA (cDNA clone MGC:77348...	40	9.3
242	ref|XM_954971.1| Neurospora crassa OR74A hypothetical protein (N...	40	9.3
243	ref|XM_325658.1| Neurospora crassa OR74A hypothetical protein (N...	40	9.3
244	ref|XR_002473.1| PREDICTED: Mus musculus hypothetical LOC631067 ...	40	9.3
245	ref|XM_383288.1| Gibberella zeae PH-1 chromosome 2 hypothetical ...	40	9.3
246	emb|Z81128.2|CET23D8 Caenorhabditis elegans Cosmid T23D8, comple...	40	9.3
247	gb|AC122798.3| Mus musculus BAC clone RP23-301A3 from 2, complet...	40	9.3
248	emb|CR376824.10| Zebrafish DNA sequence from clone DKEY-9P24 in ...	40	9.3
249	ref|XM_862965.1| PREDICTED: Canis familiaris similar to Disabled...	40	9.3
250	ref|XM_862961.1| PREDICTED: Canis familiaris similar to Disabled...	40	9.3
251	ref|XM_536493.2| PREDICTED: Canis familiaris similar to Disabled...	40	9.3
252	gb|AC097354.12| Mus musculus strain 129/Sv clone ct7-297f7 map X...	40	9.3
253	gb|AC116071.5| Rattus norvegicus 3 BAC CH230-230O7 (Children's H...	40	9.3
254	gb|AC090363.16| Homo sapiens chromosome 18, clone RP11-885J19, c...	40	9.3
255	gb|AC103814.2| Homo sapiens chromosome 18, clone CTD-3111I19, co...	40	9.3
256	ref|XM_687486.1| PREDICTED: Danio rerio similar to Forkhead box ...	40	9.3
257	ref|NM_060234.3| Caenorhabditis elegans More Of MS family member...	40	9.3
258	gb|AC096670.1| Homo sapiens BAC clone RP11-438K19 from 2, comple...	40	9.3
259	ref|NM_212963.1| Danio rerio zgc:77348 (zgc:77348), mRNA	40	9.3
260	dbj|BS000015.1| Pan troglodytes chromosome 22 clone:PTB-017F24, ...	40	9.3
261	gb|AF222685.1|AF222685 Homo sapiens chromosome 21 PAC 103K19 map...	40	9.3
262	gb|AF222684.1|AF222684 Homo sapiens chromosome 21 BAC B194B7 map...	40	9.3
263	emb|AL163208.2|HS21C008 Homo sapiens chromosome 21 segment HS21C008	40	9.3
264	dbj|AP002793.4| Homo sapiens genomic DNA, chromosome 11q clone:R...	40	9.3
265	gb|AF013953.1|AF013953 Caenorhabditis elegans mom-5 mRNA, comple...	40	9.3
266	emb|AL928607.8| Mouse DNA sequence from clone RP23-326J18 on chr...	40	9.3
267	emb|CT032692.1| Platynereis dumerilii EST IB0AAA33BD02EM1	40	9.3
268	emb|CT032691.1| Platynereis dumerilii EST IB0AAA33BD02FM1	40	9.3
269	dbj|AP006071.1| Lotus japonicus genomic DNA, chromosome 3, clone...	40	9.3
270	gb|U17250.1|BCSC1 Brassica oleracea ubiquitine conjugating enzym...	40	9.3
271	emb|AL672082.15| Mouse DNA sequence from clone RP23-67B21 on chr...	40	9.3
272	gb|AC123611.7| Mus musculus chromosome 15, clone RP23-345H23, co...	40	9.3

---

>dbj|AK102721.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033105G07, full
           insert sequence
          Length = 914

 Score =  561 bits (283), Expect = e-156
 Identities = 403/443 (90%)
 Strand = Plus / Minus

                                                                       
Query: 230 cttgggccctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttg 289
           |||||||||||||| | |||||||||||||||||||||||| || |||||||||||||||
Sbjct: 649 cttgggccctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttg 590

                                                                       
Query: 290 ctcttggcacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcc 349
           ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 589 ctcttggcacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagcc 530

                                                                       
Query: 350 tttgacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgacc 409
           || |||||||| || ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 529 ttagacttgtggatactttccataagaacacgcttgttcttgaacatgttacccttgacc 470

                                                                       
Query: 410 ttcaagtacatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcgg 469
           |||| |||||||||||| |||||||||||||| |||||||| || ||||| |||||||| 
Sbjct: 469 ttcatgtacatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgc 410

                                                                       
Query: 470 agcaggcgtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcc 529
           ||||  || |||||||| |||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 409 agcaaacgcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcc 350

                                                                       
Query: 530 tcccttgtacccctgcgcttaccatatccagaatggcggcccttctgttttgcctcgtgg 589
           |||||||||||||| ||||||||||| ||||| || || |||||||| || ||||| |||
Sbjct: 349 tcccttgtacccctacgcttaccatagccagagtgacgtcccttctgcttagcctcatgg 290

                                                                       
Query: 590 gctctgcgtgcacgggaccttgagtggatcttttggggcttcttgatgatgaagccatcc 649
           ||||| ||||| |||||||| ||||| ||||| |||||||||||||||||||| ||||||
Sbjct: 289 gctctccgtgctcgggacctggagtgaatcttctggggcttcttgatgatgaatccatcc 230

                                  
Query: 650 ttcaccaactttcgaatgttctg 672
           || |||||||| || ||||||||
Sbjct: 229 ttgaccaacttacggatgttctg 207



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 171 ttcacttctttgacttctttggtgccgctgcaggttgagcaggagctgc 219
           |||||||||||| |||||| ||||||||||||| |||||||||||||||
Sbjct: 720 ttcacttctttgccttcttaggtgccgctgcagtttgagcaggagctgc 672

---

>dbj|AK059309.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-G06, full
           insert sequence
          Length = 1121

 Score =  561 bits (283), Expect = e-156
 Identities = 403/443 (90%)
 Strand = Plus / Minus

                                                                       
Query: 230 cttgggccctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttg 289
           |||||||||||||| | |||||||||||||||||||||||| || |||||||||||||||
Sbjct: 650 cttgggccctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttg 591

                                                                       
Query: 290 ctcttggcacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcc 349
           ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||
Sbjct: 590 ctcttggcacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagcc 531

                                                                       
Query: 350 tttgacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgacc 409
           || |||||||| || ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 530 ttagacttgtggatactttccataagaacacgcttgttcttgaacatgttacccttgacc 471

                                                                       
Query: 410 ttcaagtacatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcgg 469
           |||| |||||||||||| |||||||||||||| |||||||| || ||||| |||||||| 
Sbjct: 470 ttcatgtacatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgc 411

                                                                       
Query: 470 agcaggcgtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcc 529
           ||||  || |||||||| |||||||||||||||||||| ||||||||||| |||||||||
Sbjct: 410 agcaaacgcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcc 351

                                                                       
Query: 530 tcccttgtacccctgcgcttaccatatccagaatggcggcccttctgttttgcctcgtgg 589
           |||||||||||||| ||||||||||| ||||| || || |||||||| || ||||| |||
Sbjct: 350 tcccttgtacccctacgcttaccatagccagagtgacgtcccttctgcttagcctcatgg 291

                                                                       
Query: 590 gctctgcgtgcacgggaccttgagtggatcttttggggcttcttgatgatgaagccatcc 649
           ||||| ||||| |||||||| ||||| ||||| |||||||||||||||||||| ||||||
Sbjct: 290 gctctccgtgctcgggacctggagtgaatcttctggggcttcttgatgatgaatccatcc 231

                                  
Query: 650 ttcaccaactttcgaatgttctg 672
           || |||||||| || ||||||||
Sbjct: 230 ttgaccaacttacggatgttctg 208



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 171 ttcacttctttgacttctttggtgccgctgcaggttgagcaggagctgc 219
           |||||||||||| |||||| ||||||||||||| |||||||||||||||
Sbjct: 721 ttcacttctttgccttcttaggtgccgctgcagtttgagcaggagctgc 673

---

>gb|AY103679.1| Zea mays PCO152526 mRNA sequence
          Length = 1051

 Score =  464 bits (234), Expect = e-127
 Identities = 393/446 (88%)
 Strand = Plus / Minus

                                                                       
Query: 230 cttgggccctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttg 289
           ||||||||||| || ||||||||||||||||| |||||||| || |||||||||||||||
Sbjct: 635 cttgggccctgggccagcctctcctccctcctagcaatcttcctctcacggcttgccttg 576

                                                                       
Query: 290 ctcttggcacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcc 349
           ||||| |||||||| ||||||||||| ||||| || ||||||||||| ||||||||||||
Sbjct: 575 ctctttgcacgcttggcctcaaactgatcagaaagtgtcttctctctggccttctcagcc 516

                                                                       
Query: 350 tttgacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgacc 409
           || |||||||| || || ||||||||||| | ||||||||| ||||| ||||||||||||
Sbjct: 515 ttggacttgtggatactctccataagcaccctcttgttcttaaacatattacccttgacc 456

                                                                       
Query: 410 ttcaagtacatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcgg 469
           |||| |||||||||||| ||||||||||||||||||||||| || |||||||||||||||
Sbjct: 455 ttcatgtacatgtcatgatacatgtgcttgtcgatcttcttggcctcacggtacttgcgg 396

                                                                       
Query: 470 agcaggcgtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcc 529
           |||||||| || || || |||||||||||||||||||||||||||||||| |||||||||
Sbjct: 395 agcaggcgcctcagaacacgcatcctcctcatccacagaatcttggtggggagcctagcc 336

                                                                       
Query: 530 tcccttgtacccctgcgcttaccatatccagaatggcggcccttctgttttgcctcgtgg 589
           ||||| |||||||||||||| || |||||||| || |  |||||||| || ||||| || 
Sbjct: 335 tccctggtacccctgcgcttgccgtatccagagtgccttcccttctgcttggcctcatgt 276

                                                                       
Query: 590 gctctgcgtgcacgggaccttgagtggatcttttggggcttcttgatgatgaagccatcc 649
           || || | |||||||||||| ||||| | ||| || |||||| ||||||| || ||||||
Sbjct: 275 gcccttcttgcacgggacctagagtgaaccttctgaggcttcctgatgataaacccatcc 216

                                     
Query: 650 ttcaccaactttcgaatgttctggcg 675
           || |||||||| || |||||||||||
Sbjct: 215 ttaaccaacttccggatgttctggcg 190

---

>gb|AF542969.2| Triticum aestivum ribosomal protein L19 mRNA, complete cds
          Length = 854

 Score =  454 bits (229), Expect = e-124
 Identities = 376/425 (88%)
 Strand = Plus / Minus

                                                                       
Query: 248 ctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcc 307
           ||||||||||||||||||||||| || || | |||||||||||||||||| ||||| |||
Sbjct: 555 ctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcgcgcttggcc 496

                                                                       
Query: 308 tcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctt 367
           ||||||||||||||||| ||||||||||| |||||||||||||| |||||||| || || 
Sbjct: 495 tcaaactggtcagagagggtcttctctcttgccttctcagccttggacttgtggatactc 436

                                                                       
Query: 368 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 427
           ||||| || || | ||||||||||||||||||||| |||||||||| |||||||||||||
Sbjct: 435 tccatgaggaccctcttgttcttgaacatgttacctttgaccttcaggtacatgtcatgg 376

                                                                       
Query: 428 tacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacg 487
           ||||||||||||||||||||||| || |||||||||||||| || ||||| || || |||
Sbjct: 375 tacatgtgcttgtcgatcttcttggcctcacggtacttgcgcagaaggcgcctcaggacg 316

                                                                       
Query: 488 cgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttgtacccctgcgc 547
           |||||||||| ||||||||| ||||||||||| |||||||||||||| |||||||| |||
Sbjct: 315 cgcatcctccgcatccacaggatcttggtggggagcctagcctccctggtacccctacgc 256

                                                                       
Query: 548 ttaccatatccagaatggcggcccttctgttttgcctcgtgggctctgcgtgcacgggac 607
           |||||||||||||| || ||||||||||| || ||||| || || || | |||||| |||
Sbjct: 255 ttaccatatccagagtgacggcccttctgcttggcctcatgtgccctccttgcacgagac 196

                                                                       
Query: 608 cttgagtggatcttttggggcttcttgatgatgaagccatccttcaccaactttcgaatg 667
           || ||||||||||| || |||||| |||||||||| |||||||| |||| ||| || |||
Sbjct: 195 ctggagtggatcttctgaggcttcctgatgatgaaaccatcctttaccagcttccggatg 136

                
Query: 668 ttctg 672
           |||||
Sbjct: 135 ttctg 131



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 170 cttcacttctttgacttctttggtgccgc 198
           ||||||||||| | |||||||||||||||
Sbjct: 640 cttcacttcttggccttctttggtgccgc 612

---

>gb|BT016919.1| Zea mays clone E04912701B11.c mRNA sequence
          Length = 974

 Score =  438 bits (221), Expect = e-119
 Identities = 389/445 (87%)
 Strand = Plus / Plus

                                                                       
Query: 231 ttgggccctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgc 290
           |||||||||| || ||||| ||||||||||| | |||||| ||||||||| |||||||||
Sbjct: 327 ttgggccctgggccagcctttcctccctcctagaaatcttcctttcacgggttgccttgc 386

                                                                       
Query: 291 tcttggcacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcct 350
           |||| |||||||| ||||||||||| ||| | || ||||||||||| |||||||||||||
Sbjct: 387 tctttgcacgcttggcctcaaactgatcaaaaagtgtcttctctctggccttctcagcct 446

                                                                       
Query: 351 ttgacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgacct 410
           | |||||||| || || ||||||||||| | ||||||||| ||||| |||||||||||||
Sbjct: 447 tggacttgtggatactctccataagcaccctcttgttcttaaacatattacccttgacct 506

                                                                       
Query: 411 tcaagtacatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcgga 470
           ||| |||||||||||| |||||||||||| |||||||||| || ||||||||||||||||
Sbjct: 507 tcatgtacatgtcatgatacatgtgcttggcgatcttcttggcctcacggtacttgcgga 566

                                                                       
Query: 471 gcaggcgtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcct 530
           ||||||| || || || |||||||||||||||||||||||||||||||| ||||||||||
Sbjct: 567 gcaggcgcctcagaacacgcatcctcctcatccacagaatcttggtggggagcctagcct 626

                                                                       
Query: 531 cccttgtacccctgcgcttaccatatccagaatggcggcccttctgttttgcctcgtggg 590
           |||| |||||||||||||| ||||||||||| || |  |||||||| || ||||| || |
Sbjct: 627 ccctggtacccctgcgcttgccatatccagagtgccttcccttctgcttggcctcatgtg 686

                                                                       
Query: 591 ctctgcgtgcacgggaccttgagtggatcttttggggcttcttgatgatgaagccatcct 650
           | || | |||||||||||| ||||| | ||| || |||||| ||||||| || |||||||
Sbjct: 687 cccttcttgcacgggacctagagtgaaccttctgaggcttcctgatgataaacccatcct 746

                                    
Query: 651 tcaccaactttcgaatgttctggcg 675
           | |||||||| || |||||||||||
Sbjct: 747 taaccaacttccggatgttctggcg 771

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  436 bits (220), Expect = e-119
 Identities = 292/316 (92%)
 Strand = Plus / Plus

                                                                            
Query: 237      cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 296
                ||||||| | |||||||||||||||||||||||| || ||||||||||||||||||||||
Sbjct: 12517448 cctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttgctcttgg 12517507

                                                                            
Query: 297      cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 356
                |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 12517508 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 12517567

                                                                            
Query: 357      tgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagt 416
                |||| || ||||||||||| ||||||||||||||||||||||||||||||||||||| ||
Sbjct: 12517568 tgtggatactttccataagaacacgcttgttcttgaacatgttacccttgaccttcatgt 12517627

                                                                            
Query: 417      acatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggc 476
                |||||||||| |||||||||||||| |||||||| || ||||| |||||||| ||||  |
Sbjct: 12517628 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 12517687

                                                                            
Query: 477      gtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttg 536
                | |||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||
Sbjct: 12517688 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctcccttg 12517747

                                
Query: 537      tacccctgcgcttacc 552
                ||||||| ||||||||
Sbjct: 12517748 tacccctacgcttacc 12517763



 Score =  381 bits (192), Expect = e-102
 Identities = 285/316 (90%)
 Strand = Plus / Plus

                                                                            
Query: 237      cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 296
                ||||||| | |||||| || | |||||||||||| || ||||| || |||||||||||||
Sbjct: 21047190 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 21047249

                                                                            
Query: 297      cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 356
                |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 21047250 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 21047309

                                                                            
Query: 357      tgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagt 416
                |||| || |||||||| || ||||||||||||||||||||||||||||||||||||| ||
Sbjct: 21047310 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 21047369

                                                                            
Query: 417      acatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggc 476
                |||||||||| |||||||||||||| |||||||| || ||||| |||||||| ||||  |
Sbjct: 21047370 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 21047429

                                                                            
Query: 477      gtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttg 536
                | |||||||| |||||||||||||||||||| ||||||||||| |||||||||||||| |
Sbjct: 21047430 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 21047489

                                
Query: 537      tacccctgcgcttacc 552
                ||||||| ||||||||
Sbjct: 21047490 tacccctacgcttacc 21047505



 Score =  117 bits (59), Expect = 5e-23
 Identities = 107/123 (86%)
 Strand = Plus / Plus

                                                                            
Query: 550      accatatccagaatggcggcccttctgttttgcctcgtgggctctgcgtgcacgggacct 609
                |||||| ||||| || || |||||||| || ||||| |||||||| ||||||||||||||
Sbjct: 21047582 accatagccagagtgacgtcccttctgcttggcctcatgggctctccgtgcacgggacct 21047641

                                                                            
Query: 610      tgagtggatcttttggggcttcttgatgatgaagccatccttcaccaactttcgaatgtt 669
                 ||||| ||||| |||||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 21047642 ggagtgaatcttctggggcttcttgataatgaacccatccttgaccaacttacggatgtt 21047701

                   
Query: 670      ctg 672
                |||
Sbjct: 21047702 ctg 21047704



 Score =  117 bits (59), Expect = 5e-23
 Identities = 107/123 (86%)
 Strand = Plus / Plus

                                                                            
Query: 550      accatatccagaatggcggcccttctgttttgcctcgtgggctctgcgtgcacgggacct 609
                |||||| ||||| || || |||||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 12517843 accatagccagagtgacgtcccttctgcttagcctcatgggctctccgtgctcgggacct 12517902

