ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd16h21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY108351.1| Zea mays PCO122024 mRNA sequence 119 1e-23
2emb|AJ421778.1|MMU421778 Macaca mulatta znfl gene (partial), sac... 44 0.55
3gb|CP000264.1| Jannaschia sp. CCS1, complete genome 44 0.55
4gb|AC148707.1| Macaca mulatta Major Histocompatibility Complex B... 44 0.55
5gb|AC148674.1| Macaca mulatta Major Histocompatibility Complex B... 44 0.55
6gb|AC168882.3| Mus musculus BAC clone RP23-80D1 from chromosome ... 42 2.2
7emb|AL512631.11| Human DNA sequence from clone RP11-138I18 on ch... 42 2.2
8emb|AL136172.16| Human DNA sequence from clone RP4-621N11 on chr... 42 2.2
9gb|AC156793.3| Mus musculus BAC clone RP24-148D3 from chromosome... 42 2.2
10ref|XM_640721.1| Dictyostelium discoideum hypothetical protein (... 40 8.5
11gb|AC044805.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 40 8.5
12ref|XM_390134.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 40 8.5
13ref|XM_852064.1| PREDICTED: Canis familiaris similar to Myomesin... 40 8.5
14ref|XM_852019.1| PREDICTED: Canis familiaris similar to Myomesin... 40 8.5
15ref|XM_851978.1| PREDICTED: Canis familiaris similar to Myomesin... 40 8.5
16ref|XM_851937.1| PREDICTED: Canis familiaris similar to Myomesin... 40 8.5
17ref|XM_537314.2| PREDICTED: Canis familiaris similar to Myomesin... 40 8.5
18emb|AL450326.30| Human DNA sequence from clone RP11-517P14 on ch... 40 8.5
19emb|BX640449.1| Bordetella bronchiseptica strain RB50, complete ... 40 8.5
20emb|BX640434.1| Bordetella parapertussis strain 12822, complete ... 40 8.5
21emb|BX640421.1| Bordetella pertussis strain Tohama I, complete g... 40 8.5
22gb|AC010873.12| Homo sapiens BAC clone RP11-112N16 from 2, compl... 40 8.5
23dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ... 40 8.5
24emb|BX294118.4| Zebrafish DNA sequence from clone DKEYP-38B6, co... 40 8.5
25emb|BX640585.2| Pig DNA sequence from clone XX-279G2, complete s... 40 8.5
26emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 40 8.5
27gb|AC171338.5| Rhesus Macaque BAC CH250-526I15 (Children's Hosp... 40 8.5
28dbj|BA000021.3| Wigglesworthia glossinidia endosymbiont of Gloss... 40 8.5

>gb|AY108351.1| Zea mays PCO122024 mRNA sequence
          Length = 1233

 Score =  119 bits (60), Expect = 1e-23
 Identities = 257/322 (79%), Gaps = 3/322 (0%)
 Strand = Plus / Minus

                                                                        
Query: 309  tccacatcgtcgagaaacccggcctgctggcagaacttgacggtgtccgtgatggtctcc 368
            ||||| || ||||||||||| ||||||||||||||||  ||||| ||||  || || |||
Sbjct: 1093 tccacgtcctcgagaaacccagcctgctggcagaactcaacggtctccgcaattgtttcc 1034

                                                                        
Query: 369  tccagcgaccggcagctccaccccagcttcttgagcttgtcggtcgtcatcggagccggg 428
            | ||||| || |    |||| ||||| |||||||||||||||| |||||| ||||| |||
Sbjct: 1033 ttcagcggcctgaccttccatcccagtttcttgagcttgtcggacgtcattggagctggg 974

                                                                        
Query: 429  tgatccatgtcacagatgctctccttgctgactagagg---atagtcagggtacatattc 485
            || ||||||||  |||||||||||||||| |  | |||   ||  |||||||||||  ||
Sbjct: 973  tgctccatgtcgtagatgctctccttgctaatgaaagggtaatcatcagggtacatcgtc 914

                                                                        
Query: 486  ttgagcatgtcccgcaggtcgcgggcggtgatgacatgcggcgcgcagatgtgcctgccg 545
            || ||||  ||| ||||| | |||||| |||||| ||| || ||||||||||||||||||
Sbjct: 913  ttcagcagctccagcaggccacgggcgctgatgaaatgaggagcgcagatgtgcctgccg 854

                                                                        
Query: 546  acggcctcaggcgcctcgtagagcaggagcagagcgtcggcggtgtcgcgcacgtcgacg 605
              ||| |  || | ||| || |  || || ||||| ||||| ||||| |  |||||||||
Sbjct: 853  gaggcttgtggtgtctcatacacaagcaggagagcatcggcagtgtccctgacgtcgacg 794

