Clone Information

BLAST Search Result

Clone Name	rbasd16b22
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	ref\|XM_467399.1\| Oryza sativa (japonica cultivar-group), mRNA	498	e-137
2	gb\|AY109202.1\| Zea mays PCO136905 mRNA sequence	456	e-125
3	gb\|BT009441.1\| Triticum aestivum clone wlmk4.pk0023.c10:fis, ful...	359	6e-96
4	gb\|AY112578.1\| Zea mays CL885_1 mRNA sequence	329	6e-87
5	gb\|BT017385.1\| Zea mays clone EL01N0326H05.c mRNA sequence	321	1e-84
6	ref\|XM_549849.1\| Oryza sativa (japonica cultivar-group), mRNA	313	3e-82
7	dbj\|AK119792.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	313	3e-82
8	dbj\|AK099287.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	313	3e-82
9	dbj\|AK059300.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	313	3e-82
10	dbj\|AK073331.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	305	8e-80
11	gb\|DQ294622.1\| Arachis hypogaea RING-box protein (RBX1a) mRNA, c...	244	3e-61
12	gb\|AY119265.1\| Drosophila melanogaster SD23839 full insert cDNA	242	1e-60
13	ref\|NM_130496.2\| Drosophila melanogaster Roc1a CG16982-RA (Roc1a...	242	1e-60
14	gb\|DQ099098.1\| Arachis stenosperma clone AS1RN18H05 microsatelli...	236	6e-59
15	ref\|XM_314102.2\| Anopheles gambiae str. PEST ENSANGP00000010437 ...	214	2e-52
16	dbj\|AK066348.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	210	4e-51
17	gb\|AY555146.1\| Fragaria x ananassa putative ring-box protein mRN...	206	5e-50
18	emb\|AL031581.1\|DMC115C2 Drosophila melanogaster cosmid clone 115C2	202	9e-49
19	gb\|AC104602.3\| Drosophila melanogaster X BAC RP98-16G6 (Roswell ...	202	9e-49
20	gb\|AE003418.4\| Drosophila melanogaster chromosome X, section 2 o...	202	9e-49
21	emb\|BX006952.1\|CNS08DJ0 Single read from an extremity of a full-...	198	1e-47
22	emb\|BX006498.1\|CNS08D6E Single read from an extremity of a full-...	198	1e-47
23	emb\|BX008661.1\|CNS08EUH Single read from an extremity of a full-...	194	2e-46
24	emb\|BX020496.1\|CNS08NZ8 Single read from an extremity of a full-...	190	3e-45
25	emb\|BX012866.1\|CNS08I3A Single read from an extremity of a full-...	182	8e-43
26	emb\|BX006499.1\|CNS08D6F Single read from an extremity of a full-...	180	3e-42
27	ref\|NM_122064.2\| Arabidopsis thaliana RBX1 AT5G20570 (RBX1) mRNA...	178	1e-41
28	gb\|AY114719.1\| Arabidopsis thaliana ring-box protein-like (At5g2...	178	1e-41
29	gb\|AY072430.1\| Arabidopsis thaliana ring-box protein - like (At5...	178	1e-41
30	gb\|AY052401.1\| Arabidopsis thaliana ring box-1-like protein mRNA...	178	1e-41
31	gb\|AY086913.1\| Arabidopsis thaliana clone 29408 mRNA, complete s...	178	1e-41
32	dbj\|AK118181.1\| Arabidopsis thaliana At5g20570 mRNA for putative...	178	1e-41
33	gb\|AY027936.1\| Salmo salar hyperosmotic protein 21 mRNA, complet...	172	8e-40
34	gb\|DQ000158.1\| Salmo salar hyperosmotic protein 21 (Shop21) gene...	172	8e-40
35	gb\|DQ000157.1\| Salmo salar hyperosmotic protein 21 (Shop21) gene...	172	8e-40
36	gb\|AY432709.1\| Aedes aegypti ASAP ID: 35185 ubiquitin ligase mRN...	170	3e-39
37	gb\|DQ440316.1\| Aedes aegypti clone AET-4020 SCF ubiquitin ligase...	170	3e-39
38	emb\|BX833527.1\|CNS0A0LK Arabidopsis thaliana Full-length cDNA Co...	170	3e-39
39	gb\|AY302066.1\| Populus tomentosa ring box protein mRNA, complete...	163	7e-37
40	emb\|BX037579.1\|CNS0915R Single read from an extremity of a full-...	161	3e-36
41	emb\|BX008706.1\|CNS08EVQ Single read from an extremity of a full-...	155	2e-34
42	emb\|CR631384.2\|CNS0EM59 Tetraodon nigroviridis full-length cDNA	151	3e-33
43	ref\|XM_363999.1\| Magnaporthe grisea 70-15 hypothetical protein (...	149	1e-32
44	emb\|BX020497.1\|CNS08NZ9 Single read from an extremity of a full-...	147	4e-32
45	gb\|AF480496.1\| Oryza sativa clone BAC 49D11, complete sequence	145	2e-31