                                                                            
Query: 610      tgagtggatcttttggggcttcttgatgatgaagccatccttcaccaactttcgaatgtt 669
                 ||||| ||||| |||||||||||||||||||| |||||||| |||||||| || |||||
Sbjct: 12517903 ggagtgaatcttctggggcttcttgatgatgaatccatccttgaccaacttacggatgtt 12517962

                   
Query: 670      ctg 672
                |||
Sbjct: 12517963 ctg 12517965



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 196      cgctgcaggttgagcaggagctgc 219
                |||||||| |||||||||||||||
Sbjct: 12517154 cgctgcagtttgagcaggagctgc 12517177

---

>gb|AC134885.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1125B03,
             from chromosome 3, complete sequence
          Length = 124550

 Score =  436 bits (220), Expect = e-119
 Identities = 292/316 (92%)
 Strand = Plus / Minus

                                                                         
Query: 237   cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 296
             ||||||| | |||||||||||||||||||||||| || ||||||||||||||||||||||
Sbjct: 70493 cctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttgctcttgg 70434

                                                                         
Query: 297   cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 356
             |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 70433 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 70374

                                                                         
Query: 357   tgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagt 416
             |||| || ||||||||||| ||||||||||||||||||||||||||||||||||||| ||
Sbjct: 70373 tgtggatactttccataagaacacgcttgttcttgaacatgttacccttgaccttcatgt 70314

                                                                         
Query: 417   acatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggc 476
             |||||||||| |||||||||||||| |||||||| || ||||| |||||||| ||||  |
Sbjct: 70313 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 70254

                                                                         
Query: 477   gtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttg 536
             | |||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||
Sbjct: 70253 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctcccttg 70194

                             
Query: 537   tacccctgcgcttacc 552
             ||||||| ||||||||
Sbjct: 70193 tacccctacgcttacc 70178



 Score =  117 bits (59), Expect = 5e-23
 Identities = 107/123 (86%)
 Strand = Plus / Minus

                                                                         
Query: 550   accatatccagaatggcggcccttctgttttgcctcgtgggctctgcgtgcacgggacct 609
             |||||| ||||| || || |||||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 70098 accatagccagagtgacgtcccttctgcttagcctcatgggctctccgtgctcgggacct 70039

                                                                         
Query: 610   tgagtggatcttttggggcttcttgatgatgaagccatccttcaccaactttcgaatgtt 669
              ||||| ||||| |||||||||||||||||||| |||||||| |||||||| || |||||
Sbjct: 70038 ggagtgaatcttctggggcttcttgatgatgaatccatccttgaccaacttacggatgtt 69979

                
Query: 670   ctg 672
             |||
Sbjct: 69978 ctg 69976



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 196   cgctgcaggttgagcaggagctgc 219
             |||||||| |||||||||||||||
Sbjct: 70787 cgctgcagtttgagcaggagctgc 70764

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  436 bits (220), Expect = e-119
 Identities = 292/316 (92%)
 Strand = Plus / Plus

                                                                            
Query: 237      cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 296
                ||||||| | |||||||||||||||||||||||| || ||||||||||||||||||||||
Sbjct: 12514211 cctgagccaacctctcctccctcctggcaatcttcctctcacggcttgccttgctcttgg 12514270

                                                                            
Query: 297      cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 356
                |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 12514271 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 12514330

                                                                            
Query: 357      tgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagt 416
                |||| || ||||||||||| ||||||||||||||||||||||||||||||||||||| ||
Sbjct: 12514331 tgtggatactttccataagaacacgcttgttcttgaacatgttacccttgaccttcatgt 12514390

                                                                            
Query: 417      acatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggc 476
                |||||||||| |||||||||||||| |||||||| || ||||| |||||||| ||||  |
Sbjct: 12514391 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 12514450

                                                                            
Query: 477      gtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttg 536
                | |||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||
Sbjct: 12514451 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctcccttg 12514510

                                
Query: 537      tacccctgcgcttacc 552
                ||||||| ||||||||
Sbjct: 12514511 tacccctacgcttacc 12514526



 Score =  381 bits (192), Expect = e-102
 Identities = 285/316 (90%)
 Strand = Plus / Plus

                                                                            
Query: 237      cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 296
                ||||||| | |||||| || | |||||||||||| || ||||| || |||||||||||||
Sbjct: 21040219 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 21040278

                                                                            
Query: 297      cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 356
                |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 21040279 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 21040338

                                                                            
Query: 357      tgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagt 416
                |||| || |||||||| || ||||||||||||||||||||||||||||||||||||| ||
Sbjct: 21040339 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 21040398

                                                                            
Query: 417      acatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggc 476
                |||||||||| |||||||||||||| |||||||| || ||||| |||||||| ||||  |
Sbjct: 21040399 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 21040458

                                                                            
Query: 477      gtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttg 536
                | |||||||| |||||||||||||||||||| ||||||||||| |||||||||||||| |
Sbjct: 21040459 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 21040518

                                
Query: 537      tacccctgcgcttacc 552
                ||||||| ||||||||
Sbjct: 21040519 tacccctacgcttacc 21040534



 Score =  117 bits (59), Expect = 5e-23
 Identities = 107/123 (86%)
 Strand = Plus / Plus

                                                                            
Query: 550      accatatccagaatggcggcccttctgttttgcctcgtgggctctgcgtgcacgggacct 609
                |||||| ||||| || || |||||||| || ||||| |||||||| ||||||||||||||
Sbjct: 21040611 accatagccagagtgacgtcccttctgcttggcctcatgggctctccgtgcacgggacct 21040670

                                                                            
Query: 610      tgagtggatcttttggggcttcttgatgatgaagccatccttcaccaactttcgaatgtt 669
                 ||||| ||||| |||||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 21040671 ggagtgaatcttctggggcttcttgataatgaacccatccttgaccaacttacggatgtt 21040730

                   
Query: 670      ctg 672
                |||
Sbjct: 21040731 ctg 21040733



 Score =  117 bits (59), Expect = 5e-23
 Identities = 107/123 (86%)
 Strand = Plus / Plus

                                                                            
Query: 550      accatatccagaatggcggcccttctgttttgcctcgtgggctctgcgtgcacgggacct 609
                |||||| ||||| || || |||||||| || ||||| |||||||| ||||| ||||||||
Sbjct: 12514606 accatagccagagtgacgtcccttctgcttagcctcatgggctctccgtgctcgggacct 12514665

                                                                            
Query: 610      tgagtggatcttttggggcttcttgatgatgaagccatccttcaccaactttcgaatgtt 669
                 ||||| ||||| |||||||||||||||||||| |||||||| |||||||| || |||||
Sbjct: 12514666 ggagtgaatcttctggggcttcttgatgatgaatccatccttgaccaacttacggatgtt 12514725

                   
Query: 670      ctg 672
                |||
Sbjct: 12514726 ctg 12514728



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 196      cgctgcaggttgagcaggagctgc 219
                |||||||| |||||||||||||||
Sbjct: 12513917 cgctgcagtttgagcaggagctgc 12513940

---

>gb|BT019233.1| Zea mays clone Contig906.F mRNA sequence
          Length = 1470

 Score =  406 bits (205), Expect = e-110
 Identities = 373/429 (86%)
 Strand = Plus / Plus

                                                                       
Query: 247 cctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagc 306
           ||||||||||||||| || ||||| || |||||||| |||||||||||||| ||||| ||
Sbjct: 289 cctctcctccctcctagcgatcttcctctcacggctcgccttgctcttggcgcgcttggc 348

                                                                       
Query: 307 ctcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgct 366
           ||||||||||||||| || ||||||||||| |||||||||||||| |||||||| || ||
Sbjct: 349 ctcaaactggtcagaaagtgtcttctctctggccttctcagccttggacttgtggatact 408

                                                                       
Query: 367 ttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatg 426
            ||||||||||| | ||||||||||||   |||||| |||||||||| ||||||||||||
Sbjct: 409 ctccataagcaccctcttgttcttgaaggcgttacctttgaccttcatgtacatgtcatg 468

                                                                       
Query: 427 gtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcac 486
            |||||||||||||| |||||||| || ||||| ||||||||||| ||||| || |||||
Sbjct: 469 atacatgtgcttgtcaatcttcttggcctcacgatacttgcggagaaggcgcctcagcac 528

                                                                       
Query: 487 gcgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttgtacccctgcg 546
            |||||||||||||||||||||| ||||||||| |||||||||||||| |||||||| ||
Sbjct: 529 acgcatcctcctcatccacagaaccttggtgggtagcctagcctccctggtacccctacg 588

                                                                       
Query: 547 cttaccatatccagaatggcggcccttctgttttgcctcgtgggctctgcgtgcacggga 606
           |||||||||||| || ||||| ||||| || || || || || || || | |||||||||
Sbjct: 589 cttaccatatcctgagtggcgtcccttttgcttggcgtcatgtgcccttcttgcacggga 648

                                                                       
Query: 607 ccttgagtggatcttttggggcttcttgatgatgaagccatccttcaccaactttcgaat 666
            || ||||||||||| || |||||||||||||| || |||||||| |||||||| || ||
Sbjct: 649 tctagagtggatcttatgaggcttcttgatgataaacccatccttaaccaacttccggat 708

                    
Query: 667 gttctggcg 675
            ||||||||
Sbjct: 709 attctggcg 717

---

>gb|BT016537.1| Zea mays clone Contig370 mRNA sequence
          Length = 956

 Score =  406 bits (205), Expect = e-110
 Identities = 373/429 (86%)
 Strand = Plus / Minus

                                                                       
Query: 247 cctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagc 306
           ||||||||||||||| || ||||| || |||||||| |||||||||||||| ||||| ||
Sbjct: 727 cctctcctccctcctagcgatcttcctctcacggctcgccttgctcttggcgcgcttggc 668

                                                                       
Query: 307 ctcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgct 366
           ||||||||||||||| || ||||||||||| |||||||||||||| |||||||| || ||
Sbjct: 667 ctcaaactggtcagaaagtgtcttctctctggccttctcagccttggacttgtggatact 608

                                                                       
Query: 367 ttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatg 426
            ||||||||||| | ||||||||||||   |||||| |||||||||| ||||||||||||
Sbjct: 607 ctccataagcaccctcttgttcttgaaggcgttacctttgaccttcatgtacatgtcatg 548

                                                                       
Query: 427 gtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcac 486
            |||||||||||||| |||||||| || ||||| ||||||||||| ||||| || |||||
Sbjct: 547 atacatgtgcttgtcaatcttcttggcctcacgatacttgcggagaaggcgcctcagcac 488

                                                                       
Query: 487 gcgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttgtacccctgcg 546
            |||||||||||||||||||||| ||||||||| |||||||||||||| |||||||| ||
Sbjct: 487 acgcatcctcctcatccacagaaccttggtgggtagcctagcctccctggtacccctacg 428

                                                                       
Query: 547 cttaccatatccagaatggcggcccttctgttttgcctcgtgggctctgcgtgcacggga 606
           |||||||||||| || ||||| ||||| || || || || || || || | |||||||||
Sbjct: 427 cttaccatatcctgagtggcgtcccttttgcttggcgtcatgtgcccttcttgcacggga 368

                                                                       
Query: 607 ccttgagtggatcttttggggcttcttgatgatgaagccatccttcaccaactttcgaat 666
            || ||||||||||| || |||||||||||||| || |||||||| |||||||| || ||
Sbjct: 367 tctagagtggatcttatgaggcttcttgatgataaacccatccttaaccaacttccggat 308

                    
Query: 667 gttctggcg 675
            ||||||||
Sbjct: 307 attctggcg 299

---

>gb|AY103638.1| Zea mays PCO153348 mRNA sequence
          Length = 1258

 Score =  406 bits (205), Expect = e-110
 Identities = 373/429 (86%)
 Strand = Plus / Minus

                                                                       
Query: 247 cctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagc 306
           ||||||||||||||| || ||||| || |||||||| |||||||||||||| ||||| ||
Sbjct: 922 cctctcctccctcctagcgatcttcctctcacggctcgccttgctcttggcgcgcttggc 863

                                                                       
Query: 307 ctcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgct 366
           ||||||||||||||| || ||||||||||| |||||||||||||| |||||||| || ||
Sbjct: 862 ctcaaactggtcagaaagtgtcttctctctggccttctcagccttggacttgtggatact 803

                                                                       
Query: 367 ttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatg 426
            ||||||||||| | ||||||||||||   |||||| |||||||||| ||||||||||||
Sbjct: 802 ctccataagcaccctcttgttcttgaaggcgttacctttgaccttcatgtacatgtcatg 743

                                                                       
Query: 427 gtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcac 486
            |||||||||||||| |||||||| || ||||| ||||||||||| ||||| || |||||
Sbjct: 742 atacatgtgcttgtcaatcttcttggcctcacgatacttgcggagaaggcgcctcagcac 683

                                                                       
Query: 487 gcgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttgtacccctgcg 546
            |||||||||||||||||||||| ||||||||| |||||||||||||| |||||||| ||
Sbjct: 682 acgcatcctcctcatccacagaaccttggtgggtagcctagcctccctggtacccctacg 623

                                                                       
Query: 547 cttaccatatccagaatggcggcccttctgttttgcctcgtgggctctgcgtgcacggga 606
           |||||||||||| || ||||| ||||| || || || || || || || | |||||||||
Sbjct: 622 cttaccatatcctgagtggcgtcccttttgcttggcgtcatgtgcccttcttgcacggga 563

                                                                       
Query: 607 ccttgagtggatcttttggggcttcttgatgatgaagccatccttcaccaactttcgaat 666
            || ||||||||||| || |||||||||||||| || |||||||| |||||||| || ||
Sbjct: 562 tctagagtggatcttatgaggcttcttgatgataaacccatccttaaccaacttccggat 503

                    
Query: 667 gttctggcg 675
            ||||||||
Sbjct: 502 attctggcg 494

---

>gb|BT016443.1| Zea mays clone Contig276 mRNA sequence
          Length = 779

 Score =  385 bits (194), Expect = e-103
 Identities = 383/446 (85%)
 Strand = Plus / Minus

                                                                       
Query: 230 cttgggccctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttg 289
           ||||||||||| || |||||||| |||||||| ||| |||| || || || || ||||||
Sbjct: 589 cttgggccctgggccagcctctcttccctcctagcattcttcctctcgcgactcgccttg 530

                                                                       
Query: 290 ctcttggcacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcc 349
           |||||||| ||| | ||||| ||||| || |||||||||||||| || ||||||||||||
Sbjct: 529 ctcttggcgcgcctggcctcgaactgatcggagagcgtcttctccctggccttctcagcc 470

                                                                       
Query: 350 tttgacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgacc 409
           || |||||||| ||||| ||||||||||| | |||||||||||||  |||||| ||||||
Sbjct: 469 ttggacttgtggatgctctccataagcaccctcttgttcttgaacgagttacctttgacc 410

                                                                       
Query: 410 ttcaagtacatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcgg 469
           |||| |||||| || |||||||||||||||||||||||||| || || ||||||||||||
Sbjct: 409 ttcatgtacatatcgtggtacatgtgcttgtcgatcttcttggcctcgcggtacttgcgg 350

                                                                       
Query: 470 agcaggcgtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcc 529
           |||||||| || |||||||||||||||||||||||||| | ||||||||| |||||||||
Sbjct: 349 agcaggcgcctcagcacgcgcatcctcctcatccacagtaccttggtggggagcctagcc 290

                                                                       
Query: 530 tcccttgtacccctgcgcttaccatatccagaatggcggcccttctgttttgcctcgtgg 589
           ||||| ||||| || ||||| |||||||| || || || |||||||| || |||||||| 
Sbjct: 289 tccctggtacctctacgcttcccatatcctgagtgccgtcccttctgcttagcctcgtgc 230

                                                                       
Query: 590 gctctgcgtgcacgggaccttgagtggatcttttggggcttcttgatgatgaagccatcc 649
           || || | |||||| || || |||||||| || || |||||||||||||| || ||||||
Sbjct: 229 gcccttcttgcacgagatctagagtggattttctgaggcttcttgatgataaacccatcc 170

                                     
Query: 650 ttcaccaactttcgaatgttctggcg 675
           || |||||||| || ||||| |||||
Sbjct: 169 ttaaccaacttccggatgttatggcg 144

---

>gb|AC147962.1| Oryza sativa chromosome 3 BAC OSJNBa0083K01 genomic sequence, complete
             sequence
          Length = 167239

 Score =  381 bits (192), Expect = e-102
 Identities = 285/316 (90%)
 Strand = Plus / Minus

                                                                         
Query: 237   cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 296
             ||||||| | |||||| || | |||||||||||| || ||||| || |||||||||||||
Sbjct: 38088 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 38029

                                                                         
Query: 297   cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 356
             |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 38028 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 37969

                                                                         
Query: 357   tgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagt 416
             |||| || |||||||| || ||||||||||||||||||||||||||||||||||||| ||
Sbjct: 37968 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 37909

                                                                         
Query: 417   acatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggc 476
             |||||||||| |||||||||||||| |||||||| || ||||| |||||||| ||||  |
Sbjct: 37908 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 37849

                                                                         
Query: 477   gtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttg 536
             | |||||||| |||||||||||||||||||| ||||||||||| |||||||||||||| |
Sbjct: 37848 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 37789

                             
Query: 537   tacccctgcgcttacc 552
             ||||||| ||||||||
Sbjct: 37788 tacccctacgcttacc 37773



 Score =  117 bits (59), Expect = 5e-23
 Identities = 107/123 (86%)
 Strand = Plus / Minus

                                                                         
Query: 550   accatatccagaatggcggcccttctgttttgcctcgtgggctctgcgtgcacgggacct 609
             |||||| ||||| || || |||||||| || ||||| |||||||| ||||||||||||||
Sbjct: 37696 accatagccagagtgacgtcccttctgcttggcctcatgggctctccgtgcacgggacct 37637

                                                                         
Query: 610   tgagtggatcttttggggcttcttgatgatgaagccatccttcaccaactttcgaatgtt 669
              ||||| ||||| |||||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 37636 ggagtgaatcttctggggcttcttgataatgaacccatccttgaccaacttacggatgtt 37577

                
Query: 670   ctg 672
             |||
Sbjct: 37576 ctg 37574

---

>gb|AC128645.5| Oryza sativa chromosome 3 BAC OSJNBb0016P23 genomic sequence, complete
             sequence
          Length = 131250

