ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd16g04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_467399.1| Oryza sativa (japonica cultivar-group), mRNA 498 e-137
2gb|AY109202.1| Zea mays PCO136905 mRNA sequence 456 e-125
3gb|BT009441.1| Triticum aestivum clone wlmk4.pk0023.c10:fis, ful... 359 7e-96
4gb|AY112578.1| Zea mays CL885_1 mRNA sequence 329 6e-87
5gb|BT017385.1| Zea mays clone EL01N0326H05.c mRNA sequence 321 1e-84
6ref|XM_549849.1| Oryza sativa (japonica cultivar-group), mRNA 313 4e-82
7dbj|AK119792.1| Oryza sativa (japonica cultivar-group) cDNA clon... 313 4e-82
8dbj|AK099287.1| Oryza sativa (japonica cultivar-group) cDNA clon... 313 4e-82
9dbj|AK059300.1| Oryza sativa (japonica cultivar-group) cDNA clon... 313 4e-82
10dbj|AK073331.1| Oryza sativa (japonica cultivar-group) cDNA clon... 305 9e-80
11gb|DQ294622.1| Arachis hypogaea RING-box protein (RBX1a) mRNA, c... 244 3e-61
12gb|AY119265.1| Drosophila melanogaster SD23839 full insert cDNA 242 1e-60
13ref|NM_130496.2| Drosophila melanogaster Roc1a CG16982-RA (Roc1a... 242 1e-60
14gb|DQ099098.1| Arachis stenosperma clone AS1RN18H05 microsatelli... 236 7e-59
15ref|XM_314102.2| Anopheles gambiae str. PEST ENSANGP00000010437 ... 214 2e-52
16dbj|AK066348.1| Oryza sativa (japonica cultivar-group) cDNA clon... 210 4e-51
17gb|AY555146.1| Fragaria x ananassa putative ring-box protein mRN... 206 6e-50
18emb|AL031581.1|DMC115C2 Drosophila melanogaster cosmid clone 115C2 202 9e-49
19gb|AC104602.3| Drosophila melanogaster X BAC RP98-16G6 (Roswell ... 202 9e-49
20gb|AE003418.4| Drosophila melanogaster chromosome X, section 2 o... 202 9e-49
21emb|BX006952.1|CNS08DJ0 Single read from an extremity of a full-... 198 1e-47
22emb|BX006498.1|CNS08D6E Single read from an extremity of a full-... 198 1e-47
23emb|BX008661.1|CNS08EUH Single read from an extremity of a full-... 194 2e-46
24emb|BX020496.1|CNS08NZ8 Single read from an extremity of a full-... 190 4e-45
25emb|BX012866.1|CNS08I3A Single read from an extremity of a full-... 182 9e-43
26emb|BX006499.1|CNS08D6F Single read from an extremity of a full-... 180 3e-42
27ref|NM_122064.2| Arabidopsis thaliana RBX1 AT5G20570 (RBX1) mRNA... 178 1e-41
28gb|AY114719.1| Arabidopsis thaliana ring-box protein-like (At5g2... 178 1e-41
29gb|AY072430.1| Arabidopsis thaliana ring-box protein - like (At5... 178 1e-41
30gb|AY052401.1| Arabidopsis thaliana ring box-1-like protein mRNA... 178 1e-41
31gb|AY086913.1| Arabidopsis thaliana clone 29408 mRNA, complete s... 178 1e-41
32dbj|AK118181.1| Arabidopsis thaliana At5g20570 mRNA for putative... 178 1e-41
33gb|AY027936.1| Salmo salar hyperosmotic protein 21 mRNA, complet... 172 8e-40
34gb|DQ000158.1| Salmo salar hyperosmotic protein 21 (Shop21) gene... 172 8e-40
35gb|DQ000157.1| Salmo salar hyperosmotic protein 21 (Shop21) gene... 172 8e-40
36gb|AY432709.1| Aedes aegypti ASAP ID: 35185 ubiquitin ligase mRN... 170 3e-39
37gb|DQ440316.1| Aedes aegypti clone AET-4020 SCF ubiquitin ligase... 170 3e-39
38emb|BX833527.1|CNS0A0LK Arabidopsis thaliana Full-length cDNA Co... 170 3e-39
39gb|AY302066.1| Populus tomentosa ring box protein mRNA, complete... 163 8e-37
40emb|BX037579.1|CNS0915R Single read from an extremity of a full-... 161 3e-36
41emb|BX008706.1|CNS08EVQ Single read from an extremity of a full-... 155 2e-34
42emb|CR631384.2|CNS0EM59 Tetraodon nigroviridis full-length cDNA 151 3e-33
43ref|XM_363999.1| Magnaporthe grisea 70-15 hypothetical protein (... 149 1e-32
44emb|BX020497.1|CNS08NZ9 Single read from an extremity of a full-... 147 5e-32
45gb|AF480496.1| Oryza sativa clone BAC 49D11, complete sequence 145 2e-31
46dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 145 2e-31
47dbj|AP005844.3| Oryza sativa (japonica cultivar-group) genomic D... 145 2e-31
48emb|CR712304.2|CNS0GCKC Tetraodon nigroviridis full-length cDNA 143 8e-31
49emb|CR711741.2|CNS0GC4P Tetraodon nigroviridis full-length cDNA 143 8e-31
50emb|CR718984.2|CNS0GHPQ Tetraodon nigroviridis full-length cDNA 143 8e-31
51emb|CR718953.2|CNS0GHOV Tetraodon nigroviridis full-length cDNA 143 8e-31
52emb|CR718828.2|CNS0GHLE Tetraodon nigroviridis full-length cDNA 143 8e-31
53emb|CR718557.2|CNS0GHDV Tetraodon nigroviridis full-length cDNA 143 8e-31
54emb|CR717778.2|CNS0GGS8 Tetraodon nigroviridis full-length cDNA 143 8e-31
55emb|CR717707.2|CNS0GGQ9 Tetraodon nigroviridis full-length cDNA 143 8e-31
56emb|CR717638.2|CNS0GGOC Tetraodon nigroviridis full-length cDNA 143 8e-31
57emb|CR717357.2|CNS0GGGJ Tetraodon nigroviridis full-length cDNA 143 8e-31
58emb|CR717269.2|CNS0GGE3 Tetraodon nigroviridis full-length cDNA 143 8e-31
59emb|CR717135.2|CNS0GGAG Tetraodon nigroviridis full-length cDNA 143 8e-31
60emb|CR716834.2|CNS0GG23 Tetraodon nigroviridis full-length cDNA 143 8e-31
61emb|CR716017.2|CNS0GFFH Tetraodon nigroviridis full-length cDNA 143 8e-31
62emb|CR715173.2|CNS0GES1 Tetraodon nigroviridis full-length cDNA 143 8e-31
63emb|CR714756.2|CNS0GEGG Tetraodon nigroviridis full-length cDNA 143 8e-31
64emb|CR711398.2|CNS0GBV6 Tetraodon nigroviridis full-length cDNA 143 8e-31
65emb|CR714255.2|CNS0GE2J Tetraodon nigroviridis full-length cDNA 143 8e-31
66emb|CR713764.2|CNS0GDOW Tetraodon nigroviridis full-length cDNA 143 8e-31
67emb|CR713551.2|CNS0GDIZ Tetraodon nigroviridis full-length cDNA 143 8e-31
68emb|CR713038.2|CNS0GD4Q Tetraodon nigroviridis full-length cDNA 143 8e-31
69emb|CR712711.2|CNS0GCVN Tetraodon nigroviridis full-length cDNA 143 8e-31
70emb|CR712093.2|CNS0GCEH Tetraodon nigroviridis full-length cDNA 143 8e-31
71emb|CR710993.2|CNS0GBJX Tetraodon nigroviridis full-length cDNA 143 8e-31
72emb|CR710591.2|CNS0GB8R Tetraodon nigroviridis full-length cDNA 143 8e-31
73emb|CR710156.2|CNS0GAWO Tetraodon nigroviridis full-length cDNA 143 8e-31
74emb|CR709913.2|CNS0GAPX Tetraodon nigroviridis full-length cDNA 143 8e-31
75emb|CR709418.2|CNS0GAC6 Tetraodon nigroviridis full-length cDNA 143 8e-31
76emb|CR709337.2|CNS0GA9X Tetraodon nigroviridis full-length cDNA 143 8e-31
77emb|CR708996.2|CNS0GA0G Tetraodon nigroviridis full-length cDNA 143 8e-31
78emb|CR709183.2|CNS0GA5N Tetraodon nigroviridis full-length cDNA 143 8e-31
79emb|CR709075.2|CNS0GA2N Tetraodon nigroviridis full-length cDNA 143 8e-31
80emb|CR708377.2|CNS0G9J9 Tetraodon nigroviridis full-length cDNA 143 8e-31
81emb|CR708266.2|CNS0G9G6 Tetraodon nigroviridis full-length cDNA 143 8e-31
82emb|CR708263.2|CNS0G9G3 Tetraodon nigroviridis full-length cDNA 143 8e-31
83emb|CR707631.2|CNS0G8YJ Tetraodon nigroviridis full-length cDNA 143 8e-31
84emb|CR707603.2|CNS0G8XR Tetraodon nigroviridis full-length cDNA 143 8e-31
85emb|CR705966.2|CNS0G7OA Tetraodon nigroviridis full-length cDNA 143 8e-31
86emb|CR706999.2|CNS0G8GZ Tetraodon nigroviridis full-length cDNA 143 8e-31
87emb|CR706688.2|CNS0G88C Tetraodon nigroviridis full-length cDNA 143 8e-31
88emb|CR706606.2|CNS0G862 Tetraodon nigroviridis full-length cDNA 143 8e-31
89emb|CR706092.2|CNS0G7RS Tetraodon nigroviridis full-length cDNA 143 8e-31
90emb|CR705735.2|CNS0G7HV Tetraodon nigroviridis full-length cDNA 143 8e-31
91emb|CR705000.2|CNS0G6XG Tetraodon nigroviridis full-length cDNA 143 8e-31
92emb|CR704952.2|CNS0G6W4 Tetraodon nigroviridis full-length cDNA 143 8e-31
93emb|CR704915.2|CNS0G6V3 Tetraodon nigroviridis full-length cDNA 143 8e-31
94emb|CR705166.2|CNS0G722 Tetraodon nigroviridis full-length cDNA 143 8e-31
95emb|CR704225.2|CNS0G6BX Tetraodon nigroviridis full-length cDNA 143 8e-31
96emb|CR702171.2|CNS0G4QV Tetraodon nigroviridis full-length cDNA 143 8e-31
97emb|CR696134.2|CNS0G036 Tetraodon nigroviridis full-length cDNA 143 8e-31
98emb|CR685564.2|CNS0FRXK Tetraodon nigroviridis full-length cDNA 143 8e-31
99emb|CR683717.2|CNS0FQI9 Tetraodon nigroviridis full-length cDNA 143 8e-31
100emb|CR633484.2|CNS0ENRM Tetraodon nigroviridis full-length cDNA 143 8e-31
101emb|CR632165.2|CNS0EMQZ Tetraodon nigroviridis full-length cDNA 143 8e-31
102ref|XM_677021.1| Aspergillus nidulans FGSC A4 hypothetical prote... 141 3e-30
103emb|CR718972.2|CNS0GHPE Tetraodon nigroviridis full-length cDNA 135 2e-28
104emb|CR716350.2|CNS0GFON Tetraodon nigroviridis full-length cDNA 135 2e-28
105emb|CR715418.2|CNS0GEYU Tetraodon nigroviridis full-length cDNA 135 2e-28
106emb|CR715040.2|CNS0GEOC Tetraodon nigroviridis full-length cDNA 135 2e-28
107emb|CR708622.2|CNS0G9Q2 Tetraodon nigroviridis full-length cDNA 135 2e-28
108emb|CR707762.2|CNS0G926 Tetraodon nigroviridis full-length cDNA 135 2e-28
109emb|CR707479.2|CNS0G8UB Tetraodon nigroviridis full-length cDNA 135 2e-28
110emb|CR684241.2|CNS0FQWT Tetraodon nigroviridis full-length cDNA 135 2e-28
111emb|CR670549.2|CNS0FGD7 Tetraodon nigroviridis full-length cDNA 135 2e-28
112emb|CR659058.2|CNS0F7I0 Tetraodon nigroviridis full-length cDNA 135 2e-28
113emb|CR632856.2|CNS0ENA6 Tetraodon nigroviridis full-length cDNA 135 2e-28
114gb|BC081497.1| Danio rerio im:7137515, mRNA (cDNA clone IMAGE:72... 133 7e-28
115ref|XM_688824.1| PREDICTED: Danio rerio similar to RING-box prot... 133 7e-28
116gb|BC107831.1| Danio rerio im:7137515, mRNA (cDNA clone IMAGE:72... 133 7e-28
117emb|CR659962.2|CNS0F874 Tetraodon nigroviridis full-length cDNA 127 5e-26
118ref|XM_382673.1| Gibberella zeae PH-1 chromosome 1 hypothetical ... 119 1e-23
119ref|NM_001034135.1| Rattus norvegicus ring-box 1 (Rbx1), mRNA 119 1e-23
120gb|BC100258.1| Rattus norvegicus ring-box 1, mRNA (cDNA clone MG... 119 1e-23
121gb|AY440092.1| Armigeres subalbatus ASAP ID: 42179 ubiquitin lig... 115 2e-22
122ref|XM_748960.1| Aspergillus fumigatus Af293 ubiquitin ligase su... 113 7e-22
123ref|NM_114151.1| Arabidopsis thaliana ubiquitin-protein ligase A... 111 3e-21
124gb|BC051473.1| Mus musculus ring-box 1, mRNA (cDNA clone MGC:629... 111 3e-21
125ref|NM_019712.2| Mus musculus ring-box 1 (Rbx1), mRNA 111 3e-21
126gb|BC083057.1| Mus musculus ring-box 1, mRNA (cDNA clone IMAGE:5... 111 3e-21
127gb|BC056992.1| Mus musculus ring-box 1, mRNA (cDNA clone MGC:669... 111 3e-21
128dbj|AK152012.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 111 3e-21
129dbj|AK159571.1| Mus musculus osteoclast-like cell cDNA, RIKEN fu... 111 3e-21
130gb|BC027396.1| Mus musculus ring-box 1, mRNA (cDNA clone MGC:359... 111 3e-21
131gb|AF140599.1|AF140599 Mus musculus ring-box protein 1 (Rbx1) mR... 111 3e-21
132ref|XM_957982.1| Neurospora crassa OR74A hypothetical protein (N... 109 1e-20
133ref|XM_326078.1| Neurospora crassa OR74A hypothetical protein (N... 109 1e-20
134gb|DQ446722.1| Arabidopsis thaliana clone pENTR221-At3g42830 rin... 107 4e-20
135dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 105 2e-19
136dbj|AP002863.3| Oryza sativa (japonica cultivar-group) genomic D... 105 2e-19
137dbj|AP002845.3| Oryza sativa (japonica cultivar-group) genomic D... 105 2e-19
138dbj|AK003159.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 103 7e-19
139dbj|AK004114.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 103 7e-19
140dbj|AK183716.1| Mus musculus cDNA, clone:Y0G0126N24, strand:plus... 103 7e-19
141dbj|AK182752.1| Mus musculus cDNA, clone:Y0G0123J24, strand:plus... 103 7e-19
142gb|DQ311404.1| Bombyx mori ring box protein mRNA, complete cds 101 3e-18
143ref|NM_073095.4| Caenorhabditis elegans yeast RBX (ring finger p... 101 3e-18
144gb|AC084553.1|CBRG33P21 Caenorhabditis briggsae cosmid G33P21, c... 101 3e-18
145dbj|AB077287.1| Caenorhabditis elegans Ce-rbx-1 mRNA for RING-H2... 101 3e-18
146ref|NM_014248.2| Homo sapiens ring-box 1 (RBX1), mRNA 100 1e-17
147ref|XM_597082.2| PREDICTED: Bos taurus similar to RING-box prote... 100 1e-17
148gb|BC017370.1| Homo sapiens ring-box 1, mRNA (cDNA clone IMAGE:4... 100 1e-17
149gb|BC105329.1| Bos taurus similar to RING-box protein 1 (Rbx1), ... 100 1e-17
150gb|AY099360.1| Homo sapiens ZYP protein mRNA, partial cds 100 1e-17
151gb|BC001466.2| Homo sapiens ring-box 1, mRNA (cDNA clone MGC:148... 100 1e-17
152gb|AF142059.1|AF142059 Homo sapiens RING finger protein (ROC1) m... 100 1e-17
153emb|CR456560.1| Homo sapiens RBX1 full length open reading frame... 100 1e-17
154gb|AF140598.1|AF140598 Homo sapiens ring-box protein 1 (RBX1) mR... 100 1e-17
155gb|AF085906.1|HUMYQ60A05 Homo sapiens full length insert cDNA cl... 100 1e-17
156gb|AC112970.18| Mus musculus chromosome 17, clone RP24-443D19, c... 96 2e-16
157emb|Z70757.1|CEZK287 Caenorhabditis elegans Cosmid ZK287, comple... 96 2e-16
158emb|CR974451.9| Mouse DNA sequence from clone RP24-180B11 on chr... 96 2e-16
159ref|XM_515153.1| PREDICTED: Pan troglodytes similar to RBX1 prot... 92 2e-15
160ref|XM_881804.1| PREDICTED: Bos taurus similar to RING-box prote... 92 2e-15
161emb|CT033337.1| Platynereis dumerilii EST IB0AAA22BD06EM1 92 2e-15
162emb|CT033336.1| Platynereis dumerilii EST IB0AAA22BD06FM1 92 2e-15
163emb|CT032976.1| Platynereis dumerilii EST IB0AAA28CF05EM1 92 2e-15
164emb|CT032975.1| Platynereis dumerilii EST IB0AAA28CF05FM1 92 2e-15
165emb|CT032443.1| Platynereis dumerilii EST IB0AAA38AF03EM1 92 2e-15
166emb|CT032442.1| Platynereis dumerilii EST IB0AAA38AF03FM1 92 2e-15
167emb|CT032439.1| Platynereis dumerilii EST IB0AAA38AH04FM1 92 2e-15
168emb|CT032267.1| Platynereis dumerilii EST IB0AAA42AB12EM1 92 2e-15
169emb|CT032266.1| Platynereis dumerilii EST IB0AAA42AB12FM1 92 2e-15
170ref|XM_756798.1| Ustilago maydis 521 hypothetical protein (UM057... 86 2e-13
171gb|DQ213704.1| Taeniopygia guttata clone 0058P0062F10 RBX1 prote... 82 2e-12
172gb|AC010010.6| Drosophila melanogaster 3L BAC RP98-13F6 (Roswell... 82 2e-12
173ref|NM_144356.2| Drosophila melanogaster Roc1b CG16988-RA (Roc1b... 82 2e-12
174ref|NM_138189.2| Drosophila melanogaster CG6905-RA (CG6905), mRNA 82 2e-12
175gb|AY070810.1| Drosophila melanogaster AT21612 full length cDNA 82 2e-12
176gb|AY061302.1| Drosophila melanogaster LD21614 full length cDNA 82 2e-12
177gb|AF218290.1|AF218290 Drosophila melanogaster ring finger prote... 82 2e-12
178gb|AE003468.3| Drosophila melanogaster chromosome 3L, section 2 ... 82 2e-12
179emb|CR686693.2|CNS0FSSX Tetraodon nigroviridis full-length cDNA 80 9e-12
180emb|X73608.1|HSTEST H.sapiens mRNA for testican 80 9e-12
181ref|XM_531722.2| PREDICTED: Canis familiaris similar to RING-box... 78 4e-11
182emb|CT027911.1| Xenopus tropicalis finished cDNA, clone TEgg095b23 76 1e-10
183dbj|AB220470.1| Macaca fascicularis mRNA, clone QflA-19125: simi... 76 1e-10
184dbj|AK149259.1| Mus musculus adult retina cDNA, RIKEN full-lengt... 76 1e-10
185gb|DQ306845.1| Hevea brasiliensis isolate SSH116 mRNA sequence 76 1e-10
186gb|DQ306836.1| Hevea brasiliensis isolate SSH107 mRNA sequence 76 1e-10
187gb|DQ213705.1| Taeniopygia guttata clone 0063P0003E09 RBX1 prote... 74 6e-10
188emb|CT032440.1| Platynereis dumerilii EST IB0AAA38AH04EM1 74 6e-10
189ref|XM_416239.1| PREDICTED: Gallus gallus similar to RBX1 protei... 72 2e-09
190emb|CR390140.1| Gallus gallus finished cDNA, clone ChEST162j5 72 2e-09
191emb|BX470254.7| Zebrafish DNA sequence from clone CH211-256M1 in... 66 1e-07
192gb|AC109153.13| Mus musculus chromosome 15, clone RP23-51J23, co... 64 6e-07
193emb|AL954851.5| Zebrafish DNA sequence from clone CH211-280J3, c... 64 6e-07
194gb|AC160528.9| Mus musculus chromosome 15, clone RP23-310L8, com... 64 6e-07
195gb|DQ103593.1| Olimarabidopsis pumila clone BAC 44L14, complete ... 60 9e-06
196dbj|AK005127.1| Mus musculus adult male cerebellum cDNA, RIKEN f... 60 9e-06
197emb|AL138639.1|ATT21C14 Arabidopsis thaliana DNA chromosome 3, B... 60 9e-06
198ref|XM_962490.1| PREDICTED: Tribolium castaneum similar to CG169... 58 3e-05
199emb|AL080242.11|HSA554C12 Human DNA sequence from clone RP11-554... 56 1e-04
200dbj|AB225693.1| Aspergillus oryzae cDNA, contig sequence: AoEST2548 54 5e-04
201gb|AF296833.1|F7C8 Arabidopsis thaliana BAC F7C8 54 5e-04
202dbj|AK090764.1| Homo sapiens cDNA FLJ33445 fis, clone BRALZ2000263 52 0.002
203dbj|AK116119.1| Ciona intestinalis cDNA, clone:citb010m18, full ... 50 0.008
204ref|XM_392227.2| PREDICTED: Apis mellifera similar to ENSANGP000... 48 0.033
205ref|NM_187604.1| Oryza sativa (japonica cultivar-group), predic... 46 0.13
206gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 46 0.13
207gb|AC107226.2| Oryza sativa (japonica cultivar-group) chromosome... 46 0.13
208gb|BC034498.1| Homo sapiens WD repeat domain 26, mRNA (cDNA clon... 46 0.13
209emb|AL662947.3|OSJN00148 Oryza sativa genomic DNA, chromosome 4,... 46 0.13
210dbj|AP007150.1| Aspergillus oryzae RIB40 genomic DNA, SC009 46 0.13
211dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.13
212dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.13
213gb|AF156371.1| Nicotiana tabacum clone PR29 mRNA sequence 46 0.13
214gb|AC099790.3| Homo sapiens chromosome 1 clone RP11-397G23, comp... 46 0.13
215dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 46 0.13
216dbj|AB209887.1| Homo sapiens mRNA for WD repeat domain 26 varian... 46 0.13
217ref|NM_188653.1| Oryza sativa (japonica cultivar-group), Ozsa825... 44 0.52
218ref|XM_550562.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.52
219ref|XM_550658.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.52
220ref|XM_480356.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.52
221ref|XM_507147.1| PREDICTED Oryza sativa (japonica cultivar-group... 44 0.52
222gb|AC120527.3| Oryza sativa (japonica cultivar-group) chromosome... 44 0.52
223gb|AC147812.2| Oryza sativa (japonica cultivar-group) chromosome... 44 0.52
224gb|AY257863.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.52
225dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.52
226dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.52
227dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.52
228dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.52
229dbj|AP002481.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.52
230dbj|AP001539.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.52
231dbj|AP003878.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.52
232dbj|AP006554.2| Oryza sativa (japonica cultivar-group) genomic D... 44 0.52
233dbj|AP001168.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.52
234dbj|AK120816.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.52
235dbj|AK102200.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.52
236dbj|AK072269.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.52
237dbj|AK070877.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.52
238dbj|AK069966.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.52
239gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.52
240gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 44 0.52
241emb|AL954852.5|CNS08CD6 Oryza sativa chromosome 12, . BAC OJ1573... 44 0.52
242ref|XM_466656.1| Oryza sativa (japonica cultivar-group), mRNA 42 2.1
243ref|XM_506859.1| PREDICTED Oryza sativa (japonica cultivar-group... 42 2.1
244emb|AL160408.24| Human DNA sequence from clone RP4-781K5 on chro... 42 2.1
245emb|AL008726.3|HS337O18 Human DNA sequence from clone RP3-337O18... 42 2.1
246dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 42 2.1
247dbj|AP005107.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
248dbj|AP006438.3| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
249dbj|AP004881.2| Oryza sativa (japonica cultivar-group) genomic D... 42 2.1
250dbj|AK105867.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.1
251emb|X17625.1|HS5ETS Human rRNA primary transcript 5' external tr... 42 2.1
252dbj|AK068690.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.1
253emb|AL592188.60| Human DNA sequence from clone RP11-337M7 on chr... 42 2.1
254gb|AC124471.4| Mus musculus BAC clone RP24-79D7 from 12, complet... 42 2.1
255gb|U13369.1|HSU13369 Human ribosomal DNA complete repeating unit 42 2.1
256emb|X14345.1|HSRRETS Human DNA for 5' external transcribed space... 42 2.1
257gb|AC011697.9| Drosophila melanogaster clone BACR12J05, complete... 40 8.1
258gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 8.1
259gb|AC102081.15| Mus musculus chromosome 18, clone RP23-43H5, com... 40 8.1
260gb|AC104713.3| Oryza sativa (japonica cultivar-group) chromosome... 40 8.1
261ref|XM_475807.1| Oryza sativa (japonica cultivar-group), predic... 40 8.1
262ref|XM_466892.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.1
263ref|XM_464343.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.1
264ref|XM_450819.1| Oryza sativa (japonica cultivar-group), mRNA 40 8.1
265gb|AF377946.3| Oryza sativa (japonica cultivar-group) chromosome... 40 8.1
266gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl... 40 8.1
267gb|AC146936.4| Oryza sativa (japonica cultivar-group) chromosome... 40 8.1
268gb|AC147426.2| Oryza sativa chromosome 3 B1377B10 genomic seque... 40 8.1
269gb|AC131343.4| Oryza sativa (japonica cultivar-group) chromosome... 40 8.1
270gb|BC056612.1| Mus musculus transmembrane protein 24, mRNA (cDNA... 40 8.1
271gb|BC049875.1| Mus musculus transmembrane protein 24, mRNA (cDNA... 40 8.1
272gb|BC035271.1| Mus musculus transmembrane protein 24, mRNA (cDNA... 40 8.1
273ref|XM_916065.2| PREDICTED: Mus musculus similar to Transmembran... 40 8.1
274ref|XM_972678.1| PREDICTED: Mus musculus similar to Transmembran... 40 8.1
275ref|XM_883985.2| PREDICTED: Mus musculus similar to Transmembran... 40 8.1
276gb|AY160083.1| Drosophila melanogaster alpha1U protein (na) gene... 40 8.1
277ref|XM_568891.1| Cryptococcus neoformans var. neoformans JEC21 u... 40 8.1
278gb|AC122428.4| Mus musculus BAC clone RP24-175C20 from chromosom... 40 8.1
279emb|CR352210.11| Zebrafish DNA sequence from clone DKEY-166N8 in... 40 8.1
280emb|AL844222.19| Mouse DNA sequence from clone RP23-44P13 on chr... 40 8.1
281gb|AC093711.3| Sus scrofa clone RP44-453O1, complete sequence 40 8.1
282gb|CP000088.1| Thermobifida fusca YX, complete genome 40 8.1
283gb|AE017342.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 8.1
284dbj|AB249656.1| Oryza sativa (japonica cultivar-group) OsRR11 mR... 40 8.1
285dbj|AK128752.1| Homo sapiens cDNA FLJ44795 fis, clone BRACE30402... 40 8.1
286dbj|AK125754.1| Homo sapiens cDNA FLJ43766 fis, clone TESTI2049246 40 8.1
287ref|NM_167402.1| Drosophila melanogaster narrow abdomen CG1517-R... 40 8.1
288ref|NM_167401.1| Drosophila melanogaster narrow abdomen CG1517-R... 40 8.1
289dbj|AK153804.1| Mus musculus 3 days neonate thymus cDNA, RIKEN f... 40 8.1
290ref|XM_941170.1| PREDICTED: Homo sapiens hypothetical LOC401923 ... 40 8.1
291ref|XM_377538.2| PREDICTED: Homo sapiens hypothetical LOC401923 ... 40 8.1
292ref|NM_027909.2| Mus musculus transmembrane protein 24 (Tmem24),... 40 8.1
293dbj|AK039220.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 40 8.1
294dbj|AK004920.1| Mus musculus adult male liver cDNA, RIKEN full-l... 40 8.1
295gb|DQ350703.1| Ajellomyces capsulatus nitrosative stress induced... 40 8.1
296dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
297dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
298gb|AC022506.38| Homo sapiens 12 BAC RP11-181L23 (Roswell Park Ca... 40 8.1
299ref|XM_576398.1| PREDICTED: Rattus norvegicus transmembrane prot... 40 8.1
300gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 8.1
301dbj|AK218328.1| Mus musculus cDNA, clone:Y2G0144N03, strand:minu... 40 8.1
302dbj|AK184934.1| Mus musculus cDNA, clone:Y0G0132A09, strand:plus... 40 8.1
303dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete g... 40 8.1
304dbj|AP005619.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
305dbj|AP006156.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
306dbj|AP006452.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
307dbj|AP004087.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
308dbj|AP005312.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.1
309dbj|AK122237.1| Mus musculus mRNA for mKIAA0285 protein 40 8.1
310dbj|AK106139.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.1
311dbj|AK106948.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.1
312dbj|AK103420.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.1
313dbj|AK103385.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.1
314dbj|AK102605.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.1
315dbj|AK072284.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.1
316dbj|AK067820.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.1
317dbj|AK060489.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.1
318dbj|AK059834.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 8.1
319gb|AC007785.1|AC007785 Homo sapiens chromosome 19, BAC 282485 (C... 40 8.1
320gb|AE003495.4| Drosophila melanogaster chromosome X, section 47 ... 40 8.1
321dbj|AB090825.1| Bombyx mori retrotransposon HOPEBm2 DNA, partial... 40 8.1
322gb|BC085925.1| Rattus norvegicus transmembrane protein 24, mRNA ... 40 8.1
323ref|NM_001011996.1| Rattus norvegicus transmembrane protein 24 (... 40 8.1
324emb|AL731747.2|CNS08C7W Oryza sativa chromosome 12, . BAC OSJNBa... 40 8.1
325emb|AL954853.5|CNS08CD7 Oryza sativa chromosome 12, . BAC OSJNBb... 40 8.1
326emb|AL732378.3|CNS08C91 Oryza sativa chromosome 12, . BAC OSJNBa... 40 8.1
327emb|BX664710.2|CNS09SC0 Oryza sativa chromosome 12, . PAC P0243A... 40 8.1
328gb|AC124577.5| Mus musculus BAC clone RP23-162P10 from 9, comple... 40 8.1
329emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB ... 40 8.1
330gb|BC060156.1| Mus musculus transmembrane protein 24, mRNA (cDNA... 40 8.1
331dbj|D83352.1|DUKNMDART1 Duck mRNA for N-methyl-D-aspartate recep... 40 8.1
332dbj|AB063490.1| Bombyx mori BmKMO gene for kynurenine 3-monooxyg... 40 8.1

