ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd16f23 |
|---|---|
| Clone Library Name | barley_pub |
>gb|BT008914.1| Triticum aestivum clone wpa1c.pk002.f9:fis, full insert mRNA sequence Length = 1493 Score = 702 bits (354), Expect = 0.0 Identities = 507/553 (91%), Gaps = 4/553 (0%) Strand = Plus / Minus Query: 13 catatactagcaccaaa-gggtaagnaaccctaacatggnaaaacttgagnaggacagna 71 ||||||||||||||||| ||||||| |||| |||||||| |||||||||| | |||| | Sbjct: 1449 catatactagcaccaaaagggtaag-aaccataacatgg-aaaacttgagaacaacag-a 1393 Query: 72 aacgaattcatctgctcactgacgatcacaacatcctgcctgactactgctgggcgcact 131 |||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 1392 aacgaattcatctgctgactgacgatcacaacatcctgcctgcctactgctgggcgcact 1333 Query: 132 gcaccctctgcccgccgccgcccggcatatcctcgtcctcgtcataggcctcctgcgcct 191 |||||| ||| |||||||| || ||||| |||||||||||||| ||||||||||| |||| Sbjct: 1332 gcacccgctggccgccgccaccgggcatgtcctcgtcctcgtcgtaggcctcctgtgcct 1273 Query: 192 gctgctgctgttgcctccgcatctcttcctcaatgtctatatcgtaggccatcgtctcct 251 ||||||||||| ||||||||||||| ||||| ||||| || ||||||||||||||||||| Sbjct: 1272 gctgctgctgtcgcctccgcatctcctcctcgatgtcaatgtcgtaggccatcgtctcct 1213 Query: 252 cgcactcgtctagctccatgtctgtgtactgcgatgccggcttgggcgggaggaccgtct 311 |||||||||| ||||||||||| ||||||||||| |||||||||||||| ||||| |||| Sbjct: 1212 cgcactcgtccagctccatgtccgtgtactgcgacgccggcttgggcggcaggacagtct 1153 Query: 312 cgagggccttgcactggtccaagctcagcgagtcggggaaaaccaccgtgaagtggatgt 371 |||| |||||||||||||||| ||||||||||||||| ||| | |||||||||||||||| Sbjct: 1152 cgagcgccttgcactggtccaggctcagcgagtcgggaaaatcaaccgtgaagtggatgt 1093 Query: 372 agagcttgcccttcatgaagggcctctggtacatgggcatgccctcgtcgttgatcgcct 431 | ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 1092 acagcttgcccttcatgaacggcctctggtacatgggcatgccctcgtcgttgatcgcct 1033 Query: 432 tgaatgaatcaggcttgacaacttccccggggttggacttgatgagcagctgtctgccat 491 |||| |||||||||||||| ||||| || ||||||||||||||||||||||| ||||| | Sbjct: 1032 tgaacgaatcaggcttgacgacttcgccagggttggacttgatgagcagctgcctgccgt 973 Query: 492 ccaaatgagctaggacatattggaagccacagagggcctccgtcagggtcagggtgtgct 551 |||||||||| |||||||| ||||||||||| || ||||| ||||||||||||||||||| Sbjct: 972 ccaaatgagccaggacatactggaagccacacagtgcctcggtcagggtcagggtgtgct 913 Query: 552 catagaagaggtc 564 | ||||||||||| Sbjct: 912 cgtagaagaggtc 900
>gb|AY103727.1| Zea mays PCO082317 mRNA sequence Length = 1504 Score = 361 bits (182), Expect = 2e-96 Identities = 384/450 (85%), Gaps = 6/450 (1%) Strand = Plus / Minus Query: 115 ctactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtc 174 |||||||||||||||||||||||||||| ||||||| |||||| ||||| |||||||| Sbjct: 1319 ctactgctgggcgcactgcaccctctgcgcgccgcc---cggcatgtcctcatcctcgtc 1263 Query: 175 ataggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatc 234 ||||||||||| ||||||||||| ||||||||||||| | || |||| | || Sbjct: 1262 gtaggcctcctgg---tgctgctgctgccgcctccgcatctccgcttcgatgttcacgtc 1206 Query: 235 gtaggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggctt 294 |||| ||||||||||||||||||||| ||||||||||| ||||||||||| ||||||| Sbjct: 1205 atagggcatcgtctcctcgcactcgtccagctccatgtcggtgtactgcgacaccggctt 1146 Query: 295 gggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaac 354 ||||||||| || | ||| |||||||||||||| ||| |||||||||||| ||||| | Sbjct: 1145 gggcgggagcacagcctccagggccttgcactgctccgggctcagcgagtccgggaactc 1086 Query: 355 caccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgcc 414 ||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||| Sbjct: 1085 caccgagaagtggatgtacagcttgcccttcatgaacggcctctggtacatgggcatgcc 1026 Query: 415 ctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttgat 474 |||||||||||||||||||| ||||||||||| |||||||| || || || || ||||| Sbjct: 1025 ttcgtcgttgatcgccttgaaagaatcaggcttcacaacttcgcccggatttgatttgat 966 Query: 475 gagcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccgt 534 |||||||| ||| |||||| |||| | ||| | ||||||||||| || | || || Sbjct: 965 cagcagctgcctgttatccaagtgagtcacaacaaactggaagccacacagagattcagt 906 Query: 535 cagggtcagggtgtgctcatagaagaggtc 564 || ||||||||||||||| ||||||||||| Sbjct: 905 caaggtcagggtgtgctcgtagaagaggtc 876
>dbj|AK104315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-023-E04, full insert sequence Length = 1532 Score = 359 bits (181), Expect = 7e-96 Identities = 382/449 (85%) Strand = Plus / Minus Query: 116 tactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtca 175 |||||||| ||||||||||| | ||| |||||||||| |||| |||||||||||||| Sbjct: 1342 tactgctgcgcgcactgcacgcgctgggcgccgccgccgtgcatgtcctcgtcctcgtcg 1283 Query: 176 taggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatcg 235 || ||||||||| |||||| ||||| |||||| |||||| ||||| |||| | ||| Sbjct: 1282 tatgcctcctgctgctgctgttgctgccgcctcctcatctcctcctcgatgttcacgtcg 1223 Query: 236 taggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggcttg 295 || | ||| ||||||||||||||||| ||||||||||| ||||||||||| ||||| | Sbjct: 1222 tacggcatggtctcctcgcactcgtcgagctccatgtcggtgtactgcgacaccggcctt 1163 Query: 296 ggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaacc 355 ||||||||||| ||||| ||||||||||||||||| | ||| ||||||||||| || Sbjct: 1162 ggcgggaggacggtctccagggccttgcactggtcagggttcaaagagtcggggaattcc 1103 Query: 356 accgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccc 415 || | |||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| Sbjct: 1102 acggagaagtggatgtagagcttccccttcatgaatggccgctggtacatcggcatgccc 1043 Query: 416 tcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttgatg 475 |||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 1042 tcgtcgttgacagccttgaatgaatcaggcttgacaacttcaccgggcttggacttgata 983 Query: 476 agcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccgtc 535 |||||||| ||| ||||| |||| || ||| | ||||||||||| |||||||| || Sbjct: 982 agcagctgcctgttgtccaagtgagtgagaacaaactggaagccacaaagggcctcagtg 923 Query: 536 agggtcagggtgtgctcatagaagaggtc 564 ||| ||||||||||||| ||||||||||| Sbjct: 922 aggttcagggtgtgctcgtagaagaggtc 894
>dbj|AK061049.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-G01, full insert sequence Length = 1558 Score = 359 bits (181), Expect = 7e-96 Identities = 382/449 (85%) Strand = Plus / Minus Query: 116 tactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtca 175 |||||||| ||||||||||| | ||| |||||||||| |||| |||||||||||||| Sbjct: 1349 tactgctgcgcgcactgcacgcgctgggcgccgccgccgtgcatgtcctcgtcctcgtcg 1290 Query: 176 taggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatcg 235 || ||||||||| |||||| ||||| |||||| |||||| ||||| |||| | ||| Sbjct: 1289 tatgcctcctgctgctgctgttgctgccgcctcctcatctcctcctcgatgttcacgtcg 1230 Query: 236 taggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggcttg 295 || | ||| ||||||||||||||||| ||||||||||| ||||||||||| ||||| | Sbjct: 1229 tacggcatggtctcctcgcactcgtcgagctccatgtcggtgtactgcgacaccggcctt 1170 Query: 296 ggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaacc 355 ||||||||||| ||||| ||||||||||||||||| | ||| ||||||||||| || Sbjct: 1169 ggcgggaggacggtctccagggccttgcactggtcagggttcaaagagtcggggaattcc 1110 Query: 356 accgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccc 415 || | |||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| Sbjct: 1109 acggagaagtggatgtagagcttccccttcatgaatggccgctggtacatcggcatgccc 1050 Query: 416 tcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttgatg 475 |||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||| Sbjct: 1049 tcgtcgttgacagccttgaatgaatcaggcttgacaacttcaccgggcttggacttgata 990 Query: 476 agcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccgtc 535 |||||||| ||| ||||| |||| || ||| | ||||||||||| |||||||| || Sbjct: 989 agcagctgcctgttgtccaagtgagtgagaacaaactggaagccacaaagggcctcagtg 930 Query: 536 agggtcagggtgtgctcatagaagaggtc 564 ||| ||||||||||||| ||||||||||| Sbjct: 929 aggttcagggtgtgctcgtagaagaggtc 901
>gb|BT017684.1| Zea mays clone EL01N0443H09.c mRNA sequence Length = 1401 Score = 281 bits (142), Expect = 1e-72 Identities = 374/450 (83%), Gaps = 6/450 (1%) Strand = Plus / Minus Query: 115 ctactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtc 174 |||||||||||||||||||||||||||||| ||||| |||| ||| || |||||||| Sbjct: 1160 ctactgctgggcgcactgcaccctctgcccaccgcct---ggcacatcatcatcctcgtc 1104 Query: 175 ataggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatc 234 ||||||||||| || |||||||| ||||||||||||| || || |||| | || Sbjct: 1103 gtaggcctcctgg---tggtgctgctgccgcctccgcatctcctcttcgatgttcacgtc 1047 Query: 235 gtaggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggctt 294 ||| | ||| ||||||||||||||||||||||||||||| |||||||| ||| | ||||| Sbjct: 1046 gtacgtcattgtctcctcgcactcgtctagctccatgtcagtgtactgtgatactggctt 987 Query: 295 gggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaac 354 ||||||||| || ||| |||||||||||||| ||| ||||| |||||| ||||| | Sbjct: 986 gggcgggagaacaacctccagggccttgcactgctccgggctcaacgagtccgggaactc 927 Query: 355 caccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgcc 414 ||||| ||||| ||||| |||||||||||||||||||||||||| |||||||||||||| Sbjct: 926 caccgaaaagtgaatgtacagcttgcccttcatgaagggcctctgatacatgggcatgcc 867 Query: 415 ctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttgat 474 || |||||||| |||||||| ||||||||||| |||||||| || ||||| || ||||| Sbjct: 866 ttcatcgttgattgccttgaaagaatcaggcttcacaacttcaccagggttcgatttgat 807 Query: 475 gagcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccgt 534 |||||||| ||| |||||| |||| || ||| | |||| ||||| || | || || Sbjct: 806 cagcagctgcctgttatccaagtgagtcagaacaaactggagcccacacagagattcagt 747 Query: 535 cagggtcagggtgtgctcatagaagaggtc 564 || |||||| |||||||| ||||||||||| Sbjct: 746 caaggtcagtgtgtgctcgtagaagaggtc 717
>gb|AC084296.12| Oryza sativa chromosome 3 BAC OSJNBb0024J04 genomic sequence, complete sequence Length = 145507 Score = 258 bits (130), Expect = 2e-65 Identities = 277/326 (84%) Strand = Plus / Minus Query: 116 tactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtca 175 |||||||| ||||||||||| | ||| |||||||||| |||| |||||||||||||| Sbjct: 59321 tactgctgcgcgcactgcacgcgctgggcgccgccgccgtgcatgtcctcgtcctcgtcg 59262 Query: 176 taggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatcg 235 || ||||||||| |||||| ||||| |||||| |||||| ||||| |||| | ||| Sbjct: 59261 tatgcctcctgctgctgctgttgctgccgcctcctcatctcctcctcgatgttcacgtcg 59202 Query: 236 taggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggcttg 295 || | ||| ||||||||||||||||| ||||||||||| ||||||||||| ||||| | Sbjct: 59201 tacggcatggtctcctcgcactcgtcgagctccatgtcggtgtactgcgacaccggcctt 59142 Query: 296 ggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaacc 355 ||||||||||| ||||| ||||||||||||||||| | ||| ||||||||||| || Sbjct: 59141 ggcgggaggacggtctccagggccttgcactggtcagggttcaaagagtcggggaattcc 59082 Query: 356 accgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccc 415 || | |||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| Sbjct: 59081 acggagaagtggatgtagagcttccccttcatgaatggccgctggtacatcggcatgccc 59022 Query: 416 tcgtcgttgatcgccttgaatgaatc 441 |||||||||| |||||||||||||| Sbjct: 59021 tcgtcgttgacagccttgaatgaatc 58996 Score = 103 bits (52), Expect = 6e-19 Identities = 106/124 (85%) Strand = Plus / Minus Query: 441 caggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaaatgag 500 |||||||||||||||| ||||| ||||||||||| |||||||| ||| ||||| |||| Sbjct: 58867 caggcttgacaacttcaccgggcttggacttgataagcagctgcctgttgtccaagtgag 58808 Query: 501 ctaggacatattggaagccacagagggcctccgtcagggtcagggtgtgctcatagaaga 560 || ||| | ||||||||||| |||||||| || ||| ||||||||||||| ||||||| Sbjct: 58807 tgagaacaaactggaagccacaaagggcctcagtgaggttcagggtgtgctcgtagaaga 58748 Query: 561 ggtc 564 |||| Sbjct: 58747 ggtc 58744 Score = 54.0 bits (27), Expect = 5e-04 Identities = 61/72 (84%), Gaps = 4/72 (5%) Strand = Plus / Plus Query: 374 agcttgcccttcatgaagggcctctggtacatgggcatgccc----tcgtcgttgatcgc 429 ||||| ||||||||||| |||| ||||||||| |||| |||| |||||||||| || Sbjct: 81589 agcttccccttcatgaatggccgctggtacatcggcacgccctcgatcgtcgttgacagc 81648 Query: 430 cttgaatgaatc 441 |||||||||||| Sbjct: 81649 cttgaatgaatc 81660