 Score =  381 bits (192), Expect = e-102
 Identities = 285/316 (90%)
 Strand = Plus / Plus

                                                                         
Query: 237   cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 296
             ||||||| | |||||| || | |||||||||||| || ||||| || |||||||||||||
Sbjct: 24946 cctgagccaacctctcgtcacgcctggcaatcttcctctcacgactggccttgctcttgg 25005

                                                                         
Query: 297   cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 356
             |||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 25006 cacgcttagcctcaaactggtcagagagtgtcttctctcttgccttctcagccttagact 25065

                                                                         
Query: 357   tgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagt 416
             |||| || |||||||| || ||||||||||||||||||||||||||||||||||||| ||
Sbjct: 25066 tgtggatactttccatgagaacacgcttgttcttgaacatgttacccttgaccttcatgt 25125

                                                                         
Query: 417   acatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggc 476
             |||||||||| |||||||||||||| |||||||| || ||||| |||||||| ||||  |
Sbjct: 25126 acatgtcatgatacatgtgcttgtcaatcttcttggcctcacgatacttgcgcagcaaac 25185

                                                                         
Query: 477   gtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttg 536
             | |||||||| |||||||||||||||||||| ||||||||||| |||||||||||||| |
Sbjct: 25186 gcctgagcacacgcatcctcctcatccacaggatcttggtggggagcctagcctccctgg 25245

                             
Query: 537   tacccctgcgcttacc 552
             ||||||| ||||||||
Sbjct: 25246 tacccctacgcttacc 25261



 Score =  117 bits (59), Expect = 5e-23
 Identities = 107/123 (86%)
 Strand = Plus / Plus

                                                                         
Query: 550   accatatccagaatggcggcccttctgttttgcctcgtgggctctgcgtgcacgggacct 609
             |||||| ||||| || || |||||||| || ||||| |||||||| ||||||||||||||
Sbjct: 25338 accatagccagagtgacgtcccttctgcttggcctcatgggctctccgtgcacgggacct 25397

                                                                         
Query: 610   tgagtggatcttttggggcttcttgatgatgaagccatccttcaccaactttcgaatgtt 669
              ||||| ||||| |||||||||||||| ||||| |||||||| |||||||| || |||||
Sbjct: 25398 ggagtgaatcttctggggcttcttgataatgaacccatccttgaccaacttacggatgtt 25457

                
Query: 670   ctg 672
             |||
Sbjct: 25458 ctg 25460

---

>gb|AY104244.1| Zea mays PCO075323 mRNA sequence
          Length = 924

 Score =  353 bits (178), Expect = 5e-94
 Identities = 379/446 (84%)
 Strand = Plus / Minus

                                                                       
Query: 227 tcccttgggccctgagcaagcctctcctccctcctggcaatctttctttcacggcttgcc 286
           ||||||||||||||||| |  |||||||||||||| ||||||||||| ||||||   |||
Sbjct: 632 tcccttgggccctgagccaatctctcctccctccttgcaatctttctctcacgggaagcc 573

                                                                       
Query: 287 ttgctcttggcacgcttagcctcaaactggtcagagagcgtcttctctctagccttctca 346
           ||||||||||| ||||| ||||||||||| || ||||| ||||||||||| |||||||| 
Sbjct: 572 ttgctcttggctcgcttggcctcaaactgatccgagagagtcttctctctggccttctcg 513

                                                                       
Query: 347 gcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttg 406
           |||||||||||||| ||||| ||||| || || | ||| || || |||||||| || || 
Sbjct: 512 gcctttgacttgtggatgctctccatgagtaccctcttatttttaaacatgtttcctttt 453

                                                                       
Query: 407 accttcaagtacatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttg 466
           || ||||  ||||| || ||||||||||| |||||||| |||||||||||||| ||||||
Sbjct: 452 actttcatatacatatcgtggtacatgtgtttgtcgattttctttgcttcacgatacttg 393

                                                                       
Query: 467 cggagcaggcgtctgagcacgcgcatcctcctcatccacagaatcttggtgggaagccta 526
           || ||||| || ||||| || |||||||| | |||||| || ||||||||||| ||||||
Sbjct: 392 cgcagcagacgcctgaggacacgcatcctgcgcatccaaaggatcttggtggggagccta 333

                                                                       
Query: 527 gcctcccttgtacccctgcgcttaccatatccagaatggcggcccttctgttttgcctcg 586
           |||||||| ||||||||||||||||| || ||||| || |  |||||||| || ||||| 
Sbjct: 332 gcctccctggtacccctgcgcttaccgtaaccagagtgcctccccttctgcttggcctca 273

                                                                       
Query: 587 tgggctctgcgtgcacgggaccttgagtggatcttttggggcttcttgatgatgaagcca 646
           ||||| || | ||| ||||||||||||||||| || || |||||||| || ||||| |||
Sbjct: 272 tgggccctccttgcccgggaccttgagtggattttctgtggcttcttaattatgaatcca 213

                                     
Query: 647 tccttcaccaactttcgaatgttctg 672
           |||||||||| ||| |||||||||||
Sbjct: 212 tccttcaccagcttacgaatgttctg 187



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 171 ttcacttctttgacttctttggtgccgctgca 202
           |||||||||| | |||||||||||| ||||||
Sbjct: 700 ttcacttcttcgccttctttggtgcagctgca 669

---

>gb|AY489023.1| Capsicum annuum ribosomal protein L19 mRNA, complete sequence
          Length = 719

 Score =  248 bits (125), Expect = 2e-62
 Identities = 275/325 (84%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||||| ||| || | ||| ||||| |||||||||||| |||| || | | |||||||
Sbjct: 550 ctcctcccgcctagcgaacttcctttctcggcttgccttgttctttgctctcctagcctc 491

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
           ||| ||||| || |  |||||||||||||||||||||||||||| |||||| ||  ||||
Sbjct: 490 aaattggtcggacaaggtcttctctctagccttctcagcctttgtcttgtggatattttc 431

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| |||||||||||||||||||| |  |||||||| ||||||| |||||||||||| ||
Sbjct: 430 catcagcacacgcttgttcttgaagacattacccttcaccttcatgtacatgtcatgata 371

                                                                       
Query: 430 catgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcg 489
           ||||||||||||||||||||||| ||| | ||||||||| ||||  || ||||| || | 
Sbjct: 370 catgtgcttgtcgatcttctttgattccctgtacttgcgaagcaaacgcctgaggactct 311

                                                                       
Query: 490 catcctcctcatccacagaatcttggtgggaagcctagcctcccttgtacccctgcgctt 549
           ||| ||||||||||| || | |||||| || || ||||||||||| |||||  |||||||
Sbjct: 310 cattctcctcatccaaagcaccttggtaggcagtctagcctccctggtacctttgcgctt 251

                                    
Query: 550 accatatccagaatggcggcccttc 574
           ||| |||||||| || |||||||||
Sbjct: 250 accgtatccagagtgacggcccttc 226

---

>gb|AY485789.1| Capsicum annuum 60S ribosomal protein L19 mRNA, complete cds
          Length = 831

 Score =  248 bits (125), Expect = 2e-62
 Identities = 275/325 (84%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||||| ||| || | ||| ||||| |||||||||||| |||| || | | |||||||
Sbjct: 563 ctcctcccgcctagcgaacttcctttctcggcttgccttgttctttgctctcctagcctc 504

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
           ||| ||||| || |  |||||||||||||||||||||||||||| |||||| ||  ||||
Sbjct: 503 aaattggtcggacaaggtcttctctctagccttctcagcctttgtcttgtggatattttc 444

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| |||||||||||||||||||| |  |||||||| ||||||| |||||||||||| ||
Sbjct: 443 catcagcacacgcttgttcttgaagacattacccttcaccttcatgtacatgtcatgata 384

                                                                       
Query: 430 catgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcg 489
           ||||||||||||||||||||||| ||| | ||||||||| ||||  || ||||| || | 
Sbjct: 383 catgtgcttgtcgatcttctttgattccctgtacttgcgaagcaaacgcctgaggactct 324

                                                                       
Query: 490 catcctcctcatccacagaatcttggtgggaagcctagcctcccttgtacccctgcgctt 549
           ||| ||||||||||| || | |||||| || || ||||||||||| |||||  |||||||
Sbjct: 323 cattctcctcatccaaagcaccttggtaggcagtctagcctccctggtacctttgcgctt 264

                                    
Query: 550 accatatccagaatggcggcccttc 574
           ||| |||||||| || |||||||||
Sbjct: 263 accgtatccagagtgacggcccttc 239

---

>gb|AY389581.1| Hyacinthus orientalis ribosomal protein L19 (RPL19) mRNA, complete
           cds
          Length = 664

 Score =  228 bits (115), Expect = 2e-56
 Identities = 265/315 (84%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||||||||||||||||||||| || | |||||||||||||||||||||||| || ||
Sbjct: 557 ctcctccctcctggcaatctttctctctctgcttgccttgctcttggcacgcttggcttc 498

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
           |||||| ||||| |  |||||||| || ||||||||||| || || ||||||||||| ||
Sbjct: 497 aaactgatcagatatagtcttctcccttgccttctcagctttggatttgtgaatgctctc 438

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| ||||| | ||||||||| ||||  |||||||| || |||| |||||| ||||||||
Sbjct: 437 catcagcaccctcttgttcttaaacacattacccttcactttcatgtacatatcatggta 378

                                                                       
Query: 430 catgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcg 489
           |||||| ||||| || ||||| | ||| |||||||| |  ||||  ||||  || || ||
Sbjct: 377 catgtgtttgtcaattttcttggattctcggtacttcctcagcaaacgtcgcagaactcg 318

                                                                       
Query: 490 catcctcctcatccacagaatcttggtgggaagcctagcctcccttgtacccctgcgctt 549
           ||||||||||||||| |||| |||||| || |||||||| ||||| |||||| |||||||
Sbjct: 317 catcctcctcatccaaagaaccttggttgggagcctagcttccctggtacccttgcgctt 258

                          
Query: 550 accatatccagaatg 564
            || || ||||||||
Sbjct: 257 tccgtagccagaatg 243



 Score = 40.1 bits (20), Expect = 9.3
 Identities = 56/68 (82%)
 Strand = Plus / Minus

                                                                       
Query: 611 gagtggatcttttggggcttcttgatgatgaagccatccttcaccaactttcgaatgttc 670
           ||||| ||||| ||||||||| | ||||| || ||||||||||| | ||| |  || |||
Sbjct: 196 gagtgaatcttctggggcttcctaatgataaatccatccttcacaagcttccttatattc 137

                   
Query: 671 tggcgaga 678
           ||||||||
Sbjct: 136 tggcgaga 129

---

>ref|NM_112551.2| Arabidopsis thaliana structural constituent of ribosome AT3G16780
           mRNA, complete cds
          Length = 847

 Score =  218 bits (110), Expect = 2e-53
 Identities = 263/314 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 ctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcc 307
           |||||||| || ||||||| |||||| || | ||| |||||| ||||   |||||| |||
Sbjct: 596 ctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttggcc 537

                                                                       
Query: 308 tcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctt 367
           ||||||||||||| ||| ||||||||||||||||||||||||||   |||||| ||||| 
Sbjct: 536 tcaaactggtcagcgagagtcttctctctagccttctcagccttcatcttgtggatgctc 477

                                                                       
Query: 368 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 427
           |||||||||||||||||||||||||| |  |||||||| || |||| |||||||||||||
Sbjct: 476 tccataagcacacgcttgttcttgaaaacattacccttcactttcatgtacatgtcatgg 417

                                                                       
Query: 428 tacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacg 487
           ||||||||| | || ||||||||||  |||||||||||||  |  |  || || | ||| 
Sbjct: 416 tacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaacgcctcaacacc 357

                                                                       
Query: 488 cgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttgtacccctgcgc 547
           | ||| ||||||||||| ||||||||||| || ||||| ||||| ||||||||| | | |
Sbjct: 356 ctcattctcctcatccaaagaatcttggttggtagccttgcctctcttgtaccctttctc 297

                         
Query: 548 ttaccatatccaga 561
           ||||| ||||||||
Sbjct: 296 ttaccgtatccaga 283

---

>gb|AY090335.1| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, complete cds
          Length = 630

 Score =  218 bits (110), Expect = 2e-53
 Identities = 263/314 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 ctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcc 307
           |||||||| || ||||||| |||||| || | ||| |||||| ||||   |||||| |||
Sbjct: 539 ctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttggcc 480

                                                                       
Query: 308 tcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctt 367
           ||||||||||||| ||| ||||||||||||||||||||||||||   |||||| ||||| 
Sbjct: 479 tcaaactggtcagcgagagtcttctctctagccttctcagccttcatcttgtggatgctc 420

                                                                       
Query: 368 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 427
           |||||||||||||||||||||||||| |  |||||||| || |||| |||||||||||||
Sbjct: 419 tccataagcacacgcttgttcttgaaaacattacccttcactttcatgtacatgtcatgg 360

                                                                       
Query: 428 tacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacg 487
           ||||||||| | || ||||||||||  |||||||||||||  |  |  || || | ||| 
Sbjct: 359 tacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaacgcctcaacacc 300

                                                                       
Query: 488 cgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttgtacccctgcgc 547
           | ||| ||||||||||| ||||||||||| || ||||| ||||| ||||||||| | | |
Sbjct: 299 ctcattctcctcatccaaagaatcttggttggtagccttgcctctcttgtaccctttctc 240

                         
Query: 548 ttaccatatccaga 561
           ||||| ||||||||
Sbjct: 239 ttaccgtatccaga 226

---

>gb|AY045610.1| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, complete cds
          Length = 814

 Score =  218 bits (110), Expect = 2e-53
 Identities = 263/314 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 ctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcc 307
           |||||||| || ||||||| |||||| || | ||| |||||| ||||   |||||| |||
Sbjct: 582 ctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttggcc 523

                                                                       
Query: 308 tcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctt 367
           ||||||||||||| ||| ||||||||||||||||||||||||||   |||||| ||||| 
Sbjct: 522 tcaaactggtcagcgagagtcttctctctagccttctcagccttcatcttgtggatgctc 463

                                                                       
Query: 368 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 427
           |||||||||||||||||||||||||| |  |||||||| || |||| |||||||||||||
Sbjct: 462 tccataagcacacgcttgttcttgaaaacattacccttcactttcatgtacatgtcatgg 403

                                                                       
Query: 428 tacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacg 487
           ||||||||| | || ||||||||||  |||||||||||||  |  |  || || | ||| 
Sbjct: 402 tacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaacgcctcaacacc 343

                                                                       
Query: 488 cgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttgtacccctgcgc 547
           | ||| ||||||||||| ||||||||||| || ||||| ||||| ||||||||| | | |
Sbjct: 342 ctcattctcctcatccaaagaatcttggttggtagccttgcctctcttgtaccctttctc 283

                         
Query: 548 ttaccatatccaga 561
           ||||| ||||||||
Sbjct: 282 ttaccgtatccaga 269

---

>gb|AY089073.1| Arabidopsis thaliana clone 27978 mRNA, complete sequence
          Length = 812

 Score =  218 bits (110), Expect = 2e-53
 Identities = 263/314 (83%)
 Strand = Plus / Minus

                                                                       
Query: 248 ctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcc 307
           |||||||| || ||||||| |||||| || | ||| |||||| ||||   |||||| |||
Sbjct: 594 ctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttggcc 535

                                                                       
Query: 308 tcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctt 367
           ||||||||||||| ||| ||||||||||||||||||||||||||   |||||| ||||| 
Sbjct: 534 tcaaactggtcagcgagggtcttctctctagccttctcagccttcatcttgtggatgctc 475

                                                                       
Query: 368 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 427
           |||||||||||||||||||||||||| |  |||||||| || |||| |||||||||||||
Sbjct: 474 tccataagcacacgcttgttcttgaaaacattacccttcactttcatgtacatgtcatgg 415

                                                                       
Query: 428 tacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacg 487
           ||||||||| | || ||||||||||  |||||||||||||  |  |  || || | ||| 
Sbjct: 414 tacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaacgcctcaacacc 355

                                                                       
Query: 488 cgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttgtacccctgcgc 547
           | ||| ||||||||||| ||||||||||| || ||||| ||||| ||||||||| | | |
Sbjct: 354 ctcattctcctcatccaaagaatcttggttggtagccttgcctctcttgtaccctttctc 295

                         
Query: 548 ttaccatatccaga 561
           ||||| ||||||||
Sbjct: 294 ttaccgtatccaga 281

---

>emb|Z31720.1|NTL19RIB N.tabacum (cv.Samsun NN) L19 mRNA for ribosomal protein L19
          Length = 1597

 Score =  218 bits (110), Expect = 2e-53
 Identities = 344/422 (81%)
 Strand = Plus / Minus

                                                                        
Query: 251  tcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctca 310
            ||||||||||| |||| ||| ||||| | ||| || ||| |||| || | | | ||||||
Sbjct: 1332 tcctccctcctagcaaacttcctttccctgctggctttgttctttgccctcctggcctca 1273

                                                                        
Query: 311  aactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttcc 370
            || || ||||| |  ||||||||||||||||| ||||||||||  ||||||||| |||||
Sbjct: 1272 aattgatcagacaaggtcttctctctagccttttcagcctttgttttgtgaatgttttcc 1213

                                                                        
Query: 371  ataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtac 430
            || || ||||||||||||||||| |  |||||||| ||||||| |||||||||||| |||
Sbjct: 1212 atgaggacacgcttgttcttgaaaacattacccttcaccttcatgtacatgtcatgatac 1153

                                                                        
Query: 431  atgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcgc 490
            |||||| ||||||||||||| |  || | ||||||||| ||||  || ||||| || | |
Sbjct: 1152 atgtgcctgtcgatcttcttggactccctgtacttgcgaagcaaacgcctgagaactctc 1093

                                                                        
Query: 491  atcctcctcatccacagaatcttggtgggaagcctagcctcccttgtacccctgcgctta 550
            ||||||||||||||||| | ||| || || | |||||||||||| |||||| | ||||||
Sbjct: 1092 atcctcctcatccacagcacctttgttggcaacctagcctccctggtacccttacgctta 1033

                                                                        
Query: 551  ccatatccagaatggcggcccttctgttttgcctcgtgggctctgcgtgcacgggacctt 610
            ||||||||||| || || ||||||   || || || |    |||||||||||| || |||
Sbjct: 1032 ccatatccagagtgacgacccttcctcttggcttccttcattctgcgtgcacgagatctt 973