46	dbj\|AP008208.1\| Oryza sativa (japonica cultivar-group) genomic D...	145	2e-31
47	dbj\|AP005844.3\| Oryza sativa (japonica cultivar-group) genomic D...	145	2e-31
48	emb\|CR712304.2\|CNS0GCKC Tetraodon nigroviridis full-length cDNA	143	7e-31
49	emb\|CR711741.2\|CNS0GC4P Tetraodon nigroviridis full-length cDNA	143	7e-31
50	emb\|CR718984.2\|CNS0GHPQ Tetraodon nigroviridis full-length cDNA	143	7e-31
51	emb\|CR718953.2\|CNS0GHOV Tetraodon nigroviridis full-length cDNA	143	7e-31
52	emb\|CR718828.2\|CNS0GHLE Tetraodon nigroviridis full-length cDNA	143	7e-31
53	emb\|CR718557.2\|CNS0GHDV Tetraodon nigroviridis full-length cDNA	143	7e-31
54	emb\|CR717778.2\|CNS0GGS8 Tetraodon nigroviridis full-length cDNA	143	7e-31
55	emb\|CR717707.2\|CNS0GGQ9 Tetraodon nigroviridis full-length cDNA	143	7e-31
56	emb\|CR717638.2\|CNS0GGOC Tetraodon nigroviridis full-length cDNA	143	7e-31
57	emb\|CR717357.2\|CNS0GGGJ Tetraodon nigroviridis full-length cDNA	143	7e-31
58	emb\|CR717269.2\|CNS0GGE3 Tetraodon nigroviridis full-length cDNA	143	7e-31
59	emb\|CR717135.2\|CNS0GGAG Tetraodon nigroviridis full-length cDNA	143	7e-31
60	emb\|CR716834.2\|CNS0GG23 Tetraodon nigroviridis full-length cDNA	143	7e-31
61	emb\|CR716017.2\|CNS0GFFH Tetraodon nigroviridis full-length cDNA	143	7e-31
62	emb\|CR715173.2\|CNS0GES1 Tetraodon nigroviridis full-length cDNA	143	7e-31
63	emb\|CR714756.2\|CNS0GEGG Tetraodon nigroviridis full-length cDNA	143	7e-31
64	emb\|CR711398.2\|CNS0GBV6 Tetraodon nigroviridis full-length cDNA	143	7e-31
65	emb\|CR714255.2\|CNS0GE2J Tetraodon nigroviridis full-length cDNA	143	7e-31
66	emb\|CR713764.2\|CNS0GDOW Tetraodon nigroviridis full-length cDNA	143	7e-31
67	emb\|CR713551.2\|CNS0GDIZ Tetraodon nigroviridis full-length cDNA	143	7e-31
68	emb\|CR713038.2\|CNS0GD4Q Tetraodon nigroviridis full-length cDNA	143	7e-31
69	emb\|CR712711.2\|CNS0GCVN Tetraodon nigroviridis full-length cDNA	143	7e-31
70	emb\|CR712093.2\|CNS0GCEH Tetraodon nigroviridis full-length cDNA	143	7e-31
71	emb\|CR710993.2\|CNS0GBJX Tetraodon nigroviridis full-length cDNA	143	7e-31
72	emb\|CR710591.2\|CNS0GB8R Tetraodon nigroviridis full-length cDNA	143	7e-31
73	emb\|CR710156.2\|CNS0GAWO Tetraodon nigroviridis full-length cDNA	143	7e-31
74	emb\|CR709913.2\|CNS0GAPX Tetraodon nigroviridis full-length cDNA	143	7e-31
75	emb\|CR709418.2\|CNS0GAC6 Tetraodon nigroviridis full-length cDNA	143	7e-31
76	emb\|CR709337.2\|CNS0GA9X Tetraodon nigroviridis full-length cDNA	143	7e-31
77	emb\|CR708996.2\|CNS0GA0G Tetraodon nigroviridis full-length cDNA	143	7e-31
78	emb\|CR709183.2\|CNS0GA5N Tetraodon nigroviridis full-length cDNA	143	7e-31
79	emb\|CR709075.2\|CNS0GA2N Tetraodon nigroviridis full-length cDNA	143	7e-31
80	emb\|CR708377.2\|CNS0G9J9 Tetraodon nigroviridis full-length cDNA	143	7e-31
81	emb\|CR708266.2\|CNS0G9G6 Tetraodon nigroviridis full-length cDNA	143	7e-31
82	emb\|CR708263.2\|CNS0G9G3 Tetraodon nigroviridis full-length cDNA	143	7e-31
83	emb\|CR707631.2\|CNS0G8YJ Tetraodon nigroviridis full-length cDNA	143	7e-31
84	emb\|CR707603.2\|CNS0G8XR Tetraodon nigroviridis full-length cDNA	143	7e-31
85	emb\|CR705966.2\|CNS0G7OA Tetraodon nigroviridis full-length cDNA	143	7e-31
86	emb\|CR706999.2\|CNS0G8GZ Tetraodon nigroviridis full-length cDNA	143	7e-31
87	emb\|CR706688.2\|CNS0G88C Tetraodon nigroviridis full-length cDNA	143	7e-31
88	emb\|CR706606.2\|CNS0G862 Tetraodon nigroviridis full-length cDNA	143	7e-31
89	emb\|CR706092.2\|CNS0G7RS Tetraodon nigroviridis full-length cDNA	143	7e-31
90	emb\|CR705735.2\|CNS0G7HV Tetraodon nigroviridis full-length cDNA	143	7e-31
91	emb\|CR705000.2\|CNS0G6XG Tetraodon nigroviridis full-length cDNA	143	7e-31
92	emb\|CR704952.2\|CNS0G6W4 Tetraodon nigroviridis full-length cDNA	143	7e-31