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 258 bits (130), Expect = 2e-65 Identities = 277/326 (84%) Strand = Plus / Minus Query: 116 tactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtca 175 |||||||| ||||||||||| | ||| |||||||||| |||| |||||||||||||| Sbjct: 32407193 tactgctgcgcgcactgcacgcgctgggcgccgccgccgtgcatgtcctcgtcctcgtcg 32407134 Query: 176 taggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatcg 235 || ||||||||| |||||| ||||| |||||| |||||| ||||| |||| | ||| Sbjct: 32407133 tatgcctcctgctgctgctgttgctgccgcctcctcatctcctcctcgatgttcacgtcg 32407074 Query: 236 taggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggcttg 295 || | ||| ||||||||||||||||| ||||||||||| ||||||||||| ||||| | Sbjct: 32407073 tacggcatggtctcctcgcactcgtcgagctccatgtcggtgtactgcgacaccggcctt 32407014 Query: 296 ggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaacc 355 ||||||||||| ||||| ||||||||||||||||| | ||| ||||||||||| || Sbjct: 32407013 ggcgggaggacggtctccagggccttgcactggtcagggttcaaagagtcggggaattcc 32406954 Query: 356 accgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccc 415 || | |||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| Sbjct: 32406953 acggagaagtggatgtagagcttccccttcatgaatggccgctggtacatcggcatgccc 32406894 Query: 416 tcgtcgttgatcgccttgaatgaatc 441 |||||||||| |||||||||||||| Sbjct: 32406893 tcgtcgttgacagccttgaatgaatc 32406868 Score = 103 bits (52), Expect = 6e-19 Identities = 106/124 (85%) Strand = Plus / Minus Query: 441 caggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaaatgag 500 |||||||||||||||| ||||| ||||||||||| |||||||| ||| ||||| |||| Sbjct: 32406739 caggcttgacaacttcaccgggcttggacttgataagcagctgcctgttgtccaagtgag 32406680 Query: 501 ctaggacatattggaagccacagagggcctccgtcagggtcagggtgtgctcatagaaga 560 || ||| | ||||||||||| |||||||| || ||| ||||||||||||| ||||||| Sbjct: 32406679 tgagaacaaactggaagccacaaagggcctcagtgaggttcagggtgtgctcgtagaaga 32406620 Query: 561 ggtc 564 |||| Sbjct: 32406619 ggtc 32406616 Score = 93.7 bits (47), Expect = 6e-16 Identities = 74/83 (89%) Strand = Plus / Minus Query: 354 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 413 |||||||||| || ||||||||||| ||||||||||| |||||||||||||| ||||| | Sbjct: 24843932 ccaccgtgaaatgaatgtagagcttccccttcatgaaaggcctctggtacattggcattc 24843873 Query: 414 cctcgtcgttgatcgccttgaat 436 |||| ||||| || ||||||||| Sbjct: 24843872 cctcatcgtttattgccttgaat 24843850 Score = 65.9 bits (33), Expect = 1e-07 Identities = 99/121 (81%) Strand = Plus / Minus Query: 441 caggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaaatgag 500 ||||||| |||||||| |||||||| ||||| ||||||||||||||| |||| ||| | Sbjct: 24843762 caggcttaacaacttcaccggggtttgacttaatgagcagctgtctgttgtccagatgtg 24843703 Query: 501 ctaggacatattggaagccacagagggcctccgtcagggtcagggtgtgctcatagaaga 560 |||||| ||||||| ||||| || || || ||||| | | |||||||||||| |||| Sbjct: 24843702 tcaggacaaattggaaaccacaaagtgcttcagtcagagataaggtgtgctcataaaaga 24843643 Query: 561 g 561 | Sbjct: 24843642 g 24843642 Score = 54.0 bits (27), Expect = 5e-04 Identities = 61/72 (84%), Gaps = 4/72 (5%) Strand = Plus / Plus Query: 374 agcttgcccttcatgaagggcctctggtacatgggcatgccc----tcgtcgttgatcgc 429 ||||| ||||||||||| |||| ||||||||| |||| |||| |||||||||| || Sbjct: 32429461 agcttccccttcatgaatggccgctggtacatcggcacgccctcgatcgtcgttgacagc 32429520 Query: 430 cttgaatgaatc 441 |||||||||||| Sbjct: 32429521 cttgaatgaatc 32429532
>emb|AJ457802.1|OSA457802 Oryza sativa (japonica cultivar-group) partial mRNA for putative DnaJ protein (dnaJ gene) Length = 552 Score = 258 bits (130), Expect = 2e-65 Identities = 277/326 (84%) Strand = Plus / Minus Query: 116 tactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtca 175 |||||||| ||||||||||| | ||| |||||||||| |||| |||||||||||||| Sbjct: 326 tactgctgcgcgcactgcacgcgctgggcgccgccgccgtgcatgtcctcgtcctcgtcg 267 Query: 176 taggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatcg 235 || ||||||||| |||||| ||||| |||||| |||||| ||||| |||| | ||| Sbjct: 266 tatgcctcctgctgctgctgttgctgccgcctcctcatctcctcctcgatgttcacgtcg 207 Query: 236 taggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggcttg 295 || | ||| ||||||||||||||||| ||||||||||| ||||||||||| ||||| | Sbjct: 206 tacggcatggtctcctcgcactcgtcgagctccatgtcggtgtactgcgacaccggcctt 147 Query: 296 ggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaacc 355 ||||||||||| ||||| ||||||||||||||||| | ||| ||||||||||| || Sbjct: 146 ggcgggaggacggtctccagggccttgcactggtcagggttcaaagagtcggggaattcc 87 Query: 356 accgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccc 415 || | |||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| Sbjct: 86 acggagaagtggatgtagagcttccccttcatgaatggccgctggtacatcggcatgccc 27 Query: 416 tcgtcgttgatcgccttgaatgaatc 441 |||||||||| |||||||||||||| Sbjct: 26 tcgtcgttgacagccttgaatgaatc 1
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 258 bits (130), Expect = 2e-65 Identities = 277/326 (84%) Strand = Plus / Minus Query: 116 tactgctgggcgcactgcaccctctgcccgccgccgcccggcatatcctcgtcctcgtca 175 |||||||| ||||||||||| | ||| |||||||||| |||| |||||||||||||| Sbjct: 32497703 tactgctgcgcgcactgcacgcgctgggcgccgccgccgtgcatgtcctcgtcctcgtcg 32497644 Query: 176 taggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatgtctatatcg 235 || ||||||||| |||||| ||||| |||||| |||||| ||||| |||| | ||| Sbjct: 32497643 tatgcctcctgctgctgctgttgctgccgcctcctcatctcctcctcgatgttcacgtcg 32497584 Query: 236 taggccatcgtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggcttg 295 || | ||| ||||||||||||||||| ||||||||||| ||||||||||| ||||| | Sbjct: 32497583 tacggcatggtctcctcgcactcgtcgagctccatgtcggtgtactgcgacaccggcctt 32497524 Query: 296 ggcgggaggaccgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaacc 355 ||||||||||| ||||| ||||||||||||||||| | ||| ||||||||||| || Sbjct: 32497523 ggcgggaggacggtctccagggccttgcactggtcagggttcaaagagtcggggaattcc 32497464 Query: 356 accgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccc 415 || | |||||||||||||||||| ||||||||||| |||| ||||||||| ||||||||| Sbjct: 32497463 acggagaagtggatgtagagcttccccttcatgaatggccgctggtacatcggcatgccc 32497404 Query: 416 tcgtcgttgatcgccttgaatgaatc 441 |||||||||| |||||||||||||| Sbjct: 32497403 tcgtcgttgacagccttgaatgaatc 32497378 Score = 103 bits (52), Expect = 6e-19 Identities = 106/124 (85%) Strand = Plus / Minus Query: 441 caggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaaatgag 500 |||||||||||||||| ||||| ||||||||||| |||||||| ||| ||||| |||| Sbjct: 32497249 caggcttgacaacttcaccgggcttggacttgataagcagctgcctgttgtccaagtgag 32497190 Query: 501 ctaggacatattggaagccacagagggcctccgtcagggtcagggtgtgctcatagaaga 560 || ||| | ||||||||||| |||||||| || ||| ||||||||||||| ||||||| Sbjct: 32497189 tgagaacaaactggaagccacaaagggcctcagtgaggttcagggtgtgctcgtagaaga 32497130 Query: 561 ggtc 564 |||| Sbjct: 32497129 ggtc 32497126 Score = 93.7 bits (47), Expect = 6e-16 Identities = 74/83 (89%) Strand = Plus / Minus Query: 354 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 413 |||||||||| || ||||||||||| ||||||||||| |||||||||||||| ||||| | Sbjct: 24935255 ccaccgtgaaatgaatgtagagcttccccttcatgaaaggcctctggtacattggcattc 24935196 Query: 414 cctcgtcgttgatcgccttgaat 436 |||| ||||| || ||||||||| Sbjct: 24935195 cctcatcgtttattgccttgaat 24935173 Score = 65.9 bits (33), Expect = 1e-07 Identities = 99/121 (81%) Strand = Plus / Minus Query: 441 caggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaaatgag 500 ||||||| |||||||| |||||||| ||||| ||||||||||||||| |||| ||| | Sbjct: 24935085 caggcttaacaacttcaccggggtttgacttaatgagcagctgtctgttgtccagatgtg 24935026 Query: 501 ctaggacatattggaagccacagagggcctccgtcagggtcagggtgtgctcatagaaga 560 |||||| ||||||| ||||| || || || ||||| | | |||||||||||| |||| Sbjct: 24935025 tcaggacaaattggaaaccacaaagtgcttcagtcagagataaggtgtgctcataaaaga 24934966 Query: 561 g 561 | Sbjct: 24934965 g 24934965 Score = 54.0 bits (27), Expect = 5e-04 Identities = 61/72 (84%), Gaps = 4/72 (5%) Strand = Plus / Plus Query: 374 agcttgcccttcatgaagggcctctggtacatgggcatgccc----tcgtcgttgatcgc 429 ||||| ||||||||||| |||| ||||||||| |||| |||| |||||||||| || Sbjct: 32519971 agcttccccttcatgaatggccgctggtacatcggcacgccctcgatcgtcgttgacagc 32520030 Query: 430 cttgaatgaatc 441 |||||||||||| Sbjct: 32520031 cttgaatgaatc 32520042
>gb|BT024164.1| Zea mays clone EL01N0426F11 mRNA sequence Length = 1761 Score = 145 bits (73), Expect = 2e-31 Identities = 187/225 (83%) Strand = Plus / Minus Query: 337 cagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcct 396 ||||||||||||||| |||||||||| || ||||||||||| ||||||||||||||||| Sbjct: 1174 cagcgagtcggggaactccaccgtgaaatgaatgtagagcttccccttcatgaagggcct 1115 Query: 397 ctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttc 456 |||||| || ||||| ||||||||||| || ||||||||| ||||| || |||||||| Sbjct: 1114 ctggtaaatcggcatcccctcgtcgtttattgccttgaattggtcaggtttaacaacttc 1055 Query: 457 cccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattggaa 516 |||||||| || ||||| || ||||| ||| |||| ||| | || ||| ||||||| Sbjct: 1054 gccggggtttgatttgatcagaagctgcctgttgtccagatgtgtaagaacaaattggaa 995 Query: 517 gccacagagggcctccgtcagggtcagggtgtgctcatagaagag 561 ||||| || || || ||||| | ||||||||||||||| ||||| Sbjct: 994 cccacatagagcttcggtcagagacagggtgtgctcataaaagag 950
>gb|AY224432.1| Oryza sativa (japonica cultivar-group) isolate 20618 DNAJ-like protein mRNA, complete cds Length = 1254 Score = 143 bits (72), Expect = 7e-31 Identities = 174/208 (83%) Strand = Plus / Minus Query: 354 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 413 |||||||||| || ||||||||||| ||||||||||| |||||||||||||| ||||| | Sbjct: 1018 ccaccgtgaaatgaatgtagagcttccccttcatgaaaggcctctggtacattggcattc 959 Query: 414 cctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttga 473 |||| ||||| || ||||||||| |||||||| |||||||| |||||||| ||||| | Sbjct: 958 cctcatcgtttattgccttgaattggtcaggcttaacaacttcaccggggtttgacttaa 899 Query: 474 tgagcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccg 533 |||||||||||||| |||| ||| | |||||| ||||||| ||||| || || || | Sbjct: 898 tgagcagctgtctgttgtccagatgtgtcaggacaaattggaaaccacaaagtgcttcag 839 Query: 534 tcagggtcagggtgtgctcatagaagag 561 |||| | | |||||||||||| ||||| Sbjct: 838 tcagagataaggtgtgctcataaaagag 811
>dbj|AK105028.2| Oryza sativa (japonica cultivar-group) cDNA clone:001-012-E01, full insert sequence Length = 1667 Score = 143 bits (72), Expect = 7e-31 Identities = 174/208 (83%) Strand = Plus / Minus Query: 354 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 413 |||||||||| || ||||||||||| ||||||||||| |||||||||||||| ||||| | Sbjct: 1145 ccaccgtgaaatgaatgtagagcttccccttcatgaaaggcctctggtacattggcattc 1086 Query: 414 cctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttga 473 |||| ||||| || ||||||||| |||||||| |||||||| |||||||| ||||| | Sbjct: 1085 cctcatcgtttattgccttgaattggtcaggcttaacaacttcaccggggtttgacttaa 1026 Query: 474 tgagcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccg 533 |||||||||||||| |||| ||| | |||||| ||||||| ||||| || || || | Sbjct: 1025 tgagcagctgtctgttgtccagatgtgtcaggacaaattggaaaccacaaagtgcttcag 966 Query: 534 tcagggtcagggtgtgctcatagaagag 561 |||| | | |||||||||||| ||||| Sbjct: 965 tcagagataaggtgtgctcataaaagag 938
>dbj|AK070556.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023062J10, full insert sequence Length = 2409 Score = 143 bits (72), Expect = 7e-31 Identities = 174/208 (83%) Strand = Plus / Minus Query: 354 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 413 |||||||||| || ||||||||||| ||||||||||| |||||||||||||| ||||| | Sbjct: 1840 ccaccgtgaaatgaatgtagagcttccccttcatgaaaggcctctggtacattggcattc 1781 Query: 414 cctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttga 473 |||| ||||| || ||||||||| |||||||| |||||||| |||||||| ||||| | Sbjct: 1780 cctcatcgtttattgccttgaattggtcaggcttaacaacttcaccggggtttgacttaa 1721 Query: 474 tgagcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccg 533 |||||||||||||| |||| ||| | |||||| ||||||| ||||| || || || | Sbjct: 1720 tgagcagctgtctgttgtccagatgtgtcaggacaaattggaaaccacaaagtgcttcag 1661 Query: 534 tcagggtcagggtgtgctcatagaagag 561 |||| | | |||||||||||| ||||| Sbjct: 1660 tcagagataaggtgtgctcataaaagag 1633
>gb|AY104862.1| Zea mays PCO104800 mRNA sequence Length = 1031 Score = 137 bits (69), Expect = 4e-29 Identities = 255/317 (80%) Strand = Plus / Minus Query: 245 gtctcctcgcactcgtctagctccatgtctgtgtactgcgatgccggcttgggcgggagg 304 ||||||||||| || |||| |||||||||||| || || | ||||| ||||| || Sbjct: 522 gtctcctcgcattcatctatctccatgtctgtcagcttggacgaaggctttggcggaagt 463 Query: 305 accgtctcgagggccttgcactggtccaagctcagcgagtcggggaaaaccaccgtgaag 364 |||| |||||| ||||||||||| || ||||||||||||||| |||||||||| Sbjct: 462 accgactcgagagccttgcactgctctggtgccagcgagtcggggaactccaccgtgaaa 403 Query: 365 tggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccctcgtcgttg 424 || ||||||||||| ||||||||||||||||||||||| || ||||| |||||||| || Sbjct: 402 tgaatgtagagcttccccttcatgaagggcctctggtaaataggcatcccctcgtcattt 343 Query: 425 atcgccttgaatgaatcaggcttgacaacttccccggggttggacttgatgagcagctgt 484 |||||||||||| ||||| || |||||||| |||||||| || ||||| || ||||| Sbjct: 342 atcgccttgaattggtcaggtttaacaacttcgccggggtttgatttgatcagaagctgc 283 Query: 485 ctgccatccaaatgagctaggacatattggaagccacagagggcctccgtcagggtcagg 544 ||| |||| || | || ||| ||||||| ||||| || || || ||||| | |||| Sbjct: 282 ctgttgtccaggtgtgtaagaacaaattggaacccacatagagcttcggtcagagacagg 223 Query: 545 gtgtgctcatagaagag 561 ||||||||||| ||||| Sbjct: 222 gtgtgctcataaaagag 206