                                                                        
Query: 611  gagtggatcttttggggcttcttgatgatgaagccatccttcaccaactttcgaatgttc 670
            ||||| || |||   || ||| |||||||||| ||||| |||||||||||||  ||||||
Sbjct: 972  gagtgaatttttgttggtttcctgatgatgaaaccatctttcaccaactttctgatgttc 913

              
Query: 671  tg 672
            ||
Sbjct: 912  tg 911

---

>gb|DQ294277.1| Solanum tuberosum clone 172G04 60S ribosomal protein L19-like
           protein mRNA, complete cds
          Length = 759

 Score =  216 bits (109), Expect = 7e-53
 Identities = 265/317 (83%)
 Strand = Plus / Minus

                                                                       
Query: 254 tccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctcaaac 313
           |||||||| |||| ||||||||| | |||||||||| |||| || | | |||||||||| 
Sbjct: 543 tccctccttgcaaactttctttctctgcttgccttgttctttgccctcctagcctcaaat 484

                                                                       
Query: 314 tggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttccata 373
           ||||| || |  |||||||||||||| ||||||||||||| |||||| ||  ||||||| 
Sbjct: 483 tggtcggacaaggtcttctctctagctttctcagcctttgtcttgtggatattttccatc 424

                                                                       
Query: 374 agcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatg 433
           |||||||||||||||||||| |  |||||||| ||||||| |||||||||||| ||||||
Sbjct: 423 agcacacgcttgttcttgaaaacattacccttcaccttcatgtacatgtcatgatacatg 364

                                                                       
Query: 434 tgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcgcatc 493
           || ||||| |||||||||| ||| |  |||||||| ||||  || ||||| || | ||  
Sbjct: 363 tgtttgtcaatcttctttgattccctatacttgcgaagcaaacgcctgaggactctcaat 304

                                                                       
Query: 494 ctcctcatccacagaatcttggtgggaagcctagcctcccttgtacccctgcgcttacca 553
           ||||||||||| || | |||||| || || ||||||||||| |||||  |||||||||||
Sbjct: 303 ctcctcatccaaagcaccttggtaggcagtctagcctccctggtacctttgcgcttacca 244

                            
Query: 554 tatccagaatggcggcc 570
           |||||||| || |||||
Sbjct: 243 tatccagagtgacggcc 227

---

>dbj|AB022217.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGL6
          Length = 79459

 Score =  210 bits (106), Expect = 4e-51
 Identities = 247/294 (84%)
 Strand = Plus / Minus

                                                                         
Query: 248   ctctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcc 307
             |||||||| || ||||||| |||||| || | ||| |||||| ||||   |||||| |||
Sbjct: 76031 ctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttggcc 75972

                                                                         
Query: 308   tcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctt 367
             ||||||||||||| ||| ||||||||||||||||||||||||||   |||||| ||||| 
Sbjct: 75971 tcaaactggtcagcgagagtcttctctctagccttctcagccttcatcttgtggatgctc 75912

                                                                         
Query: 368   tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 427
             |||||||||||||||||||||||||| |  |||||||| || |||| |||||||||||||
Sbjct: 75911 tccataagcacacgcttgttcttgaaaacattacccttcactttcatgtacatgtcatgg 75852

                                                                         
Query: 428   tacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacg 487
             ||||||||| | || ||||||||||  |||||||||||||  |  |  || || | ||| 
Sbjct: 75851 tacatgtgcctatcaatcttctttgactcacggtacttgctcaagaaacgcctcaacacc 75792

                                                                   
Query: 488   cgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttgtaccc 541
             | ||| ||||||||||| ||||||||||| || ||||| ||||| |||||||||
Sbjct: 75791 ctcattctcctcatccaaagaatcttggttggtagccttgcctctcttgtaccc 75738

---

>dbj|D21304.1|RICSS504 Oryza sativa SS504 mRNA for ribosomal protein L19, partial sequence
          Length = 153

 Score =  196 bits (99), Expect = 7e-47
 Identities = 133/146 (91%)
 Strand = Plus / Minus

                                                                       
Query: 275 tcacggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgtcttctct 334
           |||||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||  
Sbjct: 151 tcacggcttgccttgctcttggcaagcttagcctnaaactggtcagagagtgtcttctnn 92

                                                                       
Query: 335 ctagccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaac 394
           || ||||||||||||||  ||||||| || ||||||||||| ||| ||||||||||||||
Sbjct: 91  cttgccttctcagccttanacttgtggatactttccataagaacangcttgttcttgaac 32

                                     
Query: 395 atgttacccttgaccttcaagtacat 420
           ||||||||||||||||||| ||||||
Sbjct: 31  atgttacccttgaccttcatgtacat 6

---

>gb|AY488031.1| Capsicum annuum ribosomal protein L19 mRNA, partial sequence
          Length = 526

 Score =  190 bits (96), Expect = 4e-45
 Identities = 192/224 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||||| ||| || | ||| ||||| |||||||||||| |||| || | | |||||||
Sbjct: 257 ctcctcccgcctagcgaacttcctttctcggcttgccttgttctttgctctcctagcctc 198

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
           ||| ||||| || |  |||||||||||||||||||||||||||| |||||| ||  ||||
Sbjct: 197 aaattggtcggacaaggtcttctctctagccttctcagcctttgtcttgtggatattttc 138

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| |||||||||||||||||||| |  |||||||| ||||||| |||||||||||| ||
Sbjct: 137 catcagcacacgcttgttcttgaagacattacccttcaccttcatgtacatgtcatgata 78

                                                       
Query: 430 catgtgcttgtcgatcttctttgcttcacggtacttgcggagca 473
           | ||||||||||||||||||||| ||| | ||||||||| ||||
Sbjct: 77  cgtgtgcttgtcgatcttctttgattccctgtacttgcgaagca 34

---

>gb|AC152751.22| Medicago truncatula clone mth2-18n7, complete sequence
          Length = 117170

 Score =  176 bits (89), Expect = 6e-41
 Identities = 200/237 (84%)
 Strand = Plus / Plus

                                                                          
Query: 305    gcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatg 364
              ||||||||||| ||||| |  |||||||| ||||||||||||||||| || |||||||| 
Sbjct: 101714 gcctcaaactgatcagataatgtcttctccctagccttctcagccttggatttgtgaata 101773

                                                                          
Query: 365    ctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtca 424
              || |||||||| || | |||||||||||| |  || ||||| ||||||| |||||| |||
Sbjct: 101774 ctctccataaggactctcttgttcttgaagacatttcccttcaccttcatgtacatatca 101833

                                                                          
Query: 425    tggtacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagc 484
              || ||||| || ||||| ||||||||||| || ||||||||||| ||||  || ||||| 
Sbjct: 101834 tgatacatatgtttgtcaatcttctttgcctctcggtacttgcgaagcaaacgcctgagg 101893

                                                                       
Query: 485    acgcgcatcctcctcatccacagaatcttggtgggaagcctagcctcccttgtaccc 541
              || ||||| ||||||||||| || || |||||||| ||||||||||| |||||||||
Sbjct: 101894 acacgcattctcctcatccaaaggattttggtggggagcctagcctctcttgtaccc 101950



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                 
Query: 626    ggcttcttgatgatgaagccatccttcaccaactt 660
              |||||| |||| |||||||||||||| ||||||||
Sbjct: 102475 ggcttcctgataatgaagccatccttaaccaactt 102509

---

>ref|NM_100157.2| Arabidopsis thaliana EMB2386; structural constituent of ribosome
           AT1G02780 (EMB2386) mRNA, complete cds
          Length = 988

 Score =  168 bits (85), Expect = 2e-38
 Identities = 172/201 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||| ||||| |||  ||| ||||| ||||| |||||| |||| || | |||||||||
Sbjct: 581 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 522

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
           |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || ||
Sbjct: 521 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 462

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| |  |||||||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 461 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 402

                                
Query: 430 catgtgcttgtcgatcttctt 450
           |||||||||||| ||||||||
Sbjct: 401 catgtgcttgtcaatcttctt 381



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 205 ggcttcctgatgatgaaaccatccttcac 177

---

>ref|NM_116456.2| Arabidopsis thaliana structural constituent of ribosome AT4G02230
           mRNA, complete cds
          Length = 816

 Score =  168 bits (85), Expect = 2e-38
 Identities = 151/173 (87%)
 Strand = Plus / Minus

                                                                       
Query: 278 cggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgtcttctctcta 337
           ||||| |||||| |||| || | ||||||||||||||||||||| |  ||||||||||||
Sbjct: 536 cggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtcttctctcta 477

                                                                       
Query: 338 gccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacatg 397
           |||||||||||||| || |||||||| |||||||| | |||||||||||||||||| | |
Sbjct: 476 gccttctcagccttggatttgtgaatactttccatcaacacacgcttgttcttgaagacg 417

                                                                
Query: 398 ttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcgatcttctt 450
           || |||||||| |||| |||||||||||||||||| ||  |||| ||||||||
Sbjct: 416 tttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttctt 364



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 188 ggcttcctgatgatgaatccatccttcac 160

---

>gb|AC009525.3| Arabidopsis thaliana chromosome I BAC F22D16 genomic sequence, complete
             sequence
          Length = 100239

 Score =  168 bits (85), Expect = 2e-38
 Identities = 172/201 (85%)
 Strand = Plus / Minus

                                                                         
Query: 250   ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
             |||||| ||||| |||  ||| ||||| ||||| |||||| |||| || | |||||||||
Sbjct: 84067 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 84008

                                                                         
Query: 310   aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
             |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || ||
Sbjct: 84007 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 83948

                                                                         
Query: 370   cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
             ||| |  |||||||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 83947 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 83888

                                  
Query: 430   catgtgcttgtcgatcttctt 450
             |||||||||||| ||||||||
Sbjct: 83887 catgtgcttgtcaatcttctt 83867



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 626   ggcttcttgatgatgaagccatccttcac 654
             |||||| |||||||||| |||||||||||
Sbjct: 83587 ggcttcctgatgatgaaaccatccttcac 83559

---

>gb|BT010178.1| Arabidopsis thaliana At1g02780/T14P4_3 mRNA, complete cds
          Length = 645

 Score =  168 bits (85), Expect = 2e-38
 Identities = 172/201 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||| ||||| |||  ||| ||||| ||||| |||||| |||| || | |||||||||
Sbjct: 537 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 478

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
           |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || ||
Sbjct: 477 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 418

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| |  |||||||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 417 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 358

                                
Query: 430 catgtgcttgtcgatcttctt 450
           |||||||||||| ||||||||
Sbjct: 357 catgtgcttgtcaatcttctt 337



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 161 ggcttcctgatgatgaaaccatccttcac 133

---

>emb|AL161494.2|ATCHRIV6 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 6
          Length = 194892

 Score =  168 bits (85), Expect = 2e-38
 Identities = 151/173 (87%)
 Strand = Plus / Plus

                                                                         
Query: 278   cggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgtcttctctcta 337
             ||||| |||||| |||| || | ||||||||||||||||||||| |  ||||||||||||
Sbjct: 15243 cggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtcttctctcta 15302

                                                                         
Query: 338   gccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacatg 397
             |||||||||||||| || |||||||| |||||||| | |||||||||||||||||| | |
Sbjct: 15303 gccttctcagccttggatttgtgaatactttccatcaacacacgcttgttcttgaagacg 15362

                                                                  
Query: 398   ttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcgatcttctt 450
             || |||||||| |||| |||||||||||||||||| ||  |||| ||||||||
Sbjct: 15363 tttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttctt 15415



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 626   ggcttcttgatgatgaagccatccttcac 654
             |||||| |||||||||| |||||||||||
Sbjct: 15671 ggcttcctgatgatgaatccatccttcac 15699

---

>gb|AY072494.1| Arabidopsis thaliana similar to 60S ribosome protein L19
           (At4g02230; T2H3.3) mRNA, complete cds
          Length = 677

 Score =  168 bits (85), Expect = 2e-38
 Identities = 151/173 (87%)
 Strand = Plus / Minus

                                                                       
Query: 278 cggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgtcttctctcta 337
           ||||| |||||| |||| || | ||||||||||||||||||||| |  ||||||||||||
Sbjct: 509 cggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtcttctctcta 450

                                                                       
Query: 338 gccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacatg 397
           |||||||||||||| || |||||||| |||||||| | |||||||||||||||||| | |
Sbjct: 449 gccttctcagccttggatttgtgaatactttccatcaacacacgcttgttcttgaagacg 390

                                                                
Query: 398 ttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcgatcttctt 450
           || |||||||| |||| |||||||||||||||||| ||  |||| ||||||||
Sbjct: 389 tttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttctt 337



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 161 ggcttcctgatgatgaatccatccttcac 133

---

>gb|AF462835.1|AF462835 Arabidopsis thaliana At1g02780/T14P4_3 mRNA, complete cds
          Length = 847

 Score =  168 bits (85), Expect = 2e-38
 Identities = 172/201 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||| ||||| |||  ||| ||||| ||||| |||||| |||| || | |||||||||
Sbjct: 580 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 521

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
           |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || ||
Sbjct: 520 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 461

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| |  |||||||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 460 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 401

                                
Query: 430 catgtgcttgtcgatcttctt 450
           |||||||||||| ||||||||
Sbjct: 400 catgtgcttgtcaatcttctt 380



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 204 ggcttcctgatgatgaaaccatccttcac 176

---

>gb|AF424580.1|AF424580 Arabidopsis thaliana At1g02780/T14P4_3 mRNA, complete cds
          Length = 897

 Score =  168 bits (85), Expect = 2e-38
 Identities = 172/201 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||| ||||| |||  ||| ||||| ||||| |||||| |||| || | |||||||||
Sbjct: 580 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 521

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
           |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || ||
Sbjct: 520 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 461

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| |  |||||||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 460 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 401

                                
Query: 430 catgtgcttgtcgatcttctt 450
           |||||||||||| ||||||||
Sbjct: 400 catgtgcttgtcaatcttctt 380



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 204 ggcttcctgatgatgaaaccatccttcac 176

---

>gb|AF386993.1|AF386993 Arabidopsis thaliana Similar to 60S ribosome protein L19 (T2H3.3)
           mRNA, complete cds
          Length = 804

 Score =  168 bits (85), Expect = 2e-38
 Identities = 151/173 (87%)
 Strand = Plus / Minus

                                                                       
Query: 278 cggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgtcttctctcta 337
           ||||| |||||| |||| || | ||||||||||||||||||||| |  ||||||||||||
Sbjct: 536 cggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtcttctctcta 477

                                                                       
Query: 338 gccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacatg 397
           |||||||||||||| || |||||||| |||||||| | |||||||||||||||||| | |
Sbjct: 476 gccttctcagccttggatttgtgaatactttccatcaacacacgcttgttcttgaagacg 417

                                                                
Query: 398 ttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcgatcttctt 450
           || |||||||| |||| |||||||||||||||||| ||  |||| ||||||||
Sbjct: 416 tttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttctt 364



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 188 ggcttcctgatgatgaatccatccttcac 160

---

>emb|BX816202.1|CNS0AE3J Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH34ZA05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 872

 Score =  168 bits (85), Expect = 2e-38
 Identities = 172/201 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||| ||||| |||  ||| ||||| ||||| |||||| |||| || | |||||||||
Sbjct: 557 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 498

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
           |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || ||
Sbjct: 497 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 438

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| |  |||||||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 437 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 378

                                
Query: 430 catgtgcttgtcgatcttctt 450
           |||||||||||| ||||||||
Sbjct: 377 catgtgcttgtcaatcttctt 357



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 181 ggcttcctgatgatgaaaccatccttcac 153

---

>emb|BX816956.1|CNS0AD7Y Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH78ZF01 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 848

 Score =  168 bits (85), Expect = 2e-38
 Identities = 172/201 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||| ||||| |||  ||| ||||| ||||| |||||| |||| || | |||||||||
Sbjct: 566 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 507

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
           |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || ||
Sbjct: 506 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 447

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| |  |||||||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 446 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 387

                                
Query: 430 catgtgcttgtcgatcttctt 450
           |||||||||||| ||||||||
Sbjct: 386 catgtgcttgtcaatcttctt 366



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 190 ggcttcctgatgatgaaaccatccttcac 162

---

>emb|BX816918.1|CNS0ADAO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH76ZE12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 865

 Score =  168 bits (85), Expect = 2e-38
 Identities = 172/201 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||| ||||| |||  ||| ||||| ||||| |||||| |||| || | |||||||||
Sbjct: 568 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 509

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
           |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || ||
Sbjct: 508 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 449

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| |  |||||||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 448 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 389

                                
Query: 430 catgtgcttgtcgatcttctt 450
           |||||||||||| ||||||||
Sbjct: 388 catgtgcttgtcaatcttctt 368

---

>emb|BX815921.1|CNS0AD0X Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH16ZH11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 813

 Score =  168 bits (85), Expect = 2e-38
 Identities = 172/201 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||| ||||| |||  ||| ||||| ||||| |||||| |||| || | |||||||||
Sbjct: 563 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 504

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
           |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || ||
Sbjct: 503 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 444

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| |  |||||||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 443 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 384

                                
Query: 430 catgtgcttgtcgatcttctt 450
           |||||||||||| ||||||||
Sbjct: 383 catgtgcttgtcaatcttctt 363



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 187 ggcttcctgatgatgaaaccatccttcac 159

---

>emb|BX817746.1|CNS0ACMV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL3ZA09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 873

 Score =  168 bits (85), Expect = 2e-38
 Identities = 172/201 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||| ||||| |||  ||| ||||| ||||| |||||| |||| || | |||||||||
Sbjct: 558 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 499

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
           |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || ||
Sbjct: 498 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 439

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| |  |||||||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 438 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 379

                                
Query: 430 catgtgcttgtcgatcttctt 450
           |||||||||||| ||||||||
Sbjct: 378 catgtgcttgtcaatcttctt 358



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 182 ggcttcctgatgatgaaaccatccttcac 154

---

>emb|BX813821.1|CNS0AAUL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB41ZA10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 885

 Score =  168 bits (85), Expect = 2e-38
 Identities = 172/201 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||| ||||| |||  ||| ||||| ||||| |||||| |||| || | |||||||||
Sbjct: 564 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 505

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
           |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || ||
Sbjct: 504 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 445

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| |  |||||||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 444 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 385