>ref|XM_467399.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 345

 Score =  498 bits (251), Expect = e-137
 Identities = 272/279 (97%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 344 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 285

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 284 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 225

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 224 gtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatgcagaggtccatg 165

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           ||||||||||||||||||||||||||||| || |||||||||||||||||||| | ||| 
Sbjct: 164 atgtggttgcggcagatggcgcagttgtccacgacgatgtcccaggcccagagggagaca 105

                                                  
Query: 457 gcgttccactttttgatctcgaagcgcttgcccttcttg 495
           ||||||||||| |||||||||||||||||||||||||||
Sbjct: 104 gcgttccacttcttgatctcgaagcgcttgcccttcttg 66



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 531 gggggccacggccacggcgacgtcgccctggtccat 566
           ||||| ||||||||||||||||||||||| ||||||
Sbjct: 36  ggggggcacggccacggcgacgtcgcccttgtccat 1



to top

>gb|AY109202.1| Zea mays PCO136905 mRNA sequence
          Length = 736

 Score =  456 bits (230), Expect = e-125
 Identities = 266/278 (95%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 418 tagtgaccatacttctggaactcccactcactgttgtcaagagggcacacttgacgggtc 359

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           || |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||
Sbjct: 358 tttagccaacggctgatacagtggaagtggaatgcatggttgcaaattccccaagcgacg 299

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 298 gtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatgcaaaggtccatg 239

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||||
Sbjct: 238 atgtggttgcggcagatggcgcagttgtccaccacgatgtcccaggcccagagagagacg 179

                                                 
Query: 457 gcgttccactttttgatctcgaagcgcttgcccttctt 494
           ||||||||||| |||||||||||||||||| |||||||
Sbjct: 178 gcgttccacttcttgatctcgaagcgcttggccttctt 141



to top

>gb|BT009441.1| Triticum aestivum clone wlmk4.pk0023.c10:fis, full insert mRNA
           sequence
          Length = 582

 Score =  359 bits (181), Expect = 7e-96
 Identities = 241/261 (92%)
 Strand = Plus / Minus

                                                                       
Query: 229 ttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaacgg 288
           |||||||||||||| |||||||||||||| ||||||||||| || ||||||||||| | |
Sbjct: 361 ttctggaactcccattcgctgttgtctagtgggcacacttggcgagtcttgagccacctg 302

                                                                       
Query: 289 ctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcg 348
           |||||||||||||||||||| ||||| || || || ||||| ||||||||||| ||||||
Sbjct: 301 ctgatgcagtggaagtggaaagcatgattacagacaccccatgcgacggtgcattcctcg 242

                                                                       
Query: 349 ctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcgg 408
           |||||||||||||||||||| ||||||||||||||||| || |||||||||||||| |||
Sbjct: 241 ctggtggcgctggcctggttggcctggcactcgatgcatagatccatgatgtggttacgg 182

                                                                       
Query: 409 cagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttt 468
           ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| 
Sbjct: 181 cagatggcgcagttgtccaccacgatgtcccacgcccagagcgcgacggcgttccacttc 122

                                
Query: 469 ttgatctcgaagcgcttgccc 489
           |||||||||||||||||||||
Sbjct: 121 ttgatctcgaagcgcttgccc 101



to top

>gb|AY112578.1| Zea mays CL885_1 mRNA sequence
          Length = 797

 Score =  329 bits (166), Expect = 6e-87
 Identities = 244/270 (90%)
 Strand = Plus / Plus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||| ||||||||||||||||| ||||| ||||  |||||||||||||| |||
Sbjct: 366 tagtggccatatttctggaactcccactcactgttatctaatgggcacacttgacgagtc 425

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           || ||||| | |||||||||||||||||| || ||||| || || ||||||||||| || 
Sbjct: 426 ttaagccacctgctgatgcagtggaagtgaaaagcatgattacagactccccaagcaaca 485

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||||||||||||||| |||||||| ||||||||||||||||||||||| || ||||||
Sbjct: 486 gtgcactcctcgctggtcgcgctggcttggttcgcctggcactcgatgcatagatccatg 545

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           ||||||||||||||||| |||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 546 atgtggttgcggcagatagcgcagttgtcgacgacgatatcccatgcccagagcgcgacg 605

                                         
Query: 457 gcgttccactttttgatctcgaagcgcttg 486
           ||||||||||| ||||||||||||||||||
Sbjct: 606 gcgttccacttcttgatctcgaagcgcttg 635



to top

>gb|BT017385.1| Zea mays clone EL01N0326H05.c mRNA sequence
          Length = 720

 Score =  321 bits (162), Expect = 1e-84
 Identities = 243/270 (90%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||| ||||||||||||||||| ||||| ||||  ||||||||||| || |||
Sbjct: 434 tagtggccatatttctggaactcccactcactgttatctaatgggcacacttggcgagtc 375

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           || ||||| | |||||||||||||||||| || ||||| || || || ||||||||||| 
Sbjct: 374 ttaagccacctgctgatgcagtggaagtgaaaagcatgattacagacaccccaagcgaca 315

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||||||||||||||| ||||| || ||||||||||||||||||||||| || ||||||
Sbjct: 314 gtgcactcctcgctggtcgcgctagcttggttcgcctggcactcgatgcatagatccatg 255

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 254 atgtggttgcggcagatggcgcagttgtcgacgacgatatcccatgcccagagcgcgacg 195

                                         
Query: 457 gcgttccactttttgatctcgaagcgcttg 486
           ||||||||||| ||||||||||||||||||
Sbjct: 194 gcgttccacttcttgatctcgaagcgcttg 165



to top

>ref|XM_549849.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 690

 Score =  313 bits (158), Expect = 4e-82
 Identities = 242/270 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||| ||||| || ||||| || ||||| ||||  ||||||||||| || |||
Sbjct: 429 tagtgcccatatttctgaaattcccattcactgttatctaacgggcacacttggcgagtc 370

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| | ||||||||| |||||||| || ||||| || || || ||||||||||| 
Sbjct: 369 ttgagccacctgctgatgcaatggaagtgaaaagcatgattacagacaccccaagcgaca 310

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 309 gtgcactcctcactggtggcgctggcctggttcgcctggcactcgatgcatagatccatg 250

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 249 atgtggttgcggcagatggcgcagttgtcgacgacgatatcccatgcccagagcgcgacg 190

                                         
Query: 457 gcgttccactttttgatctcgaagcgcttg 486
           ||||||||||| ||||||||||||||||||
Sbjct: 189 gcgttccacttcttgatctcgaagcgcttg 160



to top

>dbj|AK119792.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-175-A04, full
           insert sequence
          Length = 703

 Score =  313 bits (158), Expect = 4e-82
 Identities = 242/270 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||| ||||| || ||||| || ||||| ||||  ||||||||||| || |||
Sbjct: 441 tagtgcccatatttctgaaattcccattcactgttatctaacgggcacacttggcgagtc 382

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| | ||||||||| |||||||| || ||||| || || || ||||||||||| 
Sbjct: 381 ttgagccacctgctgatgcaatggaagtgaaaagcatgattacagacaccccaagcgaca 322

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 321 gtgcactcctcactggtggcgctggcctggttcgcctggcactcgatgcatagatccatg 262

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 261 atgtggttgcggcagatggcgcagttgtcgacgacgatatcccatgcccagagcgcgacg 202

                                         
Query: 457 gcgttccactttttgatctcgaagcgcttg 486
           ||||||||||| ||||||||||||||||||
Sbjct: 201 gcgttccacttcttgatctcgaagcgcttg 172



to top

>dbj|AK099287.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023127H11, full
            insert sequence
          Length = 1715

 Score =  313 bits (158), Expect = 4e-82
 Identities = 242/270 (89%)
 Strand = Plus / Minus

                                                                        
Query: 217  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
            ||||| ||||| ||||| || ||||| || ||||| ||||  ||||||||||| || |||
Sbjct: 1419 tagtgcccatatttctgaaattcccattcactgttatctaacgggcacacttggcgagtc 1360

                                                                        
Query: 277  ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
            |||||||| | ||||||||| |||||||| || ||||| || || || ||||||||||| 
Sbjct: 1359 ttgagccacctgctgatgcaatggaagtgaaaagcatgattacagacaccccaagcgaca 1300

                                                                        
Query: 337  gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
            ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 1299 gtgcactcctcactggtggcgctggcctggttcgcctggcactcgatgcatagatccatg 1240

                                                                        
Query: 397  atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
            |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 1239 atgtggttgcggcagatggcgcagttgtcgacgacgatatcccatgcccagagcgcgacg 1180

                                          
Query: 457  gcgttccactttttgatctcgaagcgcttg 486
            ||||||||||| ||||||||||||||||||
Sbjct: 1179 gcgttccacttcttgatctcgaagcgcttg 1150



to top

>dbj|AK059300.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-F02, full
           insert sequence
          Length = 721

 Score =  313 bits (158), Expect = 4e-82
 Identities = 242/270 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||| ||||| || ||||| || ||||| ||||  ||||||||||| || |||
Sbjct: 460 tagtgcccatatttctgaaattcccattcactgttatctaacgggcacacttggcgagtc 401

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| | ||||||||| |||||||| || ||||| || || || ||||||||||| 
Sbjct: 400 ttgagccacctgctgatgcaatggaagtgaaaagcatgattacagacaccccaagcgaca 341

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 340 gtgcactcctcactggtggcgctggcctggttcgcctggcactcgatgcatagatccatg 281

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 280 atgtggttgcggcagatggcgcagttgtcgacgacgatatcccatgcccagagcgcgacg 221

                                         
Query: 457 gcgttccactttttgatctcgaagcgcttg 486
           ||||||||||| ||||||||||||||||||
Sbjct: 220 gcgttccacttcttgatctcgaagcgcttg 191



to top

>dbj|AK073331.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033026G05, full
           insert sequence
          Length = 690

 Score =  305 bits (154), Expect = 9e-80
 Identities = 241/270 (89%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||| ||||| || ||||| || ||||| ||||  ||||||||||| || |||
Sbjct: 429 tagtgcccatatttctgaaattcccattcactgttatctaacgggcacacttggcgagtc 370

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| | ||||||||| |||||||| ||  |||| || || || ||||||||||| 
Sbjct: 369 ttgagccacctgctgatgcaatggaagtgaaaaacatgattacagacaccccaagcgaca 310

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 309 gtgcactcctcactggtggcgctggcctggttcgcctggcactcgatgcatagatccatg 250

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 249 atgtggttgcggcagatggcgcagttgtcgacgacgatatcccatgcccagagcgcgacg 190

                                         
Query: 457 gcgttccactttttgatctcgaagcgcttg 486
           ||||||||||| ||||||||||||||||||
Sbjct: 189 gcgttccacttcttgatctcgaagcgcttg 160



to top

>gb|DQ294622.1| Arachis hypogaea RING-box protein (RBX1a) mRNA, complete cds
          Length = 355

 Score =  244 bits (123), Expect = 3e-61
 Identities = 240/279 (86%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||| ||||| |||||||||||||| || ||||||||||| ||||||||||||
Sbjct: 350 tagtggccatatttctgaaactcccactcgctattatctagagggcaaacttgacgggtc 291

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| | ||| ||||| |||||||| || |||||||||||||||||||| || || 
Sbjct: 290 ttgagccatctgcttatgcaatggaagtgaaaagcatggttgcaaactccccacgctaca 231

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||| |||||||| |||||||| ||||| || ||||||||||| |||||||| ||||||
Sbjct: 230 gtgcattcctcgctagtggcgctagcctgattagcctggcactcaatgcagagatccatg 171

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           || ||||| ||||| || |||||||| || || || || ||||| |||||||| || || 
Sbjct: 170 atatggttccggcaaatagcgcagttatcaacaactatatcccaagcccagagagcaaca 111

                                                  
Query: 457 gcgttccactttttgatctcgaagcgcttgcccttcttg 495
           |||||||| || ||||||||||||||||||  |||||||
Sbjct: 110 gcgttccatttcttgatctcgaagcgcttgggcttcttg 72



to top

>gb|AY119265.1| Drosophila melanogaster SD23839 full insert cDNA
          Length = 1181