93	emb\|CR704915.2\|CNS0G6V3 Tetraodon nigroviridis full-length cDNA	143	7e-31
94	emb\|CR705166.2\|CNS0G722 Tetraodon nigroviridis full-length cDNA	143	7e-31
95	emb\|CR704225.2\|CNS0G6BX Tetraodon nigroviridis full-length cDNA	143	7e-31
96	emb\|CR702171.2\|CNS0G4QV Tetraodon nigroviridis full-length cDNA	143	7e-31
97	emb\|CR696134.2\|CNS0G036 Tetraodon nigroviridis full-length cDNA	143	7e-31
98	emb\|CR685564.2\|CNS0FRXK Tetraodon nigroviridis full-length cDNA	143	7e-31
99	emb\|CR683717.2\|CNS0FQI9 Tetraodon nigroviridis full-length cDNA	143	7e-31
100	emb\|CR633484.2\|CNS0ENRM Tetraodon nigroviridis full-length cDNA	143	7e-31
101	emb\|CR632165.2\|CNS0EMQZ Tetraodon nigroviridis full-length cDNA	143	7e-31
102	ref\|XM_677021.1\| Aspergillus nidulans FGSC A4 hypothetical prote...	141	3e-30
103	emb\|CR718972.2\|CNS0GHPE Tetraodon nigroviridis full-length cDNA	135	2e-28
104	emb\|CR716350.2\|CNS0GFON Tetraodon nigroviridis full-length cDNA	135	2e-28
105	emb\|CR715418.2\|CNS0GEYU Tetraodon nigroviridis full-length cDNA	135	2e-28
106	emb\|CR715040.2\|CNS0GEOC Tetraodon nigroviridis full-length cDNA	135	2e-28
107	emb\|CR708622.2\|CNS0G9Q2 Tetraodon nigroviridis full-length cDNA	135	2e-28
108	emb\|CR707762.2\|CNS0G926 Tetraodon nigroviridis full-length cDNA	135	2e-28
109	emb\|CR707479.2\|CNS0G8UB Tetraodon nigroviridis full-length cDNA	135	2e-28
110	emb\|CR684241.2\|CNS0FQWT Tetraodon nigroviridis full-length cDNA	135	2e-28
111	emb\|CR670549.2\|CNS0FGD7 Tetraodon nigroviridis full-length cDNA	135	2e-28
112	emb\|CR659058.2\|CNS0F7I0 Tetraodon nigroviridis full-length cDNA	135	2e-28
113	emb\|CR632856.2\|CNS0ENA6 Tetraodon nigroviridis full-length cDNA	135	2e-28
114	gb\|BC081497.1\| Danio rerio im:7137515, mRNA (cDNA clone IMAGE:72...	133	7e-28
115	ref\|XM_688824.1\| PREDICTED: Danio rerio similar to RING-box prot...	133	7e-28
116	gb\|BC107831.1\| Danio rerio im:7137515, mRNA (cDNA clone IMAGE:72...	133	7e-28
117	emb\|CR659962.2\|CNS0F874 Tetraodon nigroviridis full-length cDNA	127	4e-26
118	ref\|XM_382673.1\| Gibberella zeae PH-1 chromosome 1 hypothetical ...	119	1e-23
119	ref\|NM_001034135.1\| Rattus norvegicus ring-box 1 (Rbx1), mRNA	119	1e-23
120	gb\|BC100258.1\| Rattus norvegicus ring-box 1, mRNA (cDNA clone MG...	119	1e-23
121	gb\|AY440092.1\| Armigeres subalbatus ASAP ID: 42179 ubiquitin lig...	115	2e-22
122	ref\|XM_748960.1\| Aspergillus fumigatus Af293 ubiquitin ligase su...	113	6e-22
123	ref\|NM_114151.1\| Arabidopsis thaliana ubiquitin-protein ligase A...	111	2e-21
124	gb\|BC051473.1\| Mus musculus ring-box 1, mRNA (cDNA clone MGC:629...	111	2e-21
125	ref\|NM_019712.2\| Mus musculus ring-box 1 (Rbx1), mRNA	111	2e-21
126	gb\|BC083057.1\| Mus musculus ring-box 1, mRNA (cDNA clone IMAGE:5...	111	2e-21
127	gb\|BC056992.1\| Mus musculus ring-box 1, mRNA (cDNA clone MGC:669...	111	2e-21
128	dbj\|AK152012.1\| Mus musculus bone marrow macrophage cDNA, RIKEN ...	111	2e-21
129	dbj\|AK159571.1\| Mus musculus osteoclast-like cell cDNA, RIKEN fu...	111	2e-21
130	gb\|BC027396.1\| Mus musculus ring-box 1, mRNA (cDNA clone MGC:359...	111	2e-21
131	gb\|AF140599.1\|AF140599 Mus musculus ring-box protein 1 (Rbx1) mR...	111	2e-21
132	ref\|XM_957982.1\| Neurospora crassa OR74A hypothetical protein (N...	109	1e-20
133	ref\|XM_326078.1\| Neurospora crassa OR74A hypothetical protein (N...	109	1e-20
134	gb\|DQ446722.1\| Arabidopsis thaliana clone pENTR221-At3g42830 rin...	107	4e-20
135	dbj\|AP008207.1\| Oryza sativa (japonica cultivar-group) genomic D...	105	1e-19
136	dbj\|AP002863.3\| Oryza sativa (japonica cultivar-group) genomic D...	105	1e-19
137	dbj\|AP002845.3\| Oryza sativa (japonica cultivar-group) genomic D...	105	1e-19