                                
Query: 430 catgtgcttgtcgatcttctt 450
           |||||||||||| ||||||||
Sbjct: 384 catgtgcttgtcaatcttctt 364



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 188 ggcttcctgatgatgaaaccatccttcac 160

---

>gb|AC022521.4|AC022521 Arabidopsis thaliana chromosome I BAC T14P4 genomic sequence,
            complete sequence
          Length = 121668

 Score =  168 bits (85), Expect = 2e-38
 Identities = 172/201 (85%)
 Strand = Plus / Minus

                                                                        
Query: 250  ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
            |||||| ||||| |||  ||| ||||| ||||| |||||| |||| || | |||||||||
Sbjct: 9427 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 9368

                                                                        
Query: 310  aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
            |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || ||
Sbjct: 9367 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 9308

                                                                        
Query: 370  cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
            ||| |  |||||||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 9307 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 9248

                                 
Query: 430  catgtgcttgtcgatcttctt 450
            |||||||||||| ||||||||
Sbjct: 9247 catgtgcttgtcaatcttctt 9227



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 626  ggcttcttgatgatgaagccatccttcac 654
            |||||| |||||||||| |||||||||||
Sbjct: 8947 ggcttcctgatgatgaaaccatccttcac 8919

---

>gb|AF075597.1|T2H3 Arabidopsis thaliana BAC T2H3
          Length = 48689

 Score =  168 bits (85), Expect = 2e-38
 Identities = 151/173 (87%)
 Strand = Plus / Minus

                                                                         
Query: 278   cggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgtcttctctcta 337
             ||||| |||||| |||| || | ||||||||||||||||||||| |  ||||||||||||
Sbjct: 37035 cggctagccttgttcttagccctcttagcctcaaactggtcagacaatgtcttctctcta 36976

                                                                         
Query: 338   gccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacatg 397
             |||||||||||||| || |||||||| |||||||| | |||||||||||||||||| | |
Sbjct: 36975 gccttctcagccttggatttgtgaatactttccatcaacacacgcttgttcttgaagacg 36916

                                                                  
Query: 398   ttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcgatcttctt 450
             || |||||||| |||| |||||||||||||||||| ||  |||| ||||||||
Sbjct: 36915 tttcccttgactttcatgtacatgtcatggtacatatgtctgtcaatcttctt 36863



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 626   ggcttcttgatgatgaagccatccttcac 654
             |||||| |||||||||| |||||||||||
Sbjct: 36607 ggcttcctgatgatgaatccatccttcac 36579

---

>emb|BX818275.1|CNS0ACJX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL6ZG09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 830

 Score =  165 bits (83), Expect = 2e-37
 Identities = 158/183 (86%)
 Strand = Plus / Minus

                                                                       
Query: 268 ctttctttcacggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgt 327
           ||||||||| ||||| |||||| |||| || | ||||||||||||||| ||||| || ||
Sbjct: 548 ctttctttctcggctagccttgttcttcgccctcttagcctcaaactgatcagacagagt 489

                                                                       
Query: 328 cttctctctagccttctcagcctttgacttgtgaatgctttccataagcacacgcttgtt 387
           |||||| |||||||||||||||||||||||||| || || ||||| |  | |||||||||
Sbjct: 488 cttctccctagccttctcagcctttgacttgtggatactctccatcaagagacgcttgtt 429

                                                                       
Query: 388 cttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcgatctt 447
           ||||||||  |||||||| ||   || ||||||||||||||||||||||||||| |||||
Sbjct: 428 cttgaacacattacccttcacacgcatgtacatgtcatggtacatgtgcttgtcaatctt 369

              
Query: 448 ctt 450
           |||
Sbjct: 368 ctt 366



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 190 ggcttcctgatgatgaaaccatccttcac 162

---

>emb|BX815471.1|CNS0ACXF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS63ZB09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 870

 Score =  161 bits (81), Expect = 4e-36
 Identities = 171/201 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||| ||||| |||  ||| ||||| ||||| |||||| |||| || | |||||||||
Sbjct: 566 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 507

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
           |||||| ||||| || |||||||| |||||||||||||||||||||||||| || || ||
Sbjct: 506 aaactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 447

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| |  |||||||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 446 catcaagacacgcttgttcttgaacacattacccttcacacgcatgtacatgtcatggta 387

                                
Query: 430 catgtgcttgtcgatcttctt 450
           ||||||||| || ||||||||
Sbjct: 386 catgtgcttctcaatcttctt 366



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 190 ggcttcctgatgatgaaaccatccttcac 162

---

>emb|BX842172.1|CNS09YDA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL16ZB09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 729

 Score =  159 bits (80), Expect = 1e-35
 Identities = 151/172 (87%), Gaps = 2/172 (1%)
 Strand = Plus / Minus

                                                                       
Query: 298 acgcttagcctcaaactggtcagagagcgtcttctctctagcctt-ctcagcctt-tgac 355
           |||||| |||||||||||||||| ||| ||||||||||||||||| |||||||||    |
Sbjct: 527 acgcttggcctcaaactggtcagcgagagtcttctctctagccttactcagccttcatcc 468

                                                                       
Query: 356 ttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaag 415
           ||||| ||||| |||||||||||||||||||||||||| |  |||||||| || |||| |
Sbjct: 467 ttgtggatgctctccataagcacacgcttgttcttgaaaacattacccttcactttcatg 408

                                                               
Query: 416 tacatgtcatggtacatgtgcttgtcgatcttctttgcttcacggtacttgc 467
           ||||||||||||||||||||| | || ||||||||||  |||||||||||||
Sbjct: 407 tacatgtcatggtacatgtgcctatcaatcttctttgactcacggtacttgc 356



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 506 agaatcttggtgggaagcctagcctcccttgtacccctgcgcttaccatatccaga 561
           ||||||||||| || ||||| ||||| ||||||||| | | |||||| ||||||||
Sbjct: 314 agaatcttggttggtagccttgcctctcttgtaccctttctcttaccgtatccaga 259

---

>gb|AY086882.1| Arabidopsis thaliana clone 2906 mRNA, complete sequence
          Length = 898

 Score =  153 bits (77), Expect = 9e-34
 Identities = 170/201 (84%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||| ||||| |||  ||| ||||| ||||| |||||| |||| || | |||||||||
Sbjct: 581 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 522

                                                                       
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttc 369
             |||| ||||| || |||||||| |||||||||||||||||||||||||| || || ||
Sbjct: 521 ctactgatcagacagagtcttctccctagccttctcagcctttgacttgtggatactctc 462

                                                                       
Query: 370 cataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggta 429
           ||| |  |||||||||||||||||||  |||||||| ||   || |||||||||||||||
Sbjct: 461 catcaagacacgcttgttcttgaacacattacccttaacacgcatgtacatgtcatggta 402

                                
Query: 430 catgtgcttgtcgatcttctt 450
           |||||||||||| ||||||||
Sbjct: 401 catgtgcttgtcaatcttctt 381



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 205 ggcttcctgatgatgaaaccatccttcac 177

---

>emb|BX816648.1|CNS0AD9N Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH60ZC04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 819

 Score =  149 bits (75), Expect = 1e-32
 Identities = 144/167 (86%)
 Strand = Plus / Minus

                                                                       
Query: 272 ctttcacggcttgccttgctcttggcacgcttagcctcaaactggtcagagagcgtcttc 331
           ||||| ||||| |||||| |||| || | ||||||||||||||| ||||| || ||||||
Sbjct: 480 ctttctcggctagccttgttcttcgccctcttagcctcaaactgatcagacagagtcttc 421

                                                                       
Query: 332 tctctagccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttg 391
           || |||||||||||||||||||||||||| || || ||||| |  |||||||||||||||
Sbjct: 420 tccctagccttctcagcctttgacttgtggatactctccatcaagacacgcttgttcttg 361

                                                          
Query: 392 aacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||  |||||||| ||   || ||||||||||||||||||||||||
Sbjct: 360 aacacattacccttaacacgcatgtacatgtcatggtacatgtgctt 314



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 626 ggcttcttgatgatgaagccatccttcac 654
           |||||| |||||||||| |||||||||||
Sbjct: 125 ggcttcctgatgatgaaaccatccttcac 97

---

>dbj|D29721.1|RICYK34 Oryza sativa mRNA, partial homologous to ribosomal protein L19 gene
          Length = 369

 Score =  139 bits (70), Expect = 1e-29
 Identities = 114/125 (91%), Gaps = 3/125 (2%)
 Strand = Plus / Plus

                                                                       
Query: 230 cttgggccctgagcaagcctctcctccctcctggcaatctttctttcacggctt-gcctt 288
           |||||||||||||| | |||||||| ||||||||||||||| || |||||| || |||||
Sbjct: 241 cttgggccctgagccaacctctcctncctcctggcaatcttcctctcacgggtttgcctt 300

                                                                       
Query: 289 gctcttggcacgcttagcctcaaac-tggtcagagagcgtcttctctc-tagccttctca 346
           ||||||||||||||||||||||||| ||||||||||| |||||||||| | |||||||||
Sbjct: 301 gctcttggcacgcttagcctcaaacttggtcagagagtgtcttctctcttggccttctca 360

                
Query: 347 gcctt 351
           |||||
Sbjct: 361 gcctt 365



 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 46/49 (93%)
 Strand = Plus / Plus

                                                            
Query: 171 ttcacttctttgacttctttggtgccgctgcaggttgagcaggagctgc 219
           |||||||||||| |||||| ||||||||||||| |||||||||||||||
Sbjct: 170 ttcacttctttgccttcttaggtgccgctgcagtttgagcaggagctgc 218

---

>dbj|AK110270.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-C08, full
           insert sequence
          Length = 1089

 Score =  113 bits (57), Expect = 8e-22
 Identities = 108/125 (86%)
 Strand = Plus / Minus

                                                                       
Query: 368 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 427
           ||||| |||||||||||||||||||| | ||||||||||||||||| ||| |  || |||
Sbjct: 498 tccatgagcacacgcttgttcttgaagacgttacccttgaccttcatgtagagctcgtgg 439

                                                                       
Query: 428 tacatgtgcttgtcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacg 487
           |||  |||||||||||||||||| || ||||||||||||||||| || |  |||||||| 
Sbjct: 438 tacgagtgcttgtcgatcttcttggcctcacggtacttgcggagaagcctcctgagcaca 379

                
Query: 488 cgcat 492
           |||||
Sbjct: 378 cgcat 374

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 160/194 (82%), Gaps = 2/194 (1%)
 Strand = Plus / Minus

                                                                            
Query: 237      cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 296
                ||||||| | |||||||| |||||||| |||||| |||||  |||||||| |||||||||
Sbjct: 28305978 cctgagccaacctctcctacctcctggaaatcttcctttcttggcttgccatgctcttgg 28305919

                                                                            
Query: 297      cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 356
                || |||| || ||||||||||| || || ||  |||  ||||| ||||||| |||  |||
Sbjct: 28305918 caagcttggcttcaaactggtcggaaagagttctcttcctagctttctcag-cttgcact 28305860

                                                                            
Query: 357      tgtgaatgctttccataa-gcacacgcttgttcttgaacatgttacccttgaccttcaag 415
                |||| || || ||||||| |  | | |||||| |||| ||||||||||||||||||||  
Sbjct: 28305859 tgtggatactctccataaggtcccctcttgttgttgagcatgttacccttgaccttcatt 28305800

                              
Query: 416      tacatgtcatggta 429
                ||||||||||||||
Sbjct: 28305799 tacatgtcatggta 28305786



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                               
Query: 490      catcctcctcatccacagaatcttggtggga 520
                |||||||||||||||||||||||||||||||
Sbjct: 28305712 catcctcctcatccacagaatcttggtggga 28305682

---

>dbj|AP004300.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0470D12
          Length = 157248

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 160/194 (82%), Gaps = 2/194 (1%)
 Strand = Plus / Minus

                                                                         
Query: 237   cctgagcaagcctctcctccctcctggcaatctttctttcacggcttgccttgctcttgg 296
             ||||||| | |||||||| |||||||| |||||| |||||  |||||||| |||||||||
Sbjct: 31541 cctgagccaacctctcctacctcctggaaatcttcctttcttggcttgccatgctcttgg 31482

                                                                         
Query: 297   cacgcttagcctcaaactggtcagagagcgtcttctctctagccttctcagcctttgact 356
             || |||| || ||||||||||| || || ||  |||  ||||| ||||||| |||  |||
Sbjct: 31481 caagcttggcttcaaactggtcggaaagagttctcttcctagctttctcag-cttgcact 31423

                                                                         
Query: 357   tgtgaatgctttccataa-gcacacgcttgttcttgaacatgttacccttgaccttcaag 415
             |||| || || ||||||| |  | | |||||| |||| ||||||||||||||||||||  
Sbjct: 31422 tgtggatactctccataaggtcccctcttgttgttgagcatgttacccttgaccttcatt 31363

                           
Query: 416   tacatgtcatggta 429
             ||||||||||||||
Sbjct: 31362 tacatgtcatggta 31349



 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 31/31 (100%)
 Strand = Plus / Minus

                                            
Query: 490   catcctcctcatccacagaatcttggtggga 520
             |||||||||||||||||||||||||||||||
Sbjct: 31275 catcctcctcatccacagaatcttggtggga 31245

---

>gb|DQ066293.1| Ixodes scapularis isolate is-all-397 ribosomal protein L19 mRNA,
           complete cds
          Length = 597

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 368 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 427
           ||||| || ||||||||||||||||||| ||| |||||  |||||||||||| |||||||
Sbjct: 419 tccatgaggacacgcttgttcttgaacacgttgcccttagccttcaagtacaggtcatgg 360

                               
Query: 428 tacatgtgcttgtcgatctt 447
           |||| |||||||||||||||
Sbjct: 359 tacaggtgcttgtcgatctt 340

---

>emb|BX814021.1|CNS0ADSF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB52ZE12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 425

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 88/103 (85%)
 Strand = Plus / Minus

                                                                       
Query: 250 ctcctccctcctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctc 309
           |||||| ||||| |||  ||| ||||| ||||| |||||| |||| || | |||||||||
Sbjct: 110 ctcctctctcctagcatgcttcctttctcggctagccttgttcttcgccctcttagcctc 51

                                                      
Query: 310 aaactggtcagagagcgtcttctctctagccttctcagccttt 352
           |||||| ||||| || |||||||| ||||||||||||||||||
Sbjct: 50  aaactgatcagacagagtcttctccctagccttctcagccttt 8

---

>ref|NM_001030929.1| Gallus gallus ribosomal protein L19 (RPL19), mRNA
          Length = 706

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 104/125 (83%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           |||||||||||||||| ||||||||||||||||| ||||| |   |||||||| ||   |
Sbjct: 439 cgcttgttcttgaacacgttacccttgaccttcaggtacaggctgtggtacatatggcgg 380

                                                                       
Query: 440 tcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcgcatcctcctc 499
           ||||||||||| |  || | |||  ||||||||||||| ||||| |  ||||||||||||
Sbjct: 379 tcgatcttcttggactccctgtatctgcggagcaggcgcctgagaatccgcatcctcctc 320

                
Query: 500 atcca 504
           |||||
Sbjct: 319 atcca 315

---

>emb|AJ720076.1| Gallus gallus mRNA for hypothetical protein, clone 10e3
          Length = 706

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 104/125 (83%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           |||||||||||||||| ||||||||||||||||| ||||| |   |||||||| ||   |
Sbjct: 439 cgcttgttcttgaacacgttacccttgaccttcaggtacaggctgtggtacatatggcgg 380

                                                                       
Query: 440 tcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcgcatcctcctc 499
           ||||||||||| |  || | |||  ||||||||||||| ||||| |  ||||||||||||
Sbjct: 379 tcgatcttcttggactccctgtatctgcggagcaggcgcctgagaatccgcatcctcctc 320

                
Query: 500 atcca 504
           |||||
Sbjct: 319 atcca 315

---

>emb|AM049066.1| Sphaerius sp. APV-2005 mRNA for ribosomal protein L19e (rpL19e
           gene)
          Length = 600

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Minus

                                                                       
Query: 383 ttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcg 442
           ||||||||||||| |||||||||  |||||| |||||   ||||||| | |||| |||||
Sbjct: 404 ttgttcttgaacacgttacccttcgccttcatgtacagcgcatggtagaggtgcctgtcg 345

                                          
Query: 443 atcttctttgcttcacggtacttgcggagca 473
           || ||||| |||| |||||||||||||||||
Sbjct: 344 attttcttcgcttgacggtacttgcggagca 314

---

>gb|AY393838.1| Gallus gallus ribosomal protein L19 mRNA, partial cds
          Length = 523

 Score = 73.8 bits (37), Expect = 7e-10
 Identities = 103/125 (82%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           |||||||||||||||| ||||||||||||||||| ||||| |   |||||||| ||   |
Sbjct: 384 cgcttgttcttgaacacgttacccttgaccttcaggtacaggctgtggtacatatggcgg 325

                                                                       
Query: 440 tcgatcttctttgcttcacggtacttgcggagcaggcgtctgagcacgcgcatcctcctc 499
           ||||||||||| |  || | |||  |||||||||| || ||||| |  ||||||||||||
Sbjct: 324 tcgatcttcttggactccctgtatctgcggagcagacgcctgagaatccgcatcctcctc 265

                
Query: 500 atcca 504
           |||||
Sbjct: 264 atcca 260

---

>gb|AY232030.1| Drosophila yakuba clone yak-ad_RpL19 mRNA sequence
          Length = 582

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           |||||||||||||||| ||||||||||  ||||| ||||| ||| ||||||| |||| ||
Sbjct: 407 cgcttgttcttgaacacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 348

                      
Query: 440 tcgatcttctt 450
           || ||||||||
Sbjct: 347 tcaatcttctt 337

---

>ref|XM_793320.1| PREDICTED: Strongylocentrotus purpuratus similar to CG2746-PA,
           isoform A (LOC593861), mRNA
          Length = 1296

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 71/83 (85%)
 Strand = Plus / Minus

                                                                       
Query: 368 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 427
           ||||| || ||||||||||||||||| |  |||||||||||||||| |||||  || |||
Sbjct: 440 tccatgagaacacgcttgttcttgaagacattacccttgaccttcatgtacagctcgtgg 381

                                  
Query: 428 tacatgtgcttgtcgatcttctt 450
           ||||  ||| |||||||||||||
Sbjct: 380 tacagatgcctgtcgatcttctt 358

