>emb|AL109865.36|HSG120K12 Human DNA sequence from clone GS1-120K12 on chromosome 1q25.3-31.2
              Contains the 5' end of the C1orf24 gene for chromosome 1
              open reading frame 24, the RNF2 gene for ring finger
              protein 2, a ferritin heavy polypeptide (FTH) pseudogene
              and the 3' end of the C1orf25 gene for chromosome 1 open
              reading frame 25, complete sequence
          Length = 201823

 Score = 44.1 bits (22), Expect = 0.18
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 101    atgtgtatgttctgcatttctt 122
              ||||||||||||||||||||||
Sbjct: 130058 atgtgtatgttctgcatttctt 130037

>gb|AC153553.4| Mus musculus 10 BAC RP23-329D17 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 185583

 Score = 42.1 bits (21), Expect = 0.72
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 20    aattgcactgtacaacaacaa 40
             |||||||||||||||||||||
Sbjct: 36666 aattgcactgtacaacaacaa 36646

>gb|AC165090.3| Mus musculus BAC clone RP23-95H4 from chromosome 8, complete sequence
          Length = 252334

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 161    tgaaatcatgaacaatgaga 180
              ||||||||||||||||||||
Sbjct: 100559 tgaaatcatgaacaatgaga 100578

>gb|AC116744.8| Mus musculus chromosome 19, clone RP23-79B16, complete sequence
          Length = 236661

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    cactgtacaacaacaaggtt 44
             ||||||||||||||||||||
Sbjct: 67486 cactgtacaacaacaaggtt 67467

>gb|AC126009.22| Medicago truncatula clone mth2-15c20, complete sequence
          Length = 118705

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 153   gcatgccatgaaatcatgaa 172
             ||||||||||||||||||||
Sbjct: 21818 gcatgccatgaaatcatgaa 21799

>gb|AC137822.30| Medicago truncatula clone mth2-31e20, complete sequence
          Length = 140561

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 153  gcatgccatgaaatcatgaa 172
            ||||||||||||||||||||
Sbjct: 6347 gcatgccatgaaatcatgaa 6328

>gb|AY259412.1| Motacilla flava flavissima isolate M.f.fis.K mitochondrial control
           region, partial sequence; tRNA-Phe gene, complete
           sequence; and 12S ribosomal RNA gene, partial sequence
          Length = 1267

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 124 cggttgggaattgggcataa 143
           ||||||||||||||||||||
Sbjct: 208 cggttgggaattgggcataa 189

>emb|BX901917.9| Zebrafish DNA sequence from clone DKEY-32E10 in linkage group 5,
             complete sequence
          Length = 238589

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 57    gacaaacaagcatagcatga 76
             ||||||||||||||||||||
Sbjct: 20302 gacaaacaagcatagcatga 20321

>emb|BX323062.10| Zebrafish DNA sequence from clone DKEYP-38H2 in linkage group 5, complete
              sequence
          Length = 199133

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 197    gcgcagttgaagatgacaacattg 220
              ||||| ||||||||||||||||||
Sbjct: 111368 gcgcacttgaagatgacaacattg 111345

>ref|XM_692169.1| PREDICTED: Danio rerio similar to netrin receptor Unc5h4
           (LOC568814), mRNA
          Length = 1092

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 197 gcgcagttgaagatgacaacattg 220
           ||||| ||||||||||||||||||
Sbjct: 128 gcgcacttgaagatgacaacattg 151

>emb|AJ278704.1|FRX278704 Fragaria x ananassa mRNA for beta-galactosidase (beta-gal2 gene)
          Length = 2993

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 105  gtatgttctgcatttcttgc 124
            ||||||||||||||||||||
Sbjct: 1488 gtatgttctgcatttcttgc 1507

>gb|AC148014.3| Mus musculus BAC clone RP23-118N15 from 19, complete sequence
          Length = 222061

 Score = 40.1 bits (20), Expect = 2.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 25    cactgtacaacaacaaggtt 44
             ||||||||||||||||||||
Sbjct: 20254 cactgtacaacaacaaggtt 20273


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,008,468
Number of Sequences: 3902068
Number of extensions: 2008468
Number of successful extensions: 137950
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 137909
Number of HSP's gapped (non-prelim): 41
length of query: 222
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 200
effective length of database: 17,147,199,772
effective search space: 3429439954400
effective search space used: 3429439954400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)