 Score =  242 bits (122), Expect = 1e-60
 Identities = 233/270 (86%)
 Strand = Plus / Minus

                                                                       
Query: 216 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 275
           |||||| || ||||||||||| |||||||||| |||||| || ||||| || || || ||
Sbjct: 488 ttagtggccgtacttctggaaatcccactcgcggttgtccagtgggcatacctggcgcgt 429

                                                                       
Query: 276 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 335
           ||| ||||| ||   |||||||||||| ||||| || |||||||| || ||||| || ||
Sbjct: 428 ctttagccagcgagagatgcagtggaaatggaaggcgtggttgcagacgccccaggccac 369

                                                                       
Query: 336 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 395
           ||||||||||||||| ||||||   |||||||||||||| ||||||||||| | ||||||
Sbjct: 368 ggtgcactcctcgctagtggcggacgcctggttcgcctgacactcgatgcacaagtccat 309

                                                                       
Query: 396 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 455
           |||||||||||||||||||||||||||||| |||||||||||||||||||| || || ||
Sbjct: 308 gatgtggttgcggcagatggcgcagttgtccaccacgatgtcccaggcccacagagccac 249

                                         
Query: 456 ggcgttccactttttgatctcgaagcgctt 485
           |||||||||||| || | ||| ||||||||
Sbjct: 248 ggcgttccacttcttcacctcaaagcgctt 219



to top

>ref|NM_130496.2| Drosophila melanogaster Roc1a CG16982-RA (Roc1a), mRNA
          Length = 1168

 Score =  242 bits (122), Expect = 1e-60
 Identities = 233/270 (86%)
 Strand = Plus / Minus

                                                                       
Query: 216 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 275
           |||||| || ||||||||||| |||||||||| |||||| || ||||| || || || ||
Sbjct: 488 ttagtggccgtacttctggaaatcccactcgcggttgtccagtgggcatacctggcgcgt 429

                                                                       
Query: 276 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 335
           ||| ||||| ||   |||||||||||| ||||| || |||||||| || ||||| || ||
Sbjct: 428 ctttagccagcgagagatgcagtggaaatggaaggcgtggttgcagacgccccaggccac 369

                                                                       
Query: 336 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 395
           ||||||||||||||| ||||||   |||||||||||||| ||||||||||| | ||||||
Sbjct: 368 ggtgcactcctcgctagtggcggacgcctggttcgcctgacactcgatgcacaagtccat 309

                                                                       
Query: 396 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 455
           |||||||||||||||||||||||||||||| |||||||||||||||||||| || || ||
Sbjct: 308 gatgtggttgcggcagatggcgcagttgtccaccacgatgtcccaggcccacagagccac 249

                                         
Query: 456 ggcgttccactttttgatctcgaagcgctt 485
           |||||||||||| || | ||| ||||||||
Sbjct: 248 ggcgttccacttcttcacctcaaagcgctt 219



to top

>gb|DQ099098.1| Arachis stenosperma clone AS1RN18H05 microsatellite sequence
          Length = 692

 Score =  236 bits (119), Expect = 7e-59
 Identities = 239/279 (85%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||| ||||| |||||||| ||||| || ||||||||||| ||||||||||||
Sbjct: 416 tagtggccatatttctgaaactcccattcgctattatctagagggcaaacttgacgggtc 357

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| | ||| ||||| |||||||| || |||||||||||||||||||| || || 
Sbjct: 356 ttgagccatctgcttatgcaatggaagtgaaaagcatggttgcaaactccccacgctaca 297

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||| |||||||| |||||||| ||||| || ||||||||||| |||||||| ||||||
Sbjct: 296 gtgcattcctcgctagtggcgctagcctgattagcctggcactcaatgcagagatccatg 237

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           || ||||| ||||| || |||||||| || || || || ||||| |||||||| || || 
Sbjct: 236 atatggttccggcaaatagcgcagttatcaacaactatatcccaagcccagagagcaaca 177

                                                  
Query: 457 gcgttccactttttgatctcgaagcgcttgcccttcttg 495
           |||||||| || ||||||||||||||||||  |||||||
Sbjct: 176 gcgttccatttcttgatctcgaagcgcttgggcttcttg 138



to top

>ref|XM_314102.2| Anopheles gambiae str. PEST ENSANGP00000010437
           (ENSANGG00000007948), mRNA
          Length = 612

 Score =  214 bits (108), Expect = 2e-52
 Identities = 222/260 (85%)
 Strand = Plus / Minus

                                                                       
Query: 220 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 279
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 381 tgaccgtacttctggaactcccactctctgttgtcgagcggacagacctgccgggtcttc 322

                                                                       
Query: 280 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 339
           ||||| |||  |||||||||||||||||| ||||| || || || |||||||| || |||
Sbjct: 321 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgtg 262

                                                                       
Query: 340 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 399
           || |||||||||||||||   || ||||||||||||||||||||||| || |||||||||
Sbjct: 261 cattcctcgctggtggcggacgcttggttcgcctggcactcgatgcacagatccatgatg 202

                                                                       
Query: 400 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 459
           || || |||||||| || |||||||| |||||||||||||||||||| |  || || |||
Sbjct: 201 tgatttcggcagatcgcacagttgtccaccacgatgtcccaggcccacaaggctaccgcg 142

                               
Query: 460 ttccactttttgatctcgaa 479
           |||||||| |||| ||||||
Sbjct: 141 ttccacttcttgacctcgaa 122



to top

>dbj|AK066348.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013059F24, full
            insert sequence
          Length = 2340

 Score =  210 bits (106), Expect = 4e-51
 Identities = 109/110 (99%)
 Strand = Plus / Minus

                                                                        
Query: 217  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2091 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 2032

                                                              
Query: 277  ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactcc 326
            |||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 2031 ttgagccaacggctgatgcagtggaagtggaacgcatggttgcaaactcc 1982



 Score =  172 bits (87), Expect = 8e-40
 Identities = 105/111 (94%)
 Strand = Plus / Minus

                                                                       
Query: 385 cagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcc 444
           ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||
Sbjct: 233 cagaggtccatgatgtggttgcggcagatggcgcagttgtccacgacgatgtcccaggcc 174

                                                              
Query: 445 cagagcgcgacggcgttccactttttgatctcgaagcgcttgcccttcttg 495
           ||||| | ||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 173 cagagggagacagcgttccacttcttgatctcgaagcgcttgcccttcttg 123



 Score =  113 bits (57), Expect = 7e-22
 Identities = 60/61 (98%)
 Strand = Plus / Minus

                                                                       
Query: 325 ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 384
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 423 ccccaagcgacggtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatg 364

            
Query: 385 c 385
           |
Sbjct: 363 c 363



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 531 gggggccacggccacggcgacgtcgccctggtccatcgcga 571
           ||||| ||||||||||||||||||||||| |||||| ||||
Sbjct: 93  ggggggcacggccacggcgacgtcgcccttgtccatggcga 53



to top

>gb|AY555146.1| Fragaria x ananassa putative ring-box protein mRNA, partial cds
          Length = 422

 Score =  206 bits (104), Expect = 6e-50
 Identities = 200/232 (86%)
 Strand = Plus / Minus

                                                                       
Query: 264 cacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaac 323
           |||||| |||||||||||||| | ||| ||||||||||||||||| |||||||| |||||
Sbjct: 422 cacttggcgggtcttgagccatctgctaatgcagtggaagtggaaggcatggttacaaac 363

                                                                       
Query: 324 tccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgat 383
            |||||||| || || |||||||| || || || || |||||||||||||||||||||||
Sbjct: 362 cccccaagcaacagtacactcctcactcgtagcactcgcctggttcgcctggcactcgat 303

                                                                       
Query: 384 gcagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggc 443
           |||||||||||| || ||||| | |||||||||||| || || || || |  ||||||||
Sbjct: 302 gcagaggtccataatatggttcctgcagatggcgcaattatccacaacaacatcccaggc 243

                                                               
Query: 444 ccagagcgcgacggcgttccactttttgatctcgaagcgcttgcccttcttg 495
           |||||| ||||||||||||||||| |||||||| || ||||||  |||||||
Sbjct: 242 ccagagagcgacggcgttccacttcttgatctcaaatcgcttgggcttcttg 191



to top

>emb|AL031581.1|DMC115C2 Drosophila melanogaster cosmid clone 115C2
          Length = 46630

 Score =  202 bits (102), Expect = 9e-49
 Identities = 192/222 (86%)
 Strand = Plus / Minus

                                                                         
Query: 216   ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 275
             |||||| || ||||||||||| |||||||||| |||||| || ||||| || || || ||
Sbjct: 25504 ttagtggccgtacttctggaaatcccactcgcggttgtccagtgggcatacctggcgcgt 25445

                                                                         
Query: 276   cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 335
             ||| ||||| ||   |||||||||||| ||||| || |||||||| || ||||| || ||
Sbjct: 25444 ctttagccagcgagagatgcagtggaaatggaaggcgtggttgcagacgccccaggccac 25385

                                                                         
Query: 336   ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 395
             ||||||||||||||| ||||||   |||||||||||||| ||||||||||| | ||||||
Sbjct: 25384 ggtgcactcctcgctagtggcggacgcctggttcgcctgacactcgatgcacaagtccat 25325

                                                       
Query: 396   gatgtggttgcggcagatggcgcagttgtcgaccacgatgtc 437
             |||||||||||||||||||||||||||||| |||||||||||
Sbjct: 25324 gatgtggttgcggcagatggcgcagttgtccaccacgatgtc 25283



to top

>gb|AC104602.3| Drosophila melanogaster X BAC RP98-16G6 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 161668

 Score =  202 bits (102), Expect = 9e-49
 Identities = 192/222 (86%)
 Strand = Plus / Minus

                                                                          
Query: 216    ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 275
              |||||| || ||||||||||| |||||||||| |||||| || ||||| || || || ||
Sbjct: 133697 ttagtggccgtacttctggaaatcccactcgcggttgtccagtgggcatacctggcgcgt 133638

                                                                          
Query: 276    cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 335
              ||| ||||| ||   |||||||||||| ||||| || |||||||| || ||||| || ||
Sbjct: 133637 ctttagccagcgagagatgcagtggaaatggaaggcgtggttgcagacgccccaggccac 133578

                                                                          
Query: 336    ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 395
              ||||||||||||||| ||||||   |||||||||||||| ||||||||||| | ||||||
Sbjct: 133577 ggtgcactcctcgctagtggcggacgcctggttcgcctgacactcgatgcacaagtccat 133518

                                                        
Query: 396    gatgtggttgcggcagatggcgcagttgtcgaccacgatgtc 437
              |||||||||||||||||||||||||||||| |||||||||||
Sbjct: 133517 gatgtggttgcggcagatggcgcagttgtccaccacgatgtc 133476



to top

>gb|AE003418.4| Drosophila melanogaster chromosome X, section 2 of 74 of the complete
              sequence
          Length = 315092

 Score =  202 bits (102), Expect = 9e-49
 Identities = 192/222 (86%)
 Strand = Plus / Minus

                                                                          
Query: 216    ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 275
              |||||| || ||||||||||| |||||||||| |||||| || ||||| || || || ||
Sbjct: 117064 ttagtggccgtacttctggaaatcccactcgcggttgtccagtgggcatacctggcgcgt 117005

                                                                          
Query: 276    cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 335
              ||| ||||| ||   |||||||||||| ||||| || |||||||| || ||||| || ||
Sbjct: 117004 ctttagccagcgagagatgcagtggaaatggaaggcgtggttgcagacgccccaggccac 116945

                                                                          
Query: 336    ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 395
              ||||||||||||||| ||||||   |||||||||||||| ||||||||||| | ||||||
Sbjct: 116944 ggtgcactcctcgctagtggcggacgcctggttcgcctgacactcgatgcacaagtccat 116885

                                                        
Query: 396    gatgtggttgcggcagatggcgcagttgtcgaccacgatgtc 437
              |||||||||||||||||||||||||||||| |||||||||||
Sbjct: 116884 gatgtggttgcggcagatggcgcagttgtccaccacgatgtc 116843



to top

>emb|BX006952.1|CNS08DJ0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 636

 Score =  198 bits (100), Expect = 1e-47
 Identities = 221/260 (85%), Gaps = 1/260 (0%)
 Strand = Plus / Minus

                                                                       
Query: 220 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 279
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 366 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 307

                                                                       
Query: 280 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 339
           ||||| |||  |||||||||||||||||| ||||| || || || |||||||| || |||
Sbjct: 306 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgtg 247

                                                                       
Query: 340 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 399
           || ||||||||||||| |  | | ||||||||||||||||||||||| || |||||||||
Sbjct: 246 cattcctcgctggtggtgacg-cttggttcgcctggcactcgatgcacagatccatgatg 188

                                                                       
Query: 400 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 459
           || || |||||||| || |||||||| |||||||||||||||||||| |  || || |||
Sbjct: 187 tgatttcggcagatcgcacagttgtccaccacgatgtcccaggcccacaaggctaccgcg 128

                               
Query: 460 ttccactttttgatctcgaa 479
           |||||||| |||| ||||||
Sbjct: 127 ttccacttcttgacctcgaa 108



to top

>emb|BX006498.1|CNS08D6E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 647

 Score =  198 bits (100), Expect = 1e-47
 Identities = 221/260 (85%), Gaps = 1/260 (0%)
 Strand = Plus / Minus

                                                                       
Query: 220 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 279
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 365 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 306

                                                                       
Query: 280 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 339
           ||||| |||  |||||||||||||||||| ||||| || || || |||||||| || |||
Sbjct: 305 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgtg 246

                                                                       
Query: 340 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 399
           || ||||||||||||| |  | | ||||||||||||||||||||||| || |||||||||
Sbjct: 245 cattcctcgctggtggtgacg-cttggttcgcctggcactcgatgcacagatccatgatg 187

                                                                       
Query: 400 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 459
           || || |||||||| || |||||||| |||||||||||||||||||| |  || || |||
Sbjct: 186 tgatttcggcagatcgctcagttgtccaccacgatgtcccaggcccacaaggctaccgcg 127

                               
Query: 460 ttccactttttgatctcgaa 479
           |||||||| |||| ||||||
Sbjct: 126 ttccacttcttgacctcgaa 107



to top

>emb|BX008661.1|CNS08EUH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score =  194 bits (98), Expect = 2e-46
 Identities = 225/266 (84%), Gaps = 1/266 (0%)
 Strand = Plus / Minus

                                                                       
Query: 220 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 279
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 442 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 383

                                                                       
Query: 280 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 339
           ||||| |||  |||| ||||||||||||| ||||| || || || |||||||| || |||
Sbjct: 382 agccatcgggagatgaagtggaagtggaacgcatgattacacacaccccaagccaccgtg 323

                                                                       
Query: 340 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 399
           || ||||||||||||| |  | | ||||||||||||||||||||||| || |||||||||
Sbjct: 322 cattcctcgctggtggtgacg-cttggttcgcctggcactcgatgcacagatccatgatg 264

                                                                       
Query: 400 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 459
           || || |||||||| || |||||||| |||||||||||||||||||| |  || || |||
Sbjct: 263 tgatttcggcagatcgcacagttgtccaccacgatgtcccaggcccacaaggctaccgcg 204

                                     
Query: 460 ttccactttttgatctcgaagcgctt 485
           |||||||| |||| |||||| |||||
Sbjct: 203 ttccacttcttgacctcgaaccgctt 178



to top

>emb|BX020496.1|CNS08NZ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score =  190 bits (96), Expect = 4e-45
 Identities = 220/260 (84%), Gaps = 1/260 (0%)
 Strand = Plus / Minus

                                                                       
Query: 220 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 279
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 443 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 384

                                                                       
Query: 280 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 339
           ||||| |||  |||||||||||||||||| ||||| || || || |||||||| || | |
Sbjct: 383 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgcg 324

                                                                       
Query: 340 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 399
           || ||||||||||||| |  | | ||||||||||||||||||||||| || |||||||||
Sbjct: 323 cattcctcgctggtggtgacg-cttggttcgcctggcactcgatgcacagatccatgatg 265

                                                                       
Query: 400 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 459
           || || |||||||| || |||||||| |||||||||||||||||||| |  || || |||
Sbjct: 264 tgatttcggcagatcgcacagttgtccaccacgatgtcccaggcccacaaggctaccgcg 205

                               
Query: 460 ttccactttttgatctcgaa 479
           |||||||| |||| ||||||
Sbjct: 204 ttccacttcttgacctcgaa 185



to top

>emb|BX012866.1|CNS08I3A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 537

 Score =  182 bits (92), Expect = 9e-43
 Identities = 218/260 (83%)
 Strand = Plus / Plus

                                                                       
Query: 226 tacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaa 285
           |||||||||||||||||||| |||||||| || || || || || |||||||| ||||| 
Sbjct: 139 tacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttcagccat 198

                                                                       
Query: 286 cggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcc 345
           |||  || ||||||||||||||| ||||| || || || |||||||| || ||||| |||
Sbjct: 199 cgggagaagcagtggaagtggaacgcatgattacacacaccccaagccaccgtgcattcc 258

                                                                       
Query: 346 tcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttg 405
           |||||||||||    || ||||||||||||||||||||||| |  ||||||||||| || 
Sbjct: 259 tcgctggtggctgacgcttggttcgcctggcactcgatgcacaaatccatgatgtgattt 318

                                                                       
Query: 406 cggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccac 465
           |||||||  || |||||||| |||||||||||||||||||| |  || || |||||||||
Sbjct: 319 cggcagaacgcacagttgtccaccacgatgtcccaggcccacaaggctaccgcgttccac 378

                               
Query: 466 tttttgatctcgaagcgctt 485
           || |||| |||||| |||||
Sbjct: 379 ttcttgacctcgaaccgctt 398



to top

>emb|BX006499.1|CNS08D6F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 648

 Score =  180 bits (91), Expect = 3e-42
 Identities = 224/267 (83%), Gaps = 1/267 (0%)
 Strand = Plus / Plus

                                                                       
Query: 220 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 279
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 226 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 285

                                                                       
Query: 280 agccaacggctgatgcagtggaagtggaatgc-atggttgcaaactccccaagcgacggt 338
           ||||| |||  || ||||||||||||||| || ||| || || || |||||||| || ||
Sbjct: 286 agccatcgggagaagcagtggaagtggaacgccatgattacacacaccccaagccaccgt 345

                                                                       
Query: 339 gcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgat 398
           ||| ||||||||||||||    || ||||||||||||||||||||||| || ||||||||
Sbjct: 346 gcattcctcgctggtggctgacgcttggttcgcctggcactcgatgcacagatccatgat 405

                                                                       
Query: 399 gtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggc 458
           ||| || |||||||  || |||||||| |||||||||||||||||||| |  || || ||
Sbjct: 406 gtgatttcggcagaacgcacagttgtccaccacgatgtcccaggcccacaaggctaccgc 465

                                      
Query: 459 gttccactttttgatctcgaagcgctt 485
           ||||||||| |||| |||||| |||||
Sbjct: 466 gttccacttcttgacctcgaaccgctt 492



to top

>ref|NM_122064.2| Arabidopsis thaliana RBX1 AT5G20570 (RBX1) mRNA, complete cds
          Length = 692

 Score =  178 bits (90), Expect = 1e-41
 Identities = 225/270 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 275
           |||||||||||| ||||| ||||||||||| ||||| || |  || || |||||||| ||
Sbjct: 447 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 388

                                                                       
Query: 276 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 335
           ||| ||||| | |||||||||||| |||||||| || || |||||||| |||||||| ||
Sbjct: 387 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 328

                                                                       
Query: 336 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 395
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 327 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 268

                                                                       
Query: 396 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 455
           ||||||||| | |||||| || |||||||| || ||||| ||||| |||||||| || ||
Sbjct: 267 gatgtggtttctgcagatcgcacagttgtcaacaacgatatcccaagcccagagagcaac 208

                                         
Query: 456 ggcgttccactttttgatctcgaagcgctt 485
           |||| ||||||| || || ||||| |||||
Sbjct: 207 ggcgctccacttcttaatttcgaatcgctt 178



to top

>gb|AY114719.1| Arabidopsis thaliana ring-box protein-like (At5g20570) mRNA,
           complete cds
          Length = 544

 Score =  178 bits (90), Expect = 1e-41
 Identities = 225/270 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 275
           |||||||||||| ||||| ||||||||||| ||||| || |  || || |||||||| ||
Sbjct: 357 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 298

                                                                       
Query: 276 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 335
           ||| ||||| | |||||||||||| |||||||| || || |||||||| |||||||| ||
Sbjct: 297 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 238

                                                                       
Query: 336 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 395
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 237 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 178

                                                                       
Query: 396 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 455
           ||||||||| | |||||| || |||||||| || ||||| ||||| |||||||| || ||
Sbjct: 177 gatgtggtttctgcagatcgcacagttgtcaacaacgatatcccaagcccagagagcaac 118

                                         
Query: 456 ggcgttccactttttgatctcgaagcgctt 485
           |||| ||||||| || || ||||| |||||
Sbjct: 117 ggcgctccacttcttaatttcgaatcgctt 88



to top

>gb|AY072430.1| Arabidopsis thaliana ring-box protein - like (At5g20570) mRNA,
           complete cds
          Length = 666

 Score =  178 bits (90), Expect = 1e-41
 Identities = 225/270 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 275
           |||||||||||| ||||| ||||||||||| ||||| || |  || || |||||||| ||
Sbjct: 444 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 385

                                                                       
Query: 276 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 335
           ||| ||||| | |||||||||||| |||||||| || || |||||||| |||||||| ||
Sbjct: 384 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 325

                                                                       
Query: 336 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 395
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 324 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 265