138	dbj\|AK003159.1\| Mus musculus 18-day embryo whole body cDNA, RIKE...	103	6e-19
139	dbj\|AK004114.1\| Mus musculus 18-day embryo whole body cDNA, RIKE...	103	6e-19
140	dbj\|AK183716.1\| Mus musculus cDNA, clone:Y0G0126N24, strand:plus...	103	6e-19
141	dbj\|AK182752.1\| Mus musculus cDNA, clone:Y0G0123J24, strand:plus...	103	6e-19
142	gb\|DQ311404.1\| Bombyx mori ring box protein mRNA, complete cds	101	2e-18
143	ref\|NM_073095.4\| Caenorhabditis elegans yeast RBX (ring finger p...	101	2e-18
144	gb\|AC084553.1\|CBRG33P21 Caenorhabditis briggsae cosmid G33P21, c...	101	2e-18
145	dbj\|AB077287.1\| Caenorhabditis elegans Ce-rbx-1 mRNA for RING-H2...	101	2e-18
146	ref\|NM_014248.2\| Homo sapiens ring-box 1 (RBX1), mRNA	100	9e-18
147	ref\|XM_597082.2\| PREDICTED: Bos taurus similar to RING-box prote...	100	9e-18
148	gb\|BC017370.1\| Homo sapiens ring-box 1, mRNA (cDNA clone IMAGE:4...	100	9e-18
149	gb\|BC105329.1\| Bos taurus similar to RING-box protein 1 (Rbx1), ...	100	9e-18
150	gb\|AY099360.1\| Homo sapiens ZYP protein mRNA, partial cds	100	9e-18
151	gb\|BC001466.2\| Homo sapiens ring-box 1, mRNA (cDNA clone MGC:148...	100	9e-18
152	gb\|AF142059.1\|AF142059 Homo sapiens RING finger protein (ROC1) m...	100	9e-18
153	emb\|CR456560.1\| Homo sapiens RBX1 full length open reading frame...	100	9e-18
154	gb\|AF140598.1\|AF140598 Homo sapiens ring-box protein 1 (RBX1) mR...	100	9e-18
155	gb\|AF085906.1\|HUMYQ60A05 Homo sapiens full length insert cDNA cl...	100	9e-18
156	gb\|AC112970.18\| Mus musculus chromosome 17, clone RP24-443D19, c...	96	1e-16
157	emb\|Z70757.1\|CEZK287 Caenorhabditis elegans Cosmid ZK287, comple...	96	1e-16
158	emb\|CR974451.9\| Mouse DNA sequence from clone RP24-180B11 on chr...	96	1e-16
159	ref\|XM_515153.1\| PREDICTED: Pan troglodytes similar to RBX1 prot...	92	2e-15
160	ref\|XM_881804.1\| PREDICTED: Bos taurus similar to RING-box prote...	92	2e-15
161	emb\|CT033337.1\| Platynereis dumerilii EST IB0AAA22BD06EM1	92	2e-15
162	emb\|CT033336.1\| Platynereis dumerilii EST IB0AAA22BD06FM1	92	2e-15
163	emb\|CT032976.1\| Platynereis dumerilii EST IB0AAA28CF05EM1	92	2e-15
164	emb\|CT032975.1\| Platynereis dumerilii EST IB0AAA28CF05FM1	92	2e-15
165	emb\|CT032443.1\| Platynereis dumerilii EST IB0AAA38AF03EM1	92	2e-15
166	emb\|CT032442.1\| Platynereis dumerilii EST IB0AAA38AF03FM1	92	2e-15
167	emb\|CT032439.1\| Platynereis dumerilii EST IB0AAA38AH04FM1	92	2e-15
168	emb\|CT032267.1\| Platynereis dumerilii EST IB0AAA42AB12EM1	92	2e-15
169	emb\|CT032266.1\| Platynereis dumerilii EST IB0AAA42AB12FM1	92	2e-15
170	ref\|XM_756798.1\| Ustilago maydis 521 hypothetical protein (UM057...	86	1e-13
171	gb\|DQ213704.1\| Taeniopygia guttata clone 0058P0062F10 RBX1 prote...	82	2e-12
172	gb\|AC010010.6\| Drosophila melanogaster 3L BAC RP98-13F6 (Roswell...	82	2e-12
173	ref\|NM_144356.2\| Drosophila melanogaster Roc1b CG16988-RA (Roc1b...	82	2e-12
174	ref\|NM_138189.2\| Drosophila melanogaster CG6905-RA (CG6905), mRNA	82	2e-12
175	gb\|AY070810.1\| Drosophila melanogaster AT21612 full length cDNA	82	2e-12
176	gb\|AY061302.1\| Drosophila melanogaster LD21614 full length cDNA	82	2e-12
177	gb\|AF218290.1\|AF218290 Drosophila melanogaster ring finger prote...	82	2e-12
178	gb\|AE003468.3\| Drosophila melanogaster chromosome 3L, section 2 ...	82	2e-12
179	emb\|CR686693.2\|CNS0FSSX Tetraodon nigroviridis full-length cDNA	80	9e-12
180	emb\|X73608.1\|HSTEST H.sapiens mRNA for testican	80	9e-12
181	ref\|XM_531722.2\| PREDICTED: Canis familiaris similar to RING-box...	78	3e-11
182	emb\|CT027911.1\| Xenopus tropicalis finished cDNA, clone TEgg095b23	76	1e-10
183	dbj\|AB220470.1\| Macaca fascicularis mRNA, clone QflA-19125: simi...	76	1e-10
184	dbj\|AK149259.1\| Mus musculus adult retina cDNA, RIKEN full-lengt...	76	1e-10