>dbj|AK102263.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033088M01, full insert sequence Length = 1819 Score = 135 bits (68), Expect = 2e-28 Identities = 173/208 (83%) Strand = Plus / Minus Query: 354 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 413 |||||| ||| || ||||||||||| ||||||||||| |||||||||||||| ||||| | Sbjct: 1180 ccaccgcgaaatgaatgtagagcttccccttcatgaaaggcctctggtacattggcattc 1121 Query: 414 cctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttga 473 |||| ||||| || ||||||||| |||||||| |||||||| |||||||| ||||| | Sbjct: 1120 cctcatcgtttattgccttgaattggtcaggcttaacaacttcaccggggtttgacttaa 1061 Query: 474 tgagcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccg 533 |||||||||||||| |||| ||| | |||||| ||||||| ||||| || || || | Sbjct: 1060 tgagcagctgtctgttgtccagatgtgtcaggacaaattggaaaccacaaagtgcttcag 1001 Query: 534 tcagggtcagggtgtgctcatagaagag 561 |||| | | |||||||||||| ||||| Sbjct: 1000 tcagagataaggtgtgctcataaaagag 973
>gb|AF169022.1|AF169022 Glycine max seed maturation protein PM37 (PM37) mRNA, complete cds Length = 1533 Score = 117 bits (59), Expect = 4e-23 Identities = 164/199 (82%) Strand = Plus / Minus Query: 354 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 413 |||| |||||||| ||||| || || ||||||||||| |||||||| ||||||||||| | Sbjct: 1116 ccacagtgaagtgaatgtaaagtttccccttcatgaatggcctctgatacatgggcattc 1057 Query: 414 cctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttga 473 |||| || || || |||||| ||||||||||||| |||||||||||||| || || || | Sbjct: 1056 cctcatcatttatagccttgtatgaatcaggcttcacaacttccccgggatttgatttaa 997 Query: 474 tgagcagctgtctgccatccaaatgagctaggacatattggaagccacagagggcctccg 533 | || ||||| | || |||||| |||| || ||| ||||||||||||| | |||||| | Sbjct: 996 taagaagctgacggctatccaagtgagtcagcacaaattggaagccacacaaggcctcgg 937 Query: 534 tcagggtcagggtgtgctc 552 | |||| || |||||||| Sbjct: 936 taagggacaaagtgtgctc 918 Score = 44.1 bits (22), Expect = 0.50 Identities = 25/26 (96%) Strand = Plus / Minus Query: 116 tactgctgggcgcactgcaccctctg 141 ||||||||||||||||| |||||||| Sbjct: 1348 tactgctgggcgcactgtaccctctg 1323
>emb|X67695.1|CSCSDJ C.sativus mRNA for cs DnaJ-1 Length = 1688 Score = 113 bits (57), Expect = 6e-22 Identities = 120/141 (85%) Strand = Plus / Minus Query: 360 tgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccctcgt 419 ||||||||||||| || |||||||||||||| |||||||||||||| ||||| ||||| | Sbjct: 1104 tgaagtggatgtaaagtttgcccttcatgaatggcctctggtacataggcataccctcat 1045 Query: 420 cgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttgatgagca 479 |||| || ||||||||| |||||||| || ||||| ||||| || |||||||| | Sbjct: 1044 cgtttatggccttgaattggtcaggcttcactacttcaccgggaagtgatttgatgagta 985 Query: 480 gctgtctgccatccaaatgag 500 |||||| |||||||||||||| Sbjct: 984 gctgtcggccatccaaatgag 964
>gb|AY109456.1| Zea mays CL1808_1 mRNA sequence Length = 2488 Score = 113 bits (57), Expect = 6e-22 Identities = 183/225 (81%) Strand = Plus / Minus Query: 337 cagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcct 396 ||||||||| ||||| |||||||||| |||||||| ||||| ||||||||||| ||||| Sbjct: 1850 cagcgagtcagggaactccaccgtgaaatggatgtacagcttccccttcatgaaaggcct 1791 Query: 397 ctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttc 456 |||||| || ||||| ||||| || || |||||||||||| ||||| || |||||||| Sbjct: 1790 ctggtaaattggcatcccctcatcattaatcgccttgaattggtcaggtttaacaacttc 1731 Query: 457 cccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattggaa 516 || |||| || |||||||| ||||| ||| |||| ||| | || ||| ||||||| Sbjct: 1730 accagggtctgatttgatgagaagctgcctgttgtccagatgtgtaagaacaaattggaa 1671 Query: 517 gccacagagggcctccgtcagggtcagggtgtgctcatagaagag 561 ||||| || || || ||||| | || |||||||||||||||||| Sbjct: 1670 cccacatagtgcttcggtcagagacaaggtgtgctcatagaagag 1626
>gb|BT016912.1| Zea mays clone Contig745 mRNA sequence Length = 982 Score = 107 bits (54), Expect = 4e-20 Identities = 180/222 (81%) Strand = Plus / Plus Query: 340 cgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctg 399 |||||| ||||| |||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 614 cgagtcagggaactccaccgtgaaatggatgtacagcttccccttcatgaaaggcctctg 673 Query: 400 gtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttcccc 459 ||| || ||||| ||||| || || |||||||||||| ||||| || |||||||| || Sbjct: 674 gtaaattggcatcccctcatcattaatcgccttgaattggtcaggtttaacaacttcacc 733 Query: 460 ggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattggaagcc 519 |||| || |||||||| ||||| ||| |||| ||| | || ||| ||||||| || Sbjct: 734 agggtctgatttgatgagaagctgcctgttgtccagatgtgtaagaacaaattggaaccc 793 Query: 520 acagagggcctccgtcagggtcagggtgtgctcatagaagag 561 ||| || || || ||||| | || |||||||||||||||||| Sbjct: 794 acatagtgcttcggtcagagacaaggtgtgctcatagaagag 835
>ref|NM_122127.2| Arabidopsis thaliana ATJ2 AT5G22060 (ATJ2) mRNA, complete cds Length = 1565 Score = 105 bits (53), Expect = 2e-19 Identities = 128/153 (83%) Strand = Plus / Minus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||||||| || ||||| | ||||||||||| ||||| ||||| ||||||||||| || Sbjct: 1173 gctcagcgattccgggaattcaaccgtgaagtgaatgtatagcttacccttcatgaacgg 1114 Query: 394 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 453 ||| ||||| || ||||| ||||| || | ||||||||| |||||||||| ||||| || Sbjct: 1113 cctttggtatattggcattccctcatcacttatcgccttgtatgaatcaggtttgacgac 1054 Query: 454 ttccccggggttggacttgatgagcagctgtct 486 || ||||| ||||| |||||||| |||||||| Sbjct: 1053 ctctccgggcttggatttgatgagaagctgtct 1021
>ref|NM_114279.2| Arabidopsis thaliana ATJ3 AT3G44110 (ATJ3) transcript variant AT3G44110.1 mRNA, complete cds Length = 1746 Score = 105 bits (53), Expect = 2e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 1203 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 1144 Query: 394 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 453 ||||||||| || ||||| || || ||| | || |||||| |||||||||| || || || Sbjct: 1143 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatcaggtttcacgac 1084 Query: 454 ttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattg 513 ||||| || || || || ||||| || |||||||||||| |||| || ||| |||| Sbjct: 1083 ctccccaggattagatttaatgagaagacttctgccatccaagtgagtcagaacaaattg 1024 Query: 514 gaagccaca 522 ||||||||| Sbjct: 1023 gaagccaca 1015
>gb|BT017212.1| Zea mays clone EL01N0372B09.c mRNA sequence Length = 891 Score = 105 bits (53), Expect = 2e-19 Identities = 90/101 (89%), Gaps = 1/101 (0%) Strand = Plus / Minus Query: 337 cagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcct 396 ||||||||||||||| |||||||||| || ||||||||||| ||||||||||||||||| Sbjct: 390 cagcgagtcggggaactccaccgtgaaatgaatgtagagcttccccttcatgaagggcct 331 Query: 397 ctggtacatgggc-atgccctcgtcgttgatcgccttgaat 436 |||||| || ||| || ||||||||||| || ||||||||| Sbjct: 330 ctggtaaatcggcaatcccctcgtcgtttattgccttgaat 290
>gb|AY113878.1| Arabidopsis thaliana putative DnaJ-like protein atj3 (At3g44110) mRNA, complete cds Length = 1294 Score = 105 bits (53), Expect = 2e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 1041 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 982 Query: 394 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 453 ||||||||| || ||||| || || ||| | || |||||| |||||||||| || || || Sbjct: 981 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatcaggtttcacgac 922 Query: 454 ttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattg 513 ||||| || || || || ||||| || |||||||||||| |||| || ||| |||| Sbjct: 921 ctccccaggattagatttaatgagaagacttctgccatccaagtgagtcagaacaaattg 862 Query: 514 gaagccaca 522 ||||||||| Sbjct: 861 gaagccaca 853
>gb|AY035087.1| Arabidopsis thaliana putative dnaJ protein homolog atj3 (At3g44110) mRNA, complete cds Length = 1653 Score = 105 bits (53), Expect = 2e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 1157 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 1098 Query: 394 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 453 ||||||||| || ||||| || || ||| | || |||||| |||||||||| || || || Sbjct: 1097 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatcaggtttcacgac 1038 Query: 454 ttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattg 513 ||||| || || || || ||||| || |||||||||||| |||| || ||| |||| Sbjct: 1037 ctccccaggattagatttaatgagaagacttctgccatccaagtgagtcagaacaaattg 978 Query: 514 gaagccaca 522 ||||||||| Sbjct: 977 gaagccaca 969
>gb|AY045655.1| Arabidopsis thaliana AT3g44110/F26G5_60 mRNA, complete cds Length = 1692 Score = 105 bits (53), Expect = 2e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 1174 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 1115 Query: 394 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 453 ||||||||| || ||||| || || ||| | || |||||| |||||||||| || || || Sbjct: 1114 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatcaggtttcacgac 1055 Query: 454 ttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattg 513 ||||| || || || || ||||| || |||||||||||| |||| || ||| |||| Sbjct: 1054 ctccccaggattagatttaatgagaagacttctgccatccaagtgagtcagaacaaattg 995 Query: 514 gaagccaca 522 ||||||||| Sbjct: 994 gaagccaca 986
>emb|BX831588.1|CNS0A0V0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH17ZB05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1489 Score = 105 bits (53), Expect = 2e-19 Identities = 128/153 (83%) Strand = Plus / Minus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||||||| || ||||| | ||||||||||| ||||| ||||| ||||||||||| || Sbjct: 1137 gctcagcgattccgggaattcaaccgtgaagtgaatgtatagcttacccttcatgaacgg 1078 Query: 394 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 453 ||| ||||| || ||||| ||||| || | ||||||||| |||||||||| ||||| || Sbjct: 1077 cctttggtatattggcattccctcatcacttatcgccttgtatgaatcaggtttgacgac 1018 Query: 454 ttccccggggttggacttgatgagcagctgtct 486 || ||||| ||||| |||||||| |||||||| Sbjct: 1017 ctctccgggcttggatttgatgagaagctgtct 985
>emb|BX830687.1|CNS0A0QX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS14ZE01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1491 Score = 105 bits (53), Expect = 2e-19 Identities = 128/153 (83%) Strand = Plus / Minus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||||||| || ||||| | ||||||||||| ||||| ||||| ||||||||||| || Sbjct: 1133 gctcagcgattccgggaattcaaccgtgaagtgaatgtatagcttacccttcatgaacgg 1074 Query: 394 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 453 ||| ||||| || ||||| ||||| || | ||||||||| |||||||||| ||||| || Sbjct: 1073 cctttggtatattggcattccctcatcacttatcgccttgtatgaatcaggtttgacgac 1014 Query: 454 ttccccggggttggacttgatgagcagctgtct 486 || ||||| ||||| |||||||| |||||||| Sbjct: 1013 ctctccgggcttggatttgatgagaagctgtct 981
>dbj|AK118386.1| Arabidopsis thaliana At5g22060 mRNA for putative DNAJ PROTEIN HOMOLOG ATJ, complete cds, clone: RAFL19-64-P10 Length = 1451 Score = 105 bits (53), Expect = 2e-19 Identities = 128/153 (83%) Strand = Plus / Minus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||||||| || ||||| | ||||||||||| ||||| ||||| ||||||||||| || Sbjct: 1119 gctcagcgattccgggaattcaaccgtgaagtgaatgtatagcttacccttcatgaacgg 1060 Query: 394 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 453 ||| ||||| || ||||| ||||| || | ||||||||| |||||||||| ||||| || Sbjct: 1059 cctttggtatattggcattccctcatcacttatcgccttgtatgaatcaggtttgacgac 1000 Query: 454 ttccccggggttggacttgatgagcagctgtct 486 || ||||| ||||| |||||||| |||||||| Sbjct: 999 ctctccgggcttggatttgatgagaagctgtct 967
>gb|U22340.1|ATU22340 Arabidopsis thaliana DnaJ homolog (atj) mRNA, complete cds Length = 1642 Score = 105 bits (53), Expect = 2e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 1140 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 1081 Query: 394 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 453 ||||||||| || ||||| || || ||| | || |||||| |||||||||| || || || Sbjct: 1080 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatcaggtttcacgac 1021 Query: 454 ttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattg 513 ||||| || || || || ||||| || |||||||||||| |||| || ||| |||| Sbjct: 1020 ctccccaggattagatttaatgagaagacttctgccatccaagtgagtcagaacaaattg 961 Query: 514 gaagccaca 522 ||||||||| Sbjct: 960 gaagccaca 952