                                                                       
Query: 396 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 455
           ||||||||| | |||||| || |||||||| || ||||| ||||| |||||||| || ||
Sbjct: 264 gatgtggtttctgcagatcgcacagttgtcaacaacgatatcccaagcccagagagcaac 205

                                         
Query: 456 ggcgttccactttttgatctcgaagcgctt 485
           |||| ||||||| || || ||||| |||||
Sbjct: 204 ggcgctccacttcttaatttcgaatcgctt 175



to top

>gb|AY052401.1| Arabidopsis thaliana ring box-1-like protein mRNA, complete cds
          Length = 357

 Score =  178 bits (90), Expect = 1e-41
 Identities = 225/270 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 275
           |||||||||||| ||||| ||||||||||| ||||| || |  || || |||||||| ||
Sbjct: 357 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 298

                                                                       
Query: 276 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 335
           ||| ||||| | |||||||||||| |||||||| || || |||||||| |||||||| ||
Sbjct: 297 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 238

                                                                       
Query: 336 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 395
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 237 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 178

                                                                       
Query: 396 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 455
           ||||||||| | |||||| || |||||||| || ||||| ||||| |||||||| || ||
Sbjct: 177 gatgtggtttctgcagatcgcacagttgtcaacaacgatatcccaagcccagagagcaac 118

                                         
Query: 456 ggcgttccactttttgatctcgaagcgctt 485
           |||| ||||||| || || ||||| |||||
Sbjct: 117 ggcgctccacttcttaatttcgaatcgctt 88



to top

>gb|AY086913.1| Arabidopsis thaliana clone 29408 mRNA, complete sequence
          Length = 635

 Score =  178 bits (90), Expect = 1e-41
 Identities = 225/270 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 275
           |||||||||||| ||||| ||||||||||| ||||| || |  || || |||||||| ||
Sbjct: 447 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 388

                                                                       
Query: 276 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 335
           ||| ||||| | |||||||||||| |||||||| || || |||||||| |||||||| ||
Sbjct: 387 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 328

                                                                       
Query: 336 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 395
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 327 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 268

                                                                       
Query: 396 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 455
           ||||||||| | |||||| || |||||||| || ||||| ||||| |||||||| || ||
Sbjct: 267 gatgtggtttctgcagatcgcacagttgtcaacaacgatatcccaagcccagagagcaac 208

                                         
Query: 456 ggcgttccactttttgatctcgaagcgctt 485
           |||| ||||||| || || ||||| |||||
Sbjct: 207 ggcgctccacttcttaatttcgaatcgctt 178



to top

>dbj|AK118181.1| Arabidopsis thaliana At5g20570 mRNA for putative ring-box protein,
           complete cds, clone: RAFL19-50-B14
          Length = 665

 Score =  178 bits (90), Expect = 1e-41
 Identities = 225/270 (83%)
 Strand = Plus / Minus

                                                                       
Query: 216 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 275
           |||||||||||| ||||| ||||||||||| ||||| || |  || || |||||||| ||
Sbjct: 438 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 379

                                                                       
Query: 276 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 335
           ||| ||||| | |||||||||||| |||||||| || || |||||||| |||||||| ||
Sbjct: 378 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 319

                                                                       
Query: 336 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 395
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 318 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 259

                                                                       
Query: 396 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 455
           ||||||||| | |||||| || |||||||| || ||||| ||||| |||||||| || ||
Sbjct: 258 gatgtggtttctgcagatcgcacagttgtcaacaacgatatcccaagcccagagagcaac 199

                                         
Query: 456 ggcgttccactttttgatctcgaagcgctt 485
           |||| ||||||| || || ||||| |||||
Sbjct: 198 ggcgctccacttcttaatttcgaatcgctt 169



to top

>gb|AY027936.1| Salmo salar hyperosmotic protein 21 mRNA, complete cds
          Length = 1933

 Score =  172 bits (87), Expect = 8e-40
 Identities = 210/251 (83%)
 Strand = Plus / Minus

                                                                        
Query: 217  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
            ||||| ||||| ||||| ||||||||||| ||||||||||| |||||||| || | ||||
Sbjct: 1703 tagtgtccatatttctgaaactcccactccctgttgtctagggggcacacctgcctggtc 1644

                                                                        
Query: 277  ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
            || | |||||||  ||| |||||||| ||||||||||| ||||| |||||||| || |||
Sbjct: 1643 ttcaaccaacgggagatacagtggaaatggaatgcatgattgcagactccccaggctacg 1584

                                                                        
Query: 337  gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
            |||||||||||    |||||   ||||||||| ||||||||||| |||||||| ||||| 
Sbjct: 1583 gtgcactcctctgatgtggcagaggcctggttagcctggcactctatgcagagatccata 1524

                                                                        
Query: 397  atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
            ||||| || |  |||||||| |||||||| ||||| |||||||||||||| || || || 
Sbjct: 1523 atgtgattcctacagatggcacagttgtccaccacaatgtcccaggcccaaagtgccact 1464

                       
Query: 457  gcgttccactt 467
            || ||||||||
Sbjct: 1463 gcattccactt 1453



to top

>gb|DQ000158.1| Salmo salar hyperosmotic protein 21 (Shop21) gene, Shop21-2 allele,
            complete cds
          Length = 2855

 Score =  172 bits (87), Expect = 8e-40
 Identities = 210/251 (83%)
 Strand = Plus / Minus

                                                                        
Query: 217  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
            ||||| ||||| ||||| ||||||||||| ||||||||||| |||||||| || | ||||
Sbjct: 2825 tagtgtccatatttctgaaactcccactccctgttgtctagggggcacacctgcctggtc 2766

                                                                        
Query: 277  ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
            || | |||||||  ||| |||||||| ||||||||||| ||||| |||||||| || |||
Sbjct: 2765 ttcaaccaacgggagatacagtggaaatggaatgcatgattgcagactccccaggctacg 2706

                                                                        
Query: 337  gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
            |||||||||||    |||||   ||||||||| ||||||||||| |||||||| ||||| 
Sbjct: 2705 gtgcactcctctgatgtggcagaggcctggttagcctggcactctatgcagagatccata 2646

                                                                        
Query: 397  atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
            ||||| || |  |||||||| |||||||| ||||| |||||||||||||| || || || 
Sbjct: 2645 atgtgattcctacagatggcacagttgtccaccacaatgtcccaggcccaaagtgccact 2586

                       
Query: 457  gcgttccactt 467
            || ||||||||
Sbjct: 2585 gcattccactt 2575



to top

>gb|DQ000157.1| Salmo salar hyperosmotic protein 21 (Shop21) gene, Shop21-1 allele,
            complete cds
          Length = 3985

 Score =  172 bits (87), Expect = 8e-40
 Identities = 210/251 (83%)
 Strand = Plus / Minus

                                                                        
Query: 217  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
            ||||| ||||| ||||| ||||||||||| ||||||||||| |||||||| || | ||||
Sbjct: 3955 tagtgtccatatttctgaaactcccactccctgttgtctagggggcacacctgcctggtc 3896

                                                                        
Query: 277  ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
            || | |||||||  ||| |||||||| ||||||||||| ||||| |||||||| || |||
Sbjct: 3895 ttcaaccaacgggagatacagtggaaatggaatgcatgattgcagactccccaggctacg 3836

                                                                        
Query: 337  gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
            |||||||||||    |||||   ||||||||| ||||||||||| |||||||| ||||| 
Sbjct: 3835 gtgcactcctctgatgtggcagaggcctggttagcctggcactctatgcagagatccata 3776

                                                                        
Query: 397  atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
            ||||| || |  |||||||| |||||||| ||||| |||||||||||||| || || || 
Sbjct: 3775 atgtgattcctacagatggcacagttgtccaccacaatgtcccaggcccaaagtgccact 3716

                       
Query: 457  gcgttccactt 467
            || ||||||||
Sbjct: 3715 gcattccactt 3705



to top

>gb|AY432709.1| Aedes aegypti ASAP ID: 35185 ubiquitin ligase mRNA sequence
          Length = 626

 Score =  170 bits (86), Expect = 3e-39
 Identities = 212/254 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| ||||| || ||||| || |  ||||| ||||| || |||
Sbjct: 472 tagtgtccatacttttggaattcccattccctgttatccaacgggcagacttgtcgtgtc 413

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           || |||||||||  |||||||||||| |||||||| ||||| ||||| ||||| || || 
Sbjct: 412 ttcagccaacgggagatgcagtggaaatggaatgcgtggttacaaacaccccaggctaca 353

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||| || ||||| |||||    || || || |||||||| |||||||| || ||||| 
Sbjct: 352 gtgcattcttcgctagtggcagatgcttgatttgcctggcattcgatgcaaagatccata 293

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           ||||| |||||||| ||||||||||||||||||||||| ||||||||||| || || |||
Sbjct: 292 atgtgattgcggcaaatggcgcagttgtcgaccacgatatcccaggcccacagagctacg 233

                         
Query: 457 gcgttccacttttt 470
           ||||||||||||||
Sbjct: 232 gcgttccacttttt 219



to top

>gb|DQ440316.1| Aedes aegypti clone AET-4020 SCF ubiquitin ligase Rbx1 component
           mRNA, complete cds
          Length = 330

 Score =  170 bits (86), Expect = 3e-39
 Identities = 212/254 (83%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| ||||| || ||||| || |  ||||| ||||| || |||
Sbjct: 329 tagtgtccatacttttggaattcccattccctgttatccaacgggcagacttgtcgtgtc 270

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           || |||||||||  |||||||||||| |||||||| ||||| ||||| ||||| || || 
Sbjct: 269 ttcagccaacgggagatgcagtggaaatggaatgcgtggttacaaacaccccaggctaca 210

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||| || ||||| |||||    || || || |||||||| |||||||| || ||||| 
Sbjct: 209 gtgcattcttcgctagtggcagatgcttgatttgcctggcattcgatgcaaagatccata 150

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           ||||| |||||||| ||||||||||||||||||||||| ||||||||||| || || |||
Sbjct: 149 atgtgattgcggcaaatggcgcagttgtcgaccacgatatcccaggcccacagagctacg 90

                         
Query: 457 gcgttccacttttt 470
           ||||||||||||||
Sbjct: 89  gcgttccacttttt 76



to top

>emb|BX833527.1|CNS0A0LK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL60ZC05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 581

 Score =  170 bits (86), Expect = 3e-39
 Identities = 224/270 (82%)
 Strand = Plus / Minus

                                                                       
Query: 216 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 275
           |||||||||||| ||||| ||||||||||| ||||| || |  || || |||||||| ||
Sbjct: 421 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 362

                                                                       
Query: 276 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 335
           ||| ||||| | |||||||||||| |||||||| || || |||||||| |||||||| ||
Sbjct: 361 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 302

                                                                       
Query: 336 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 395
            |||||||| || || ||||  |||||||| || ||||| |||||||| || || |||||
Sbjct: 301 agtgcactcttcacttgtgggactggcctgattagcctgacactcgatacaaagatccat 242

                                                                       
Query: 396 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 455
           ||||||||| | |||||| || |||||||| || ||||| ||||| |||||||| || ||
Sbjct: 241 gatgtggtttctgcagatcgcacagttgtcaacaacgatatcccaagcccagagagcaac 182

                                         
Query: 456 ggcgttccactttttgatctcgaagcgctt 485
           |||| ||||||| || || ||||| |||||
Sbjct: 181 ggcgctccacttcttaatttcgaatcgctt 152



to top

>gb|AY302066.1| Populus tomentosa ring box protein mRNA, complete cds
          Length = 687

 Score =  163 bits (82), Expect = 8e-37
 Identities = 223/270 (82%)
 Strand = Plus / Minus

                                                                       
Query: 216 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 275
           |||||| ||||||||||| |||||||||||||| || || |||||||||||||| |||||
Sbjct: 417 ttagtggccatacttctgaaactcccactcgctattatcgagagggcacacttggcgggt 358

                                                                       
Query: 276 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 335
            |||||||| |||||||| |||||||||||||| ||||||||||| || ||||| || ||
Sbjct: 357 tttgagccatcggctgatacagtggaagtggaaggcatggttgcacacaccccaggcaac 298

                                                                       
Query: 336 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 395
            |||||||||||||| || || || || || || || |||||||| ||||| || |||||
Sbjct: 297 agtgcactcctcgcttgtagcactagcttgatttgcttggcactcaatgcaaagatccat 238

                                                                       
Query: 396 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 455
           ||| ||||| |  || || ||||| || || ||||| || ||||| ||||| || || ||
Sbjct: 237 gatatggtttctacaaatagcgcaattatccaccacaatatcccaagcccaaagagcaac 178

                                         
Query: 456 ggcgttccactttttgatctcgaagcgctt 485
            || |||||||| || || ||||| |||||
Sbjct: 177 agcattccacttcttaatttcgaatcgctt 148



to top

>emb|BX037579.1|CNS0915R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 468

 Score =  161 bits (81), Expect = 3e-36
 Identities = 174/205 (84%)
 Strand = Plus / Plus

                                                                       
Query: 220 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 279
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 264 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 323

                                                                       
Query: 280 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 339
           ||||| |||  |||||||||||||||||| ||||| || || || |||||||| || |||
Sbjct: 324 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgtg 383

                                                                       
Query: 340 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 399
           || ||||||||||||||    || ||||||||||||||||||||||| || |||||||||
Sbjct: 384 cattcctcgctggtggctgacgcttggttcgcctggcactcgatgcacagatccatgatg 443

                                    
Query: 400 tggttgcggcagatggcgcagttgt 424
           || || |||||||| || |||||||
Sbjct: 444 tgatttcggcagatcgcacagttgt 468



to top

>emb|BX008706.1|CNS08EVQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 499

 Score =  155 bits (78), Expect = 2e-34
 Identities = 189/222 (85%), Gaps = 3/222 (1%)
 Strand = Plus / Minus

                                                                       
Query: 220 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 279
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 264 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 205

                                                                       
Query: 280 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 339
           ||||| |||  |||||||||||||||||| ||||| || || || |||||||| || |||
Sbjct: 204 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgtg 145

                                                                       
Query: 340 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 399
           || ||||||||||||| |   || ||||||||||||||||||||||| || |||||||||
Sbjct: 144 cattcctcgctggtggtg-acgcttggttcgcctggcactcgatgcacagatccatgatg 86

                                                     
Query: 400 tggttgcggcagatg-gcgcagttgtcga-ccacgatgtccc 439
           || || ||||||||| || |||||||| | ||||||||||||
Sbjct: 85  tgatttcggcagatgcgcacagttgtccagccacgatgtccc 44



to top

>emb|CR631384.2|CNS0EM59 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  151 bits (76), Expect = 3e-33
 Identities = 205/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| |||||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacggcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>ref|XM_363999.1| Magnaporthe grisea 70-15 hypothetical protein (MG08844.4) partial
           cds
          Length = 702

 Score =  149 bits (75), Expect = 1e-32
 Identities = 165/195 (84%)
 Strand = Plus / Minus

                                                                       
Query: 291 gatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcgct 350
           |||||||||||||||||| || || ||||| |  ||||| || || ||||||||||||||
Sbjct: 285 gatgcagtggaagtggaaagcgtgattgcagataccccaggcaacagtgcactcctcgct 226

                                                                       
Query: 351 ggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggca 410
            ||||||   || ||||| |||||||| || || || || ||||||||||| || | |||
Sbjct: 225 cgtggcggatgcttggtttgcctggcattcaatacaaagatccatgatgtgattcctgca 166

                                                                       
Query: 411 gatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttttt 470
           |||||||||||||||||| || |||||||| ||||||||||| |||||||||||||| ||
Sbjct: 165 gatggcgcagttgtcgacgacaatgtcccaagcccagagcgcaacggcgttccacttctt 106

                          
Query: 471 gatctcgaagcgctt 485
           || |||||| |||||
Sbjct: 105 gacctcgaatcgctt 91



to top

>emb|BX020497.1|CNS08NZ9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 228

 Score =  147 bits (74), Expect = 5e-32
 Identities = 173/206 (83%)
 Strand = Plus / Plus

                                                                       
Query: 220 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 279
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 23  tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 82

                                                                       
Query: 280 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 339
           ||||| |||  || ||||||||||||||| ||||| || || || |||||||| || | |
Sbjct: 83  agccatcgggagaagcagtggaagtggaacgcatgattacacacaccccaagccaccgcg 142

                                                                       
Query: 340 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 399
           || ||||||||||||||    || ||||||||||||||||||||||| || |||||||||
Sbjct: 143 cattcctcgctggtggctgacgcttggttcgcctggcactcgatgcacagatccatgatg 202

                                     
Query: 400 tggttgcggcagatggcgcagttgtc 425
           || || |||||||| || ||||||||
Sbjct: 203 tgatttcggcagatcgcacagttgtc 228



to top

>gb|AF480496.1| Oryza sativa clone BAC 49D11, complete sequence
          Length = 158050

 Score =  145 bits (73), Expect = 2e-31
 Identities = 73/73 (100%)
 Strand = Plus / Plus

                                                                         
Query: 254   ctagagggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcat 313
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 56962 ctagagggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcat 57021

                          
Query: 314   ggttgcaaactcc 326
             |||||||||||||
Sbjct: 57022 ggttgcaaactcc 57034



 Score =  113 bits (57), Expect = 7e-22
 Identities = 60/61 (98%)
 Strand = Plus / Plus

                                                                         
Query: 325   ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 384
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 58593 ccccaagcgacggtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatg 58652

              
Query: 385   c 385
             |
Sbjct: 58653 c 58653



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 51/53 (96%)
 Strand = Plus / Plus

                                                                  
Query: 385   cagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtc 437
             ||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 58783 cagaggtccatgatgtggttgcggcagatggcgcagttgtccacgacgatgtc 58835



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 55/59 (93%)
 Strand = Plus / Plus

                                                                        
Query: 437   cccaggcccagagcgcgacggcgttccactttttgatctcgaagcgcttgcccttcttg 495
             ||||||||||||| | ||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 58950 cccaggcccagagggagacagcgttccacttcttgatctcgaagcgcttgcccttcttg 59008



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 39/39 (100%)
 Strand = Plus / Plus

                                                    
Query: 217   tagtgaccatacttctggaactcccactcgctgttgtct 255
             |||||||||||||||||||||||||||||||||||||||
Sbjct: 56836 tagtgaccatacttctggaactcccactcgctgttgtct 56874



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Plus

                                                      
Query: 531   gggggccacggccacggcgacgtcgccctggtccatcgcga 571
             ||||| ||||||||||||||||||||||| |||||| ||||
Sbjct: 59038 ggggggcacggccacggcgacgtcgcccttgtccatggcga 59078



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  145 bits (73), Expect = 2e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                            
Query: 254      ctagagggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcat 313
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29305669 ctagagggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcat 29305610

                             
Query: 314      ggttgcaaactcc 326
                |||||||||||||
Sbjct: 29305609 ggttgcaaactcc 29305597



 Score =  113 bits (57), Expect = 7e-22
 Identities = 60/61 (98%)
 Strand = Plus / Minus

                                                                            
Query: 325      ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 384
                ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 29304038 ccccaagcgacggtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatg 29303979

                 
Query: 385      c 385
                |
Sbjct: 29303978 c 29303978



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                     
Query: 385      cagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtc 437
                ||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 29303848 cagaggtccatgatgtggttgcggcagatggcgcagttgtccacgacgatgtc 29303796



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                           
Query: 437      cccaggcccagagcgcgacggcgttccactttttgatctcgaagcgcttgcccttcttg 495
                ||||||||||||| | ||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 29303681 cccaggcccagagggagacagcgttccacttcttgatctcgaagcgcttgcccttcttg 29303623



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 39/39 (100%)
 Strand = Plus / Minus

                                                       
Query: 217      tagtgaccatacttctggaactcccactcgctgttgtct 255
                |||||||||||||||||||||||||||||||||||||||
Sbjct: 29305795 tagtgaccatacttctggaactcccactcgctgttgtct 29305757



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                         
Query: 531      gggggccacggccacggcgacgtcgccctggtccatcgcga 571
                ||||| ||||||||||||||||||||||| |||||| ||||
Sbjct: 29303593 ggggggcacggccacggcgacgtcgcccttgtccatggcga 29303553



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                     
Query: 500      cggcgccggcgcaggaggaggagggggcgccgggggc 536
                ||||| |||||  |||||||||||||||| |||||||
Sbjct: 23917981 cggcggcggcggcggaggaggagggggcggcgggggc 23918017



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 500      cggcgccggcgcaggaggag 519
                ||||||||||||||||||||
Sbjct: 25306324 cggcgccggcgcaggaggag 25306305



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 498     gccggcgccggcgcaggaggagga 521
               ||||||||||||| ||||||||||
Sbjct: 4595157 gccggcgccggcgaaggaggagga 4595134



to top

>dbj|AP005844.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBb0060O16
          Length = 164373

 Score =  145 bits (73), Expect = 2e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                          
Query: 254    ctagagggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcat 313
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 103014 ctagagggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcat 102955

                           
Query: 314    ggttgcaaactcc 326
              |||||||||||||
Sbjct: 102954 ggttgcaaactcc 102942



 Score =  113 bits (57), Expect = 7e-22
 Identities = 60/61 (98%)
 Strand = Plus / Minus

                                                                          
Query: 325    ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 384
              ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 101383 ccccaagcgacggtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatg 101324

               
Query: 385    c 385
              |
Sbjct: 101323 c 101323



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                   
Query: 385    cagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtc 437
              ||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 101193 cagaggtccatgatgtggttgcggcagatggcgcagttgtccacgacgatgtc 101141



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                         
Query: 437    cccaggcccagagcgcgacggcgttccactttttgatctcgaagcgcttgcccttcttg 495
              ||||||||||||| | ||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 101026 cccaggcccagagggagacagcgttccacttcttgatctcgaagcgcttgcccttcttg 100968