---

>emb|X74776.1|DMRPL19 D.melanogaster rpL19 gene for ribosomal protein L19
          Length = 1022

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           |||||||||||||||| ||||||||||  ||||| ||||| ||| ||||||| |||| ||
Sbjct: 748 cgcttgttcttgaacacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 689

                      
Query: 440 tcgatcttctt 450
           || ||||||||
Sbjct: 688 tcaatcttctt 678

---

>gb|L32181.1|DRORPL19X Drosophila melanogaster ribosomal protein L19 mRNA
          Length = 723

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 62/71 (87%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           |||||||||||||||| ||||||||||  ||||| ||||| ||| ||||||| |||| ||
Sbjct: 426 cgcttgttcttgaacacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 367

                      
Query: 440 tcgatcttctt 450
           || ||||||||
Sbjct: 366 tcaatcttctt 356

---

>gb|M95065.1|MZEORFF Zea mays putative ribosomal protein L19 mRNA, partial cds
          Length = 189

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 602 cgggaccttgagtggatcttttggggcttcttgatgatgaagccatccttcaccaacttt 661
           ||||| || ||||||||||| || |||||||||||||| || |||||||| |||||||| 
Sbjct: 177 cgggatctagagtggatcttatgaggcttcttgatgataaacccatccttaaccaacttc 118

                         
Query: 662 cgaatgttctggcg 675
           || || ||||||||
Sbjct: 117 cggatattctggcg 104

---

>ref|XM_479458.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 165

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 127/156 (81%), Gaps = 2/156 (1%)
 Strand = Plus / Minus

                                                                       
Query: 259 cctggcaatctttctttcacggcttgccttgctcttggcacgcttagcctcaaactggtc 318
           ||||| |||||| |||||  |||||||| ||||||||||| |||| || |||||||||||
Sbjct: 156 cctggaaatcttcctttcttggcttgccatgctcttggcaagcttggcttcaaactggtc 97

                                                                       
Query: 319 agagagcgtcttctctctagccttctcagcctttgacttgtgaatgctttccataa-gca 377
            || || ||  |||  ||||| ||||||| |||  ||||||| || || ||||||| |  
Sbjct: 96  ggaaagagttctcttcctagctttctcag-cttgcacttgtggatactctccataaggtc 38

                                               
Query: 378 cacgcttgttcttgaacatgttacccttgaccttca 413
           | | |||||| |||| ||||||||||||||||||||
Sbjct: 37  ccctcttgttgttgagcatgttacccttgaccttca 2

---

>ref|XM_752688.1| Ustilago maydis 521 hypothetical protein (UM01634.1) partial mRNA
          Length = 588

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 68/80 (85%)
 Strand = Plus / Minus

                                                                       
Query: 368 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatgg 427
           |||||||||||||||||||||||||| | |||||||||   ||| | ||| |  || |||
Sbjct: 419 tccataagcacacgcttgttcttgaaaacgttacccttcgacttgaggtaaagctcgtgg 360

                               
Query: 428 tacatgtgcttgtcgatctt 447
           |||| |||||||||||||||
Sbjct: 359 tacaggtgcttgtcgatctt 340

---

>gb|BC041546.1| Xenopus laevis ribosomal protein L19, mRNA (cDNA clone MGC:53844
           IMAGE:5542707), complete cds
          Length = 688

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| ||||||||| || |||| ||||| |   |||||||||||| |
Sbjct: 415 acgcttgttcttgaacacgttaccctttactttcaggtacaggctgtggtacatgtgcct 356

                       
Query: 439 gtcgatcttctt 450
           ||| ||||||||
Sbjct: 355 gtcaatcttctt 344

---

>gb|AF401574.1| Ictalurus punctatus ribosomal protein L19 mRNA, complete cds
          Length = 640

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||| ||| || ||| ||||| |   |||||||||||| |
Sbjct: 418 acgcttgttcttgaacacgttacctttggccctcaggtacaggctgtggtacatgtgcct 359

                       
Query: 439 gtcgatcttctt 450
           ||||||||||||
Sbjct: 358 gtcgatcttctt 347



 Score = 48.1 bits (24), Expect = 0.038
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 625 gggcttcttgatgatgaagccatccttcacca 656
           |||||||||||||||||  |||||||||||||
Sbjct: 172 gggcttcttgatgatgagaccatccttcacca 141

---

>gb|AY168759.1| Branchiostoma belcheri tsingtaunese ribosomal protein L19 mRNA,
           complete cds
          Length = 728

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 62/72 (86%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||| |||||| |||||  |  |||||||  |||||
Sbjct: 438 acgcttgttcttgaacacgttacccttggccttcatgtacagctggtggtacagatgctt 379

                       
Query: 439 gtcgatcttctt 450
           |||||| |||||
Sbjct: 378 gtcgattttctt 367

---

>emb|AM049063.1| Cicindela campestris mRNA for ribosomal protein L19e (rpL19e gene)
          Length = 600

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 37/39 (94%)
 Strand = Plus / Minus

                                                  
Query: 367 ttccataagcacacgcttgttcttgaacatgttaccctt 405
           ||||||||| ||||||||||||||||||| |||||||||
Sbjct: 420 ttccataaggacacgcttgttcttgaacacgttaccctt 382

---

>ref|NM_206219.1| Drosophila melanogaster Ribosomal protein L19 CG2746-RB, transcript
           variant B (RpL19), mRNA
          Length = 751

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           |||||||||||||| | ||||||||||  ||||| ||||| ||| ||||||| |||| ||
Sbjct: 439 cgcttgttcttgaatacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 380

                      
Query: 440 tcgatcttctt 450
           || ||||||||
Sbjct: 379 tcaatcttctt 369

---

>ref|NM_057283.4| Drosophila melanogaster Ribosomal protein L19 CG2746-RA, transcript
           variant A (RpL19), mRNA
          Length = 793

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           |||||||||||||| | ||||||||||  ||||| ||||| ||| ||||||| |||| ||
Sbjct: 481 cgcttgttcttgaatacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 422

                      
Query: 440 tcgatcttctt 450
           || ||||||||
Sbjct: 421 tcaatcttctt 411

---

>gb|AC007884.5|AC007884 Drosophila melanogaster, chromosome 2R, region 60F-60F, BAC clone
              BACR08I14, complete sequence
          Length = 190616

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                          
Query: 380    cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
              |||||||||||||| | ||||||||||  ||||| ||||| ||| ||||||| |||| ||
Sbjct: 129049 cgcttgttcttgaatacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 129108

                         
Query: 440    tcgatcttctt 450
              || ||||||||
Sbjct: 129109 tcaatcttctt 129119

---

>gb|AY130453.1| Branchiostoma lanceolatum ribosomal protein L19 mRNA, partial cds
          Length = 588

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           |||||||||||||||| |||||||||  |||||| |||||  |  |||||||  ||||||
Sbjct: 407 cgcttgttcttgaacacgttacccttcgccttcatgtacagctggtggtacagatgcttg 348

                      
Query: 440 tcgatcttctt 450
           |||||||||||
Sbjct: 347 tcgatcttctt 337

---

>gb|AY061217.1| Drosophila melanogaster LD16326 full insert cDNA
          Length = 793

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           |||||||||||||| | ||||||||||  ||||| ||||| ||| ||||||| |||| ||
Sbjct: 463 cgcttgttcttgaatacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 404

                      
Query: 440 tcgatcttctt 450
           || ||||||||
Sbjct: 403 tcaatcttctt 393

---

>gb|BT024264.1| Drosophila melanogaster IP15818 full insert cDNA
          Length = 748

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 61/71 (85%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           |||||||||||||| | ||||||||||  ||||| ||||| ||| ||||||| |||| ||
Sbjct: 423 cgcttgttcttgaatacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 364

                      
Query: 440 tcgatcttctt 450
           || ||||||||
Sbjct: 363 tcaatcttctt 353

---

>gb|AE003465.3| Drosophila melanogaster chromosome 2R, section 72 of 73 of the complete
              sequence
          Length = 343833

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                          
Query: 380    cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
              |||||||||||||| | ||||||||||  ||||| ||||| ||| ||||||| |||| ||
Sbjct: 281353 cgcttgttcttgaatacgttacccttgcacttcatgtacaggtcgtggtacaggtgcctg 281412

                         
Query: 440    tcgatcttctt 450
              || ||||||||
Sbjct: 281413 tcaatcttctt 281423

---

>gb|AY648758.1| Danio rerio 60s ribosomal protein L19 mRNA, complete cds
          Length = 701

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 625 gggcttcttgatgatgaagccatccttcaccaactttcgaat 666
           ||||||||||||||| || ||||||||||||||||| |||||
Sbjct: 192 gggcttcttgatgatcaaaccatccttcaccaacttacgaat 151



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           |||||||||||||||| |||||||||  || |||  |||| |   |||||||||||| ||
Sbjct: 437 cgcttgttcttgaacacgttaccctttgccctcagatacaggctgtggtacatgtgcctg 378

                      
Query: 440 tcgatcttctt 450
           |||||||||||
Sbjct: 377 tcgatcttctt 367

---

>ref|NM_213208.1| Danio rerio ribosomal protein L19 (rpl19), mRNA
          Length = 762

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 625 gggcttcttgatgatgaagccatccttcaccaactttcgaat 666
           ||||||||||||||| || ||||||||||||||||| |||||
Sbjct: 186 gggcttcttgatgatcaaaccatccttcaccaacttacgaat 145



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           |||||||||||||||| |||||||||  || |||  |||| |   |||||||||||| ||
Sbjct: 431 cgcttgttcttgaacacgttaccctttgccctcagatacaggctgtggtacatgtgcctg 372

                      
Query: 440 tcgatcttctt 450
           |||||||||||
Sbjct: 371 tcgatcttctt 361

---

>gb|BC062844.1| Danio rerio ribosomal protein L19, mRNA (cDNA clone MGC:77733
           IMAGE:7000768), complete cds
          Length = 762

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 625 gggcttcttgatgatgaagccatccttcaccaactttcgaat 666
           ||||||||||||||| || ||||||||||||||||| |||||
Sbjct: 186 gggcttcttgatgatcaaaccatccttcaccaacttacgaat 145



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           |||||||||||||||| |||||||||  || |||  |||| |   |||||||||||| ||
Sbjct: 431 cgcttgttcttgaacacgttaccctttgccctcagatacaggctgtggtacatgtgcctg 372

                      
Query: 440 tcgatcttctt 450
           |||||||||||
Sbjct: 371 tcgatcttctt 361

---

>emb|CR388097.9| Zebrafish DNA sequence from clone CH211-10J9 in linkage group 3, complete
              sequence
          Length = 195927

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                        
Query: 625    gggcttcttgatgatgaagccatccttcaccaactttcgaat 666
              ||||||||||||||| || ||||||||||||||||| |||||
Sbjct: 125165 gggcttcttgatgatcaaaccatccttcaccaacttacgaat 125206



 Score = 44.1 bits (22), Expect = 0.59
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 380    cgcttgttcttgaacatgttaccctt 405
              |||||||||||||||| |||||||||
Sbjct: 124539 cgcttgttcttgaacacgttaccctt 124564

---

>ref|NM_117696.1| Arabidopsis thaliana structural constituent of ribosome AT4G16030
           mRNA, complete cds
          Length = 306

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 353 gacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttc 412
           |||||||| |||||||||||||| |||| |||||||||| | |  || || || ||||||
Sbjct: 185 gacttgtgcatgctttccataagaacacacttgttcttgtaaacttttcctttcaccttc 126

                            
Query: 413 aagtacatgtcatggta 429
           | | |||||||||||||
Sbjct: 125 atgaacatgtcatggta 109

---

>emb|AM049062.1| Carabus granulatus partial mRNA for ribosomal protein L19e (rpL19e
           gene)
          Length = 548

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 341 ttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacatgtta 400
           |||||||||||   ||||||||||  |||||| || |||||||||||||||||||  |||
Sbjct: 394 ttctcagccttcttcttgtgaatgtattccatcaggacacgcttgttcttgaacacatta 335

                
Query: 401 ccctt 405
           |||||
Sbjct: 334 ccctt 330

---

>gb|BT010624.1| Arabidopsis thaliana At4g16030 gene, complete cds
          Length = 270

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 353 gacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttc 412
           |||||||| |||||||||||||| |||| |||||||||| | |  || || || ||||||
Sbjct: 185 gacttgtgcatgctttccataagaacacacttgttcttgtaaacttttcctttcaccttc 126

                            
Query: 413 aagtacatgtcatggta 429
           | | |||||||||||||
Sbjct: 125 atgaacatgtcatggta 109

---

>gb|AF548014.1| Spodoptera frugiperda ribosomal protein L19 mRNA, partial cds
          Length = 244

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 71/85 (83%)
 Strand = Plus / Minus

                                                                       
Query: 335 ctagccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaac 394
           |||||||||||||||||   | |||| |||   |||||||| ||||||||||||||||||
Sbjct: 97  ctagccttctcagccttcttcctgtggatgtactccataagtacacgcttgttcttgaac 38

                                    
Query: 395 atgttacccttgaccttcaagtaca 419
           |  ||||||||  |||||| |||||
Sbjct: 37  acattaccctttgccttcatgtaca 13

---

>emb|Z97340.2|ATFCA5 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 5
          Length = 209164

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                         
Query: 353   gacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttc 412
             |||||||| |||||||||||||| |||| |||||||||| | |  || || || ||||||
Sbjct: 50580 gacttgtgcatgctttccataagaacacacttgttcttgtaaacttttcctttcaccttc 50521

                              
Query: 413   aagtacatgtcatggta 429
             | | |||||||||||||
Sbjct: 50520 atgaacatgtcatggta 50504

---

>emb|AL161543.2|ATCHRIV43 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 43
          Length = 198226

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                         
Query: 353   gacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttc 412
             |||||||| |||||||||||||| |||| |||||||||| | |  || || || ||||||
Sbjct: 19570 gacttgtgcatgctttccataagaacacacttgttcttgtaaacttttcctttcaccttc 19511

                              
Query: 413   aagtacatgtcatggta 429
             | | |||||||||||||
Sbjct: 19510 atgaacatgtcatggta 19494

---

>dbj|AK175808.1| Arabidopsis thaliana mRNA for probable ribosomal protein, complete
           cds, clone: RAFL22-40-J11
          Length = 1006

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 353 gacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttc 412
           |||||||| |||||||||||||| |||| |||||||||| | |  || || || ||||||
Sbjct: 295 gacttgtgcatgctttccataagaacacacttgttcttgtaaacttttcctttcaccttc 236

                            
Query: 413 aagtacatgtcatggta 429
           | | |||||||||||||
Sbjct: 235 atgaacatgtcatggta 219

---

>dbj|AK175588.1| Arabidopsis thaliana mRNA for probable ribosomal protein, complete
           cds, clone: RAFL22-04-M21
          Length = 1004

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                       
Query: 353 gacttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttc 412
           |||||||| |||||||||||||| |||| |||||||||| | |  || || || ||||||
Sbjct: 295 gacttgtgcatgctttccataagaacacacttgttcttgtaaacttttcctttcaccttc 236

                            
Query: 413 aagtacatgtcatggta 429
           | | |||||||||||||
Sbjct: 235 atgaacatgtcatggta 219

---

>emb|CR725299.2|CNS0GML5 Tetraodon nigroviridis full-length cDNA
          Length = 337

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaa 414
           ||||||||||   |||||||| |  ||||||||||| ||||  ||||||||| |||||| 
Sbjct: 112 cttgtgaatgtgctccataaggatgcgcttgttcttaaacacattacccttggccttcag 53

                                               
Query: 415 gtacatgtcatggtacatgtgcttgtcgatcttctt 450
           ||||| |   |||||||||||| |||| ||||||||
Sbjct: 52  gtacaggctgtggtacatgtgcctgtcaatcttctt 17

---

>emb|CR707866.2|CNS0G952 Tetraodon nigroviridis full-length cDNA
          Length = 335

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 79/96 (82%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaa 414
           ||||||||||   |||||||| |  ||||||||||| ||||  ||||||||| |||||| 
Sbjct: 112 cttgtgaatgtgctccataaggatgcgcttgttcttaaacacattacccttggccttcag 53

                                               
Query: 415 gtacatgtcatggtacatgtgcttgtcgatcttctt 450
           ||||| |   |||||||||||| |||| ||||||||
Sbjct: 52  gtacaggctgtggtacatgtgcctgtcaatcttctt 17

---

>gb|AY829780.1| Lonomia obliqua ribosomal protein L19e mRNA, partial cds
          Length = 333

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                               
Query: 368 tccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtaca 419
           ||||| || |||||||||||||||||||  |||||||| ||||||| |||||
Sbjct: 149 tccatgaggacacgcttgttcttgaacacattacccttcaccttcatgtaca 98

---

>gb|AY769289.1| Bombyx mori ribosomal protein L19 (RpL19) mRNA, complete cds
          Length = 720

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 368 tccataagcacacgcttgttcttgaacatgttaccctt 405
           ||||| ||||||||||||||||||||||  ||||||||
Sbjct: 482 tccatgagcacacgcttgttcttgaacacattaccctt 445

---

>gb|DQ443429.1| Bombyx mori PDP protein mRNA, complete cds
          Length = 991

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 368 tccataagcacacgcttgttcttgaacatgttaccctt 405
           ||||| ||||||||||||||||||||||  ||||||||
Sbjct: 547 tccatgagcacacgcttgttcttgaacacattaccctt 510

---

>gb|AY431470.1| Aedes aegypti ASAP ID: 35661 cytosolic large ribosomal subunit L19
           mRNA sequence
          Length = 832

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 396
           ||||||||| ||||||  |||||| |||  |||||| || | ||||||||||||||||| 
Sbjct: 499 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 440

                    
Query: 397 gttaccctt 405
            ||||||||
Sbjct: 439 attaccctt 431



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 625 gggcttcttgatgatgaagccatccttcaccaactttcgaatgttctggcg 675
           ||||||||||||||| || |||||||| | |||||| || ||| |||||||
Sbjct: 211 gggcttcttgatgatcaaaccatccttgatcaacttacggatgctctggcg 161

---

>gb|AY389933.1| Latimeria chalumnae ribosomal protein L19 mRNA, partial cds
          Length = 520

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtaca 419
           |||||||||||||||||  |||||||| ||||||| |||||
Sbjct: 382 acgcttgttcttgaacacattacccttaaccttcaggtaca 342