>gb|U64912.1|ATU64912 Arabidopsis thaliana farnesylated protein ATFP9 mRNA, partial cds Length = 270 Score = 105 bits (53), Expect = 2e-19 Identities = 155/189 (82%) Strand = Plus / Minus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 258 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 199 Query: 394 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 453 ||||||||| || ||||| || || ||| | || |||||| |||||||||| || || || Sbjct: 198 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatcaggtttcacgac 139 Query: 454 ttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattg 513 ||||| || || || || ||||| || |||||||||||| |||| || ||| |||| Sbjct: 138 ctccccaggattagatttaatgagaagacttctgccatccaagtgagtcagaacaaattg 79 Query: 514 gaagccaca 522 ||||||||| Sbjct: 78 gaagccaca 70
>gb|AF124139.1|AF124139 Lycopersicon esculentum DnaJ-like protein mRNA, complete cds Length = 1566 Score = 103 bits (52), Expect = 6e-19 Identities = 121/144 (84%) Strand = Plus / Minus Query: 344 tcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtac 403 ||||||||| | || |||||||| ||||| | |||||||||||||| ||||| |||||| Sbjct: 1111 tcggggaaatcaacagtgaagtgaatgtacattttgcccttcatgaacggcctttggtac 1052 Query: 404 atgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccgggg 463 || ||||| || || |||||||| ||||| || |||||||||||||||||| || || Sbjct: 1051 atcggcattccttcatcgttgatagccttaaactgatcaggcttgacaacttcgccaggt 992 Query: 464 ttggacttgatgagcagctgtctg 487 | |||||| ||||||||||||||| Sbjct: 991 tgggacttaatgagcagctgtctg 968
>gb|AC124955.34| Medicago truncatula clone mth2-12l24, complete sequence Length = 115804 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Minus Query: 343 gtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggta 402 ||||||||| |||| |||||||| ||||| |||||||||||||| || ||||||||||| Sbjct: 64040 gtcggggaattccacggtgaagtgaatgtaaagcttgcccttcataaatggcctctggta 63981 Query: 403 catgggcatgccctcgtcgttgatcgccttgaatgaatc 441 ||| ||||| ||||||||||| || |||||| ||||||| Sbjct: 63980 catcggcattccctcgtcgttaatagccttgtatgaatc 63942 Score = 44.1 bits (22), Expect = 0.50 Identities = 31/34 (91%) Strand = Plus / Minus Query: 441 caggcttgacaacttccccggggttggacttgat 474 |||||||||||||||| |||||||| || ||||| Sbjct: 63713 caggcttgacaacttctccggggtttgatttgat 63680
>gb|AC147405.7| Medicago truncatula clone mth2-146n5, complete sequence Length = 147062 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Plus Query: 343 gtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggta 402 ||||||||| |||| |||||||| ||||| |||||||||||||| || ||||||||||| Sbjct: 83023 gtcggggaattccacggtgaagtgaatgtaaagcttgcccttcataaatggcctctggta 83082 Query: 403 catgggcatgccctcgtcgttgatcgccttgaatgaatc 441 ||| ||||| ||||||||||| || |||||| ||||||| Sbjct: 83083 catcggcattccctcgtcgttaatagccttgtatgaatc 83121 Score = 44.1 bits (22), Expect = 0.50 Identities = 31/34 (91%) Strand = Plus / Plus Query: 441 caggcttgacaacttccccggggttggacttgat 474 |||||||||||||||| |||||||| || ||||| Sbjct: 83350 caggcttgacaacttctccggggtttgatttgat 83383
>gb|AC130810.14| Medicago truncatula clone mth2-36b14, complete sequence Length = 117901 Score = 101 bits (51), Expect = 2e-18 Identities = 87/99 (87%) Strand = Plus / Plus Query: 343 gtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggta 402 ||||||||| |||| |||||||| ||||| |||||||||||||| || ||||||||||| Sbjct: 8629 gtcggggaattccacggtgaagtgaatgtaaagcttgcccttcataaatggcctctggta 8688 Query: 403 catgggcatgccctcgtcgttgatcgccttgaatgaatc 441 ||| ||||| ||||||||||| || |||||| ||||||| Sbjct: 8689 catcggcattccctcgtcgttaatagccttgtatgaatc 8727 Score = 44.1 bits (22), Expect = 0.50 Identities = 31/34 (91%) Strand = Plus / Plus Query: 441 caggcttgacaacttccccggggttggacttgat 474 |||||||||||||||| |||||||| || ||||| Sbjct: 8956 caggcttgacaacttctccggggtttgatttgat 8989
>gb|AY088078.1| Arabidopsis thaliana clone 40976 mRNA, complete sequence Length = 1595 Score = 97.6 bits (49), Expect = 4e-17 Identities = 154/189 (81%) Strand = Plus / Minus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||| |||||| ||||| |||| |||||||||||||||||||| || |||||||| || Sbjct: 1183 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacctttcatgaatgg 1124 Query: 394 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 453 ||||||||| || ||||| || || ||| | || |||||| |||||||||| || || || Sbjct: 1123 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatcaggtttcacgac 1064 Query: 454 ttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattg 513 ||||| || || || || ||||| || |||||||||||| |||| || ||| |||| Sbjct: 1063 ctccccaggattagatttaatgagaagacttctgccatccaagtgagtcagaacaaattg 1004 Query: 514 gaagccaca 522 ||||||||| Sbjct: 1003 gaagccaca 995
>gb|L36113.1|ATHATJ Arabidopsis thaliana chaperone protein (atj) mRNA, complete cds Length = 1443 Score = 97.6 bits (49), Expect = 4e-17 Identities = 127/153 (83%) Strand = Plus / Minus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||||||| || ||||| | ||||||||||| ||||| ||||| ||||||||||| || Sbjct: 1107 gctcagcgattccgggaattcaaccgtgaagtgaatgtatagcttacccttcatgaacgg 1048 Query: 394 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaac 453 || ||||| || ||||| ||||| || | ||||||||| |||||||||| ||||| || Sbjct: 1047 actttggtatattggcattccctcatcacttatcgccttgtatgaatcaggtttgacgac 988 Query: 454 ttccccggggttggacttgatgagcagctgtct 486 || ||||| ||||| |||||||| |||||||| Sbjct: 987 ctctccgggcttggatttgatgagaagctgtct 955
>gb|BT016805.1| Zea mays clone Contig638 mRNA sequence Length = 1814 Score = 95.6 bits (48), Expect = 2e-16 Identities = 120/144 (83%) Strand = Plus / Minus Query: 340 cgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctg 399 |||||| ||||| |||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 1195 cgagtcagggaactccaccgtgaaatggatgtacagcttccccttcatgaaaggcctctg 1136 Query: 400 gtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttcccc 459 ||| || ||||| ||||| || || |||||||||||| ||||| || |||||||| || Sbjct: 1135 gtaaattggcatcccctcatcattaatcgccttgaattggtcaggtttaacaacttcacc 1076 Query: 460 ggggttggacttgatgagcagctg 483 |||| || |||||||| ||||| Sbjct: 1075 agggtctgatttgatgagaagctg 1052 Score = 44.1 bits (22), Expect = 0.50 Identities = 31/34 (91%) Strand = Plus / Minus Query: 243 tcgtctcctcgcactcgtctagctccatgtctgt 276 ||||||||||||| || |||| |||||||||||| Sbjct: 1292 tcgtctcctcgcattcatctatctccatgtctgt 1259
>gb|AC145811.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBb0088L13 map near C50029S, complete sequence Length = 129900 Score = 93.7 bits (47), Expect = 6e-16 Identities = 74/83 (89%) Strand = Plus / Minus Query: 354 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 413 |||||||||| || ||||||||||| ||||||||||| |||||||||||||| ||||| | Sbjct: 79167 ccaccgtgaaatgaatgtagagcttccccttcatgaaaggcctctggtacattggcattc 79108 Query: 414 cctcgtcgttgatcgccttgaat 436 |||| ||||| || ||||||||| Sbjct: 79107 cctcatcgtttattgccttgaat 79085 Score = 65.9 bits (33), Expect = 1e-07 Identities = 99/121 (81%) Strand = Plus / Minus Query: 441 caggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaaatgag 500 ||||||| |||||||| |||||||| ||||| ||||||||||||||| |||| ||| | Sbjct: 78997 caggcttaacaacttcaccggggtttgacttaatgagcagctgtctgttgtccagatgtg 78938 Query: 501 ctaggacatattggaagccacagagggcctccgtcagggtcagggtgtgctcatagaaga 560 |||||| ||||||| ||||| || || || ||||| | | |||||||||||| |||| Sbjct: 78937 tcaggacaaattggaaaccacaaagtgcttcagtcagagataaggtgtgctcataaaaga 78878 Query: 561 g 561 | Sbjct: 78877 g 78877
>gb|AC133862.6| Medicago truncatula clone mth2-30d7, complete sequence Length = 130054 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Minus Query: 344 tcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtac 403 |||||||| |||| |||||||| ||||| ||||||||||||||||| |||||||||||| Sbjct: 70069 tcggggaactccacagtgaagtgaatgtaaagcttgcccttcatgaaaggcctctggtac 70010 Query: 404 atgggcatgccctcgtcgttgatcgccttgaatgaatc 441 || ||||| || || || ||||| |||||| ||||||| Sbjct: 70009 attggcattccttcatcattgattgccttgtatgaatc 69972 Score = 40.1 bits (20), Expect = 7.8 Identities = 29/32 (90%) Strand = Plus / Minus Query: 245 gtctcctcgcactcgtctagctccatgtctgt 276 |||||||| ||||| || |||||||||||||| Sbjct: 70168 gtctcctcacactcatccagctccatgtctgt 70137
>gb|AC124957.18| Medicago truncatula clone mth2-15k14, complete sequence Length = 140624 Score = 91.7 bits (46), Expect = 2e-15 Identities = 85/98 (86%) Strand = Plus / Plus Query: 344 tcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtac 403 |||||||| |||| |||||||| ||||| ||||||||||||||||| |||||||||||| Sbjct: 75433 tcggggaactccacagtgaagtgaatgtaaagcttgcccttcatgaaaggcctctggtac 75492 Query: 404 atgggcatgccctcgtcgttgatcgccttgaatgaatc 441 || ||||| || || || ||||| |||||| ||||||| Sbjct: 75493 attggcattccttcatcattgattgccttgtatgaatc 75530 Score = 40.1 bits (20), Expect = 7.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 245 gtctcctcgcactcgtctagctccatgtctgt 276 |||||||| ||||| || |||||||||||||| Sbjct: 75334 gtctcctcacactcatccagctccatgtctgt 75365
>gb|AF053468.1|AF053468 Zea mays DnaJ-related protein ZMDJ1 (mdJ1) gene, complete cds Length = 3748 Score = 89.7 bits (45), Expect = 9e-15 Identities = 84/97 (86%) Strand = Plus / Minus Query: 340 cgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctg 399 |||||| ||||| |||||||||| |||||||| ||||| ||||||||||| |||||||| Sbjct: 3351 cgagtcagggaactccaccgtgaaatggatgtacagcttccccttcatgaaaggcctctg 3292 Query: 400 gtacatgggcatgccctcgtcgttgatcgccttgaat 436 ||| || ||||| ||||| || || |||||||||||| Sbjct: 3291 gtaaattggcatcccctcatcattaatcgccttgaat 3255 Score = 40.1 bits (20), Expect = 7.8 Identities = 44/52 (84%) Strand = Plus / Minus Query: 510 attggaagccacagagggcctccgtcagggtcagggtgtgctcatagaagag 561 ||||||| ||||| || || || ||||| | || |||||||||||||||||| Sbjct: 3099 attggaacccacatagtgcttcggtcagagacaaggtgtgctcatagaagag 3048
>emb|AL353814.1|ATF26G5 Arabidopsis thaliana DNA chromosome 3, BAC clone F26G5 Length = 102873 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Plus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 50638 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 50697 Query: 394 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatc 441 ||||||||| || ||||| || || ||| | || |||||| ||||||| Sbjct: 50698 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatc 50745
>gb|AF032883.1|AF032883 Arabidopsis thaliana DnaJ homolog AtJ3 (ATJ3) gene, complete cds Length = 2403 Score = 87.7 bits (44), Expect = 4e-14 Identities = 92/108 (85%) Strand = Plus / Minus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 1916 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 1857 Query: 394 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatc 441 ||||||||| || ||||| || || ||| | || |||||| ||||||| Sbjct: 1856 cctctggtatatcggcattccttcatcgcttattgccttgtatgaatc 1809
>dbj|AK220968.1| Arabidopsis thaliana mRNA for dnaJ protein homolog atj3, complete cds, clone: RAFL22-56-D08 Length = 493 Score = 81.8 bits (41), Expect = 2e-12 Identities = 62/69 (89%) Strand = Plus / Minus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||| |||||| ||||| |||| |||||||||||||||||||| ||||||||||| || Sbjct: 72 gctcaacgagtccgggaactccactgtgaagtggatgtagagcttacccttcatgaatgg 13 Query: 394 cctctggta 402 ||||||||| Sbjct: 12 cctctggta 4
>gb|L09124.1|ATPANJ1X Atriplex nummularia homologous sequence (ANJ1) mRNA Length = 1672 Score = 81.8 bits (41), Expect = 2e-12 Identities = 95/113 (84%) Strand = Plus / Minus Query: 344 tcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtac 403 |||||||| |||| ||||| |||||||| | ||||||||||||||| ||||| ||||| Sbjct: 1087 tcggggaactccactgtgaaatggatgtacatcttgcccttcatgaacggcctttggtat 1028 Query: 404 atgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttc 456 || ||||| ||||| || | || ||||||||| |||||||||||||||||| Sbjct: 1027 ataggcataccctcatcctcaattgccttgaattgatcaggcttgacaacttc 975
>gb|DQ083229.1| Oryza sativa (indica cultivar-group) clone 2B3E80 mRNA sequence Length = 568 Score = 79.8 bits (40), Expect = 9e-12 Identities = 130/160 (81%) Strand = Plus / Minus Query: 402 acatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttccccgg 461 |||| ||||| ||||| ||||| || ||||||||| |||||||| |||||||| |||| Sbjct: 568 acattggcattccctcatcgtttattgccttgaattggtcaggcttaacaacttcaccgg 509 Query: 462 ggttggacttgatgagcagctgtctgccatccaaatgagctaggacatattggaagccac 521 |||| ||||| ||||||||||||||| |||| ||| | |||||| ||||||| |||| Sbjct: 508 ggtttgacttaatgagcagctgtctgttgtccagatgtgtcaggacaaattggaaaccac 449 Query: 522 agagggcctccgtcagggtcagggtgtgctcatagaagag 561 | || || || ||||| | | |||||||||||| ||||| Sbjct: 448 aaagtgcttcagtcagagataaggtgtgctcataaaagag 409