 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 39/39 (100%)
 Strand = Plus / Minus

                                                     
Query: 217    tagtgaccatacttctggaactcccactcgctgttgtct 255
              |||||||||||||||||||||||||||||||||||||||
Sbjct: 103140 tagtgaccatacttctggaactcccactcgctgttgtct 103102



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                       
Query: 531    gggggccacggccacggcgacgtcgccctggtccatcgcga 571
              ||||| ||||||||||||||||||||||| |||||| ||||
Sbjct: 100938 ggggggcacggccacggcgacgtcgcccttgtccatggcga 100898



to top

>emb|CR712304.2|CNS0GCKC Tetraodon nigroviridis full-length cDNA
          Length = 468

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR711741.2|CNS0GC4P Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR718984.2|CNS0GHPQ Tetraodon nigroviridis full-length cDNA
          Length = 457

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 327 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 268

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 267 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 208

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 207 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 148

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 147 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 88

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 87  cacttttt 80



to top

>emb|CR718953.2|CNS0GHOV Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR718828.2|CNS0GHLE Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR718557.2|CNS0GHDV Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 333 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 274

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 273 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 214

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 213 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 154

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 153 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 94

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 93  cacttttt 86



to top

>emb|CR717778.2|CNS0GGS8 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR717707.2|CNS0GGQ9 Tetraodon nigroviridis full-length cDNA
          Length = 450

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 320 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 261

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 260 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 201

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 200 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 141

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 140 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 81

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 80  cacttttt 73



to top

>emb|CR717638.2|CNS0GGOC Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 164 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 105

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 104 cacttttt 97



to top

>emb|CR717357.2|CNS0GGGJ Tetraodon nigroviridis full-length cDNA
          Length = 461

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 334 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 275

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 274 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 215

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 214 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 155

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 154 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 95

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 94  cacttttt 87



to top

>emb|CR717269.2|CNS0GGE3 Tetraodon nigroviridis full-length cDNA
          Length = 469

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 339 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 280

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 279 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 220

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 219 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 160

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 159 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 100

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 99  cacttttt 92



to top

>emb|CR717135.2|CNS0GGAG Tetraodon nigroviridis full-length cDNA
          Length = 469

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 339 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 280

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 279 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 220

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 219 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 160

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 159 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 100

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 99  cacttttt 92



to top

>emb|CR716834.2|CNS0GG23 Tetraodon nigroviridis full-length cDNA
          Length = 457

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 327 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 268

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 267 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 208

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 207 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 148

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 147 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 88

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 87  cacttttt 80



to top

>emb|CR716017.2|CNS0GFFH Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR715173.2|CNS0GES1 Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR714756.2|CNS0GEGG Tetraodon nigroviridis full-length cDNA
          Length = 457

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 327 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 268

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 267 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 208

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 207 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 148

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 147 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 88

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 87  cacttttt 80



to top

>emb|CR711398.2|CNS0GBV6 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR714255.2|CNS0GE2J Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 333 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 274

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 273 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 214

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 213 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 154

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 153 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 94

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 93  cacttttt 86



to top

>emb|CR713764.2|CNS0GDOW Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR713551.2|CNS0GDIZ Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 333 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 274

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 273 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 214

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 213 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 154

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 153 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 94

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 93  cacttttt 86



to top

>emb|CR713038.2|CNS0GD4Q Tetraodon nigroviridis full-length cDNA
          Length = 453

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 323 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 264

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 263 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 204

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 203 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 144

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 143 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 84

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 83  cacttttt 76



to top

>emb|CR712711.2|CNS0GCVN Tetraodon nigroviridis full-length cDNA
          Length = 460

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 150 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 91

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 90  cacttttt 83



to top

>emb|CR712093.2|CNS0GCEH Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR710993.2|CNS0GBJX Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR710591.2|CNS0GB8R Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 333 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 274

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 273 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 214

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 213 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 154

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 153 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 94

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 93  cacttttt 86



to top

>emb|CR710156.2|CNS0GAWO Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 356 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 297

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 296 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 237

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 236 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 177

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 176 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 117

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 116 cacttttt 109



to top

>emb|CR709913.2|CNS0GAPX Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 164 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 105

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 104 cacttttt 97



to top

>emb|CR709418.2|CNS0GAC6 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR709337.2|CNS0GA9X Tetraodon nigroviridis full-length cDNA
          Length = 453

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 323 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 264

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 263 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 204

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 203 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 144

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 143 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 84

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 83  cacttttt 76



to top

>emb|CR708996.2|CNS0GA0G Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR709183.2|CNS0GA5N Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 164 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 105

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 104 cacttttt 97



to top

>emb|CR709075.2|CNS0GA2N Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 334 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 275

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 274 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 215

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 214 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 155

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 154 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 95

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 94  cacttttt 87



to top

>emb|CR708377.2|CNS0G9J9 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR708266.2|CNS0G9G6 Tetraodon nigroviridis full-length cDNA
          Length = 462

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR708263.2|CNS0G9G3 Tetraodon nigroviridis full-length cDNA
          Length = 460

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 150 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 91

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 90  cacttttt 83



to top

>emb|CR707631.2|CNS0G8YJ Tetraodon nigroviridis full-length cDNA
          Length = 459

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 150 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 91

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 90  cacttttt 83



to top

>emb|CR707603.2|CNS0G8XR Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR705966.2|CNS0G7OA Tetraodon nigroviridis full-length cDNA
          Length = 472

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 342 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 283

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 282 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 223

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 222 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 163

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 162 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 103

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 102 cacttttt 95



to top

>emb|CR706999.2|CNS0G8GZ Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR706688.2|CNS0G88C Tetraodon nigroviridis full-length cDNA
          Length = 469

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 339 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 280

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 279 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 220

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 219 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 160

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 159 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 100

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 99  cacttttt 92



to top

>emb|CR706606.2|CNS0G862 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR706092.2|CNS0G7RS Tetraodon nigroviridis full-length cDNA
          Length = 707

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 577 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 518

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 517 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 458

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 457 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 398

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 397 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 338

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 337 cacttttt 330



to top

>emb|CR705735.2|CNS0G7HV Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR705000.2|CNS0G6XG Tetraodon nigroviridis full-length cDNA
          Length = 460

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcaaaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 150 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 91

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 90  cacttttt 83



to top

>emb|CR704952.2|CNS0G6W4 Tetraodon nigroviridis full-length cDNA
          Length = 462

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 333 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 274

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 273 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 214

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 213 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 154

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 153 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 94

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 93  cacttttt 86



to top

>emb|CR704915.2|CNS0G6V3 Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 164 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 105

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 104 cacttttt 97



to top

>emb|CR705166.2|CNS0G722 Tetraodon nigroviridis full-length cDNA
          Length = 454

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 150 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 91

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 90  cacttttt 83



to top

>emb|CR704225.2|CNS0G6BX Tetraodon nigroviridis full-length cDNA
          Length = 469

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 339 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 280

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 279 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 220

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 219 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 160

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 159 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 100

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 99  cacttttt 92



to top

>emb|CR702171.2|CNS0G4QV Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR696134.2|CNS0G036 Tetraodon nigroviridis full-length cDNA
          Length = 460

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 150 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 91

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 90  cacttttt 83



to top

>emb|CR685564.2|CNS0FRXK Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 334 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 275

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 274 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 215

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 214 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 155

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 154 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 95

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 94  cacttttt 87



to top

>emb|CR683717.2|CNS0FQI9 Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR633484.2|CNS0ENRM Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR632165.2|CNS0EMQZ Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 8e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>ref|XM_677021.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8844.2), mRNA
          Length = 351

 Score =  141 bits (71), Expect = 3e-30
 Identities = 203/247 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 tacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaa 285
           |||||||| |||||||| ||  |||| || |||||||||||||||||||| || ||||| 
Sbjct: 341 tacttctgaaactcccagtctttgttatcgagagggcacacttgacgggttttcagccag 282

                                                                       
Query: 286 cggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcc 345
           |||   || |||||||| ||||||||||||||||||| ||||||||| || |||||||||
Sbjct: 281 cgggaaatacagtggaaatggaatgcatggttgcaaattccccaagcaactgtgcactcc 222

                                                                       
Query: 346 tcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttg 405
           ||| ||||||    | | ||||| || || |||||||||||||| ||||| |||||||| 
Sbjct: 221 tcggtggtggatgagccttggtttgcttgacactcgatgcagagatccataatgtggtta 162

                                                                       
Query: 406 cggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccac 465
           ||||| || || ||||| || || ||||| ||||| ||||| || || || || ||||||
Sbjct: 161 cggcaaatagcacagttatcaacaacgatatcccacgcccatagagcaacagcattccac 102

                  
Query: 466 tttttga 472
           || ||||
Sbjct: 101 ttcttga 95



to top

>emb|CR718972.2|CNS0GHPE Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  |||  ||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatatagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 164 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 105

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 104 cacttttt 97



to top

>emb|CR716350.2|CNS0GFON Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| | |||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagataccgtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR715418.2|CNS0GEYU Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||| ||| | |||||| || |||||||| || | ||| || | |
Sbjct: 334 ccatatttctgaaactcccgctcccggttgtccagtgggcacacctgtctggttttcaac 275

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 274 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 215

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 214 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 155

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 154 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 95

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 94  cacttttt 87



to top

>emb|CR715040.2|CNS0GEOC Tetraodon nigroviridis full-length cDNA
          Length = 514

 Score =  135 bits (68), Expect = 2e-28
 Identities = 200/244 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 384 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 325

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 324 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 265

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           ||||||   |||||    |||||||| |||||||| || || || || |||||||| |||
Sbjct: 264 tcctcggatgtggcagaagcctggttggcctggcattctatacacagatccatgatatgg 205

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 204 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 145

               
Query: 463 cact 466
           ||||
Sbjct: 144 cact 141



to top

>emb|CR708622.2|CNS0G9Q2 Tetraodon nigroviridis full-length cDNA
          Length = 461

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 334 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 275

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| |||||||| || || ||||| || || ||||||
Sbjct: 274 cagcgggagatacagtggaagtggaacgcatggttacacacaccccaggccaccgtgcac 215

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 214 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 155

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 154 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 95

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 94  cacttttt 87



to top

>emb|CR707762.2|CNS0G926 Tetraodon nigroviridis full-length cDNA
          Length = 475

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| ||| |||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcccggcattctatacacagatccatgatgtgg 165

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 164 ttccagcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 105

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 104 cacttttt 97



to top

>emb|CR707479.2|CNS0G8UB Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||| | |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggctggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR684241.2|CNS0FQWT Tetraodon nigroviridis full-length cDNA
          Length = 460

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 150 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 91

                   
Query: 463 cacttttt 470
           || |||||
Sbjct: 90  catttttt 83



to top

>emb|CR670549.2|CNS0FGD7 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| ||   ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtttggttttcaac 276

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 95  cacttttt 88



to top

>emb|CR659058.2|CNS0F7I0 Tetraodon nigroviridis full-length cDNA
          Length = 457

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 327 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 268

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 267 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 208

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 207 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 148

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 147 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 88

                   
Query: 463 cacttttt 470
           || |||||
Sbjct: 87  catttttt 80



to top

>emb|CR632856.2|CNS0ENA6 Tetraodon nigroviridis full-length cDNA
          Length = 455

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||| ||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 329 ccatatttctgaaactctcactcccggttgtccagtgggcacacctgtctggttttcaac 270

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 269 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 210

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 209 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 150

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 149 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 90

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 89  cacttttt 82



to top

>gb|BC081497.1| Danio rerio im:7137515, mRNA (cDNA clone IMAGE:7251344), partial
           cds
          Length = 536

 Score =  133 bits (67), Expect = 7e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 220 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 279
           |||||||||||||| ||||||||||| |||||||| || || |||||||| | |||||| 
Sbjct: 333 tgaccatacttctgaaactcccactctctgttgtccagtggacacacttgtctggtcttc 274

                                                                       
Query: 280 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 339
           ||||| |||  |||||||||||| || || || || ||||| |||||||| || || || 
Sbjct: 273 agccagcgggagatgcagtggaaatgaaaagcgtgattgcagactccccaggccaccgta 214

                                                                       
Query: 340 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 399
           ||||||||   ||||||    ||||| || ||||| ||||| || ||||||||||| |||
Sbjct: 213 cactcctctgaggtggcagacgcctgattggcctgacactcaatacagaggtccataatg 154

                                                                       
Query: 400 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 459
           || || | ||||||||| |||||||| || || |||||||| ||||| || || || |||
Sbjct: 153 tgatttctgcagatggcacagttgtccactacaatgtcccatgcccacagagccacagcg 94

                      
Query: 460 ttccacttttt 470
           |||||||||||
Sbjct: 93  ttccacttttt 83



to top

>ref|XM_688824.1| PREDICTED: Danio rerio similar to RING-box protein 1 (Rbx1)
           (LOC565545), mRNA
          Length = 544

 Score =  133 bits (67), Expect = 7e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 220 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 279
           |||||||||||||| ||||||||||| |||||||| || || |||||||| | |||||| 
Sbjct: 337 tgaccatacttctgaaactcccactctctgttgtccagtggacacacttgtctggtcttc 278

                                                                       
Query: 280 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 339
           ||||| |||  |||||||||||| || || || || ||||| |||||||| || || || 
Sbjct: 277 agccagcgggagatgcagtggaaatgaaaagcgtgattgcagactccccaggccaccgta 218

                                                                       
Query: 340 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 399
           ||||||||   ||||||    ||||| || ||||| ||||| || ||||||||||| |||
Sbjct: 217 cactcctctgaggtggcagacgcctgattggcctgacactcaatacagaggtccataatg 158

                                                                       
Query: 400 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 459
           || || | ||||||||| |||||||| || || |||||||| ||||| || || || |||
Sbjct: 157 tgatttctgcagatggcacagttgtccactacaatgtcccatgcccacagagccacagcg 98

                      
Query: 460 ttccacttttt 470
           |||||||||||
Sbjct: 97  ttccacttttt 87



to top

>gb|BC107831.1| Danio rerio im:7137515, mRNA (cDNA clone IMAGE:7221021), partial
           cds
          Length = 570

 Score =  133 bits (67), Expect = 7e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 220 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 279
           |||||||||||||| ||||||||||| |||||||| || || |||||||| | |||||| 
Sbjct: 366 tgaccatacttctgaaactcccactctctgttgtccagtggacacacttgtctggtcttc 307

                                                                       
Query: 280 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 339
           ||||| |||  |||||||||||| || || || || ||||| |||||||| || || || 
Sbjct: 306 agccagcgggagatgcagtggaaatgaaaagcgtgattgcagactccccaggccaccgta 247

                                                                       
Query: 340 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 399
           ||||||||   ||||||    ||||| || ||||| ||||| || ||||||||||| |||
Sbjct: 246 cactcctctgaggtggcagacgcctgattggcctgacactcaatacagaggtccataatg 187

                                                                       
Query: 400 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 459
           || || | ||||||||| |||||||| || || |||||||| ||||| || || || |||
Sbjct: 186 tgatttctgcagatggcacagttgtccactacaatgtcccatgcccacagagccacagcg 127

                      
Query: 460 ttccacttttt 470
           |||||||||||
Sbjct: 126 ttccacttttt 116



to top

>emb|CR659962.2|CNS0F874 Tetraodon nigroviridis full-length cDNA
          Length = 472

 Score =  127 bits (64), Expect = 5e-26
 Identities = 202/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||| ||||| ||||||||||| | |||||| || |||||||| ||   ||| || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtttggttttcaac 285

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 164 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 105

                   
Query: 463 cacttttt 470
           || |||||
Sbjct: 104 catttttt 97



to top

>ref|XM_382673.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG02497.1)
           partial mRNA
          Length = 333

 Score =  119 bits (60), Expect = 1e-23
 Identities = 156/188 (82%)
 Strand = Plus / Minus

                                                                       
Query: 292 atgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcgctg 351
           ||||| ||||||||||||||||||||||| |  ||||| || || ||||| || ||||||
Sbjct: 257 atgcaatggaagtggaatgcatggttgcagataccccaggccacagtgcattcttcgctg 198

                                                                       
Query: 352 gtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggcag 411
           || ||    || ||||||||||| || || ||||| || ||||| ||||| || ||||||
Sbjct: 197 gtagcagatgcttggttcgcctgacattctatgcacagatccataatgtgattacggcag 138

                                                                       
Query: 412 atggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccactttttg 471
           ||||||||||| ||||||||||| ||||| ||||| || || || ||||||||||| |||
Sbjct: 137 atggcgcagttatcgaccacgatatcccaagcccaaagggctacagcgttccacttcttg 78

                   
Query: 472 atctcgaa 479
           | ||||||
Sbjct: 77  acctcgaa 70



to top

>ref|NM_001034135.1| Rattus norvegicus ring-box 1 (Rbx1), mRNA
          Length = 1549

 Score =  119 bits (60), Expect = 1e-23
 Identities = 201/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           |||||||| |||||||||||||| |||||||| |  |||||||| || | ||| ||||||
Sbjct: 325 ccatacttttggaactcccactctctgttgtccaaggggcacacctgcctggttttgagc 266

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || ||   |||||||||||| || || || ||||| || ||||||||||| || ||||||
Sbjct: 265 caccgagagatgcagtggaaatgaaaagcgtggttacagactccccaagcaaccgtgcac 206

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           || ||    || ||   ||||||||| ||||| |||||||| || || ||||| ||||||
Sbjct: 205 tcttccgaagtagctgaggcctggttggcctgacactcgatacaaagatccataatgtgg 146

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| ||||| || ||||| || |||||||||||||| || || || |||
Sbjct: 145 ttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctactgcattc 86

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 85  cacttttt 78



to top

>gb|BC100258.1| Rattus norvegicus ring-box 1, mRNA (cDNA clone MGC:116275
           IMAGE:7444286), complete cds
          Length = 1549

 Score =  119 bits (60), Expect = 1e-23
 Identities = 201/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           |||||||| |||||||||||||| |||||||| |  |||||||| || | ||| ||||||
Sbjct: 325 ccatacttttggaactcccactctctgttgtccaaggggcacacctgcctggttttgagc 266

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || ||   |||||||||||| || || || ||||| || ||||||||||| || ||||||
Sbjct: 265 caccgagagatgcagtggaaatgaaaagcgtggttacagactccccaagcaaccgtgcac 206

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           || ||    || ||   ||||||||| ||||| |||||||| || || ||||| ||||||
Sbjct: 205 tcttccgaagtagctgaggcctggttggcctgacactcgatacaaagatccataatgtgg 146

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| ||||| || ||||| || |||||||||||||| || || || |||
Sbjct: 145 ttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctactgcattc 86

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 85  cacttttt 78



to top

>gb|AY440092.1| Armigeres subalbatus ASAP ID: 42179 ubiquitin ligase mRNA sequence
          Length = 559

 Score =  115 bits (58), Expect = 2e-22
 Identities = 220/274 (80%)
 Strand = Plus / Minus

                                                                       
Query: 212 catcttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgac 271
           |||| ||||| ||||| |||||||||||||| || ||||| || | ||| || ||||| |
Sbjct: 429 catcctagtgtccatatttctggaactcccattccctgttatccaaaggacagacttgtc 370

                                                                       
Query: 272 gggtcttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaag 331
           | ||||| |||||||||  |||||||||||| ||||||||||| ||||| || ||||| |
Sbjct: 369 gtgtctttagccaacgggagatgcagtggaaatggaatgcatgattgcagacaccccagg 310

                                                                       
Query: 332 cgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggt 391
           | || ||||||||||||||||| ||    || || || |||||||| |||||||| |  |
Sbjct: 309 ccactgtgcactcctcgctggtagcagaagcttgattagcctggcattcgatgcataaat 250

                                                                       
Query: 392 ccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcg 451
           |||| || ||  | || || || ||||||||||| || || |||||||| ||||| | ||
Sbjct: 249 ccataatatgactacgacaaatagcgcagttgtccacaacaatgtcccaagcccacaacg 190

                                             
Query: 452 cgacggcgttccactttttgatctcgaagcgctt 485
           | || || ||||||||||| | |||||| |||||
Sbjct: 189 ctacagcattccactttttcacctcgaaccgctt 156



to top

>ref|XM_748960.1| Aspergillus fumigatus Af293 ubiquitin ligase subunit HrtA
           (Afu5g05790) partial mRNA
          Length = 363

 Score =  113 bits (57), Expect = 7e-22
 Identities = 99/113 (87%)
 Strand = Plus / Minus

                                                                       
Query: 367 ttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtcg 426
           |||||||||||||| || || |  ||||||||||||||||||||||| || |||||||||
Sbjct: 212 ttcgcctggcactcaatacacaaatccatgatgtggttgcggcagattgcacagttgtcg 153

                                                                
Query: 427 accacgatgtcccaggcccagagcgcgacggcgttccactttttgatctcgaa 479
           || ||||| ||||||||||| |  |||||||| ||||||||||||| ||||||
Sbjct: 152 acgacgatatcccaggcccacaaagcgacggcattccactttttgacctcgaa 100



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 292 atgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctc 347
           |||||||| || ||||||||||||||||||| |||||| || || |||||||||||
Sbjct: 287 atgcagtgaaaatggaatgcatggttgcaaattccccaggctactgtgcactcctc 232



to top

>ref|NM_114151.1| Arabidopsis thaliana ubiquitin-protein ligase AT3G42830 mRNA,
           complete cds
          Length = 348

 Score =  111 bits (56), Expect = 3e-21
 Identities = 194/240 (80%)
 Strand = Plus / Minus

                                                                       
Query: 216 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 275
           |||||||||||| |||||||| |||||||||| |   ||||| || ||||||||||| ||
Sbjct: 348 ttagtgaccatatttctggaattcccactcgcagacatctagtggacacacttgacgagt 289