185	gb\|DQ306845.1\| Hevea brasiliensis isolate SSH116 mRNA sequence	76	1e-10
186	gb\|DQ306836.1\| Hevea brasiliensis isolate SSH107 mRNA sequence	76	1e-10
187	gb\|DQ213705.1\| Taeniopygia guttata clone 0063P0003E09 RBX1 prote...	74	5e-10
188	emb\|CT032440.1\| Platynereis dumerilii EST IB0AAA38AH04EM1	74	5e-10
189	ref\|XM_416239.1\| PREDICTED: Gallus gallus similar to RBX1 protei...	72	2e-09
190	emb\|CR390140.1\| Gallus gallus finished cDNA, clone ChEST162j5	72	2e-09
191	emb\|BX470254.7\| Zebrafish DNA sequence from clone CH211-256M1 in...	66	1e-07
192	gb\|AC109153.13\| Mus musculus chromosome 15, clone RP23-51J23, co...	64	5e-07
193	emb\|AL954851.5\| Zebrafish DNA sequence from clone CH211-280J3, c...	64	5e-07
194	gb\|AC160528.9\| Mus musculus chromosome 15, clone RP23-310L8, com...	64	5e-07
195	gb\|DQ103593.1\| Olimarabidopsis pumila clone BAC 44L14, complete ...	60	8e-06
196	dbj\|AK005127.1\| Mus musculus adult male cerebellum cDNA, RIKEN f...	60	8e-06
197	emb\|AL138639.1\|ATT21C14 Arabidopsis thaliana DNA chromosome 3, B...	60	8e-06
198	ref\|XM_962490.1\| PREDICTED: Tribolium castaneum similar to CG169...	58	3e-05
199	emb\|AL080242.11\|HSA554C12 Human DNA sequence from clone RP11-554...	56	1e-04
200	dbj\|AB225693.1\| Aspergillus oryzae cDNA, contig sequence: AoEST2548	54	5e-04
201	gb\|AF296833.1\|F7C8 Arabidopsis thaliana BAC F7C8	54	5e-04
202	dbj\|AK090764.1\| Homo sapiens cDNA FLJ33445 fis, clone BRALZ2000263	52	0.002
203	dbj\|AK116119.1\| Ciona intestinalis cDNA, clone:citb010m18, full ...	50	0.008
204	ref\|XM_392227.2\| PREDICTED: Apis mellifera similar to ENSANGP000...	48	0.030
205	ref\|NM_187604.1\| Oryza sativa (japonica cultivar-group), predic...	46	0.12
206	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	46	0.12
207	gb\|AC107226.2\| Oryza sativa (japonica cultivar-group) chromosome...	46	0.12
208	gb\|BC034498.1\| Homo sapiens WD repeat domain 26, mRNA (cDNA clon...	46	0.12
209	emb\|AL662947.3\|OSJN00148 Oryza sativa genomic DNA, chromosome 4,...	46	0.12
210	dbj\|AP007150.1\| Aspergillus oryzae RIB40 genomic DNA, SC009	46	0.12
211	dbj\|AP008210.1\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.12
212	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	46	0.12
213	gb\|AF156371.1\| Nicotiana tabacum clone PR29 mRNA sequence	46	0.12
214	gb\|AC099790.3\| Homo sapiens chromosome 1 clone RP11-397G23, comp...	46	0.12
215	dbj\|BA000045.2\| Gloeobacter violaceus PCC 7421 DNA, complete genome	46	0.12
216	dbj\|AB209887.1\| Homo sapiens mRNA for WD repeat domain 26 varian...	46	0.12
217	ref\|NM_188653.1\| Oryza sativa (japonica cultivar-group), Ozsa825...	44	0.47
218	ref\|XM_550562.1\| Oryza sativa (japonica cultivar-group), mRNA	44	0.47
219	ref\|XM_550658.1\| Oryza sativa (japonica cultivar-group), mRNA	44	0.47
220	ref\|XM_480356.1\| Oryza sativa (japonica cultivar-group), mRNA	44	0.47
221	ref\|XM_507147.1\| PREDICTED Oryza sativa (japonica cultivar-group...	44	0.47
222	gb\|AC120527.3\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.47
223	gb\|AC147812.2\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.47
224	gb\|AY257863.1\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.47
225	dbj\|AP008218.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.47
226	dbj\|AP008217.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.47
227	dbj\|AP008214.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.47
228	dbj\|AP008212.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.47
229	dbj\|AP002481.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.47
230	dbj\|AP001539.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.47
231	dbj\|AP003878.3\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.47
232	dbj\|AP006554.2\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.47