>emb|X69436.1|APDNAJ A.porrum dnaJ mRNA for DNA J protein (partial) Length = 1210 Score = 77.8 bits (39), Expect = 4e-11 Identities = 132/163 (80%) Strand = Plus / Minus Query: 338 agcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcctc 397 ||||| ||||||||| | ||| ||| |||||||| | ||| ||| ||||||| ||||| Sbjct: 974 agcgaatcggggaaatcaaccaagaactggatgtacaacttccccctcatgaatggcctt 915 Query: 398 tggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttcc 457 || ||||| ||||| || ||||| ||||||||||||||| ||| ||||| || || || Sbjct: 914 tgatacattggcattccttcgtcattgatcgccttgaattgatctggcttaaccacctct 855 Query: 458 ccggggttggacttgatgagcagctgtctgccatccaaatgag 500 || ||||| |||||||| || || || ||||||||||| |||| Sbjct: 854 ccagggttagacttgataaggagttgcctgccatccaagtgag 812
>gb|AF239932.1|AF239932 Euphorbia esula DnaJ protein mRNA, complete cds Length = 1698 Score = 77.8 bits (39), Expect = 4e-11 Identities = 114/139 (82%) Strand = Plus / Minus Query: 360 tgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccctcgt 419 ||||||| ||||| | ||| ||| |||| || |||||||||||||| ||||| ||||| | Sbjct: 1099 tgaagtgaatgtacaacttacccctcataaatggcctctggtacattggcatcccctcat 1040 Query: 420 cgttgatcgccttgaatgaatcaggcttgacaacttccccggggttggacttgatgagca 479 | || || ||||||||| ||||||||| ||||||||||| || | |||||| ||||| | Sbjct: 1039 catttatagccttgaattgatcaggcttcacaacttccccaggctgggactttatgagga 980 Query: 480 gctgtctgccatccaaatg 498 | || || ||||| ||||| Sbjct: 979 gttgccttccatctaaatg 961
>emb|AL589883.1|ATT6G21 Arabidopsis thaliana DNA chromosome 5, BAC clone T6G21 (ESSA project) Length = 149788 Score = 71.9 bits (36), Expect = 2e-09 Identities = 90/108 (83%) Strand = Plus / Plus Query: 334 gctcagcgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaaggg 393 ||||||||| || ||||| | ||||||||||| ||||| ||||| ||||||||||| || Sbjct: 71732 gctcagcgattccgggaattcaaccgtgaagtgaatgtatagcttacccttcatgaacgg 71791 Query: 394 cctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatc 441 ||| ||||| || ||||| ||||| || | ||||||||| ||||||| Sbjct: 71792 cctttggtatattggcattccctcatcacttatcgccttgtatgaatc 71839
>emb|AJ299254.1|NTA299254 Nicotiana tabacum mRNA for putative DNAJ protein Length = 1631 Score = 69.9 bits (35), Expect = 9e-09 Identities = 98/119 (82%) Strand = Plus / Minus Query: 377 ttgcccttcatgaagggcctctggtacatgggcatgccctcgtcgttgatcgccttgaat 436 |||||| |||| || |||||||| ||||| ||| | ||||| || ||||| ||||||||| Sbjct: 1041 ttgcccctcataaatggcctctgatacattggcgttccctcatcattgattgccttgaat 982 Query: 437 gaatcaggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaa 495 |||||| || |||||||||||| | || || || ||||| || |||||||||||||| Sbjct: 981 tgatcaggtttaacaacttccccgagatttgattttatgaggagttgtctgccatccaa 923
>gb|AY491517.1| Capsicum annuum DnaJ-like protein mRNA, partial sequence Length = 742 Score = 67.9 bits (34), Expect = 3e-08 Identities = 76/90 (84%) Strand = Plus / Minus Query: 398 tggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgacaacttcc 457 |||||||| ||||| || || |||||||| ||||| || |||||||||||||||||| Sbjct: 738 tggtacatcggcattccttcatcgttgatagccttaaactgatcaggcttgacaacttcg 679 Query: 458 ccggggttggacttgatgagcagctgtctg 487 || || | |||||| ||||||||||||||| Sbjct: 678 ccaggttgggacttaatgagcagctgtctg 649
>ref|NM_180322.1| Arabidopsis thaliana ATJ3 AT3G44110 (ATJ3) transcript variant AT3G44110.2 mRNA, complete cds Length = 1579 Score = 60.0 bits (30), Expect = 8e-06 Identities = 114/142 (80%) Strand = Plus / Minus Query: 381 ccttcatgaagggcctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaat 440 |||||||||| ||||||||||| || ||||| || || ||| | || |||||| |||||| Sbjct: 1156 ccttcatgaatggcctctggtatatcggcattccttcatcgcttattgccttgtatgaat 1097 Query: 441 caggcttgacaacttccccggggttggacttgatgagcagctgtctgccatccaaatgag 500 |||| || || || ||||| || || || || ||||| || |||||||||||| |||| Sbjct: 1096 caggtttcacgacctccccaggattagatttaatgagaagacttctgccatccaagtgag 1037 Query: 501 ctaggacatattggaagccaca 522 || ||| ||||||||||||| Sbjct: 1036 tcagaacaaattggaagccaca 1015
>gb|AF154638.1| Nicotiana tabacum clone PR13 mRNA sequence Length = 722 Score = 58.0 bits (29), Expect = 3e-05 Identities = 81/97 (83%), Gaps = 1/97 (1%) Strand = Plus / Minus Query: 392 ggcctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggc-ttgac 450 ||||| |||||||| ||||| || || |||||||| ||||| || ||||||| ||||| Sbjct: 206 ggcctttggtacattggcattccttcatcgttgatagccttaaactgatcaggcattgac 147 Query: 451 aacttccccggggttggacttgatgagcagctgtctg 487 |||||| || || | ||||||||| |||||||||||| Sbjct: 146 aacttcgccaggttgggacttgatcagcagctgtctg 110
>gb|AY108749.1| Zea mays PCO080986 mRNA sequence Length = 1273 Score = 58.0 bits (29), Expect = 3e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 401 tacatgggcatgccctcgtcgttgatcgccttgaatgaatc 441 |||||||||||||| || |||||||| |||||||||||||| Sbjct: 1271 tacatgggcatgccttcatcgttgattgccttgaatgaatc 1231
>dbj|AB015601.1| Salix gilgiana SGJ3 mRNA for DnaJ homolog, complete cds Length = 1573 Score = 56.0 bits (28), Expect = 1e-04 Identities = 112/140 (80%) Strand = Plus / Minus Query: 392 ggcctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgaca 451 ||||| |||||||| ||||| || || || || || ||||||||| |||||||||||| Sbjct: 1109 ggcctttggtacatcggcattccttcatcatttatagccttgaattgatcaggcttgact 1050 Query: 452 acttccccggggttggacttgatgagcagctgtctgccatccaaatgagctaggacatat 511 ||||||||||| | || || || || ||||| || ||||||||||| | | ||| || Sbjct: 1049 acttccccgggttgagattttatcaggagctgccttccatccaaatgggtcaagacgaat 990 Query: 512 tggaagccacagagggcctc 531 ||||||||||| || ||||| Sbjct: 989 tggaagccacatagtgcctc 970
>emb|X77632.1|APLDJ2 A.porrum LDJ2 mRNA Length = 1509 Score = 54.0 bits (27), Expect = 5e-04 Identities = 54/63 (85%) Strand = Plus / Minus Query: 361 gaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgccctcgtc 420 |||||| ||||| ||||| || ||||||| |||||||||||||| ||||| || ||||| Sbjct: 1094 gaagtgaatgtaaagctttcctctcatgaatggcctctggtacatcggcattccttcgtc 1035 Query: 421 gtt 423 ||| Sbjct: 1034 gtt 1032 Score = 42.1 bits (21), Expect = 2.0 Identities = 51/61 (83%) Strand = Plus / Minus Query: 167 tcctcgtcataggcctcctgcgcctgctgctgctgttgcctccgcatctcttcctcaatg 226 ||||| || ||||||||||| || ||||| ||||| | ||||| |||||| ||||| ||| Sbjct: 1288 tcctcatcgtaggcctcctgagcttgctggtgctgcttcctcctcatctcctcctctatg 1229 Query: 227 t 227 | Sbjct: 1228 t 1228
>gb|AY244756.1| Solanum tuberosum clone PATMAGC326-SH AFLP marker sequence Length = 426 Score = 54.0 bits (27), Expect = 5e-04 Identities = 69/83 (83%) Strand = Plus / Minus Query: 354 ccaccgtgaagtggatgtagagcttgcccttcatgaagggcctctggtacatgggcatgc 413 |||| ||||| || ||||| || || ||||||||||| ||||||||||| | ||||| | Sbjct: 93 ccactgtgaaatgaatgtacagtttacccttcatgaatggcctctggtaaactggcattc 34 Query: 414 cctcgtcgttgatcgccttgaat 436 | || || ||||||||||||||| Sbjct: 33 cttcatcattgatcgccttgaat 11
>dbj|AB032545.1| Nicotiana tabacum B38 mRNA for DnaJ homolog, complete cds Length = 1453 Score = 54.0 bits (27), Expect = 5e-04 Identities = 78/95 (82%) Strand = Plus / Minus Query: 392 ggcctctggtacatgggcatgccctcgtcgttgatcgccttgaatgaatcaggcttgaca 451 ||||| |||||||| ||||| || || || || || ||||| ||| ||||||||||||| Sbjct: 966 ggcctttggtacattggcattccttcatcatttatggccttaaattgatcaggcttgaca 907 Query: 452 acttccccggggttggacttgatgagcagctgtct 486 ||||| || || | |||||| ||||| |||||||| Sbjct: 906 acttctccaggttgggacttaatgagtagctgtct 872
>gb|DQ228340.1| Solanum tuberosum clone 147D03 DnaJ-like protein mRNA, complete cds Length = 1492 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Minus Query: 439 atcaggcttgacaacttccccggggttggacttgatgagcagctg 483 |||||||||||||||||| ||||| | || |||||||| |||||| Sbjct: 1006 atcaggcttgacaacttctccgggttggggcttgatgatcagctg 962
>gb|DQ228331.1| Solanum tuberosum clone 140B12 DnaJ-like protein mRNA, complete cds Length = 1496 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Minus Query: 439 atcaggcttgacaacttccccggggttggacttgatgagcagctg 483 |||||||||||||||||| ||||| | || |||||||| |||||| Sbjct: 1010 atcaggcttgacaacttctccgggttggggcttgatgatcagctg 966
>gb|DQ200383.1| Solanum tuberosum clone 063B08 DnaJ-like protein mRNA, complete cds Length = 1515 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Minus Query: 439 atcaggcttgacaacttccccggggttggacttgatgagcagctg 483 |||||||||||||||||| ||||| | || |||||||| |||||| Sbjct: 1034 atcaggcttgacaacttctccgggttggggcttgatgatcagctg 990
>dbj|AB003138.1| Salix gilgiana premature mRNA for DnaJ homolog protein, complete cds Length = 2555 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Minus Query: 340 cgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcct 396 |||||| ||||| ||||| | || ||||| |||||||||||| ||||||||||||| Sbjct: 2088 cgagtcagggaacaccacattaaaatggatatagagcttgcccctcatgaagggcct 2032
>gb|DQ252506.1| Solanum tuberosum clone 085D01 DnaJ-like protein-like mRNA, complete cds Length = 1502 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Minus Query: 439 atcaggcttgacaacttccccggggttggacttgatgagcagctg 483 |||||||||||||||||| ||||| | || |||||||| |||||| Sbjct: 1001 atcaggcttgacaacttctccgggttggggcttgatgatcagctg 957
>dbj|AB003137.1| Salix gilgiana mRNA for DnaJ homolog protein, complete cds Length = 1610 Score = 50.1 bits (25), Expect = 0.008 Identities = 49/57 (85%) Strand = Plus / Minus Query: 340 cgagtcggggaaaaccaccgtgaagtggatgtagagcttgcccttcatgaagggcct 396 |||||| ||||| ||||| | || ||||| |||||||||||| ||||||||||||| Sbjct: 1149 cgagtcagggaacaccacattaaaatggatatagagcttgcccctcatgaagggcct 1093
>ref|XM_482383.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1491 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 133 caccctctgcccgccgccgcccg 155 ||||||||||||||||||||||| Sbjct: 938 caccctctgcccgccgccgcccg 916
>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome Length = 3046682 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 184 ctgcgcctgctgctgctgttgcc 206 ||||||||||||||||||||||| Sbjct: 144307 ctgcgcctgctgctgctgttgcc 144285
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 133 caccctctgcccgccgccgcccg 155 ||||||||||||||||||||||| Sbjct: 19739269 caccctctgcccgccgccgcccg 19739247
>dbj|AP005158.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OSJNBa0007M04 Length = 176293 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 133 caccctctgcccgccgccgcccg 155 ||||||||||||||||||||||| Sbjct: 68220 caccctctgcccgccgccgcccg 68198
>dbj|AK106356.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-A06, full insert sequence Length = 1491 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Minus Query: 133 caccctctgcccgccgccgcccg 155 ||||||||||||||||||||||| Sbjct: 938 caccctctgcccgccgccgcccg 916
>gb|AC107663.10| Mus musculus chromosome 13, clone RP23-99G9, complete sequence Length = 213163 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 480 gctgtctgccatccaaatgagc 501 |||||||||||||||||||||| Sbjct: 184957 gctgtctgccatccaaatgagc 184978
>ref|NM_168837.1| Drosophila melanogaster CG17233-RC, transcript variant C (CG17233), mRNA Length = 5471 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 184 ctgcgcctgctgctgctgttgc 205 |||||||||||||||||||||| Sbjct: 2519 ctgcgcctgctgctgctgttgc 2498
>ref|NM_168836.1| Drosophila melanogaster CG17233-RA, transcript variant A (CG17233), mRNA Length = 4595 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 184 ctgcgcctgctgctgctgttgc 205 |||||||||||||||||||||| Sbjct: 1643 ctgcgcctgctgctgctgttgc 1622
>ref|NM_140939.2| Drosophila melanogaster CG17233-RB, transcript variant B (CG17233), mRNA Length = 5079 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 184 ctgcgcctgctgctgctgttgc 205 |||||||||||||||||||||| Sbjct: 2127 ctgcgcctgctgctgctgttgc 2106
>gb|AC009839.10| Drosophila melanogaster 3L BAC RP98-16G9 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 185918 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 184 ctgcgcctgctgctgctgttgc 205 |||||||||||||||||||||| Sbjct: 27309 ctgcgcctgctgctgctgttgc 27330
>gb|AC009383.8| Drosophila melanogaster 3L BAC RP98-31C3 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 179283 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 184 ctgcgcctgctgctgctgttgc 205 |||||||||||||||||||||| Sbjct: 166446 ctgcgcctgctgctgctgttgc 166467
>gb|AY060466.1| Drosophila melanogaster SD04853 full length cDNA Length = 5112 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 184 ctgcgcctgctgctgctgttgc 205 |||||||||||||||||||||| Sbjct: 2127 ctgcgcctgctgctgctgttgc 2106
>gb|BT021948.1| Drosophila melanogaster LD13191 full insert cDNA Length = 2971 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Minus Query: 184 ctgcgcctgctgctgctgttgc 205 |||||||||||||||||||||| Sbjct: 1643 ctgcgcctgctgctgctgttgc 1622