                                                                       
Query: 276 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 335
            |||||||| | |||||| ||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 288 tttgagccatctgctgatacagtggaagtgaaaggcgtggttgcaaaccccccaagcaac 229

                                                                       
Query: 336 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 395
            ||||| ||||| || ||||| || || || || ||  | || || || ||||| |||||
Sbjct: 228 agtgcattcctcactagtggcactagcttgattagctagacattcaatacagagatccat 169

                                                                       
Query: 396 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 455
           |||||| || |  || || |||||||| || || ||||| ||||| |||||||| |||||
Sbjct: 168 gatgtgattcctacaaattgcgcagttatcaacaacgatatcccaagcccagagagcgac 109



to top

>gb|BC051473.1| Mus musculus ring-box 1, mRNA (cDNA clone MGC:62905 IMAGE:1430400),
           complete cds
          Length = 531

 Score =  111 bits (56), Expect = 3e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 332 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 273

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 272 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 213

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 212 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 153

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 152 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 93

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 92  cacttttt 85



to top

>ref|NM_019712.2| Mus musculus ring-box 1 (Rbx1), mRNA
          Length = 1612

 Score =  111 bits (56), Expect = 3e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 320 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 261

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 260 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 201

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 200 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 141

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 140 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 81

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 80  cacttttt 73



to top

>gb|BC083057.1| Mus musculus ring-box 1, mRNA (cDNA clone IMAGE:5329240), ****
           WARNING: chimeric clone ****
          Length = 2818

 Score =  111 bits (56), Expect = 3e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 325 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 266

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 265 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 206

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 205 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 146

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 145 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 86

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 85  cacttttt 78



to top

>gb|BC056992.1| Mus musculus ring-box 1, mRNA (cDNA clone MGC:66938 IMAGE:6818827),
           complete cds
          Length = 1612

 Score =  111 bits (56), Expect = 3e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 320 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 261

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 260 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 201

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 200 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 141

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 140 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 81

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 80  cacttttt 73



to top

>dbj|AK152012.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830045D16 product:ring-box 1,
           full insert sequence
          Length = 503

 Score =  111 bits (56), Expect = 3e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 334 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 275

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 274 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 215

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 214 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 155

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 154 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 95

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 94  cacttttt 87



to top

>dbj|AK159571.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420024J09 product:ring-box 1, full
           insert sequence
          Length = 503

 Score =  111 bits (56), Expect = 3e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 334 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 275

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 274 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 215

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 214 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 155

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 154 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 95

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 94  cacttttt 87



to top

>gb|BC027396.1| Mus musculus ring-box 1, mRNA (cDNA clone MGC:35907 IMAGE:4952242),
           complete cds
          Length = 1616

 Score =  111 bits (56), Expect = 3e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 326 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 267

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 266 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 207

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 206 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 147

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 146 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 87

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 86  cacttttt 79



to top

>gb|AF140599.1|AF140599 Mus musculus ring-box protein 1 (Rbx1) mRNA, complete cds
          Length = 504

 Score =  111 bits (56), Expect = 3e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 337 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 278

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 277 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 218

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 217 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 158

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 157 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 98

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 97  cacttttt 90



to top

>ref|XM_957982.1| Neurospora crassa OR74A hypothetical protein (NCU06224.1) partial
           mRNA
          Length = 351

 Score =  109 bits (55), Expect = 1e-20
 Identities = 202/251 (80%)
 Strand = Plus / Minus

                                                                       
Query: 229 ttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaacgg 288
           |||||||||||||| || |||||||| |||||||| |||||||| | ||||||||| |  
Sbjct: 338 ttctggaactcccaatctctgttgtcgagagggcatacttgacgcgccttgagccatctc 279

                                                                       
Query: 289 ctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcg 348
             |||||| ||||| ||||| ||||| |||||||  ||||| || || ||||| || || 
Sbjct: 278 gagatgcaatggaaatggaacgcatgattgcaaataccccacgcaaccgtgcattcttct 219

                                                                       
Query: 349 ctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcgg 408
             ||||||    | |||||| ||||||||||| || || || |||||||| ||||| || 
Sbjct: 218 gaggtggccgatgactggttggcctggcactcaatacacagatccatgatatggtttcga 159

                                                                       
Query: 409 cagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttt 468
           |||||||| ||||||||||| || || ||||| ||||| || || || ||||||||||| 
Sbjct: 158 cagatggcacagttgtcgacgacaatatcccaagcccaaagggccaccgcgttccacttc 99

                      
Query: 469 ttgatctcgaa 479
           |||| ||||||
Sbjct: 98  ttgacctcgaa 88



to top

>ref|XM_326078.1| Neurospora crassa OR74A hypothetical protein (NCU06224.1) partial
           mRNA
          Length = 351

 Score =  109 bits (55), Expect = 1e-20
 Identities = 202/251 (80%)
 Strand = Plus / Minus

                                                                       
Query: 229 ttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaacgg 288
           |||||||||||||| || |||||||| |||||||| |||||||| | ||||||||| |  
Sbjct: 338 ttctggaactcccaatctctgttgtcgagagggcatacttgacgcgccttgagccatctc 279

                                                                       
Query: 289 ctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcg 348
             |||||| ||||| ||||| ||||| |||||||  ||||| || || ||||| || || 
Sbjct: 278 gagatgcaatggaaatggaacgcatgattgcaaataccccacgcaaccgtgcattcttct 219

                                                                       
Query: 349 ctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcgg 408
             ||||||    | |||||| ||||||||||| || || || |||||||| ||||| || 
Sbjct: 218 gaggtggccgatgactggttggcctggcactcaatacacagatccatgatatggtttcga 159

                                                                       
Query: 409 cagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttt 468
           |||||||| ||||||||||| || || ||||| ||||| || || || ||||||||||| 
Sbjct: 158 cagatggcacagttgtcgacgacaatatcccaagcccaaagggccaccgcgttccacttc 99

                      
Query: 469 ttgatctcgaa 479
           |||| ||||||
Sbjct: 98  ttgacctcgaa 88



to top

>gb|DQ446722.1| Arabidopsis thaliana clone pENTR221-At3g42830 ring-box protein
           Roc1/Rbx1/Hrt1 (At3g42830) mRNA, complete cds
          Length = 348

 Score =  107 bits (54), Expect = 4e-20
 Identities = 192/238 (80%)
 Strand = Plus / Minus

                                                                       
Query: 218 agtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtct 277
           |||||||||| |||||||| |||||||||| |   ||||| || ||||||||||| || |
Sbjct: 346 agtgaccatatttctggaattcccactcgcagacatctagtggacacacttgacgagttt 287

                                                                       
Query: 278 tgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacgg 337
           ||||||| | |||||| ||||||||||| || || ||||||||||| |||||||| || |
Sbjct: 286 tgagccatctgctgatacagtggaagtgaaaggcgtggttgcaaaccccccaagcaacag 227

                                                                       
Query: 338 tgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatga 397
           |||| ||||| || ||||| || || || || ||  | || || || ||||| |||||||
Sbjct: 226 tgcattcctcactagtggcactagcttgattagctagacattcaatacagagatccatga 167

                                                                     
Query: 398 tgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 455
           |||| || |  || || |||||||| || || ||||| ||||| |||||||| |||||
Sbjct: 166 tgtgattcctacaaattgcgcagttatcaacaacgatatcccaagcccagagagcgac 109



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
              complete sequence
          Length = 43261740

 Score =  105 bits (53), Expect = 2e-19
 Identities = 59/61 (96%)
 Strand = Plus / Minus

                                                                          
Query: 325    ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 384
              ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 371384 ccccaagcgacagtgcactcctcactggtggcgctggcctggttcgcctggcactcgatg 371325

               
Query: 385    c 385
              |
Sbjct: 371324 c 371324



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                                
Query: 437    cccaggcccagagcgcgacggcgttccactttttgatctcgaagcgcttg 486
              |||| |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 371070 cccatgcccagagcgcgacggcgttccacttcttgatctcgaagcgcttg 371021



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 43/44 (97%)
 Strand = Plus / Minus

                                                          
Query: 391    tccatgatgtggttgcggcagatggcgcagttgtcgaccacgat 434
              |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 371213 tccatgatgtggttgcggcagatggcgcagttgtcgacgacgat 371170



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                      
Query: 259    gggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatg 314
              ||||||||||| || ||||||||||| | ||||||||| |||||||| || |||||
Sbjct: 373024 gggcacacttggcgagtcttgagccacctgctgatgcaatggaagtgaaaagcatg 372969



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 498     gccggcgccggcgcaggaggaggagg 523
               |||||||||||||| |||||||||||
Sbjct: 7452183 gccggcgccggcgccggaggaggagg 7452208



to top

>dbj|AP002863.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0005A05
          Length = 190834

 Score =  105 bits (53), Expect = 2e-19
 Identities = 59/61 (96%)
 Strand = Plus / Minus

                                                                          
Query: 325    ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 384
              ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 123222 ccccaagcgacagtgcactcctcactggtggcgctggcctggttcgcctggcactcgatg 123163

               
Query: 385    c 385
              |
Sbjct: 123162 c 123162



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                                
Query: 437    cccaggcccagagcgcgacggcgttccactttttgatctcgaagcgcttg 486
              |||| |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 122908 cccatgcccagagcgcgacggcgttccacttcttgatctcgaagcgcttg 122859



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 43/44 (97%)
 Strand = Plus / Minus

                                                          
Query: 391    tccatgatgtggttgcggcagatggcgcagttgtcgaccacgat 434
              |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 123051 tccatgatgtggttgcggcagatggcgcagttgtcgacgacgat 123008



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                      
Query: 259    gggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatg 314
              ||||||||||| || ||||||||||| | ||||||||| |||||||| || |||||
Sbjct: 124862 gggcacacttggcgagtcttgagccacctgctgatgcaatggaagtgaaaagcatg 124807



to top

>dbj|AP002845.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0482C06
          Length = 182779

 Score =  105 bits (53), Expect = 2e-19
 Identities = 59/61 (96%)
 Strand = Plus / Minus

                                                                         
Query: 325   ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 384
             ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 11585 ccccaagcgacagtgcactcctcactggtggcgctggcctggttcgcctggcactcgatg 11526

              
Query: 385   c 385
             |
Sbjct: 11525 c 11525



 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                               
Query: 437   cccaggcccagagcgcgacggcgttccactttttgatctcgaagcgcttg 486
             |||| |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 11271 cccatgcccagagcgcgacggcgttccacttcttgatctcgaagcgcttg 11222



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 43/44 (97%)
 Strand = Plus / Minus

                                                         
Query: 391   tccatgatgtggttgcggcagatggcgcagttgtcgaccacgat 434
             |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 11414 tccatgatgtggttgcggcagatggcgcagttgtcgacgacgat 11371



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                     
Query: 259   gggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatg 314
             ||||||||||| || ||||||||||| | ||||||||| |||||||| || |||||
Sbjct: 13225 gggcacacttggcgagtcttgagccacctgctgatgcaatggaagtgaaaagcatg 13170



to top

>dbj|AK003159.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1100001E18 product:ring-box 1,
           full insert sequence
          Length = 507

 Score =  103 bits (52), Expect = 7e-19
 Identities = 199/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 339 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 280

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 279 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 220

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 219 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 160

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | |||||||||  |||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 159 ttcctgcagatggcaaagttatcaaccacaatgtcccaggcccagagggccactgcattc 100

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 99  cacttttt 92



to top

>dbj|AK004114.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110035J03 product:ring-box 1,
           full insert sequence
          Length = 969

 Score =  103 bits (52), Expect = 7e-19
 Identities = 199/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 341 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 282

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 281 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 222

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 221 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 162

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| ||||| || ||||| |||||||| |||||||| || || || |||
Sbjct: 161 ttcctgcagatggcacagttatcaaccacaatgtcccacgcccagagggccactgcattc 102

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 101 cacttttt 94



to top

>dbj|AK183716.1| Mus musculus cDNA, clone:Y0G0126N24, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000023036, based on BLAT search
          Length = 416

 Score =  103 bits (52), Expect = 7e-19
 Identities = 199/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 271 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 212

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 211 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 152

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 151 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 92

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| ||||| || ||||| ||||||||||||||||| |  || || |||
Sbjct: 91  ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggtcactgcattc 32

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 31  cacttttt 24



to top

>dbj|AK182752.1| Mus musculus cDNA, clone:Y0G0123J24, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000023036, based on BLAT search
          Length = 398

 Score =  103 bits (52), Expect = 7e-19
 Identities = 199/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 271 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 212

                                                                       
Query: 283 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 211 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 152

                                                                       
Query: 343 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 151 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 92

                                                                       
Query: 403 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
           || | ||||||||| ||||| || ||||| ||||||||||||||||| |  || || |||
Sbjct: 91  ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggtcactgcattc 32

                   
Query: 463 cacttttt 470
           ||||||||
Sbjct: 31  cacttttt 24



to top

>gb|DQ311404.1| Bombyx mori ring box protein mRNA, complete cds
          Length = 1058

 Score =  101 bits (51), Expect = 3e-18
 Identities = 201/251 (80%)
 Strand = Plus / Minus

                                                                       
Query: 220 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 279
           ||||||||||| ||||||||||| || || |||||||| || || ||||| || ||||| 
Sbjct: 721 tgaccatacttttggaactcccattctctattgtctagtggacaaacttgtcgagtcttc 662

                                                                       
Query: 280 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 339
           | |||||||   || |||||||| ||||||||||| || ||||| |||||||| || |||
Sbjct: 661 aaccaacgggaaatacagtggaaatggaatgcatgattacaaacaccccaagcaactgtg 602

                                                                       
Query: 340 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 399
           || || || || |||||   ||| || || || ||||| ||||| || || ||||| |||
Sbjct: 601 cattcttcactagtggctgaggcttgatttgcttggcattcgatacacagatccattatg 542

                                                                       
Query: 400 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 459
           || || ||||| || || ||||||||||| || || ||||| |||||||| || || || 
Sbjct: 541 tgatttcggcaaatagcacagttgtcgacaacaatatcccaagcccagagtgctactgca 482

                      
Query: 460 ttccacttttt 470
           |||||||||||
Sbjct: 481 ttccacttttt 471



to top

>ref|NM_073095.4| Caenorhabditis elegans yeast RBX (ring finger protein) homolog
           family member (rbx-1) (rbx-1) mRNA, complete cds
          Length = 664

 Score =  101 bits (51), Expect = 3e-18
 Identities = 102/119 (85%)
 Strand = Plus / Minus

                                                                       
Query: 367 ttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtcg 426
           ||||| |||||||||||||| || ||||||||||| |||||||| || ||||||||||||
Sbjct: 277 ttcgcttggcactcgatgcacagatccatgatgtgattgcggcaaatagcgcagttgtcg 218

                                                                      
Query: 427 accacgatgtcccaggcccagagcgcgacggcgttccactttttgatctcgaagcgctt 485
           |||   |||||||||||||| || ||||||||  |||| || |||| |||||| |||||
Sbjct: 217 acctgaatgtcccaggcccaaagtgcgacggcactccatttcttgacctcgaaacgctt 159



to top

>gb|AC084553.1|CBRG33P21 Caenorhabditis briggsae cosmid G33P21, complete sequence
          Length = 40197

 Score =  101 bits (51), Expect = 3e-18
 Identities = 90/103 (87%)
 Strand = Plus / Minus

                                                                        
Query: 370  gcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtcgacc 429
            ||||||||||||||||| || ||||||||||| |||||||| ||||||||||||||||| 
Sbjct: 5345 gcctggcactcgatgcacagatccatgatgtgattgcggcaaatggcgcagttgtcgact 5286

                                                       
Query: 430  acgatgtcccaggcccagagcgcgacggcgttccactttttga 472
               |||||||| |||||||| ||||| ||  ||||||||||||
Sbjct: 5285 tgaatgtcccacgcccagagagcgacagcactccactttttga 5243



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 268  tgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatggttgca 320
            ||||| ||||||||||||||   |||||||||||| ||||| ||||| |||||
Sbjct: 5447 tgacgtgtcttgagccaacgagagatgcagtggaaatggaacgcatgattgca 5395



to top

>dbj|AB077287.1| Caenorhabditis elegans Ce-rbx-1 mRNA for RING-H2 finger protein
           Rbx1, complete cds
          Length = 361

 Score =  101 bits (51), Expect = 3e-18
 Identities = 102/119 (85%)
 Strand = Plus / Minus

                                                                       
Query: 367 ttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtcg 426
           ||||| |||||||||||||| || ||||||||||| |||||||| || ||||||||||||
Sbjct: 181 ttcgcttggcactcgatgcacagatccatgatgtgattgcggcaaatagcgcagttgtcg 122

                                                                      
Query: 427 accacgatgtcccaggcccagagcgcgacggcgttccactttttgatctcgaagcgctt 485
           |||   |||||||||||||| || ||||||||  |||| || |||| |||||| |||||
Sbjct: 121 acctgaatgtcccaggcccaaagtgcgacggcactccatttcttgacctcgaaacgctt 63



to top

>ref|NM_014248.2| Homo sapiens ring-box 1 (RBX1), mRNA
          Length = 521

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 344 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 285

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 284 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 225

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 224 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 165

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 164 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 105

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 104 gcattccacttttt 91



to top

>ref|XM_597082.2| PREDICTED: Bos taurus similar to RING-box protein 1 (Rbx1),
           transcript variant 1 (LOC518880), mRNA
          Length = 832

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 356 tagtgcccatacttttggaattcccactctctgttgtccaacggacacacctgccgtgtt 297

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||   ||||||||||||||| || |||||||| || || ||||| || |||
Sbjct: 296 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagacgccccacgccacg 237

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           |||||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 236 gtgcactcttcagaagtagcggacgcctggttggcttgacattctatgcaaagatccata 177

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 176 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 117

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 116 gcattccacttttt 103



to top

>gb|BC017370.1| Homo sapiens ring-box 1, mRNA (cDNA clone IMAGE:4065797), partial
           cds
          Length = 554

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 348 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 289

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 288 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 229

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 228 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 169

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 168 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 109

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 108 gcattccacttttt 95



to top

>gb|BC105329.1| Bos taurus similar to RING-box protein 1 (Rbx1), transcript variant
           1, mRNA (cDNA clone MGC:127542 IMAGE:7949130), complete
           cds
          Length = 1504

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 348 tagtgcccatacttttggaattcccactctctgttgtccaacggacacacctgccgtgtt 289

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||   ||||||||||||||| || |||||||| || || ||||| || |||
Sbjct: 288 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagacgccccacgccacg 229

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           |||||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 228 gtgcactcttcagaagtagcggacgcctggttggcttgacattctatgcaaagatccata 169

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 168 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 109

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 108 gcattccacttttt 95



to top

>gb|AY099360.1| Homo sapiens ZYP protein mRNA, partial cds
          Length = 306

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 289 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 230

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 229 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 170

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 169 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 110

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 109 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 50

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 49  gcattccacttttt 36



to top

>gb|BC001466.2| Homo sapiens ring-box 1, mRNA (cDNA clone MGC:1481 IMAGE:3138751),
           complete cds
          Length = 535

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 331 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 272

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 271 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 212

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 211 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 152

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 151 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 92

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 91  gcattccacttttt 78



to top

>gb|AF142059.1|AF142059 Homo sapiens RING finger protein (ROC1) mRNA, complete cds
          Length = 327

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 326 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 267

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 266 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 207

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 206 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 147

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 146 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 87

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 86  gcattccacttttt 73



to top

>emb|CR456560.1| Homo sapiens RBX1 full length open reading frame (ORF) cDNA clone
           (cDNA clone C22ORF:pGEM.RBX1)
          Length = 535

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 344 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 285

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 284 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 225

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 224 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 165

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 164 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 105

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 104 gcattccacttttt 91



to top

>gb|AF140598.1|AF140598 Homo sapiens ring-box protein 1 (RBX1) mRNA, complete cds
          Length = 508

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 332 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 273

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 272 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 213

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 212 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 153

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 152 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 93

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 92  gcattccacttttt 79



to top

>gb|AF085906.1|HUMYQ60A05 Homo sapiens full length insert cDNA clone YQ60A05
          Length = 497

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 307 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 248

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 247 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 188

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 187 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 128

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 127 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 68

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 67  gcattccacttttt 54



to top

>gb|AC112970.18| Mus musculus chromosome 17, clone RP24-443D19, complete sequence
          Length = 172747

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 198/248 (79%)
 Strand = Plus / Minus

                                                                          
Query: 223    ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
              ||||||||||||||||||||||| |||||||| |  || ||||| || |   | ||||||
Sbjct: 114187 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctctttttgagc 114128

                                                                          
Query: 283    caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
              || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 114127 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 114068

                                                                          
Query: 343    tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
              || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 114067 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 114008

                                                                          
Query: 403    ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
              || | ||||||||| ||||| || ||||| |||| |||||||||||| || || || |||
Sbjct: 114007 ttcctgcagatggcacagttatcaaccacaatgttccaggcccagagggccacagcattc 113948

                      
Query: 463    cacttttt 470
              ||||||||
Sbjct: 113947 cacttttt 113940



to top

>emb|Z70757.1|CEZK287 Caenorhabditis elegans Cosmid ZK287, complete sequence
          Length = 39874

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                         
Query: 367   ttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtcg 426
             ||||| |||||||||||||| || ||||||||||| |||||||| || ||||||||||||
Sbjct: 27216 ttcgcttggcactcgatgcacagatccatgatgtgattgcggcaaatagcgcagttgtcg 27275

                                             
Query: 427   accacgatgtcccaggcccagagcgcgacggc 458
             |||   |||||||||||||| || ||||||||
Sbjct: 27276 acctgaatgtcccaggcccaaagtgcgacggc 27307



to top

>emb|CR974451.9| Mouse DNA sequence from clone RP24-180B11 on chromosome 17, complete
              sequence
          Length = 188873