233	dbj\|AP001168.1\| Oryza sativa (japonica cultivar-group) genomic D...	44	0.47
234	dbj\|AK120816.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.47
235	dbj\|AK102200.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.47
236	dbj\|AK072269.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.47
237	dbj\|AK070877.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.47
238	dbj\|AK069966.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	44	0.47
239	gb\|DP000010.1\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.47
240	gb\|DP000011.1\| Oryza sativa (japonica cultivar-group) chromosome...	44	0.47
241	emb\|AL954852.5\|CNS08CD6 Oryza sativa chromosome 12, . BAC OJ1573...	44	0.47
242	ref\|XM_466656.1\| Oryza sativa (japonica cultivar-group), mRNA	42	1.9
243	ref\|XM_506859.1\| PREDICTED Oryza sativa (japonica cultivar-group...	42	1.9
244	emb\|AL160408.24\| Human DNA sequence from clone RP4-781K5 on chro...	42	1.9
245	emb\|AL008726.3\|HS337O18 Human DNA sequence from clone RP3-337O18...	42	1.9
246	dbj\|BA000030.2\| Streptomyces avermitilis MA-4680 genomic DNA, co...	42	1.9
247	dbj\|AP005107.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.9
248	dbj\|AP006438.3\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.9
249	dbj\|AP004881.2\| Oryza sativa (japonica cultivar-group) genomic D...	42	1.9
250	dbj\|AK105867.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.9
251	emb\|X17625.1\|HS5ETS Human rRNA primary transcript 5' external tr...	42	1.9
252	dbj\|AK068690.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	42	1.9
253	emb\|AL592188.60\| Human DNA sequence from clone RP11-337M7 on chr...	42	1.9
254	gb\|AC124471.4\| Mus musculus BAC clone RP24-79D7 from 12, complet...	42	1.9
255	gb\|U13369.1\|HSU13369 Human ribosomal DNA complete repeating unit	42	1.9
256	emb\|X14345.1\|HSRRETS Human DNA for 5' external transcribed space...	42	1.9
257	gb\|AC011697.9\| Drosophila melanogaster clone BACR12J05, complete...	40	7.3
258	gb\|CP000031.1\| Silicibacter pomeroyi DSS-3, complete genome	40	7.3
259	gb\|AC102081.15\| Mus musculus chromosome 18, clone RP23-43H5, com...	40	7.3
260	gb\|AC104713.3\| Oryza sativa (japonica cultivar-group) chromosome...	40	7.3
261	ref\|XM_475807.1\| Oryza sativa (japonica cultivar-group), predic...	40	7.3
262	ref\|XM_466892.1\| Oryza sativa (japonica cultivar-group), mRNA	40	7.3
263	ref\|XM_464343.1\| Oryza sativa (japonica cultivar-group), mRNA	40	7.3
264	gb\|AF377946.3\| Oryza sativa (japonica cultivar-group) chromosome...	40	7.3
265	gb\|CP000143.1\| Rhodobacter sphaeroides 2.4.1 chromosome 1, compl...	40	7.3
266	gb\|AC146936.4\| Oryza sativa (japonica cultivar-group) chromosome...	40	7.3
267	gb\|AC147426.2\| Oryza sativa chromosome 3 B1377B10 genomic seque...	40	7.3
268	gb\|BC056612.1\| Mus musculus transmembrane protein 24, mRNA (cDNA...	40	7.3
269	gb\|BC049875.1\| Mus musculus transmembrane protein 24, mRNA (cDNA...	40	7.3
270	gb\|BC035271.1\| Mus musculus transmembrane protein 24, mRNA (cDNA...	40	7.3
271	ref\|XM_916065.2\| PREDICTED: Mus musculus similar to Transmembran...	40	7.3
272	ref\|XM_972678.1\| PREDICTED: Mus musculus similar to Transmembran...	40	7.3
273	ref\|XM_883985.2\| PREDICTED: Mus musculus similar to Transmembran...	40	7.3
274	gb\|AY160083.1\| Drosophila melanogaster alpha1U protein (na) gene...	40	7.3
275	ref\|XM_568891.1\| Cryptococcus neoformans var. neoformans JEC21 u...	40	7.3
276	gb\|AC122428.4\| Mus musculus BAC clone RP24-175C20 from chromosom...	40	7.3
277	emb\|CR352210.11\| Zebrafish DNA sequence from clone DKEY-166N8 in...	40	7.3
278	gb\|AC093711.3\| Sus scrofa clone RP44-453O1, complete sequence	40	7.3
279	gb\|CP000088.1\| Thermobifida fusca YX, complete genome	40	7.3