---

>gb|DQ440220.1| Aedes aegypti clone AET-2449 ribosomal protein L19 mRNA, complete
           cds
          Length = 615

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 396
           ||||||||| ||||||  |||||| |||  |||||| || | ||||||||||||||||| 
Sbjct: 450 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 391

                    
Query: 397 gttaccctt 405
            ||||||||
Sbjct: 390 attaccctt 382

---

>emb|CR938671.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YB11AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 610

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 396
           ||||||||| ||||||  |||||| |||  |||||| || | ||||||||||||||||| 
Sbjct: 443 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 384

                    
Query: 397 gttaccctt 405
            ||||||||
Sbjct: 383 attaccctt 375



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 625 gggcttcttgatgatgaagccatccttcaccaactttcgaatgttctggcg 675
           ||||||||||||||| || |||||||| | |||||| || ||| |||||||
Sbjct: 155 gggcttcttgatgatcaaaccatccttgatcaacttacggatgctctggcg 105

---

>emb|CR938382.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YB01AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 854

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 396
           ||||||||| ||||||  |||||| |||  |||||| || | ||||||||||||||||| 
Sbjct: 482 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 423

                    
Query: 397 gttaccctt 405
            ||||||||
Sbjct: 422 attaccctt 414

---

>emb|CR938187.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YH14AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 844

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 396
           ||||||||| ||||||  |||||| |||  |||||| || | ||||||||||||||||| 
Sbjct: 482 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 423

                    
Query: 397 gttaccctt 405
            ||||||||
Sbjct: 422 attaccctt 414



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 625 gggcttcttgatgatgaagccatccttcaccaactttcgaatgttctggcg 675
           ||||||||||||||| || |||||||| | |||||| || ||| |||||||
Sbjct: 194 gggcttcttgatgatcaaaccatccttgatcaacttacggatgctctggcg 144

---

>emb|CR938174.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YH23AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 834

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 396
           ||||||||| ||||||  |||||| |||  |||||| || | ||||||||||||||||| 
Sbjct: 482 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 423

                    
Query: 397 gttaccctt 405
            ||||||||
Sbjct: 422 attaccctt 414

---

>emb|CR938138.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YJ05AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 858

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 396
           ||||||||| ||||||  |||||| |||  |||||| || | ||||||||||||||||| 
Sbjct: 486 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 427

                    
Query: 397 gttaccctt 405
            ||||||||
Sbjct: 426 attaccctt 418



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 625 gggcttcttgatgatgaagccatccttcaccaactttcgaatgttctggcg 675
           ||||||||||||||| || |||||||| | |||||| || ||| |||||||
Sbjct: 198 gggcttcttgatgatcaaaccatccttgatcaacttacggatgctctggcg 148

---

>emb|CR938033.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YM17AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 737

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 337 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 396
           ||||||||| ||||||  |||||| |||  |||||| || | ||||||||||||||||| 
Sbjct: 419 agccttctcggcctttcgcttgtggatgtgttccatcaggatacgcttgttcttgaacac 360

                    
Query: 397 gttaccctt 405
            ||||||||
Sbjct: 359 attaccctt 351

---

>gb|AY130357.1| Petromyzon marinus ribosomal protein L19 mRNA, partial cds
          Length = 539

 Score = 50.1 bits (25), Expect = 0.010
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           |||||||||||||||| |||||| || || |||| |||||  |  |||||||||||    
Sbjct: 381 cgcttgttcttgaacacgttacctttcactttcaggtacagattgtggtacatgtggcga 322

                                        
Query: 440 tcgatcttctttgcttcacggtacttgcg 468
           ||||||||||| || || |||||||||||
Sbjct: 321 tcgatcttcttggcctcgcggtacttgcg 293

---

>gb|BC077657.1| Xenopus tropicalis MGC89675 protein, mRNA (cDNA clone MGC:89675
           IMAGE:7026279), complete cds
          Length = 709

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           |||||| |||||||||| ||| ||||| || ||||  |||| |   |||||||||||| |
Sbjct: 433 acgcttattcttgaacacgtttccctttactttcagatacaggctgtggtacatgtgcct 374

                                   
Query: 439 gtcgatcttctttgcttcacggta 462
           ||| |||||||| | |||||||||
Sbjct: 373 gtcaatcttcttagattcacggta 350

---

>ref|NM_001005122.1| Xenopus tropicalis MGC89675 protein (MGC89675), mRNA
          Length = 709

 Score = 48.1 bits (24), Expect = 0.038
 Identities = 69/84 (82%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           |||||| |||||||||| ||| ||||| || ||||  |||| |   |||||||||||| |
Sbjct: 433 acgcttattcttgaacacgtttccctttactttcagatacaggctgtggtacatgtgcct 374

                                   
Query: 439 gtcgatcttctttgcttcacggta 462
           ||| |||||||| | |||||||||
Sbjct: 373 gtcaatcttcttagattcacggta 350

---

>gb|AY439425.1| Armigeres subalbatus ASAP ID: 39837 cytosolic large ribosomal
           subunit L19 mRNA sequence
          Length = 771

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 57/69 (82%)
 Strand = Plus / Minus

                                                                       
Query: 337 agccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaacat 396
           ||||||||||||||||  |||||| |||   ||||| || | ||||||| ||||||||| 
Sbjct: 486 agccttctcagcctttcgcttgtggatgtgctccatcaggatacgcttgytcttgaacac 427

                    
Query: 397 gttaccctt 405
            ||||||||
Sbjct: 426 attaccctt 418

---

>ref|XM_549228.2| PREDICTED: Canis familiaris similar to ribosomal protein L19
           (LOC492107), mRNA
          Length = 473

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 381 gcttgttcttgaacatgttacccttgaccttcaagtaca 419
           ||||||||||||||| ||||||||| || |||| |||||
Sbjct: 214 gcttgttcttgaacacgttacccttcactttcaggtaca 176

---

>ref|XM_572717.1| Cryptococcus neoformans var. neoformans JEC21 60S ribosomal protein
           L19 (CNI01090) partial mRNA
          Length = 677

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 425 tggtacatgtgcttgtcgatctt 447
           |||||||||||||||||||||||
Sbjct: 377 tggtacatgtgcttgtcgatctt 355

---

>ref|XM_859015.1| PREDICTED: Canis familiaris Ribosomal protein L19, transcript
           variant 4 (RPL19), mRNA
          Length = 706

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           ||||||||||||||||  |||||||| || |||| ||||| |  ||| ||||||||   |
Sbjct: 434 cgcttgttcttgaacacattacccttcactttcaggtacaggctatgatacatgtggcgg 375

                                  
Query: 440 tcgatcttctttgcttcacggta 462
           || |||||||| | |||||||||
Sbjct: 374 tcaatcttcttagattcacggta 352

---

>ref|XM_858990.1| PREDICTED: Canis familiaris Ribosomal protein L19, transcript
           variant 3 (RPL19), mRNA
          Length = 578

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           ||||||||||||||||  |||||||| || |||| ||||| |  ||| ||||||||   |
Sbjct: 306 cgcttgttcttgaacacattacccttcactttcaggtacaggctatgatacatgtggcgg 247

                                  
Query: 440 tcgatcttctttgcttcacggta 462
           || |||||||| | |||||||||
Sbjct: 246 tcaatcttcttagattcacggta 224

---

>ref|XM_858974.1| PREDICTED: Canis familiaris Ribosomal protein L19, transcript
           variant 2 (RPL19), mRNA
          Length = 702

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           ||||||||||||||||  |||||||| || |||| ||||| |  ||| ||||||||   |
Sbjct: 433 cgcttgttcttgaacacattacccttcactttcaggtacaggctatgatacatgtggcgg 374

                                  
Query: 440 tcgatcttctttgcttcacggta 462
           || |||||||| | |||||||||
Sbjct: 373 tcaatcttcttagattcacggta 351

---

>ref|XM_537655.2| PREDICTED: Canis familiaris Ribosomal protein L19, transcript
           variant 1 (RPL19), mRNA
          Length = 735

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           ||||||||||||||||  |||||||| || |||| ||||| |  ||| ||||||||   |
Sbjct: 463 cgcttgttcttgaacacattacccttcactttcaggtacaggctatgatacatgtggcgg 404

                                  
Query: 440 tcgatcttctttgcttcacggta 462
           || |||||||| | |||||||||
Sbjct: 403 tcaatcttcttagattcacggta 381

---

>emb|BX072418.1|CNS09S1I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 615

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX072399.1|CNS09S0Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 530

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX072398.1|CNS09S0Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1BC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 637

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 461 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 402

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 401 gtcgattttcttcgcctcacggtactt 375

---

>emb|BX072218.1|CNS09RVY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 468

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX072217.1|CNS09RVX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 712

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 463 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 404

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 403 gtcgattttcttcgcctcacggtactt 377

---

>emb|BX072184.1|CNS09RV0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX072183.1|CNS09RUZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 615

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 458 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 399

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 398 gtcgattttcttcgcctcacggtactt 372

---

>emb|BX071678.1|CNS09RGY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 745

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 245 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 304

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 305 gtcgattttcttcgcctcacggtactt 331

---

>emb|BX071677.1|CNS09RGX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 379 acgcttgttcttgaacatgttaccctt 405
           ||||||||||||||||| |||||||||
Sbjct: 393 acgcttgttcttgaacacgttaccctt 367

---

>emb|BX066612.1|CNS09NK8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 633 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 692

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 693 gtcgattttcttcgcctcacggtactt 719

---

>emb|BX066611.1|CNS09NK7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 981

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 445 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 386

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 385 gtcgattttcttcgcctcacggtactt 359

---

>emb|BX063837.1|CNS09LF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 584

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 264 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 323

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 324 gtcgattttcttcgcctcacggtactt 350

---

>emb|BX063836.1|CNS09LF4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1016

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 748 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 689

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 688 gtcgattttcttcgcctcacggtactt 662

---

>emb|BX059860.1|CNS09ICO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 626

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 322 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 263

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 262 gtcgattttcttcgcctcacggtactt 236

---

>emb|BX059159.1|CNS09HT7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 673

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX057349.1|CNS09GEX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 239

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 379 acgcttgttcttgaacatgttaccctt 405
           ||||||||||||||||| |||||||||
Sbjct: 166 acgcttgttcttgaacacgttaccctt 140

---

>emb|BX056471.1|CNS09FQJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 297

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 379 acgcttgttcttgaacatgttaccctt 405
           ||||||||||||||||| |||||||||
Sbjct: 105 acgcttgttcttgaacacgttaccctt 79

---

>emb|BX055496.1|CNS09EZG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 771

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 444 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 385

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 384 gtcgattttcttcgcctcacggtactt 358

---

>emb|BX054547.1|CNS09E93 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 675

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX054546.1|CNS09E92 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 446 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 387

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 386 gtcgattttcttcgcctcacggtactt 360

---

>emb|BX052331.1|CNS09CJJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC3BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 440 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 381

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 380 gtcgattttcttcgcctcacggtactt 354

---

>emb|BX050811.1|CNS09BDB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27CA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 379 acgcttgttcttgaacatgttaccctt 405
           ||||||||||||||||| |||||||||
Sbjct: 441 acgcttgttcttgaacacgttaccctt 415

---

>emb|BX030921.1|CNS08W0T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 433 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 374

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 373 gtcgattttcttcgcctcacggtactt 347

---

>emb|BX030866.1|CNS08VZA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46AD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 437 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 378

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 377 gtcgattttcttcgcctcacggtactt 351

---

>emb|BX041770.1|CNS094E6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC13BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 439 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 380

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 379 gtcgattttcttcgcctcacggtactt 353

---

>emb|BX039610.1|CNS092Q6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 291

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX039182.1|CNS092EA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 653

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX039161.1|CNS092DP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 310

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX038823.1|CNS0924B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 662

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 460 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 401

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 400 gtcgattttcttcgcctcacggtactt 374

---

>emb|BX038377.1|CNS091RX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 609

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX038376.1|CNS091RW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 734

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 446 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 387

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 386 gtcgattttcttcgcctcacggtactt 360

---

>emb|BX038311.1|CNS091Q3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 457 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 398

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 397 gtcgattttcttcgcctcacggtactt 371

---

>emb|BX038155.1|CNS091LR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 339

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX038154.1|CNS091LQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 750

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 467 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 408

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 407 gtcgattttcttcgcctcacggtactt 381

---

>emb|BX038058.1|CNS091J2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2BB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 683

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 458 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 399

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 398 gtcgattttcttcgcctcacggtactt 372

---

>emb|BX038043.1|CNS091IN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 756

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 459 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 400

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 399 gtcgattttcttcgcctcacggtactt 373

---

>emb|BX038006.1|CNS091HM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2AG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 746

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 459 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 400

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 399 gtcgattttcttcgcctcacggtactt 373

---

>emb|BX037816.1|CNS091CC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 601

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 466 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 407

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 406 gtcgattttcttcgcctcacggtactt 380

---

>emb|BX037762.1|CNS091AU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 535

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX037761.1|CNS091AT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 649

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 458 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 399

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 398 gtcgattttcttcgcctcacggtactt 372

---

>emb|BX037665.1|CNS09185 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 551

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX037664.1|CNS09184 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 634

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 462 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 403

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 402 gtcgattttcttcgcctcacggtactt 376

---

>emb|BX036410.1|CNS0909A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 680

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX036409.1|CNS09099 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 725

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 379 acgcttgttcttgaacatgttaccctt 405
           ||||||||||||||||| |||||||||
Sbjct: 430 acgcttgttcttgaacacgttaccctt 404

---

>emb|BX035051.1|CNS08Z7J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA6AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 616

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 431 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 372

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 371 gtcgattttcttcgcctcacggtactt 345

---

>emb|BX033777.1|CNS08Y85 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5BF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 660

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX033776.1|CNS08Y84 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5BF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 748

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 432 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 373

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 372 gtcgattttcttcgcctcacggtactt 346

---

>emb|BX033726.1|CNS08Y6Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA5BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 757

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 447 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 388

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 387 gtcgattttcttcgcctcacggtactt 361

---

>emb|BX033086.1|CNS08XOY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49BE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 437 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 378

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 377 gtcgattttcttcgcctcacggtactt 351

---

>emb|BX032914.1|CNS08XK6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 645

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX032913.1|CNS08XK5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA49AD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 736

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 430 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 371

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 370 gtcgattttcttcgcctcacggtactt 344

---

>emb|BX032398.1|CNS08X5U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 272

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX032397.1|CNS08X5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48BB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 464

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 396 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 337

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 336 gtcgattttcttcgcctcacggtactt 310

---

>emb|BX031307.1|CNS08WBJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA46CG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 442 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 383

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 382 gtcgattttcttcgcctcacggtactt 356

---

>emb|BX030422.1|CNS08VMY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA45BF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 742

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 431 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 372

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 371 gtcgattttcttcgcctcacggtactt 345

---

>emb|BX030095.1|CNS08VDV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 379 acgcttgttcttgaacatgttaccctt 405
           ||||||||||||||||| |||||||||
Sbjct: 172 acgcttgttcttgaacacgttaccctt 198

---

>emb|BX030094.1|CNS08VDU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA44DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 745

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 433 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 374

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 373 gtcgattttcttcgcctcacggtactt 347

---

>emb|BX028661.1|CNS08UA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42DC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 434 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 375

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 374 gtcgattttcttcgcctcacggtactt 348

---

>emb|BX027463.1|CNS08TCR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA41AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 348

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 379 acgcttgttcttgaacatgttaccctt 405
           ||||||||||||||||| |||||||||
Sbjct: 173 acgcttgttcttgaacacgttaccctt 199

---

>emb|BX027462.1|CNS08TCQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA41AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 515

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 448 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 389

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 388 gtcgattttcttcgcctcacggtactt 362

---

>emb|BX026971.1|CNS08SZ3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA40BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 525

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 210 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 151

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 150 gtcgattttcttcgcctcacggtactt 124

---

>emb|BX026323.1|CNS08SH3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 618

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 435 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 376

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 375 gtcgattttcttcgcctcacggtactt 349

---

>emb|BX026099.1|CNS08SAV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 746

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 440 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 381

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 380 gtcgattttcttcgcctcacggtactt 354

---

>emb|BX025970.1|CNS08S7A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA4AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 427 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 368

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 367 gtcgattttcttcgcctcacggtactt 341

---

>emb|BX022898.1|CNS08PTY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 631

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 451 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 392

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 391 gtcgattttcttcgcctcacggtactt 365

---

>emb|BX022839.1|CNS08PSB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 169

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 108 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 49

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 48  gtcgattttcttcgcctcacggtactt 22

---

>emb|BX022814.1|CNS08PRM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 624

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 452 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 393

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 392 gtcgattttcttcgcctcacggtactt 366

---

>emb|BX024692.1|CNS08R7S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 436 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 377

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 376 gtcgattttcttcgcctcacggtactt 350

---

>emb|BX024544.1|CNS08R3O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 406 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 347

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 346 gtcgattttcttcgcctcacggtactt 320

---

>emb|BX023626.1|CNS08QE6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 771

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 444 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 385

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 384 gtcgattttcttcgcctcacggtactt 358

---

>emb|BX023558.1|CNS08QCA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA36AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 768

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 445 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 386

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 385 gtcgattttcttcgcctcacggtactt 359

---

>emb|BX022610.1|CNS08PLY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 553

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 453 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 394

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 393 gtcgattttcttcgcctcacggtactt 367

---

>emb|BX022499.1|CNS08PIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 705

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 395 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 336

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 335 gtcgattttcttcgcctcacggtactt 309

---

>emb|BX021000.1|CNS08OD8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 379 acgcttgttcttgaacatgttaccctt 405
           ||||||||||||||||| |||||||||
Sbjct: 455 acgcttgttcttgaacacgttaccctt 429

---

>emb|BX020965.1|CNS08OC9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 636

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 448 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 389

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 388 gtcgattttcttcgcctcacggtactt 362

---

>emb|BX020716.1|CNS08O5C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30CB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 659

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 440 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 381

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 380 gtcgattttcttcgcctcacggtactt 354

---

>emb|BX019823.1|CNS08NGJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 379 acgcttgttcttgaacatgttaccctt 405
           ||||||||||||||||| |||||||||
Sbjct: 426 acgcttgttcttgaacacgttaccctt 400

---

>emb|BX019178.1|CNS08MYM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA29AG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 756

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 379 acgcttgttcttgaacatgttaccctt 405
           ||||||||||||||||| |||||||||
Sbjct: 441 acgcttgttcttgaacacgttaccctt 415