 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 198/248 (79%)
 Strand = Plus / Plus

                                                                          
Query: 223    ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 282
              ||||||||||||||||||||||| |||||||| |  || ||||| || |   | ||||||
Sbjct: 160026 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctctttttgagc 160085

                                                                          
Query: 283    caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 342
              || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 160086 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 160145

                                                                          
Query: 343    tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 402
              || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 160146 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 160205

                                                                          
Query: 403    ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 462
              || | ||||||||| ||||| || ||||| |||| |||||||||||| || || || |||
Sbjct: 160206 ttcctgcagatggcacagttatcaaccacaatgttccaggcccagagggccacagcattc 160265

                      
Query: 463    cacttttt 470
              ||||||||
Sbjct: 160266 cacttttt 160273



to top

>ref|XM_515153.1| PREDICTED: Pan troglodytes similar to RBX1 protein (LOC458860),
           mRNA
          Length = 1436

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 866 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 807

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||    |||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 806 ttgagccagcgagaaatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 747

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 746 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 687

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 686 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 627

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 626 gcattccacttttt 613



to top

>ref|XM_881804.1| PREDICTED: Bos taurus similar to RING-box protein 1 (Rbx1),
           transcript variant 2 (LOC518880), mRNA
          Length = 862

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 199/250 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 472 tagtgcccatacttttggaattcccactctctgttgtccaacggacacacctgccgtgtt 413

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||   ||||||||||||||| || |||||||| || || ||||| || |||
Sbjct: 412 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagacgccccacgccacg 353

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           |||||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 352 gtgcactcttcagaagtagcggacgcctggttggcttgacattctatgcaaagatccata 293

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 292 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 233

                     
Query: 457 gcgttccact 466
           || |||||||
Sbjct: 232 gcattccact 223



to top

>emb|CT033337.1| Platynereis dumerilii EST IB0AAA22BD06EM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 348 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 289

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 288 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 229

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 228 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 169

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 168 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 109

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 108 gcattccacttttt 95



to top

>emb|CT033336.1| Platynereis dumerilii EST IB0AAA22BD06FM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Plus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 214 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 273

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 274 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 333

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 334 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 393

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 394 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 453

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 454 gcattccacttttt 467



to top

>emb|CT032976.1| Platynereis dumerilii EST IB0AAA28CF05EM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 348 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 289

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 288 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 229

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 228 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 169

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 168 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 109

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 108 gcattccacttttt 95



to top

>emb|CT032975.1| Platynereis dumerilii EST IB0AAA28CF05FM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Plus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 214 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 273

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 274 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 333

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 334 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 393

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 394 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 453

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 454 gcattccacttttt 467



to top

>emb|CT032443.1| Platynereis dumerilii EST IB0AAA38AF03EM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 348 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 289

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 288 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 229

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 228 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 169

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 168 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 109

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 108 gcattccacttttt 95



to top

>emb|CT032442.1| Platynereis dumerilii EST IB0AAA38AF03FM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Plus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 214 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 273

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 274 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 333

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 334 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 393

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 394 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 453

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 454 gcattccacttttt 467



to top

>emb|CT032439.1| Platynereis dumerilii EST IB0AAA38AH04FM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Plus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 214 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 273

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 274 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 333

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 334 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 393

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 394 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 453

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 454 gcattccacttttt 467



to top

>emb|CT032267.1| Platynereis dumerilii EST IB0AAA42AB12EM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 348 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 289

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 288 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 229

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 228 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 169

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 168 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 109

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 108 gcattccacttttt 95



to top

>emb|CT032266.1| Platynereis dumerilii EST IB0AAA42AB12FM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Plus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 214 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 273

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 274 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 333

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 334 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 393

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 394 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 453

                         
Query: 457 gcgttccacttttt 470
           || |||||||||||
Sbjct: 454 gcattccacttttt 467



to top

>ref|XM_756798.1| Ustilago maydis 521 hypothetical protein (UM05744.1) partial mRNA
          Length = 483

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 145/179 (81%)
 Strand = Plus / Minus

                                                                       
Query: 238 tcccactcgctgttgtctagagggcacacttgacgggtcttgagccaacggctgatgcag 297
           ||||| || |||||||| || ||||| || ||||| ||||||||||| ||    ||||||
Sbjct: 389 tcccaatctctgttgtcgagcgggcatacctgacgtgtcttgagccatcgtgaaatgcag 330

                                                                       
Query: 298 tggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcgctggtggcg 357
           ||||||||||| |||||||||||    ||||||||||||||||| || ||  | || || 
Sbjct: 329 tggaagtggaaagcatggttgcattgaccccaagcgacggtgcattcttccgtagtagca 270

                                                                      
Query: 358 ctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggc 416
             | ||||||| |||||||| |||||||| || ||||| |||||||| | |||||||||
Sbjct: 269 gagccctggttggcctggcattcgatgcaaagatccataatgtggtttctgcagatggc 211



to top

>gb|DQ213704.1| Taeniopygia guttata clone 0058P0062F10 RBX1 protein-like mRNA,
           complete sequence
          Length = 519

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 212/269 (78%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||||||||| || |||||||| || || || ||||| || || 
Sbjct: 338 tagtgtccatacttttggaactcccattccctgttgtccagtggacatacttggcgtgtt 279

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||   |||||||||||||||||| || || ||||| || ||||| || || 
Sbjct: 278 ttgagccagcgagagatgcagtggaagtggaaagcgtgattgcagacgccccatgcaact 219

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||| |||||   ||| ||    || ||||| || || || || ||||| || ||||| 
Sbjct: 218 gtgcattcctcagaggtagccgatgcttggttggcttgacattctatgcacagatccata 159

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||| | ||| ||||| ||||| || ||||| |||||||| ||||| || || |||
Sbjct: 158 atgtggtttctgcaaatggcacagttatcaaccacaatgtcccatgcccacagagctacg 99

                                        
Query: 457 gcgttccactttttgatctcgaagcgctt 485
           |||||||| || || |  |||||||||||
Sbjct: 98  gcgttccatttcttcacttcgaagcgctt 70



to top

>gb|AC010010.6| Drosophila melanogaster 3L BAC RP98-13F6 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 167977

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                       
Query: 369    cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtc 425
              |||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||
Sbjct: 120733 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatggcacagttgtc 120677



to top

>ref|NM_144356.2| Drosophila melanogaster Roc1b CG16988-RA (Roc1b), mRNA
          Length = 514

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 369 cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtc 425
           |||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||
Sbjct: 269 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatggcacagttgtc 213



to top

>ref|NM_138189.2| Drosophila melanogaster CG6905-RA (CG6905), mRNA
          Length = 3359

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                     
Query: 369  cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtc 425
            |||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||
Sbjct: 2948 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatggcacagttgtc 3004



to top

>gb|AY070810.1| Drosophila melanogaster AT21612 full length cDNA
          Length = 553

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 369 cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtc 425
           |||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||
Sbjct: 269 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatggcacagttgtc 213



to top

>gb|AY061302.1| Drosophila melanogaster LD21614 full length cDNA
          Length = 3185

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                     
Query: 369  cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtc 425
            |||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||
Sbjct: 2768 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatggcacagttgtc 2824



to top

>gb|AF218290.1|AF218290 Drosophila melanogaster ring finger protein ROC1B gene, complete
           cds
          Length = 750

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 369 cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtc 425
           |||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||
Sbjct: 397 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatggcacagttgtc 341



to top

>gb|AE003468.3| Drosophila melanogaster chromosome 3L, section 2 of 83 of the complete
             sequence
          Length = 307657

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                      
Query: 369   cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtc 425
             |||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||
Sbjct: 38329 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatggcacagttgtc 38273



to top

>emb|CR686693.2|CNS0FSSX Tetraodon nigroviridis full-length cDNA
          Length = 365

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 64/72 (88%)
 Strand = Plus / Minus

                                                                       
Query: 399 gtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggc 458
           |||||| | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||
Sbjct: 163 gtggttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagc 104

                       
Query: 459 gttccacttttt 470
           ||||||||||||
Sbjct: 103 gttccacttttt 92



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 223 ccatacttctggaactcccactcgctgttgtctagagggcacac 266
           ||||| ||||| ||||||||||| | |||||| || ||||||||
Sbjct: 237 ccatatttctgaaactcccactcccggttgtccagtgggcacac 194



to top

>emb|X73608.1|HSTEST H.sapiens mRNA for testican
          Length = 3484

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 145/180 (80%)
 Strand = Plus / Plus

                                                                       
Query: 291 gatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcgct 350
           ||||||||||||||| || |||||||| || |||||||| ||||| || ||||| ||   
Sbjct: 51  gatgcagtggaagtgaaaagcatggttacagactccccatgcgacagtacactcttctga 110

                                                                       
Query: 351 ggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggca 410
            || |||   |||||||| || || || || ||||| || ||||| |||||||| | |||
Sbjct: 111 agtagcggacgcctggttagcttgacattctatgcaaagatccataatgtggttcctgca 170

                                                                       
Query: 411 gatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttttt 470
           |||||| ||||| || ||||| || |||||||||||||| || || || |||||||||||
Sbjct: 171 gatggcacagttatcaaccacaatatcccaggcccagagggctactgcattccacttttt 230



to top

>ref|XM_531722.2| PREDICTED: Canis familiaris similar to RING-box protein 1 (Rbx1)
           (LOC474494), mRNA
          Length = 1469

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 189/239 (79%)
 Strand = Plus / Minus

                                                                       
Query: 232 tggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaacggctg 291
           ||||| |||||||| |||||||| |  || ||||| || || || |||||||| ||   |
Sbjct: 611 tggaattcccactctctgttgtccaacggacacacctgccgtgttttgagccagcgagag 552

                                                                       
Query: 292 atgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcgctg 351
           |||||||||||||| || |||||||| || |||||||| || || |||||||| ||    
Sbjct: 551 atgcagtggaagtgaaaagcatggttacagactccccatgcaacagtgcactcttcagaa 492

                                                                       
Query: 352 gtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggcag 411
           || ||    |||||||| || || || || ||||| || ||||| |||||||| | ||||
Sbjct: 491 gtagcagacgcctggttagcttgacattctatgcaaagatccataatgtggttcctgcag 432

                                                                      
Query: 412 atggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttttt 470
           ||||| ||||| || ||||| || |||||||||||||| || || || |||||||||||
Sbjct: 431 atggcacagttatcaaccacaatatcccaggcccagagagctactgcattccacttttt 373



to top

>emb|CT027911.1| Xenopus tropicalis finished cDNA, clone TEgg095b23
          Length = 561

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 209/266 (78%)
 Strand = Plus / Minus

                                                                       
Query: 220 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 279
           |||||||||||||| || |||||||| || || || || ||||| ||||| || ||||| 
Sbjct: 334 tgaccatacttctgaaattcccactctctattatccagcgggcaaacttgtcgagtcttc 275

                                                                       
Query: 280 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 339
           ||||| ||    ||||| |||||||| |||||||| || || || ||||| || || |||
Sbjct: 274 agccagcgtgaaatgcaatggaagtgaaatgcatgattacacacaccccatgccacagtg 215

                                                                       
Query: 340 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 399
           || |||||    || ||    || ||||| || |||||||| ||||| | ||||||||||
Sbjct: 214 cattcctcagaagtagcagaagcttggtttgcttggcactctatgcacaagtccatgatg 155

                                                                       
Query: 400 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 459
           ||||| | ||||||||| || ||||| || || |||||||||||||| || || || || 
Sbjct: 154 tggttcctgcagatggcacaattgtccactacaatgtcccaggcccaaagggcaactgca 95

                                     
Query: 460 ttccactttttgatctcgaagcgctt 485
           |||||||| || | ||| ||||||||
Sbjct: 94  ttccacttcttaacctcaaagcgctt 69



to top

>dbj|AB220470.1| Macaca fascicularis mRNA, clone QflA-19125: similar to Homo sapiens
           ring-box 1 (RBX1), mRNA, NM_014248.2
          Length = 1465

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 101/122 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 339 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 280

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||||
Sbjct: 279 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgacg 220

             
Query: 337 gt 338
           ||
Sbjct: 219 gt 218



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 361 gcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcag 420
           |||||||| || || || || ||||| || ||||| |||||||| | ||||||||| |||
Sbjct: 195 gcctggttagcttgacattctatgcaaagatccataatgtggttcctgcagatggcacag 136

                                                             
Query: 421 ttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttttt 470
           || || ||||| || |||||||||||||| || || || |||||||||||
Sbjct: 135 ttatcaaccacaatatcccaggcccagagggctactgcattccacttttt 86



to top

>dbj|AK149259.1| Mus musculus adult retina cDNA, RIKEN full-length enriched library,
            clone:A930003C07 product:ring-box 1, full insert sequence
          Length = 2670

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                        
Query: 361  gcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcag 420
            |||||||| ||||| || ||||| || || ||||| |||||||| | ||||||||| |||
Sbjct: 1442 gcctggttggcctgacattcgatacaaagatccataatgtggttcctgcagatggcacag 1383

                                                          
Query: 421  ttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccact 466
            || || ||||| ||||||||||||||||| || || || |||||||
Sbjct: 1382 ttatcaaccacaatgtcccaggcccagagggccactgcattccact 1337



to top

>gb|DQ306845.1| Hevea brasiliensis isolate SSH116 mRNA sequence
          Length = 330

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| ||||||||||| |||||  |||||||||||||||||| |
Sbjct: 265 tagtggccatacttttggaaatcccactcgctattgtcaggagggcacacttgacggggc 324

                 
Query: 277 ttgagc 282
           ||||||
Sbjct: 325 ttgagc 330



to top

>gb|DQ306836.1| Hevea brasiliensis isolate SSH107 mRNA sequence
          Length = 330

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||| ||||||||||| |||||  |||||||||||||||||| |
Sbjct: 265 tagtggccatacttttggaaatcccactcgctattgtcaggagggcacacttgacggggc 324

                 
Query: 277 ttgagc 282
           ||||||
Sbjct: 325 ttgagc 330



to top

>gb|DQ213705.1| Taeniopygia guttata clone 0063P0003E09 RBX1 protein-like mRNA,
           complete sequence
          Length = 527

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 211/269 (78%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| |||||||| ||||||||||| || |||||||| || || || ||||| || || 
Sbjct: 346 tagtgtccatacttttggaactcccattccctgttgtccagtggacatacttggcgtgtt 287

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||   |||||||||||||||||| || || ||||| || ||| | || || 
Sbjct: 286 ttgagccagcgagagatgcagtggaagtggaaagcgtgattgcagacgcccaatgcaact 227

                                                                       
Query: 337 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 396
           ||||| |||||   ||| ||    || ||||| || || || || ||||| || ||||| 
Sbjct: 226 gtgcattcctcagaggtagccgatgcttggttggcttgacattctatgcacagatccata 167

                                                                       
Query: 397 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 456
           |||||||| | ||| ||||| ||||| || ||||| |||||||| ||||| || || |||
Sbjct: 166 atgtggtttctgcaaatggcacagttatcaaccacaatgtcccatgcccacagagctacg 107

                                        
Query: 457 gcgttccactttttgatctcgaagcgctt 485
           |||||||| || || |  |||||||||||
Sbjct: 106 gcgttccatttcttcacttcgaagcgctt 78



to top

>emb|CT032440.1| Platynereis dumerilii EST IB0AAA38AH04EM1
          Length = 561

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 292 atgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcgctg 351
           |||||||| |||||||| ||||| |||||||||||||||||||| ||||| |||||  ||
Sbjct: 273 atgcagtgaaagtggaaagcatgattgcaaactccccaagcgactgtgcattcctcattg 214

                
Query: 352 gtggc 356
           |||||
Sbjct: 213 gtggc 209



to top

>ref|XM_416239.1| PREDICTED: Gallus gallus similar to RBX1 protein (LOC418001), mRNA
          Length = 1242

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                        
Query: 217  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
            ||||| || ||||| ||||||||||| || |||||||| || ||||| ||||| || || 
Sbjct: 1079 tagtgtccgtacttttggaactcccattccctgttgtccagtgggcatacttggcgagtt 1020

                                                                        
Query: 277  ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
            |||||||| ||   |||||||||||||||||| || || ||||| || ||||| || || 
Sbjct: 1019 ttgagccagcgagagatgcagtggaagtggaaagcgtgattgcagacaccccatgcaacc 960

                    
Query: 337  gtgcactc 344
            ||||||||
Sbjct: 959  gtgcactc 952



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 83/104 (79%)
 Strand = Plus / Minus

                                                                       
Query: 382 atgcagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccag 441
           ||||| || ||||| || ||||| | ||| ||||| ||||| || ||||| |||||||| 
Sbjct: 914 atgcatagatccataatatggtttctgcaaatggcacagttatcaaccacaatgtcccat 855

                                                       
Query: 442 gcccagagcgcgacggcgttccactttttgatctcgaagcgctt 485
           ||||| || || || |||||||| || || |  |||||||||||
Sbjct: 854 gcccacagagctactgcgttccatttcttcacttcgaagcgctt 811



to top

>emb|CR390140.1| Gallus gallus finished cDNA, clone ChEST162j5
          Length = 484

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
           ||||| || ||||| ||||||||||| || |||||||| || ||||| ||||| || || 
Sbjct: 321 tagtgtccgtacttttggaactcccattccctgttgtccagtgggcatacttggcgagtt 262

                                                                       
Query: 277 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 336
           |||||||| ||   |||||||||||||||||| || || ||||| || ||||| || || 
Sbjct: 261 ttgagccagcgagagatgcagtggaagtggaaagcgtgattgcagacaccccatgcaacc 202

                   
Query: 337 gtgcactc 344
           ||||||||
Sbjct: 201 gtgcactc 194



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 83/104 (79%)
 Strand = Plus / Minus

                                                                       
Query: 382 atgcagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccag 441
           ||||| || ||||| || ||||| | ||| ||||| ||||| || ||||| |||||||| 
Sbjct: 156 atgcatagatccataatatggtttctgcaaatggcacagttatcaaccacaatgtcccat 97

                                                       
Query: 442 gcccagagcgcgacggcgttccactttttgatctcgaagcgctt 485
           ||||| || || || |||||||| || || |  |||||||||||
Sbjct: 96  gcccacagagctactgcgttccatttcttcacttcgaagcgctt 53



to top

>emb|BX470254.7| Zebrafish DNA sequence from clone CH211-256M1 in linkage group 3,
             complete sequence
          Length = 146746

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                         
Query: 226   tacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaa 285
             |||||||| ||||||||||| |||||||| || || |||||||| | |||||| ||||| 
Sbjct: 98511 tacttctgaaactcccactctctgttgtccagtggacacacttgtctggtcttcagccag 98452

                              
Query: 286   cggctgatgcagtggaa 302
             |||  ||||||||||||
Sbjct: 98451 cgggagatgcagtggaa 98435



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                         
Query: 385   cagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcc 444
             ||||||||||| ||||| || | ||||||||| |||||||| || || |||||||| |||
Sbjct: 97428 cagaggtccataatgtgatttctgcagatggcacagttgtccactacaatgtcccatgcc 97369

                                   
Query: 445   cagagcgcgacggcgttccact 466
             || || || || ||||||||||
Sbjct: 97368 cacagagccacagcgttccact 97347



to top

>gb|AC109153.13| Mus musculus chromosome 15, clone RP23-51J23, complete sequence
          Length = 222164

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                         
Query: 391   tccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagc 450
             ||||| |||||||| | ||||||||| ||||| || ||||| ||||||||||||||||| 
Sbjct: 63642 tccataatgtggttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagg 63701

                             
Query: 451   gcgacggcgttccact 466
             || || || |||||||
Sbjct: 63702 gccactgcattccact 63717



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 226   tacttctggaactcccactcgctgttgtc 254
             |||||||||||||||||||| ||||||||
Sbjct: 57939 tacttctggaactcccactctctgttgtc 57967



to top

>emb|AL954851.5| Zebrafish DNA sequence from clone CH211-280J3, complete sequence
          Length = 177221

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                          
Query: 227    acttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaac 286
              ||||||| ||||||||||| |||||||| || || |||||||| | |||||| ||||| |
Sbjct: 108354 acttctgaaactcccactctctgttgtccagtggacacacttgtctggtcttcagccagc 108413

                              
Query: 287    ggctgatgcagtggaa 302
              ||  ||||||||||||
Sbjct: 108414 gggagatgcagtggaa 108429



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                          
Query: 385    cagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcc 444
              ||||||||||| ||||| || | ||||||||| |||||||| || || |||||||| |||
Sbjct: 109445 cagaggtccataatgtgatttctgcagatggcacagttgtccactacaatgtcccatgcc 109504

                                    
Query: 445    cagagcgcgacggcgttccact 466
              || || || || ||||||||||
Sbjct: 109505 cacagagccacagcgttccact 109526



to top

>gb|AC160528.9| Mus musculus chromosome 15, clone RP23-310L8, complete sequence
          Length = 174502

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                         
Query: 391   tccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagc 450
             ||||| |||||||| | ||||||||| ||||| || ||||| ||||||||||||||||| 
Sbjct: 18852 tccataatgtggttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagg 18793

                             
Query: 451   gcgacggcgttccact 466
             || || || |||||||
Sbjct: 18792 gccactgcattccact 18777



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 226   tacttctggaactcccactcgctgttgtc 254
             |||||||||||||||||||| ||||||||
Sbjct: 24555 tacttctggaactcccactctctgttgtc 24527



to top

>gb|DQ103593.1| Olimarabidopsis pumila clone BAC 44L14, complete sequence
          Length = 118342