                                  
Query: 606  atgtgccacagcttgtccctca 627
            |||||||| |||||||||||||
Sbjct: 793  atgtgccaaagcttgtccctca 772



to top

>emb|AJ421778.1|MMU421778 Macaca mulatta znfl gene (partial), sacm2L gene (partial), htatsf1L
             gene (partial), ring1 gene, fabgl gene and ke4 gene
             (partial)
          Length = 67401

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 77    ttattacaaatggtattttctt 98
             ||||||||||||||||||||||
Sbjct: 49704 ttattacaaatggtattttctt 49725



to top

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 598     cgtcgacgatgtgccacagctt 619
               ||||||||||||||||||||||
Sbjct: 2197747 cgtcgacgatgtgccacagctt 2197726



to top

>gb|AC148707.1| Macaca mulatta Major Histocompatibility Complex BAC MMU380B12, complete
             sequence
          Length = 171055

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 77    ttattacaaatggtattttctt 98
             ||||||||||||||||||||||
Sbjct: 37710 ttattacaaatggtattttctt 37689



to top

>gb|AC148674.1| Macaca mulatta Major Histocompatibility Complex BAC MMU103F20, complete
              sequence
          Length = 174172

 Score = 44.1 bits (22), Expect = 0.55
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 77     ttattacaaatggtattttctt 98
              ||||||||||||||||||||||
Sbjct: 129985 ttattacaaatggtattttctt 129964



to top

>gb|AC168882.3| Mus musculus BAC clone RP23-80D1 from chromosome 9, complete sequence
          Length = 210475

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 563    gtagagcaggagcagagcgtc 583
              |||||||||||||||||||||
Sbjct: 132992 gtagagcaggagcagagcgtc 133012



to top

>emb|AL512631.11| Human DNA sequence from clone RP11-138I18 on chromosome 10 Contains the
             5' end of the gene for a protein related to the N terminus
             of tre (RNTRE) (KIAA0019) and a CpG island, complete
             sequence
          Length = 142863

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 432   tccatgtcacagatgctctccttgc 456
             |||||||||||| ||||||||||||
Sbjct: 36082 tccatgtcacagctgctctccttgc 36106



to top

>emb|AL136172.16| Human DNA sequence from clone RP4-621N11 on chromosome 20 Contains
            the 5' end of the RBL1 gene for retinoblastoma-like
            protein 1, the 3' end of the C20orf132 gene and three CpG
            islands, complete sequence
          Length = 69413

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 371  cagcgaccggcagctccaccc 391
            |||||||||||||||||||||
Sbjct: 4793 cagcgaccggcagctccaccc 4813



to top

>gb|AC156793.3| Mus musculus BAC clone RP24-148D3 from chromosome 9, complete
           sequence
          Length = 198338

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 563 gtagagcaggagcagagcgtc 583
           |||||||||||||||||||||
Sbjct: 506 gtagagcaggagcagagcgtc 486



to top

>ref|XM_640721.1| Dictyostelium discoideum hypothetical protein (DDB0216777), partial
            mRNA
          Length = 1503

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 63   atggaatgaaaacattatta 82
            ||||||||||||||||||||
Sbjct: 1177 atggaatgaaaacattatta 1158



to top

>gb|AC044805.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-282L6, complete
              sequence
          Length = 208526

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 43     ttgaaagagaacaccttatt 62
              ||||||||||||||||||||
Sbjct: 144487 ttgaaagagaacaccttatt 144506



to top

>ref|XM_390134.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG09958.1)
           partial mRNA
          Length = 1164

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 393 agcttcttgagcttgtcggt 412
           ||||||||||||||||||||
Sbjct: 734 agcttcttgagcttgtcggt 715



to top

>ref|XM_852064.1| PREDICTED: Canis familiaris similar to Myomesin 1 (Skelemin),
            transcript variant 6 (LOC480191), mRNA
          Length = 5678

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 81   tacaaatggtattttcttaa 100
            ||||||||||||||||||||
Sbjct: 5384 tacaaatggtattttcttaa 5365



to top

>ref|XM_852019.1| PREDICTED: Canis familiaris similar to Myomesin 1 (Skelemin),
            transcript variant 5 (LOC480191), mRNA
          Length = 5390

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 81   tacaaatggtattttcttaa 100
            ||||||||||||||||||||
Sbjct: 5096 tacaaatggtattttcttaa 5077



to top

>ref|XM_851978.1| PREDICTED: Canis familiaris similar to Myomesin 1 (Skelemin),
            transcript variant 4 (LOC480191), mRNA
          Length = 5462