280	gb\|AE017342.1\| Cryptococcus neoformans var. neoformans JEC21 chr...	40	7.3
281	dbj\|AB249656.1\| Oryza sativa (japonica cultivar-group) OsRR11 mR...	40	7.3
282	dbj\|AK128752.1\| Homo sapiens cDNA FLJ44795 fis, clone BRACE30402...	40	7.3
283	dbj\|AK125754.1\| Homo sapiens cDNA FLJ43766 fis, clone TESTI2049246	40	7.3
284	ref\|NM_167402.1\| Drosophila melanogaster narrow abdomen CG1517-R...	40	7.3
285	ref\|NM_167401.1\| Drosophila melanogaster narrow abdomen CG1517-R...	40	7.3
286	dbj\|AK153804.1\| Mus musculus 3 days neonate thymus cDNA, RIKEN f...	40	7.3
287	ref\|XM_941170.1\| PREDICTED: Homo sapiens hypothetical LOC401923 ...	40	7.3
288	ref\|XM_377538.2\| PREDICTED: Homo sapiens hypothetical LOC401923 ...	40	7.3
289	ref\|NM_027909.2\| Mus musculus transmembrane protein 24 (Tmem24),...	40	7.3
290	dbj\|AK039220.1\| Mus musculus adult male hypothalamus cDNA, RIKEN...	40	7.3
291	dbj\|AK004920.1\| Mus musculus adult male liver cDNA, RIKEN full-l...	40	7.3
292	gb\|DQ350703.1\| Ajellomyces capsulatus nitrosative stress induced...	40	7.3
293	dbj\|AP008215.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.3
294	dbj\|AP008211.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.3
295	gb\|AC022506.38\| Homo sapiens 12 BAC RP11-181L23 (Roswell Park Ca...	40	7.3
296	ref\|XM_576398.1\| PREDICTED: Rattus norvegicus transmembrane prot...	40	7.3
297	gb\|CP000251.1\| Anaeromyxobacter dehalogenans 2CP-C, complete genome	40	7.3
298	dbj\|AK218328.1\| Mus musculus cDNA, clone:Y2G0144N03, strand:minu...	40	7.3
299	dbj\|AK184934.1\| Mus musculus cDNA, clone:Y0G0132A09, strand:plus...	40	7.3
300	dbj\|AP005619.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.3
301	dbj\|AP006156.2\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.3
302	dbj\|AP006452.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.3
303	dbj\|AP004087.3\| Oryza sativa (japonica cultivar-group) genomic D...	40	7.3
304	dbj\|AK122237.1\| Mus musculus mRNA for mKIAA0285 protein	40	7.3
305	dbj\|AK106139.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.3
306	dbj\|AK106948.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.3
307	dbj\|AK103420.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.3
308	dbj\|AK102605.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.3
309	dbj\|AK072284.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.3
310	dbj\|AK067820.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.3
311	dbj\|AK060489.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.3
312	dbj\|AK059834.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	7.3
313	gb\|AC007785.1\|AC007785 Homo sapiens chromosome 19, BAC 282485 (C...	40	7.3
314	gb\|AE003495.4\| Drosophila melanogaster chromosome X, section 47 ...	40	7.3
315	dbj\|AB090825.1\| Bombyx mori retrotransposon HOPEBm2 DNA, partial...	40	7.3
316	gb\|BC085925.1\| Rattus norvegicus transmembrane protein 24, mRNA ...	40	7.3
317	ref\|NM_001011996.1\| Rattus norvegicus transmembrane protein 24 (...	40	7.3
318	emb\|AL731747.2\|CNS08C7W Oryza sativa chromosome 12, . BAC OSJNBa...	40	7.3
319	emb\|AL954853.5\|CNS08CD7 Oryza sativa chromosome 12, . BAC OSJNBb...	40	7.3
320	emb\|AL732378.3\|CNS08C91 Oryza sativa chromosome 12, . BAC OSJNBa...	40	7.3
321	emb\|BX664710.2\|CNS09SC0 Oryza sativa chromosome 12, . PAC P0243A...	40	7.3
322	gb\|AC124577.5\| Mus musculus BAC clone RP23-162P10 from 9, comple...	40	7.3
323	emb\|CR382131.1\| Yarrowia lipolytica chromosome E of strain CLIB ...	40	7.3
324	gb\|BC060156.1\| Mus musculus transmembrane protein 24, mRNA (cDNA...	40	7.3
325	dbj\|D83352.1\|DUKNMDART1 Duck mRNA for N-methyl-D-aspartate recep...	40	7.3
326	dbj\|AB063490.1\| Bombyx mori BmKMO gene for kynurenine 3-monooxyg...	40	7.3