---

>emb|BX018850.1|CNS08MPI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 744

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 428 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 369

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 368 gtcgattttcttcgcctcacggtactt 342

---

>emb|BX018223.1|CNS08M83 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 318

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Plus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 172 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 231

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 232 gtcgattttcttcgcctcacggtactt 258

---

>emb|BX018222.1|CNS08M82 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27CD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 379 acgcttgttcttgaacatgttaccctt 405
           ||||||||||||||||| |||||||||
Sbjct: 449 acgcttgttcttgaacacgttaccctt 423

---

>emb|BX016569.1|CNS08KY5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 427

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 379 acgcttgttcttgaacatgttaccctt 405
           ||||||||||||||||| |||||||||
Sbjct: 107 acgcttgttcttgaacacgttaccctt 81

---

>emb|BX015711.1|CNS08KAB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA23CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 449

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 442 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 383

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 382 gtcgattttcttcgcctcacggtactt 356

---

>emb|BX013212.1|CNS08ICW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 665

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 379 acgcttgttcttgaacatgttaccctt 405
           ||||||||||||||||| |||||||||
Sbjct: 172 acgcttgttcttgaacacgttaccctt 198

---

>emb|BX013211.1|CNS08ICV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA2DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 745

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 434 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 375

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 374 gtcgattttcttcgcctcacggtactt 348

---

>emb|BX011390.1|CNS08GYA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA18AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 663

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 442 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 383

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 382 gtcgattttcttcgcctcacggtactt 356

---

>emb|BX010651.1|CNS08GDR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA17AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 666

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                      
Query: 379 acgcttgttcttgaacatgttaccctt 405
           ||||||||||||||||| |||||||||
Sbjct: 172 acgcttgttcttgaacacgttaccctt 198

---

>emb|BX010223.1|CNS08G1V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA16BH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 523

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 219 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 160

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 159 gtcgattttcttcgcctcacggtactt 133

---

>emb|BX007556.1|CNS08DZS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 769

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 451 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 392

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 391 gtcgattttcttcgcctcacggtactt 365

---

>emb|BX007498.1|CNS08DY6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12CA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 437 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 378

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 377 gtcgattttcttcgcctcacggtactt 351

---

>emb|BX007416.1|CNS08DVW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 507

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 186 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 127

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 126 gtcgattttcttcgcctcacggtactt 100

---

>emb|BX007311.1|CNS08DSZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 659

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 340 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 281

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 280 gtcgattttcttcgcctcacggtactt 254

---

>emb|BX007293.1|CNS08DSH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA12AH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 737

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 426 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 367

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 366 gtcgattttcttcgcctcacggtactt 340

---

>gb|AF526203.1| Argopecten irradians isolate iolsaicl5ct12cn12 ribosomal protein
           L19 mRNA, partial cds
          Length = 643

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 98/123 (79%)
 Strand = Plus / Minus

                                                                       
Query: 334 tctagccttctcagcctttgacttgtgaatgctttccataagcacacgcttgttcttgaa 393
           |||||||||||| |||||   |||||||||    ||||| | ||||||||||||||||||
Sbjct: 466 tctagccttctcggccttcctcttgtgaatatgctccatcaacacacgcttgttcttgaa 407

                                                                       
Query: 394 catgttacccttgaccttcaagtacatgtcatggtacatgtgcttgtcgatcttctttgc 453
              |||||| |||   |||| |||||  || |||||||  ||||||||||| ||||| ||
Sbjct: 406 gccgttacctttgcatttcatgtacagctcgtggtacagatgcttgtcgattttcttggc 347

              
Query: 454 ttc 456
           |||
Sbjct: 346 ttc 344

---

>emb|AJ563476.1|CGI563476 Crassostrea gigas partial mRNA for ribosomal protein L19 (rpls
           gene)
          Length = 604

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 62/75 (82%)
 Strand = Plus / Minus

                                                                       
Query: 382 cttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttgtc 441
           ||||||||||||   |||||| |||  ||||| |||||  |||||||| | |||||||||
Sbjct: 412 cttgttcttgaatccgttacctttgctcttcatgtacagttcatggtataagtgcttgtc 353

                          
Query: 442 gatcttctttgcttc 456
           ||| ||||| |||||
Sbjct: 352 gattttcttggcttc 338

---

>ref|XM_313705.2| Anopheles gambiae str. PEST ENSANGP00000017616
           (ENSANGG00000015127), partial mRNA
          Length = 662

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 379 acgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgctt 438
           ||||||||||||||||| |||||||||  |   || ||||| ||| ||||||| |||   
Sbjct: 461 acgcttgttcttgaacacgttacccttcgcacgcatgtacaggtcgtggtacaggtgacg 402

                                      
Query: 439 gtcgatcttctttgcttcacggtactt 465
           |||||| ||||| || |||||||||||
Sbjct: 401 gtcgattttcttcgcctcacggtactt 375

---

>emb|AJ388522.1|CFA388522 Canis familiaris mRNA for partial Ribosomal protein L19 (rpL19
           gene)
          Length = 342

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtacatgtcatggtacatgtgcttg 439
           ||||||||||||||||  |||||||| || |||| ||||| |  ||| ||||||||   |
Sbjct: 318 cgcttgttcttgaacacattacccttcactttcaggtacaggctatgatacatgtggcgg 259

                                  
Query: 440 tcgatcttctttgcttcacggta 462
           || |||||||| | |||||||||
Sbjct: 258 tcaatcttcttagattcacggta 236

---

>gb|AY753669.1| Enterobacteria phage D6 immC region, complete sequence
          Length = 7644

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 193 tgccgctgcaggttgagcagga 214
           ||||||||||||||||||||||
Sbjct: 79  tgccgctgcaggttgagcagga 100

---

>emb|AM049064.1| Curculio glandium partial mRNA for ribosomal protein L19e (rpL19e
           gene)
          Length = 414

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 382 cttgttcttgaacatgttacccttgaccttcaagtaca 419
           |||||||||||||| |||||||||  |||||| |||||
Sbjct: 405 cttgttcttgaacacgttacccttacccttcatgtaca 368

---

>ref|XM_763259.1| Giardia lamblia ATCC 50803 hypothetical protein
           (GLP_72_19704_20255) partial mRNA
          Length = 552

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 380 cgcttgttcttgaacatgttaccctt 405
           ||||| ||||||||||||||||||||
Sbjct: 284 cgcttattcttgaacatgttaccctt 309

---

>ref|XM_763260.1| Giardia lamblia ATCC 50803 60S ribosomal protein L19B
           (GLP_72_20393_19803) partial mRNA
          Length = 591

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 380 cgcttgttcttgaacatgttaccctt 405
           ||||| ||||||||||||||||||||
Sbjct: 407 cgcttattcttgaacatgttaccctt 382

---

>emb|CT010474.12| Mouse DNA sequence from clone RP23-199B14 on chromosome 12, complete
             sequence
          Length = 205340

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 90    aacaaaacagttcatacttgaaaatt 115
             |||||||||||||| |||||||||||
Sbjct: 27956 aacaaaacagttcacacttgaaaatt 27981

---

>gb|AC131991.8| Mus musculus chromosome 12, clone RP24-190H17, complete sequence
          Length = 148426

 Score = 44.1 bits (22), Expect = 0.59
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 90     aacaaaacagttcatacttgaaaatt 115
              |||||||||||||| |||||||||||
Sbjct: 112983 aacaaaacagttcacacttgaaaatt 113008

---

>ref|XM_518463.1| PREDICTED: Pan troglodytes forkhead box P4 (LOC462682), mRNA
          Length = 1744

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 193 tgccgctgcaggttgagcaggagctgctg 221
           |||| |||||||||||||||| |||||||
Sbjct: 618 tgcctctgcaggttgagcaggtgctgctg 590

---

>ref|NM_138457.2| Homo sapiens forkhead box P4 (FOXP4), transcript variant 2, mRNA
          Length = 5926

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 193  tgccgctgcaggttgagcaggagctgctg 221
            |||| |||||||||||||||| |||||||
Sbjct: 1057 tgcctctgcaggttgagcaggtgctgctg 1029

---

>ref|NM_001012427.1| Homo sapiens forkhead box P4 (FOXP4), transcript variant 3, mRNA
          Length = 5959

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 193  tgccgctgcaggttgagcaggagctgctg 221
            |||| |||||||||||||||| |||||||
Sbjct: 1051 tgcctctgcaggttgagcaggtgctgctg 1023

---

>ref|NM_001012426.1| Homo sapiens forkhead box P4 (FOXP4), transcript variant 1, mRNA
          Length = 5965

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 193  tgccgctgcaggttgagcaggagctgctg 221
            |||| |||||||||||||||| |||||||
Sbjct: 1057 tgcctctgcaggttgagcaggtgctgctg 1029

---

>emb|AM049065.1| Meladema coriacea mRNA for ribosomal protein L19e (rpL19e gene)
          Length = 600

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 355 cttgtgaatgctttccataagcacacgcttgttcttgaacatgttacccttgaccttcaa 414
           ||||||||||  |||||| || ||||| ||||||||||| |  ||||||||  |||||| 
Sbjct: 432 cttgtgaatgtattccatgaggacacgtttgttcttgaagacattacccttcgccttcat 373

                
Query: 415 gtaca 419
           |||||
Sbjct: 372 gtaca 368

---

>emb|AM049061.1| Biphyllus lunatus partial mRNA for ribosomal protein L19e (rpL19e
           gene)
          Length = 489

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 367 ttccataagcacacgcttgttcttgaacatgttacccttgaccttcaagtaca 419
           ||||||||| || | |||||||||||| | |||||||||| | |||| |||||
Sbjct: 309 ttccataagaactctcttgttcttgaatacgttacccttggctttcatgtaca 257

---

>emb|Z98949.1|HS125H2 Human DNA sequence from clone CTA-125H2 on chromosome 22q11-12,
             complete sequence
          Length = 173513

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 236   ccctgagcaagcctctcctcc 256
             |||||||||||||||||||||
Sbjct: 29799 ccctgagcaagcctctcctcc 29779

---

>emb|AL445472.15| Human DNA sequence from clone RP13-137O5 on chromosome X Contains the
             5' end of a novel gene, complete sequence
          Length = 65349

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 251   tcctccctcctggcaatctttcttt 275
             ||||||||||||||| |||||||||
Sbjct: 14113 tcctccctcctggcattctttcttt 14137

---

>emb|AL139331.19| Human DNA sequence from clone RP11-328M4 on chromosome 6 Contains a novel
              gene,  the FOXP4 gene for forkhead box P4 and five CpG
              islands, complete sequence
          Length = 180547

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 193    tgccgctgcaggttgagcaggagctgctg 221
              |||| |||||||||||||||| |||||||
Sbjct: 158637 tgcctctgcaggttgagcaggtgctgctg 158609

---

>emb|X53633.1|CTPOX18 C.tropicalis POX18 gene
          Length = 1428

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 394  catgttacccttgaccttcaa 414
            |||||||||||||||||||||
Sbjct: 1067 catgttacccttgaccttcaa 1047

---

>emb|AJ310932.1|HSA310932 Homo sapiens MYO18B gene for myosin heavy chain, exons 1-44
          Length = 288888

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 236    ccctgagcaagcctctcctcc 256
              |||||||||||||||||||||
Sbjct: 122380 ccctgagcaagcctctcctcc 122360

---

>gb|AC147541.8| Pan troglodytes clone rp43-31n2, complete sequence
          Length = 39420

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 236   ccctgagcaagcctctcctcc 256
             |||||||||||||||||||||
Sbjct: 14094 ccctgagcaagcctctcctcc 14074

---

>gb|AY857433.1| Suberites domuncula L19 mRNA, complete cds
          Length = 600

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 368 tccataagcacacgcttgttcttgaacatgttacccttgac 408
           ||||| || ||||| |||||||| |||| ||||||||||||
Sbjct: 419 tccatgagtacacgtttgttcttaaacacgttacccttgac 379

---

>gb|AC096533.3| Homo sapiens chromosome 1 clone RP11-6B6, complete sequence
          Length = 163339

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 234   ggccctgagcaagcctctcct 254
             |||||||||||||||||||||
Sbjct: 50040 ggccctgagcaagcctctcct 50060

---

>emb|BX120013.5| Zebrafish DNA sequence from clone DKEY-76H10, complete sequence
          Length = 170264

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 87     ctgaacaaaacagttcatact 107
              |||||||||||||||||||||
Sbjct: 111783 ctgaacaaaacagttcatact 111803

---

>gb|BC052803.1| Homo sapiens forkhead box P4, transcript variant 3, mRNA (cDNA
           clone MGC:59875 IMAGE:6420057), complete cds
          Length = 3311

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 193 tgccgctgcaggttgagcaggagctgctg 221
           |||| |||||||||||||||| |||||||
Sbjct: 829 tgcctctgcaggttgagcaggtgctgctg 801

---

>dbj|AB080747.1| Homo sapiens hFKHLA mRNA for fork head-related protein like A,
           complete cds
          Length = 3770

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 193 tgccgctgcaggttgagcaggagctgctg 221
           |||| |||||||||||||||| |||||||
Sbjct: 611 tgcctctgcaggttgagcaggtgctgctg 583

---

>gb|BC040962.1| Homo sapiens forkhead box P4, mRNA (cDNA clone MGC:48953
            IMAGE:5527139), complete cds
          Length = 4186

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 193  tgccgctgcaggttgagcaggagctgctg 221
            |||| |||||||||||||||| |||||||
Sbjct: 1057 tgcctctgcaggttgagcaggtgctgctg 1029

---

>gb|M24440.1|YSAPOX18A Candida tropicalis (ATCC 20336)small aleate-inducible peroxisomal
           protein gene, complete cds
          Length = 1259

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 394 catgttacccttgaccttcaa 414
           |||||||||||||||||||||
Sbjct: 915 catgttacccttgaccttcaa 895

---

>dbj|D86472.1| Candida tropicalis pox18-2 gene for PXP-18, complete cds
          Length = 1428

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 394 catgttacccttgaccttcaa 414
           |||||||||||||||||||||
Sbjct: 971 catgttacccttgaccttcaa 951

---

>gb|AC152944.2| Mus musculus 10 BAC RP23-427I4 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 179149

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 339   ccttctcagcctttgacttgtgaa 362
             ||||||||||||||||| ||||||
Sbjct: 76853 ccttctcagcctttgacctgtgaa 76830

---

>ref|XM_631874.1| Dictyostelium discoideum hypothetical protein (DDB0187709), partial
           mRNA
          Length = 633

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 117 agataagaccaaactgattt 136
           ||||||||||||||||||||
Sbjct: 143 agataagaccaaactgattt 124

---

>gb|AE017349.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 9, complete
              sequence
          Length = 1178688

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 428    tacatgtgcttgtcgatctt 447
              ||||||||||||||||||||
Sbjct: 273528 tacatgtgcttgtcgatctt 273509

---

>gb|BC068015.1| Danio rerio zgc:77348, mRNA (cDNA clone MGC:77348 IMAGE:6968172),
            complete cds
          Length = 6276

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 493  cctcctcatccacagaatct 512
            ||||||||||||||||||||
Sbjct: 3378 cctcctcatccacagaatct 3397

---

>ref|XM_954971.1| Neurospora crassa OR74A hypothetical protein (NCU05804.1) partial
           mRNA
          Length = 708

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 625 gggcttcttgatgatgaagccatc 648
           ||||||||||||||||| ||||||
Sbjct: 291 gggcttcttgatgatgaggccatc 268

---

>ref|XM_325658.1| Neurospora crassa OR74A hypothetical protein (NCU05804.1) partial
           mRNA
          Length = 708

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 625 gggcttcttgatgatgaagccatc 648
           ||||||||||||||||| ||||||
Sbjct: 291 gggcttcttgatgatgaggccatc 268

---

>ref|XR_002473.1| PREDICTED: Mus musculus hypothetical LOC631067 (LOC631067), mRNA
          Length = 744

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 380 cgcttgttcttgaacatgttacccttgaccttcaagtaca 419
           |||||||| |||||||  || ||||||||||||| |||||
Sbjct: 445 cgcttgtttttgaacacattccccttgaccttcaggtaca 406

---

>ref|XM_383288.1| Gibberella zeae PH-1 chromosome 2 hypothetical protein (FG03112.1)
           partial mRNA
          Length = 486

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 643 gccatccttcaccaactttcgaat 666
           |||||||||||||||||| |||||
Sbjct: 477 gccatccttcaccaacttgcgaat 454

---

>emb|Z81128.2|CET23D8 Caenorhabditis elegans Cosmid T23D8, complete sequence
          Length = 34576

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 634  gatgatgaagccatccttca 653
            ||||||||||||||||||||
Sbjct: 5797 gatgatgaagccatccttca 5778

---

>gb|AC122798.3| Mus musculus BAC clone RP23-301A3 from 2, complete sequence
          Length = 206324

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 80    tccagnactgaacaaaacagttc 102
             ||||| |||||||||||||||||
Sbjct: 65121 tccagaactgaacaaaacagttc 65099

---

>emb|CR376824.10| Zebrafish DNA sequence from clone DKEY-9P24 in linkage group 23, complete
              sequence
          Length = 235026

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 493    cctcctcatccacagaatct 512
              ||||||||||||||||||||
Sbjct: 109097 cctcctcatccacagaatct 109116

---

>ref|XM_862965.1| PREDICTED: Canis familiaris similar to Disabled homolog 2
            (Differentially expressed protein 2) (DOC-2), transcript
            variant 4 (LOC479353), mRNA
          Length = 3074

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 171  ttcacttctttgacttcttt 190
            ||||||||||||||||||||
Sbjct: 1976 ttcacttctttgacttcttt 1957

---

>ref|XM_862961.1| PREDICTED: Canis familiaris similar to Disabled homolog 2
            (Differentially expressed protein 2) (DOC-2), transcript
            variant 3 (LOC479353), mRNA
          Length = 2483

 Score = 40.1 bits (20), Expect = 9.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 171  ttcacttctttgacttcttt 190
            ||||||||||||||||||||
Sbjct: 1385 ttcacttctttgacttcttt 1366


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,001,871
Number of Sequences: 3902068
Number of extensions: 6001871
Number of successful extensions: 121406
Number of sequences better than 10.0: 272
Number of HSP's better than 10.0 without gapping: 271
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 120555
Number of HSP's gapped (non-prelim): 833
length of query: 678
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 655
effective length of database: 17,143,297,704
effective search space: 11228859996120
effective search space used: 11228859996120
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---