>ref|XM_319781.2| Anopheles gambiae str. PEST ENSANGP00000023939 (ENSANGG00000023183), partial mRNA Length = 552 Score = 44.1 bits (22), Expect = 0.50 Identities = 25/26 (96%) Strand = Plus / Minus Query: 179 gcctcctgcgcctgctgctgctgttg 204 |||| ||||||||||||||||||||| Sbjct: 161 gcctgctgcgcctgctgctgctgttg 136
>gb|AE003514.4| Drosophila melanogaster chromosome 3L, section 71 of 83 of the complete sequence Length = 299903 Score = 44.1 bits (22), Expect = 0.50 Identities = 22/22 (100%) Strand = Plus / Plus Query: 184 ctgcgcctgctgctgctgttgc 205 |||||||||||||||||||||| Sbjct: 209463 ctgcgcctgctgctgctgttgc 209484
>ref|NM_178332.1| Homo sapiens gonadotropin-releasing hormone 2 (GNRH2), transcript variant 2, mRNA Length = 399 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 177 aggcctcctgcgcctgctgctgctg 201 ||||||||||| ||||||||||||| Sbjct: 69 aggcctcctgctcctgctgctgctg 93
>ref|NM_178331.1| Homo sapiens gonadotropin-releasing hormone 2 (GNRH2), transcript variant 3, mRNA Length = 402 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 177 aggcctcctgcgcctgctgctgctg 201 ||||||||||| ||||||||||||| Sbjct: 69 aggcctcctgctcctgctgctgctg 93
>ref|NM_001501.1| Homo sapiens gonadotropin-releasing hormone 2 (GNRH2), transcript variant 1, mRNA Length = 423 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 177 aggcctcctgcgcctgctgctgctg 201 ||||||||||| ||||||||||||| Sbjct: 69 aggcctcctgctcctgctgctgctg 93
>gb|AY484428.1| Mus musculus sodium-dependent monocarboxylate transporter (Slc5a8) mRNA, complete cds Length = 5346 Score = 42.1 bits (21), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 8 atatncatatactagcaccaaagg 31 |||| ||||||||||||||||||| Sbjct: 2510 atatacatatactagcaccaaagg 2487
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 168 cctcgtcataggcctcctgcg 188 ||||||||||||||||||||| Sbjct: 182192 cctcgtcataggcctcctgcg 182172
>gb|AC011251.6| Drosophila melanogaster clone BACR09F10, complete sequence Length = 173988 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 tgcgcctgctgctgctgttgc 205 ||||||||||||||||||||| Sbjct: 28681 tgcgcctgctgctgctgttgc 28701
>ref|XM_368171.1| Magnaporthe grisea 70-15 chromosome VI hypothetical protein (MG01073.4) partial mRNA Length = 2916 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 178 ggcctcctgcgcctgctgctgctgt 202 |||| |||||||||||||||||||| Sbjct: 2619 ggccgcctgcgcctgctgctgctgt 2595
>gb|AC138260.7| Mus musculus chromosome 6, clone RP23-247I19, complete sequence Length = 197686 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 181 ctcctgcgcctgctgctgctgttgc 205 ||||||| ||||||||||||||||| Sbjct: 181403 ctcctgctcctgctgctgctgttgc 181379
>gb|BC069362.1| Homo sapiens gonadotropin-releasing hormone 2, transcript variant 1, mRNA (cDNA clone MGC:97397 IMAGE:7262673), complete cds Length = 422 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 177 aggcctcctgcgcctgctgctgctg 201 ||||||||||| ||||||||||||| Sbjct: 68 aggcctcctgctcctgctgctgctg 92
>gb|BC017691.1| Mus musculus solute carrier family 5 (iodide transporter), member 8, mRNA (cDNA clone MGC:19357 IMAGE:4239161), complete cds Length = 5351 Score = 42.1 bits (21), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 8 atatncatatactagcaccaaagg 31 |||| ||||||||||||||||||| Sbjct: 2462 atatacatatactagcaccaaagg 2439
>ref|NM_019498.2| Mus musculus olfactomedin 1 (Olfm1), transcript variant 1, mRNA Length = 2727 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 135 ccctctgcccgccgccgcccg 155 ||||||||||||||||||||| Sbjct: 145 ccctctgcccgccgccgcccg 125
>ref|NM_001038612.1| Mus musculus olfactomedin 1 (Olfm1), transcript variant 2, mRNA Length = 1048 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 135 ccctctgcccgccgccgcccg 155 ||||||||||||||||||||| Sbjct: 145 ccctctgcccgccgccgcccg 125
>gb|AC165365.3| Mus musculus BAC clone RP23-28N13 from chromosome 6, complete sequence Length = 238262 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 181 ctcctgcgcctgctgctgctgttgc 205 ||||||| ||||||||||||||||| Sbjct: 138084 ctcctgctcctgctgctgctgttgc 138060
>gb|AY702654.1| Chlamydomonas reinhardtii Set3p (Set3) mRNA, complete cds Length = 3059 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ctgcgcctgctgctgctgttg 204 ||||||||||||||||||||| Sbjct: 2826 ctgcgcctgctgctgctgttg 2806
>ref|XM_001001565.1| PREDICTED: Mus musculus solute carrier family 5 (iodide transporter), member 8 (Slc5a8), mRNA Length = 2201 Score = 42.1 bits (21), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 8 atatncatatactagcaccaaagg 31 |||| ||||||||||||||||||| Sbjct: 989 atatacatatactagcaccaaagg 966
>ref|XM_983991.1| PREDICTED: Mus musculus SRY-box containing gene 30 (Sox30), mRNA Length = 2196 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 gctgctgctgttgcctccgca 212 ||||||||||||||||||||| Sbjct: 627 gctgctgctgttgcctccgca 647
>ref|XM_756903.1| Ustilago maydis 521 hypothetical protein (UM05849.1) partial mRNA Length = 3156 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 181 ctcctgcgcctgctgctgctg 201 ||||||||||||||||||||| Sbjct: 2737 ctcctgcgcctgctgctgctg 2717
>ref|XM_746258.1| Aspergillus fumigatus Af293 hypothetical protein (Afu4g14820) partial mRNA Length = 1437 Score = 42.1 bits (21), Expect = 2.0 Identities = 30/33 (90%) Strand = Plus / Minus Query: 181 ctcctgcgcctgctgctgctgttgcctccgcat 213 ||||||| ||||||||||||| ||| ||||||| Sbjct: 522 ctcctgctcctgctgctgctgctgcatccgcat 490
>gb|AC124504.3| Mus musculus BAC clone RP23-418E15 from chromosome 10, complete sequence Length = 204133 Score = 42.1 bits (21), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 8 atatncatatactagcaccaaagg 31 |||| ||||||||||||||||||| Sbjct: 113780 atatacatatactagcaccaaagg 113803
>emb|AL121905.23|HSDJ534B8 Human DNA sequence from clone RP4-534B8 on chromosome 20 Contains the 3' end of the PTPRA gene for protein tyrosine phosphatase receptor type A, the GNRH2 gene for gonadotropin-releasing hormone 2, a novel gene and two CpG islands, complete sequence Length = 126679 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 177 aggcctcctgcgcctgctgctgctg 201 ||||||||||| ||||||||||||| Sbjct: 121853 aggcctcctgctcctgctgctgctg 121877
>ref|XM_781569.1| PREDICTED: Strongylocentrotus purpuratus similar to hydroxysteroid (17-beta) dehydrogenase 4 (LOC581580), mRNA Length = 2151 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 371 tagagcttgcccttcatgaag 391 ||||||||||||||||||||| Sbjct: 2150 tagagcttgcccttcatgaag 2130
>emb|X94301.1|STDNAJ S.tuberosum mRNA for DnaJ protein Length = 1421 Score = 42.1 bits (21), Expect = 2.0 Identities = 39/45 (86%) Strand = Plus / Minus Query: 439 atcaggcttgacaacttccccggggttggacttgatgagcagctg 483 |||||||||||||||||| |||| | || |||||||| |||||| Sbjct: 986 atcaggcttgacaacttctccggcttggggcttgatgatcagctg 942
>emb|AJ000977.1|RSCHEMOOP Rhodobacter sphaeroides DNA for second chemotaxis operon and flanking genes Length = 10434 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 168 cctcgtcataggcctcctgcg 188 ||||||||||||||||||||| Sbjct: 9476 cctcgtcataggcctcctgcg 9456
>emb|AL645948.10| Mouse DNA sequence from clone RP23-298M7 on chromosome 11 Contains an H+ transporting ATP synthase mitochondrial F0 complex subunit g (Atp5l) pseudogene, a ferritin light chain 1 (Ftl1) pseudogene, three novel genes, the gene for a novel ENTH domain containing protein, the 5' end of the Sox30 gene for SRY-box containing gene 30 and three Cpg islands, complete sequence Length = 207877 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 gctgctgctgttgcctccgca 212 ||||||||||||||||||||| Sbjct: 204959 gctgctgctgttgcctccgca 204979
>ref|NM_167744.3| Drosophila melanogaster tweety CG1693-RB, transcript variant B (tty), mRNA Length = 2977 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 tgcgcctgctgctgctgttgc 205 ||||||||||||||||||||| Sbjct: 1995 tgcgcctgctgctgctgttgc 1975
>ref|NM_080712.5| Drosophila melanogaster tweety CG1693-RA, transcript variant A (tty), mRNA Length = 3890 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 tgcgcctgctgctgctgttgc 205 ||||||||||||||||||||| Sbjct: 1995 tgcgcctgctgctgctgttgc 1975
>gb|AY084210.1| Drosophila melanogaster SD08336 full insert cDNA Length = 3714 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 184 ctgcgcctgctgctgctgttg 204 ||||||||||||||||||||| Sbjct: 1329 ctgcgcctgctgctgctgttg 1309
>dbj|AK132487.1| Mus musculus 10 days neonate skin cDNA, RIKEN full-length enriched library, clone:4732460N23 product:solute carrier family 5 (iodide transporter), member 8, full insert sequence Length = 3491 Score = 42.1 bits (21), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 8 atatncatatactagcaccaaagg 31 |||| ||||||||||||||||||| Sbjct: 671 atatacatatactagcaccaaagg 648
>dbj|AK136457.1| Mus musculus adult male colon cDNA, RIKEN full-length enriched library, clone:9030417E11 product:solute carrier family 5 (iodide transporter), member 8, full insert sequence Length = 3103 Score = 42.1 bits (21), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 8 atatncatatactagcaccaaagg 31 |||| ||||||||||||||||||| Sbjct: 2520 atatacatatactagcaccaaagg 2497
>gb|AC084265.4| Homo sapiens chromosome 2, clone CTB-2367F13, complete sequence Length = 127066 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 197 tgctgttgcctccgcatctcttcct 221 |||||||||||| |||||||||||| Sbjct: 55701 tgctgttgcctcagcatctcttcct 55725
>gb|AC069282.6| Homo sapiens BAC clone RP11-61L9 from 7, complete sequence Length = 175938 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 361 gaagtggatgtagagcttgcccttc 385 |||||||||||||||| |||||||| Sbjct: 133937 gaagtggatgtagagcctgcccttc 133913
>ref|NM_145423.1| Mus musculus solute carrier family 5 (iodide transporter), member 8 (Slc5a8), mRNA Length = 5351 Score = 42.1 bits (21), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 8 atatncatatactagcaccaaagg 31 |||| ||||||||||||||||||| Sbjct: 2462 atatacatatactagcaccaaagg 2439
>gb|AF351820.1|F351812S09 Homo sapiens sterolin-2 (ABCG8) gene, exon 9 Length = 685 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 197 tgctgttgcctccgcatctcttcct 221 |||||||||||| |||||||||||| Sbjct: 272 tgctgttgcctcagcatctcttcct 296
>dbj|AK039927.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430032A05 product:weakly similar to SODIUM/IODIDE COTRANSPORTER (NA(+)/I(-) COTRANSPORTER) (SODIUM-IODIDE SYMPORTER) (NA+/I-SYMPORTER) [Homo sapiens], full insert sequence Length = 4253 Score = 42.1 bits (21), Expect = 2.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 8 atatncatatactagcaccaaagg 31 |||| ||||||||||||||||||| Sbjct: 2339 atatacatatactagcaccaaagg 2316
>emb|BX004816.11| Zebrafish DNA sequence from clone DKEY-30G5 in linkage group 3, complete sequence Length = 231341 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 471 tgatgagcagctgtctgccat 491 ||||||||||||||||||||| Sbjct: 159218 tgatgagcagctgtctgccat 159238
>gb|AC108476.5| Homo sapiens BAC clone RP11-1413K20 from 2, complete sequence Length = 139342 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 197 tgctgttgcctccgcatctcttcct 221 |||||||||||| |||||||||||| Sbjct: 53935 tgctgttgcctcagcatctcttcct 53959
>gb|AY005801.1| Mus musculus Sox-30 mRNA, complete cds Length = 3074 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 gctgctgctgttgcctccgca 212 ||||||||||||||||||||| Sbjct: 412 gctgctgctgttgcctccgca 432
>gb|S58775.1| Solanum tuberosum tuber-induction protein mRNA, partial cds Length = 950 Score = 42.1 bits (21), Expect = 2.0 Identities = 39/45 (86%) Strand = Plus / Minus Query: 439 atcaggcttgacaacttccccggggttggacttgatgagcagctg 483 |||||||||||||||||| |||| | || |||||||| |||||| Sbjct: 629 atcaggcttgacaacttctccggcttggggcttgatgatcagctg 585
>gb|AY108160.1| Zea mays PCO119794 mRNA sequence Length = 1849 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Minus Query: 245 gtctcctcgcactcgtctagctccatgtc 273 ||||||||||||| ||| ||||||||||| Sbjct: 1294 gtctcctcgcactggtccagctccatgtc 1266
>gb|AF184227.1|AF184227 Drosophila melanogaster clone LD23194 tty (tty) mRNA, complete cds Length = 3863 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 185 tgcgcctgctgctgctgttgc 205 ||||||||||||||||||||| Sbjct: 1971 tgcgcctgctgctgctgttgc 1951
>gb|AE003568.4| Drosophila melanogaster chromosome X, section 71 of 74 of the complete sequence Length = 315815 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 tgcgcctgctgctgctgttgc 205 ||||||||||||||||||||| Sbjct: 128661 tgcgcctgctgctgctgttgc 128681