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                         
Query: 262   cacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatggttgcaa 321
             ||||||||||| ||||||||||| | ||||||||| || ||||| || || |||||||||
Sbjct: 93115 cacacttgacgagtcttgagccatctgctgatgcaatgaaagtgaaaggcgtggttgcaa 93174

               
Query: 322   ac 323
             ||
Sbjct: 93175 ac 93176



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 220   tgaccatacttctggaactcccactcgctgtt 251
             |||||||| |||||||| ||||||||||||||
Sbjct: 92982 tgaccatatttctggaattcccactcgctgtt 93013



to top

>dbj|AK005127.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched
           library, clone:1500002P15 product:ring-box 1, full
           insert sequence
          Length = 1623

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 361 gcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcag 420
           |||||||| ||||  || ||||| || || ||||| |||||||| | |||  |||| |||
Sbjct: 204 gcctggttggcctaacattcgatacaaagatccataatgtggttcctgcaattggcacag 145

                                                             
Query: 421 ttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttttt 470
           || || ||||| ||||||||||||||||| || || || |||||||||||
Sbjct: 144 ttatcaaccacaatgtcccaggcccagagggccactgcattccacttttt 95



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 223 ccatacttctggaactcccactcgctgttgtc 254
           ||||||||||||||||||||||| ||||||||
Sbjct: 341 ccatacttctggaactcccactctctgttgtc 310



to top

>emb|AL138639.1|ATT21C14 Arabidopsis thaliana DNA chromosome 3, BAC clone T21C14
          Length = 79677

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                         
Query: 262   cacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatggttgcaa 321
             ||||||||||| || |||||||| | |||||| ||||||||||| || || |||||||||
Sbjct: 61327 cacacttgacgagttttgagccatctgctgatacagtggaagtgaaaggcgtggttgcaa 61386

               
Query: 322   ac 323
             ||
Sbjct: 61387 ac 61388



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 216   ttagtgaccatacttctggaactcccactcgc 247
             |||||||||||| |||||||| ||||||||||
Sbjct: 61191 ttagtgaccatatttctggaattcccactcgc 61222



to top

>ref|XM_962490.1| PREDICTED: Tribolium castaneum similar to CG16982-PA (LOC655935),
           mRNA
          Length = 375

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 119/149 (79%)
 Strand = Plus / Minus

                                                                       
Query: 322 actccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcg 381
           ||||||||||| || || ||||| || ||||| ||   |||||| || ||||| ||||| 
Sbjct: 236 actccccaagcaactgtacactcttcactggtcgctgaggcctgatttgcctgacactca 177

                                                                       
Query: 382 atgcagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccag 441
           || || |  ||||| || || ||||| || ||||| || || ||||||||||| ||||| 
Sbjct: 176 atacataaatccataatatgattgcgacaaatggcacaattatcgaccacgatatcccaa 117

                                        
Query: 442 gcccagagcgcgacggcgttccacttttt 470
           ||||| | ||| |||||||||||||||||
Sbjct: 116 gcccacaacgctacggcgttccacttttt 88



to top

>emb|AL080242.11|HSA554C12 Human DNA sequence from clone RP11-554C12 on chromosome 22, complete
             sequence
          Length = 46391

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                         
Query: 391   tccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagc 450
             ||||| |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| 
Sbjct: 24300 tccataatgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagg 24241

                             
Query: 451   gcgacggcgttccact 466
             || || || |||||||
Sbjct: 24240 gctactgcattccact 24225



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 72/89 (80%)
 Strand = Plus / Minus

                                                                         
Query: 226   tacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaa 285
             ||||| ||||| |||||||| |||||||| |  || ||||| || || || |||||||| 
Sbjct: 38559 tacttttggaattcccactctctgttgtccaatggacacacctgtcgtgttttgagccag 38500

                                          
Query: 286   cggctgatgcagtggaagtggaatgcatg 314
             ||   ||||||||||||||| || |||||
Sbjct: 38499 cgagagatgcagtggaagtgaaaagcatg 38471



to top

>dbj|AB225693.1| Aspergillus oryzae cDNA, contig sequence: AoEST2548
          Length = 889

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 376 cactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatg 435
           |||||||| || ||||||||||| || || ||||| || ||||| |||||||| ||||| 
Sbjct: 473 cactcgatacacaggtccatgatatgattacggcaaattgcgcaattgtcgacaacgata 414

                      
Query: 436 tcccaggccca 446
           ||||| |||||
Sbjct: 413 tcccacgccca 403



to top

>gb|AF296833.1|F7C8 Arabidopsis thaliana BAC F7C8
          Length = 70169

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                        
Query: 265   acttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaac 323
             |||||||| ||||| ||||| | |||||||||||| |||||||| || || ||||||||
Sbjct: 59986 acttgacgagtctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaac 60044



 Score = 48.1 bits (24), Expect = 0.033
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 216   ttagtgaccatacttctggaactcccactcgctgtt 251
             |||||||||||| ||||| ||||||||||| |||||
Sbjct: 59856 ttagtgaccatatttctgaaactcccactcactgtt 59891



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 391   tccatgatgtggttgcggcagatggcgcagttgtcgaccacgat 434
             |||||||||||||| | |||||| || |||||||| || |||||
Sbjct: 60864 tccatgatgtggtttctgcagatcgcacagttgtcaacaacgat 60907



to top

>dbj|AK090764.1| Homo sapiens cDNA FLJ33445 fis, clone BRALZ2000263
          Length = 1871

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                        
Query: 217  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 276
            ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 1696 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 1637

                                                  
Query: 277  ttgagccaacggctgatgcagtggaagtggaatgcatg 314
            |||||||| ||   ||||||||||||||| || |||||
Sbjct: 1636 ttgagccagcgagagatgcagtggaagtgaaaagcatg 1599



to top

>dbj|AK116119.1| Ciona intestinalis cDNA, clone:citb010m18, full insert sequence
          Length = 830

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 221 gaccatacttctggaactcccactc 245
           |||||||||||||||||||||||||
Sbjct: 364 gaccatacttctggaactcccactc 340



to top

>ref|XM_392227.2| PREDICTED: Apis mellifera similar to ENSANGP00000010437
           (LOC408691), mRNA
          Length = 731

 Score = 48.1 bits (24), Expect = 0.033
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 291 gatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggt 338
           |||||| ||||| ||||||||||| ||||| || |||||||| |||||
Sbjct: 289 gatgcaatggaaatggaatgcatgattgcatacaccccaagctacggt 242



to top

>ref|NM_187604.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 897

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 498 gccggcgccggcgcaggaggaggagggggcgccgg 532
           ||||| ||||| |||||||||||||| ||||||||
Sbjct: 234 gccggtgccggtgcaggaggaggaggaggcgccgg 268



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 498     gccggcgccggcgcaggaggaggagggggcgccgg 532
               ||||| ||||| |||||||||||||| ||||||||
Sbjct: 6536202 gccggtgccggtgcaggaggaggaggaggcgccgg 6536236



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 498      gccggcgccggcgcaggaggagga 521
                ||||||||||||| ||||||||||
Sbjct: 28984586 gccggcgccggcggaggaggagga 28984609



to top

>gb|AC107226.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0081P02, complete sequence
          Length = 162425

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 498   gccggcgccggcgcaggaggaggagggggcgccgg 532
             ||||| ||||| |||||||||||||| ||||||||
Sbjct: 78964 gccggtgccggtgcaggaggaggaggaggcgccgg 78998



to top

>gb|BC034498.1| Homo sapiens WD repeat domain 26, mRNA (cDNA clone IMAGE:4831010),
           partial cds
          Length = 2886

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 500 cggcgccggcgcaggaggaggagggggcgccgggggcca 538
           ||||| |||||  |||||||||||||||| |||||||||
Sbjct: 19  cggcggcggcggtggaggaggagggggcggcgggggcca 57



to top

>emb|AL662947.3|OSJN00148 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0073L04,
             complete sequence
          Length = 143301

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 497   agccggcgccggcgcaggaggaggagg 523
             ||||||||||||||||||| |||||||
Sbjct: 22382 agccggcgccggcgcaggaagaggagg 22356



to top

>dbj|AP007150.1| Aspergillus oryzae RIB40 genomic DNA, SC009
          Length = 1913118

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                          
Query: 388     aggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggccca 446
               ||||||||||| || || ||||| || ||||| |||||||| ||||| ||||| |||||
Sbjct: 1833983 aggtccatgatatgattacggcaaattgcgcaattgtcgacaacgatatcccacgccca 1834041



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 497      agccggcgccggcgcaggaggaggagg 523
                ||||||||||||||||||| |||||||
Sbjct: 20291749 agccggcgccggcgcaggaagaggagg 20291723



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 498     gccggcgccggcgcaggaggaggagggggcgccgg 532
               ||||| ||||| |||||||||||||| ||||||||
Sbjct: 6535415 gccggtgccggtgcaggaggaggaggaggcgccgg 6535449



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 498      gccggcgccggcgcaggaggagga 521
                ||||||||||||| ||||||||||
Sbjct: 29076008 gccggcgccggcggaggaggagga 29076031



to top

>gb|AF156371.1| Nicotiana tabacum clone PR29 mRNA sequence
          Length = 472

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 219 gtgaccatacttctggaactcccactcgctg 249
           ||||||||| ||||| |||||||||||||||
Sbjct: 323 gtgaccatatttctgaaactcccactcgctg 353



to top

>gb|AC099790.3| Homo sapiens chromosome 1 clone RP11-397G23, complete sequence
          Length = 213942

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                    
Query: 500   cggcgccggcgcaggaggaggagggggcgccgggggcca 538
             ||||| |||||  |||||||||||||||| |||||||||
Sbjct: 90223 cggcggcggcggtggaggaggagggggcggcgggggcca 90185



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 344     cctcgctggtggcgctggcctgg 366
               |||||||||||||||||||||||
Sbjct: 4254043 cctcgctggtggcgctggcctgg 4254065



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 468     tttgatctcgaagcgcttgc 487
               ||||||||||||||||||||
Sbjct: 4619478 tttgatctcgaagcgcttgc 4619459



to top

>dbj|AB209887.1| Homo sapiens mRNA for WD repeat domain 26 variant protein
          Length = 6623

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 500 cggcgccggcgcaggaggaggagggggcgccgggggcca 538
           ||||| |||||  |||||||||||||||| |||||||||
Sbjct: 233 cggcggcggcggtggaggaggagggggcggcgggggcca 271



to top

>ref|NM_188653.1| Oryza sativa (japonica cultivar-group), Ozsa8256 predicted mRNA
          Length = 1146

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 498 gccggcgccggcgcaggaggaggagg 523
           |||||||||||||| |||||||||||
Sbjct: 171 gccggcgccggcgccggaggaggagg 146



to top

>ref|XM_550562.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1005

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 498 gccggcgccggcgcaggaggaggagg 523
           ||||||| ||||||||||||||||||
Sbjct: 265 gccggcggcggcgcaggaggaggagg 240



to top

>ref|XM_550658.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 612

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 498 gccggcgccggcgcaggaggaggagg 523
           |||| |||||||||||||||||||||
Sbjct: 282 gccgccgccggcgcaggaggaggagg 257



to top

>ref|XM_480356.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1743

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 498  gccggcgccggcgcaggaggaggagg 523
            |||||||||||||| |||||||||||
Sbjct: 1583 gccggcgccggcgccggaggaggagg 1608



to top

>ref|XM_507147.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1120_C08.22 mRNA
          Length = 2059

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 498  gccggcgccggcgcaggaggaggagg 523
            |||||||||||||| |||||||||||
Sbjct: 1583 gccggcgccggcgccggaggaggagg 1608



to top

>gb|AC120527.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0011J22 map R10571S, complete sequence
          Length = 154441

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 498   gccggcgccggcgcaggaggaggagg 523
             |||||||||||||||||||| |||||
Sbjct: 26561 gccggcgccggcgcaggaggcggagg 26536



to top

>gb|AC147812.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0073K23
              map near R10571S, complete sequence
          Length = 161073

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 498    gccggcgccggcgcaggaggaggagg 523
              |||||||||||||||||||| |||||
Sbjct: 125862 gccggcgccggcgcaggaggcggagg 125837



to top

>gb|AY257863.1| Oryza sativa (japonica cultivar-group) chromosome 11 genomic sequence
          Length = 42748

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 498   gccggcgccggcgcaggaggaggagg 523
             |||||||||||||||||||| |||||
Sbjct: 42642 gccggcgccggcgcaggaggcggagg 42667



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 495      gcagccggcgccggcgcaggaggagg 520
                ||||||||||||| ||||||||||||
Sbjct: 24664499 gcagccggcgccgccgcaggaggagg 24664524



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 507      ggcgcaggaggaggaggggg 526
                ||||||||||||||||||||
Sbjct: 27522539 ggcgcaggaggaggaggggg 27522558



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 500      cggcgccggcgcaggaggaggagg 523
                ||||| ||||||||||||||||||
Sbjct: 21726085 cggcggcggcgcaggaggaggagg 21726062



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 498     gccggcgccggcgcaggaggaggagggg 525
               ||||||| ||||| ||||||||||||||
Sbjct: 5699025 gccggcggcggcggaggaggaggagggg 5698998



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 498     gccggcgccggcgcaggaggaggagg 523
               |||||||||||||||||||| |||||
Sbjct: 3288424 gccggcgccggcgcaggaggcggagg 3288449



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 536      ccacggccacggcgacgtcgccct 559
                ||||||||||||||| ||||||||
Sbjct: 16442814 ccacggccacggcgaggtcgccct 16442791



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 498     gccggcgccggcgcaggaggaggagg 523
               |||||||||||||| |||||||||||
Sbjct: 4576669 gccggcgccggcgccggaggaggagg 4576694



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 498     gccggcgccggcgcaggaggaggagg 523
               |||| |||||||||||||||||||||
Sbjct: 2737834 gccgccgccggcgcaggaggaggagg 2737859



 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 498     gccggcgccggcgcaggaggaggagg 523
               ||||||| ||||||||||||||||||
Sbjct: 1360632 gccggcggcggcgcaggaggaggagg 1360607



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 498     gccggcgccggcgcaggaggaggag 522
               |||| ||||||||||||||||||||
Sbjct: 7856731 gccgccgccggcgcaggaggaggag 7856755



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 500     cggcgccggcgcaggaggaggagg 523
               ||||||||||| ||||||||||||
Sbjct: 8188247 cggcgccggcggaggaggaggagg 8188224



to top

>dbj|AP002481.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
              clone:P0702F03
          Length = 141111

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 498    gccggcgccggcgcaggaggaggagg 523
              |||||||||||||| |||||||||||
Sbjct: 113211 gccggcgccggcgccggaggaggagg 113236



to top

>dbj|AP001539.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
            clone:P0708G02
          Length = 168976

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 498  gccggcgccggcgcaggaggaggagg 523
            |||||||||||||| |||||||||||
Sbjct: 975  gccggcgccggcgccggaggaggagg 1000



to top

>dbj|AP003878.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1120_C08
          Length = 150300

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 498    gccggcgccggcgcaggaggaggagg 523
              |||||||||||||| |||||||||||
Sbjct: 100517 gccggcgccggcgccggaggaggagg 100542



to top

>dbj|AP006554.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0529C07
          Length = 174011

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 498    gccggcgccggcgcaggaggaggagg 523
              |||| |||||||||||||||||||||
Sbjct: 149581 gccgccgccggcgcaggaggaggagg 149606



to top

>dbj|AP001168.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
             clone:P0425F02
          Length = 176979

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 498   gccggcgccggcgcaggaggaggagg 523
             ||||||| ||||||||||||||||||
Sbjct: 69171 gccggcggcggcgcaggaggaggagg 69146



to top

>dbj|AK120816.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023014O08, full
           insert sequence
          Length = 1687

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 498 gccggcgccggcgcaggaggaggagg 523
           |||||||||||||| |||||||||||
Sbjct: 504 gccggcgccggcgccggaggaggagg 479



to top

>dbj|AK102200.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087E11, full
           insert sequence
          Length = 1005

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 498 gccggcgccggcgcaggaggaggagg 523
           ||||||| ||||||||||||||||||
Sbjct: 265 gccggcggcggcgcaggaggaggagg 240



to top

>dbj|AK072269.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023008O22, full
            insert sequence
          Length = 1743

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 498  gccggcgccggcgcaggaggaggagg 523
            |||||||||||||| |||||||||||
Sbjct: 1583 gccggcgccggcgccggaggaggagg 1608



to top

>dbj|AK070877.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023065C06, full
            insert sequence
          Length = 2059

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 498  gccggcgccggcgcaggaggaggagg 523
            |||||||||||||| |||||||||||
Sbjct: 1583 gccggcgccggcgccggaggaggagg 1608



to top

>dbj|AK069966.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023038A10, full
           insert sequence
          Length = 1917

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 495 gcagccggcgccggcgcaggaggagg 520
           ||||||||||||| ||||||||||||
Sbjct: 79  gcagccggcgccgccgcaggaggagg 54



to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 498     gccggcgccggcgcaggaggaggagg 523
               |||||||||||||||||||| |||||
Sbjct: 3297137 gccggcgccggcgcaggaggcggagg 3297162



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 536      ccacggccacggcgacgtcgccct 559
                ||||||||||||||| ||||||||
Sbjct: 16533818 ccacggccacggcgaggtcgccct 16533795



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 495      gcagccggcgccggcgcaggaggagg 520
                ||||||||||||| ||||||||||||
Sbjct: 24592705 gcagccggcgccgccgcaggaggagg 24592730



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 507      ggcgcaggaggaggaggggg 526
                ||||||||||||||||||||
Sbjct: 27448097 ggcgcaggaggaggaggggg 27448116



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 500      cggcgccggcgcaggaggaggagg 523
                ||||| ||||||||||||||||||
Sbjct: 21654430 cggcggcggcgcaggaggaggagg 21654407



 Score = 40.1 bits (20), Expect = 8.1
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 498     gccggcgccggcgcaggaggaggagggg 525
               ||||||| ||||| ||||||||||||||
Sbjct: 5699018 gccggcggcggcggaggaggaggagggg 5698991



to top

>emb|AL954852.5|CNS08CD6 Oryza sativa chromosome 12, . BAC OJ1573_A06 of library Monsanto from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 143895

 Score = 44.1 bits (22), Expect = 0.52
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 495    gcagccggcgccggcgcaggaggagg 520
              ||||||||||||| ||||||||||||
Sbjct: 109365 gcagccggcgccgccgcaggaggagg 109390



to top

>ref|XM_466656.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1399

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 500 cggcgccggcgcaggaggaggagggggcgccgggggc 536
           ||||| |||||  |||||||||||||||| |||||||
Sbjct: 244 cggcggcggcggcggaggaggagggggcggcgggggc 208



to top

>ref|XM_506859.1| PREDICTED Oryza sativa (japonica cultivar-group), OSJNBa0030C08.39
           mRNA
          Length = 1432

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 500 cggcgccggcgcaggaggaggagggggcgccgggggc 536
           ||||| |||||  |||||||||||||||| |||||||
Sbjct: 210 cggcggcggcggcggaggaggagggggcggcgggggc 174



to top

>emb|AL160408.24| Human DNA sequence from clone RP4-781K5 on chromosome 1q42.1-43,
            complete sequence
          Length = 132887

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 507  ggcgcaggaggaggagggggcgccg 531
            |||| ||||||||||||||||||||
Sbjct: 4733 ggcggaggaggaggagggggcgccg 4757



to top

>emb|AL008726.3|HS337O18 Human DNA sequence from clone RP3-337O18 on chromosome 20q12-13.1
            Contains the PLPT gene for phospholipid transfer protein,
            the PPGB gene for protective protein for
            beta-galactosidase (galactosialidosis), the PTE1 gene for
            peroxisomal acyl-CoA thioesterase, the C20orf161 gene,
            the C20orf162 gene, the C20orf163, the C20orf164 gene,
            the C20orf165 gene, the 5' end of an variant of the TNNC2
            gene for fast troponin C2 and three CpG islands, complete
            sequence
          Length = 86080

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 505  ccggcgcaggaggaggagggg 525
            |||||||||||||||||||||
Sbjct: 6542 ccggcgcaggaggaggagggg 6522



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 497     agccggcgccggcgcaggagg 517
               |||||||||||||||||||||
Sbjct: 5788843 agccggcgccggcgcaggagg 5788823



to top

>dbj|AP005107.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0431E05
          Length = 146091

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 498   gccggcgccggcgcaggaggaggag 522
             |||| ||||||||||||||||||||
Sbjct: 71113 gccgccgccggcgcaggaggaggag 71137



to top

>dbj|AP006438.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0030C08
          Length = 163423

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                   
Query: 500    cggcgccggcgcaggaggaggagggggcgccgggggc 536
              ||||| |||||  |||||||||||||||| |||||||
Sbjct: 139647 cggcggcggcggcggaggaggagggggcggcgggggc 139683



to top

>dbj|AP004881.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0496E03
          Length = 138622

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 500   cggcgccggcgcaggaggaggagggggcgccgggggc 536
             ||||| |||||  |||||||||||||||| |||||||
Sbjct: 51945 cggcggcggcggcggaggaggagggggcggcgggggc 51981



to top

>dbj|AK105867.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-A08, full
           insert sequence
          Length = 1432

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 500 cggcgccggcgcaggaggaggagggggcgccgggggc 536
           ||||| |||||  |||||||||||||||| |||||||
Sbjct: 210 cggcggcggcggcggaggaggagggggcggcgggggc 174


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,844,626
Number of Sequences: 3902068
Number of extensions: 4844626
Number of successful extensions: 117149
Number of sequences better than 10.0: 332
Number of HSP's better than 10.0 without gapping: 344
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 113716
Number of HSP's gapped (non-prelim): 3354
length of query: 598
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 575
effective length of database: 17,143,297,704
effective search space: 9857396179800
effective search space used: 9857396179800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top