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 81   tacaaatggtattttcttaa 100
            ||||||||||||||||||||
Sbjct: 5168 tacaaatggtattttcttaa 5149



to top

>ref|XM_851937.1| PREDICTED: Canis familiaris similar to Myomesin 1 (Skelemin),
            transcript variant 3 (LOC480191), mRNA
          Length = 1600

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 81   tacaaatggtattttcttaa 100
            ||||||||||||||||||||
Sbjct: 1306 tacaaatggtattttcttaa 1287



to top

>ref|XM_537314.2| PREDICTED: Canis familiaris similar to Myomesin 1 (Skelemin),
            transcript variant 2 (LOC480191), mRNA
          Length = 5762

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 81   tacaaatggtattttcttaa 100
            ||||||||||||||||||||
Sbjct: 5468 tacaaatggtattttcttaa 5449



to top

>emb|AL450326.30| Human DNA sequence from clone RP11-517P14 on chromosome 10 Contains the
             5' end of the HNRPF gene for heterogeneous nuclear
             ribonucleoprotein F, part of a novel gene, the ZNF239 gene
             for zinc finger protein 239 (MOK2, HOK-2), two sinc finger
             protein pseudogenes and seven CpG islands, complete
             sequence
          Length = 197786

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 76    attattacaaatggtatttt 95
             ||||||||||||||||||||
Sbjct: 40497 attattacaaatggtatttt 40516



to top

>emb|BX640449.1| Bordetella bronchiseptica strain RB50, complete genome; segment 13/16
          Length = 348074

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 310   ccacatcgtcgagaaacccg 329
             ||||||||||||||||||||
Sbjct: 62844 ccacatcgtcgagaaacccg 62863



to top

>emb|BX640434.1| Bordetella parapertussis strain 12822, complete genome; segment 12/14
          Length = 344805

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 310   ccacatcgtcgagaaacccg 329
             ||||||||||||||||||||
Sbjct: 15648 ccacatcgtcgagaaacccg 15667



to top

>emb|BX640421.1| Bordetella pertussis strain Tohama I, complete genome; segment 11/12
          Length = 349726

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 310    ccacatcgtcgagaaacccg 329
              ||||||||||||||||||||
Sbjct: 132849 ccacatcgtcgagaaacccg 132868



to top

>gb|AC010873.12| Homo sapiens BAC clone RP11-112N16 from 2, complete sequence
          Length = 180602

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 67    aatgaaaacattattacaaa 86
             ||||||||||||||||||||
Sbjct: 22351 aatgaaaacattattacaaa 22370



to top

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 580     cgtcggcggtgtcgcgcacgtcga 603
               |||||||||||| |||||||||||
Sbjct: 4343226 cgtcggcggtgttgcgcacgtcga 4343249



to top

>emb|BX294118.4| Zebrafish DNA sequence from clone DKEYP-38B6, complete sequence
          Length = 184616

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 63     atggaatgaaaacattatta 82
              ||||||||||||||||||||
Sbjct: 149240 atggaatgaaaacattatta 149221



to top

>emb|BX640585.2| Pig DNA sequence from clone XX-279G2, complete sequence
          Length = 96095

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 78    tattacaaatggtattttcttaaa 101
             ||||||||||||| ||||||||||
Sbjct: 52900 tattacaaatggtgttttcttaaa 52923



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 583    cggcggtgtcgcgcacgtcg 602
              ||||||||||||||||||||
Sbjct: 852027 cggcggtgtcgcgcacgtcg 852008



to top

>gb|AC171338.5| Rhesus Macaque  BAC CH250-526I15 (Children's Hospital Oakland Research
              Institute Rhesus macaque Adult Male BAC Library) complete
              sequence
          Length = 165606

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 74     acattattacaaatggtattttcttaaa 101
              ||||||||||||| |||||||| |||||
Sbjct: 159657 acattattacaaagggtatttttttaaa 159630



to top

>dbj|BA000021.3| Wigglesworthia glossinidia endosymbiont of Glossina brevipalpis DNA,
              complete genome
          Length = 697724

 Score = 40.1 bits (20), Expect = 8.5
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 24     atctttttctgaagnaggtttgaaaga 50
              |||||||||||||  ||||||||||||
Sbjct: 261112 atctttttctgaattaggtttgaaaga 261086


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,886,357
Number of Sequences: 3902068
Number of extensions: 4886357
Number of successful extensions: 96432
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 96203
Number of HSP's gapped (non-prelim): 229
length of query: 627
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 604
effective length of database: 17,143,297,704
effective search space: 10354551813216
effective search space used: 10354551813216
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top