>gb|AF017777.1|AF017777 Drosophila melanogaster tweety (tty), flightless (fli), dodo (dod), penguin (pen), small optic lobes (sol), innocent bystander (iby), waclaw (waw), bobby sox (bbx), sluggish (slg), helicase (hlc), misato (mst), and la costa (lcs) genes, complete cds Length = 66669 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 185 tgcgcctgctgctgctgttgc 205 ||||||||||||||||||||| Sbjct: 2620 tgcgcctgctgctgctgttgc 2640
>gb|AF036330.1|AF036330 Homo sapiens gonadotropin-releasing hormone precursor, second form (GnRH-II) mRNA, partial cds Length = 391 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 177 aggcctcctgcgcctgctgctgctg 201 ||||||||||| ||||||||||||| Sbjct: 69 aggcctcctgctcctgctgctgctg 93
>gb|AF036329.1|AF036329 Homo sapiens gonadotropin-releasing hormone precursor, second form (GnRH-II) gene, complete cds Length = 4498 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 177 aggcctcctgcgcctgctgctgctg 201 ||||||||||| ||||||||||||| Sbjct: 2122 aggcctcctgctcctgctgctgctg 2146
>ref|NM_173384.1| Mus musculus SRY-box containing gene 30 (Sox30), mRNA Length = 3074 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 192 gctgctgctgttgcctccgca 212 ||||||||||||||||||||| Sbjct: 412 gctgctgctgttgcctccgca 432
>gb|AC171736.1| Lycopersicon esculentum chromosome 11 clone C11HBa0323E19, complete sequence Length = 141216 Score = 42.1 bits (21), Expect = 2.0 Identities = 48/57 (84%) Strand = Plus / Plus Query: 380 cccttcatgaagggcctctggtacatgggcatgccctcgtcgttgatcgccttgaat 436 ||||||||||| ||||||||||| | ||||| || || || ||||| ||||||||| Sbjct: 107547 cccttcatgaatggcctctggtaaactggcattccttcatcattgatagccttgaat 107603
>emb|AL731778.12| Mouse DNA sequence from clone RP23-475B13 on chromosome 2, complete sequence Length = 211430 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 135 ccctctgcccgccgccgcccg 155 ||||||||||||||||||||| Sbjct: 175172 ccctctgcccgccgccgcccg 175152
>ref|NM_188447.1| Oryza sativa (japonica cultivar-group), Ozsa8142 predicted mRNA Length = 1125 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 130 ctgcaccctctgcccgccgccgcc 153 |||| ||||||||||||||||||| Sbjct: 105 ctgcgccctctgcccgccgccgcc 82
>ref|XM_475149.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 252 cgcactcgtctagctccatgtctg 275 |||||||||| ||||||||||||| Sbjct: 545 cgcactcgtccagctccatgtctg 522
>ref|NM_186999.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1689 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 180 cctcctgcgcctgctgctgctgtt 203 |||||||| ||||||||||||||| Sbjct: 1570 cctcctgctcctgctgctgctgtt 1593
>ref|NM_022384.1| Rattus norvegicus achaete-scute complex homolog-like 1 (Drosophila) (Ascl1), mRNA Length = 1656 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gcgcctgctgctgctgttgc 205 |||||||||||||||||||| Sbjct: 906 gcgcctgctgctgctgttgc 887
>gb|AC008203.8| Drosophila melanogaster clone BACR29F06, complete sequence Length = 174729 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 tgcgcctgctgctgctgttg 204 |||||||||||||||||||| Sbjct: 124993 tgcgcctgctgctgctgttg 125012
>gb|AC007694.7| Drosophila melanogaster clone BACR17O24, complete sequence Length = 193722 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 ctatatcgtaggccatcgtc 247 |||||||||||||||||||| Sbjct: 43851 ctatatcgtaggccatcgtc 43870
>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome Length = 2560265 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 418 gtcgttgatcgccttgaatgaatc 441 |||||||||| ||||||||||||| Sbjct: 488988 gtcgttgatcaccttgaatgaatc 489011
>ref|XM_879724.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 10 (LOC615175), mRNA Length = 2598 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 200 tgttgcctccgcatctcttcctca 223 ||||||| |||||||||||||||| Sbjct: 1182 tgttgccgccgcatctcttcctca 1159
>ref|XM_879698.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 9 (LOC615175), mRNA Length = 2621 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 200 tgttgcctccgcatctcttcctca 223 ||||||| |||||||||||||||| Sbjct: 1205 tgttgccgccgcatctcttcctca 1182
>ref|XM_867114.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 1 (LOC615175), mRNA Length = 2204 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 200 tgttgcctccgcatctcttcctca 223 ||||||| |||||||||||||||| Sbjct: 1182 tgttgccgccgcatctcttcctca 1159
>ref|XM_879637.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 8 (LOC615175), mRNA Length = 2525 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 200 tgttgcctccgcatctcttcctca 223 ||||||| |||||||||||||||| Sbjct: 1109 tgttgccgccgcatctcttcctca 1086
>ref|XM_879607.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 7 (LOC615175), mRNA Length = 2400 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 200 tgttgcctccgcatctcttcctca 223 ||||||| |||||||||||||||| Sbjct: 984 tgttgccgccgcatctcttcctca 961
>ref|XM_879574.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 6 (LOC615175), mRNA Length = 2495 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 200 tgttgcctccgcatctcttcctca 223 ||||||| |||||||||||||||| Sbjct: 1182 tgttgccgccgcatctcttcctca 1159
>ref|XM_879515.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 4 (LOC615175), mRNA Length = 2080 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 200 tgttgcctccgcatctcttcctca 223 ||||||| |||||||||||||||| Sbjct: 664 tgttgccgccgcatctcttcctca 641
>ref|XM_879484.1| PREDICTED: Bos taurus similar to non-POU domain containing, octamer-binding, transcript variant 3 (LOC615175), mRNA Length = 1520 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 200 tgttgcctccgcatctcttcctca 223 ||||||| |||||||||||||||| Sbjct: 104 tgttgccgccgcatctcttcctca 81
>gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0025P09, complete sequence Length = 167318 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 252 cgcactcgtctagctccatgtctg 275 |||||||||| ||||||||||||| Sbjct: 94104 cgcactcgtccagctccatgtctg 94081
>ref|XM_706548.1| Candida albicans SC5314 hypothetical protein (CaO19.13710), mRNA Length = 2079 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 438 aatcaggcttgacaacttcc 457 |||||||||||||||||||| Sbjct: 456 aatcaggcttgacaacttcc 475
>ref|XM_706479.1| Candida albicans SC5314 hypothetical protein (CaO19.6353), mRNA Length = 2079 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 438 aatcaggcttgacaacttcc 457 |||||||||||||||||||| Sbjct: 456 aatcaggcttgacaacttcc 475
>gb|AC099640.6| Mus musculus chromosome 1, clone RP24-339K18, complete sequence Length = 177962 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 140 tgcccgccgccgcccggcat 159 |||||||||||||||||||| Sbjct: 14548 tgcccgccgccgcccggcat 14529
>ref|XM_853285.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 13 (LOC612773), mRNA Length = 2290 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 199 ctgttgcctccgcatctcttcctc 222 |||||||| ||||||||||||||| Sbjct: 1274 ctgttgccgccgcatctcttcctc 1251
>ref|XM_853248.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 12 (LOC612773), mRNA Length = 2382 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 199 ctgttgcctccgcatctcttcctc 222 |||||||| ||||||||||||||| Sbjct: 1274 ctgttgccgccgcatctcttcctc 1251
>ref|XM_853207.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 11 (LOC612773), mRNA Length = 1616 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 199 ctgttgcctccgcatctcttcctc 222 |||||||| ||||||||||||||| Sbjct: 1274 ctgttgccgccgcatctcttcctc 1251
>ref|XM_853123.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 9 (LOC612773), mRNA Length = 2385 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 199 ctgttgcctccgcatctcttcctc 222 |||||||| ||||||||||||||| Sbjct: 1174 ctgttgccgccgcatctcttcctc 1151
>ref|XM_853086.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 8 (LOC612773), mRNA Length = 2550 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 199 ctgttgcctccgcatctcttcctc 222 |||||||| ||||||||||||||| Sbjct: 1339 ctgttgccgccgcatctcttcctc 1316
>ref|XM_853047.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 7 (LOC612773), mRNA Length = 2396 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 199 ctgttgcctccgcatctcttcctc 222 |||||||| ||||||||||||||| Sbjct: 1185 ctgttgccgccgcatctcttcctc 1162
>ref|XM_853008.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 6 (LOC612773), mRNA Length = 2215 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 199 ctgttgcctccgcatctcttcctc 222 |||||||| ||||||||||||||| Sbjct: 1004 ctgttgccgccgcatctcttcctc 981
>ref|XM_852963.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 5 (LOC612773), mRNA Length = 1777 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 199 ctgttgcctccgcatctcttcctc 222 |||||||| ||||||||||||||| Sbjct: 566 ctgttgccgccgcatctcttcctc 543
>ref|XM_852923.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 4 (LOC612773), mRNA Length = 1333 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 199 ctgttgcctccgcatctcttcctc 222 |||||||| ||||||||||||||| Sbjct: 122 ctgttgccgccgcatctcttcctc 99
>ref|XM_844017.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 2 (LOC612773), mRNA Length = 2485 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 199 ctgttgcctccgcatctcttcctc 222 |||||||| ||||||||||||||| Sbjct: 1274 ctgttgccgccgcatctcttcctc 1251
>ref|XM_987520.1| PREDICTED: Mus musculus zinc finger, CCHC domain containing 2, transcript variant 2 (Zcchc2), mRNA Length = 6658 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 140 tgcccgccgccgcccggcat 159 |||||||||||||||||||| Sbjct: 635 tgcccgccgccgcccggcat 616
>ref|XM_129972.7| PREDICTED: Mus musculus zinc finger, CCHC domain containing 2, transcript variant 1 (Zcchc2), mRNA Length = 6658 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 140 tgcccgccgccgcccggcat 159 |||||||||||||||||||| Sbjct: 635 tgcccgccgccgcccggcat 616
>ref|XM_854653.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 3 (LOC482706), mRNA Length = 2338 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 199 ctgttgcctccgcatctcttcctc 222 |||||||| ||||||||||||||| Sbjct: 1108 ctgttgccgccgcatctcttcctc 1085
>ref|XM_539822.2| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding, transcript variant 2 (LOC482706), mRNA Length = 1646 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 199 ctgttgcctccgcatctcttcctc 222 |||||||| ||||||||||||||| Sbjct: 1108 ctgttgccgccgcatctcttcctc 1085
>ref|XM_846065.1| PREDICTED: Canis familiaris similar to non-POU domain containing, octamer-binding (LOC608914), mRNA Length = 1408 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 199 ctgttgcctccgcatctcttcctc 222 |||||||| ||||||||||||||| Sbjct: 1141 ctgttgccgccgcatctcttcctc 1118
>gb|AC007316.4| Homo sapiens BAC clone RP11-356B17 from 7, complete sequence Length = 106392 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 190 ctgctgctgctgttgcctcc 209 |||||||||||||||||||| Sbjct: 84569 ctgctgctgctgttgcctcc 84588
>gb|BC105532.1| Bos taurus similar to non-POU domain containing, octamer-binding, mRNA (cDNA clone MGC:128851 IMAGE:8119639), complete cds Length = 2580 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 200 tgttgcctccgcatctcttcctca 223 ||||||| |||||||||||||||| Sbjct: 1125 tgttgccgccgcatctcttcctca 1102
>gb|BT009348.1| Triticum aestivum clone wlm96.pk0006.b11:fis, full insert mRNA sequence Length = 850 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 459 cggggttggacttgatgagcagct 482 ||||||||||||||| |||||||| Sbjct: 202 cggggttggacttgaggagcagct 179
>emb|BX055061.1|CNS09END Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC33CA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 tgcgcctgctgctgctgttg 204 |||||||||||||||||||| Sbjct: 186 tgcgcctgctgctgctgttg 167
>emb|BX572599.1| Rhodopseudomonas palustris CGA009 complete genome; segment 7/16 Length = 349142 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 414 cctcgtcgttgatcgccttg 433 |||||||||||||||||||| Sbjct: 290750 cctcgtcgttgatcgccttg 290769
>ref|NM_142975.2| Drosophila melanogaster CG5669-RA (CG5669), mRNA Length = 3493 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 tgcgcctgctgctgctgttg 204 |||||||||||||||||||| Sbjct: 1478 tgcgcctgctgctgctgttg 1459
>ref|NM_142222.1| Drosophila melanogaster CG5302-RA (CG5302), mRNA Length = 1908 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 228 ctatatcgtaggccatcgtc 247 |||||||||||||||||||| Sbjct: 1363 ctatatcgtaggccatcgtc 1344
>ref|NM_137372.2| Drosophila melanogaster CG6520-RA (CG6520), mRNA Length = 864 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 181 ctcctgcgcctgctgctgct 200 |||||||||||||||||||| Sbjct: 161 ctcctgcgcctgctgctgct 142
>gb|AC105225.5| Homo sapiens chromosome 8, clone RP11-775E18, complete sequence Length = 135609 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 534 tcagggtcagggtgtgctca 553 |||||||||||||||||||| Sbjct: 34530 tcagggtcagggtgtgctca 34511
>gb|AY089533.1| Drosophila melanogaster LD04007 full insert cDNA Length = 3511 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 tgcgcctgctgctgctgttg 204 |||||||||||||||||||| Sbjct: 1478 tgcgcctgctgctgctgttg 1459
>gb|AY071537.1| Drosophila melanogaster RE57682 full length cDNA Length = 866 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 181 ctcctgcgcctgctgctgct 200 |||||||||||||||||||| Sbjct: 163 ctcctgcgcctgctgctgct 144
>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome Length = 3561584 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 177 aggcctcctgcgcctgctgc 196 |||||||||||||||||||| Sbjct: 2202104 aggcctcctgcgcctgctgc 2202123
>gb|AC109037.6| Rattus norvegicus 18 BAC CH230-178G23 (Children's Hospital Oakland Research Institute) complete sequence Length = 208650 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 190 ctgctgctgctgttgcctcc 209 |||||||||||||||||||| Sbjct: 7940 ctgctgctgctgttgcctcc 7921
>dbj|AK046562.1| Mus musculus 4 days neonate male adipose cDNA, RIKEN full-length enriched library, clone:B430011M18 product:hypothetical PX (Bem1/NCF1/PI3K) domain/ATP synthase alpha and beta subunit, central region containing protein, full insert sequence Length = 2079 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 140 tgcccgccgccgcccggcat 159 |||||||||||||||||||| Sbjct: 636 tgcccgccgccgcccggcat 617
>gb|AC153514.8| Mus musculus 10 BAC RP23-406O24 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 189633 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 484 tctgccatccaaatgagcta 503 |||||||||||||||||||| Sbjct: 121951 tctgccatccaaatgagcta 121970
>gb|AC008004.5|AC008004 Drosophila melanogaster, chromosome 2R, region 54B-54C, BAC clone BACR21A09, complete sequence Length = 175506 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 181 ctcctgcgcctgctgctgct 200 |||||||||||||||||||| Sbjct: 67392 ctcctgcgcctgctgctgct 67411
>emb|AL112780.1|CNS01AD0 Botrytis cinerea strain T4 cDNA library Length = 660 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 457 cccggggttggacttgatga 476 |||||||||||||||||||| Sbjct: 506 cccggggttggacttgatga 525
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 180 cctcctgcgcctgctgctgctgtt 203 |||||||| ||||||||||||||| Sbjct: 23694966 cctcctgctcctgctgctgctgtt 23694989
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 252 cgcactcgtctagctccatgtctg 275 |||||||||| ||||||||||||| Sbjct: 17834150 cgcactcgtccagctccatgtctg 17834127
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 130 ctgcaccctctgcccgccgccgcc 153 |||| ||||||||||||||||||| Sbjct: 6318557 ctgcgccctctgcccgccgccgcc 6318534
>gb|AC015599.5|AC015599 Homo sapiens chromosome , clone RP11-45B19, complete sequence Length = 162607 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 534 tcagggtcagggtgtgctca 553 |||||||||||||||||||| Sbjct: 14439 tcagggtcagggtgtgctca 14420
>gb|AC007647.6|AC007647 Drosophila melanogaster, chromosome 3R, region 89B-89C, BAC clone BACR05P04, complete sequence Length = 194335 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tcctgcgcctgctgctgctg 201 |||||||||||||||||||| Sbjct: 175723 tcctgcgcctgctgctgctg 175704
>gb|AC011615.4|AC011615 Drosophila melanogaster, chromosome 3R, region 89D-89D, BAC clone BACR01H23, complete sequence Length = 199653 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tcctgcgcctgctgctgctg 201 |||||||||||||||||||| Sbjct: 40864 tcctgcgcctgctgctgctg 40845
>ref|XM_341619.2| PREDICTED: Rattus norvegicus a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19 (predicted) (Adamts19_predicted), mRNA Length = 5043 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 190 ctgctgctgctgttgcctcc 209 |||||||||||||||||||| Sbjct: 939 ctgctgctgctgttgcctcc 958
>ref|XM_579457.1| PREDICTED: Rattus norvegicus achaete-scute complex homolog-like 1 (Drosophila) (Ascl1), mRNA Length = 1491 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gcgcctgctgctgctgttgc 205 |||||||||||||||||||| Sbjct: 736 gcgcctgctgctgctgttgc 717
>ref|XM_345249.2| PREDICTED: Rattus norvegicus similar to KIAA0460 protein (predicted) (LOC365869), mRNA Length = 4303 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 190 ctgctgctgctgttgcctcc 209 |||||||||||||||||||| Sbjct: 4001 ctgctgctgctgttgcctcc 3982
>gb|AC135075.5| Homo sapiens chromosome 8, clone RP11-557G24, complete sequence Length = 72016 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 534 tcagggtcagggtgtgctca 553 |||||||||||||||||||| Sbjct: 46939 tcagggtcagggtgtgctca 46920
>gb|AC011455.6|AC011455 Homo sapiens chromosome 19 clone CTC-360G5, complete sequence Length = 148876 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 121 ctgggcgcactgcaccctctgccc 144 |||||| ||||||||||||||||| Sbjct: 78423 ctgggctcactgcaccctctgccc 78400
>dbj|AP001633.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0515G01 Length = 175072 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 130 ctgcaccctctgcccgccgccgcc 153 |||| ||||||||||||||||||| Sbjct: 89623 ctgcgccctctgcccgccgccgcc 89600
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 142 cccgccgccgcccggcatat 161 |||||||||||||||||||| Sbjct: 251519 cccgccgccgcccggcatat 251538
>dbj|AK173248.1| Mus musculus mRNA for mKIAA1744 protein Length = 6369 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 140 tgcccgccgccgcccggcat 159 |||||||||||||||||||| Sbjct: 352 tgcccgccgccgcccggcat 333
>dbj|AP003803.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1060_D03 Length = 102178 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 180 cctcctgcgcctgctgctgctgtt 203 |||||||| ||||||||||||||| Sbjct: 39580 cctcctgctcctgctgctgctgtt 39603
>dbj|AK119642.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-F10, full insert sequence Length = 1452 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 130 ctgcaccctctgcccgccgccgcc 153 |||| ||||||||||||||||||| Sbjct: 168 ctgcgccctctgcccgccgccgcc 145
>dbj|AK119598.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-117-E01, full insert sequence Length = 1520 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 130 ctgcaccctctgcccgccgccgcc 153 |||| ||||||||||||||||||| Sbjct: 165 ctgcgccctctgcccgccgccgcc 142
>emb|AJ234591.1|HVU234591 Hordeum vulgare genomic DNA fragment; clone MWG0851.uni Length = 611 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 184 ctgcgcctgctgctgctgttgcct 207 |||| ||||||||||||||||||| Sbjct: 367 ctgctcctgctgctgctgttgcct 390
>ref|XM_308780.2| Anopheles gambiae str. PEST ENSANGP00000007677 (ENSANGG00000005786), partial mRNA Length = 4758 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tcctgcgcctgctgctgctg 201 |||||||||||||||||||| Sbjct: 1778 tcctgcgcctgctgctgctg 1759
>dbj|AK071269.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023088L08, full insert sequence Length = 1690 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 180 cctcctgcgcctgctgctgctgtt 203 |||||||| ||||||||||||||| Sbjct: 1571 cctcctgctcctgctgctgctgtt 1594
>ref|NM_208127.1| Eremothecium gossypii ABL173Cp (ABL173C), mRNA Length = 909 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 477 gcagctgtctgccatccaaa 496 |||||||||||||||||||| Sbjct: 175 gcagctgtctgccatccaaa 156
>dbj|AK061118.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-207-F05, full insert sequence Length = 1577 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 130 ctgcaccctctgcccgccgccgcc 153 |||| ||||||||||||||||||| Sbjct: 168 ctgcgccctctgcccgccgccgcc 145
>dbj|AK059088.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-022-B07, full insert sequence Length = 1691 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 130 ctgcaccctctgcccgccgccgcc 153 |||| ||||||||||||||||||| Sbjct: 428 ctgcgccctctgcccgccgccgcc 405
>gb|AY107770.1| Zea mays PCO087426 mRNA sequence Length = 1494 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gcgcctgctgctgctgttgc 205 |||||||||||||||||||| Sbjct: 381 gcgcctgctgctgctgttgc 362
>gb|AF080067.1|AF080067 Oryctolagus cuniculus sodium-dependent multi-vitamin transporter (SMVT) mRNA, complete cds Length = 3137 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 512 tggaagccacagagggcctc 531 |||||||||||||||||||| Sbjct: 2718 tggaagccacagagggcctc 2737
>gb|AE003746.3| Drosophila melanogaster chromosome 3R, section 84 of 118 of the complete sequence Length = 218498 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 185 tgcgcctgctgctgctgttg 204 |||||||||||||||||||| Sbjct: 193610 tgcgcctgctgctgctgttg 193629
>emb|X53725.1|RNMASH1 Rat MASH-1 mRNA expressed in neuronal precursor cells (mammalian achaete-scute homologue) Length = 1656 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 186 gcgcctgctgctgctgttgc 205 |||||||||||||||||||| Sbjct: 906 gcgcctgctgctgctgttgc 887
>gb|AE003713.3| Drosophila melanogaster chromosome 3R, section 51 of 118 of the complete sequence Length = 226561 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 182 tcctgcgcctgctgctgctg 201 |||||||||||||||||||| Sbjct: 39032 tcctgcgcctgctgctgctg 39013
>gb|AE003709.4| Drosophila melanogaster chromosome 3R, section 47 of 118 of the complete sequence Length = 222815 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 228 ctatatcgtaggccatcgtc 247 |||||||||||||||||||| Sbjct: 204859 ctatatcgtaggccatcgtc 204840
>gb|AE003803.4| Drosophila melanogaster chromosome 2R, section 47 of 73 of the complete sequence Length = 290783 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 181 ctcctgcgcctgctgctgct 200 |||||||||||||||||||| Sbjct: 210409 ctcctgcgcctgctgctgct 210428
>emb|AL133445.4|CNS01DV1 Human chromosome 14 DNA sequence BAC R-1046B16 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 190946 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 190 ctgctgctgctgttgcctcc 209 |||||||||||||||||||| Sbjct: 168377 ctgctgctgctgttgcctcc 168396
>gb|AC132123.3| Mus musculus BAC clone RP24-79F8 from 1, complete sequence Length = 214923 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 140 tgcccgccgccgcccggcat 159 |||||||||||||||||||| Sbjct: 19657 tgcccgccgccgcccggcat 19676
>gb|U49120.1|DMU49120 Drosophila melanogaster Y-box protein, ypsilon schachtel (yps) mRNA, complete cds Length = 1870 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 184 ctgcgcctgctgctgctgtt 203 |||||||||||||||||||| Sbjct: 269 ctgcgcctgctgctgctgtt 250
>dbj|AP006112.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT45P14, TM0196b, complete sequence Length = 25928 Score = 40.1 bits (20), Expect = 7.8 Identities = 29/32 (90%) Strand = Plus / Plus Query: 245 gtctcctcgcactcgtctagctccatgtctgt 276 ||||| || |||||||| |||||||||||||| Sbjct: 25795 gtctcttcacactcgtccagctccatgtctgt 25826
>gb|AE016815.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome II, complete sequence Length = 867699 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 477 gcagctgtctgccatccaaa 496 |||||||||||||||||||| Sbjct: 79031 gcagctgtctgccatccaaa 79050
>gb|DQ138884.1| Drosophila melanogaster strain Ral1 CG5669 gene, partial cds Length = 2868 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 185 tgcgcctgctgctgctgttg 204 |||||||||||||||||||| Sbjct: 1178 tgcgcctgctgctgctgttg 1159
>emb|AL355837.6|CNS05TCR Human chromosome 14 DNA sequence BAC C-2216L1 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 120724 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 190 ctgctgctgctgttgcctcc 209 |||||||||||||||||||| Sbjct: 113057 ctgctgctgctgttgcctcc 113038
>dbj|AP004318.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-77K9, complete sequence Length = 128885 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 124 ggcgcactgcaccctctgcc 143 |||||||||||||||||||| Sbjct: 61178 ggcgcactgcaccctctgcc 61197 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,419,003 Number of Sequences: 3902068 Number of extensions: 4419003 Number of successful extensions: 133542 Number of sequences better than 10.0: 215 Number of HSP's better than 10.0 without gapping: 217 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 132247 Number of HSP's gapped (non-prelim): 1246 length of query: 571 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 548 effective length of database: 17,143,297,704 effective search space: 9394527141792 effective search space used: 9394527141792 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