>ref|XM_467399.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 345

 Score =  498 bits (251), Expect = e-137
 Identities = 272/279 (97%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 344 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 285

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 284 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 225

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 224 gtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatgcagaggtccatg 165

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           ||||||||||||||||||||||||||||| || |||||||||||||||||||| | ||| 
Sbjct: 164 atgtggttgcggcagatggcgcagttgtccacgacgatgtcccaggcccagagggagaca 105

                                                  
Query: 460 gcgttccactttttgatctcgaagcgcttgcccttcttg 498
           ||||||||||| |||||||||||||||||||||||||||
Sbjct: 104 gcgttccacttcttgatctcgaagcgcttgcccttcttg 66

to top

>gb|AY109202.1| Zea mays PCO136905 mRNA sequence
          Length = 736

 Score =  456 bits (230), Expect = e-125
 Identities = 266/278 (95%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct: 418 tagtgaccatacttctggaactcccactcactgttgtcaagagggcacacttgacgggtc 359

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           || |||||||||||||| |||||||||||||||||||||||||||| |||||||||||||
Sbjct: 358 tttagccaacggctgatacagtggaagtggaatgcatggttgcaaattccccaagcgacg 299

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||
Sbjct: 298 gtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatgcaaaggtccatg 239

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           ||||||||||||||||||||||||||||| ||||||||||||||||||||||| | ||||
Sbjct: 238 atgtggttgcggcagatggcgcagttgtccaccacgatgtcccaggcccagagagagacg 179

                                                 
Query: 460 gcgttccactttttgatctcgaagcgcttgcccttctt 497
           ||||||||||| |||||||||||||||||| |||||||
Sbjct: 178 gcgttccacttcttgatctcgaagcgcttggccttctt 141

to top

>gb|BT009441.1| Triticum aestivum clone wlmk4.pk0023.c10:fis, full insert mRNA
           sequence
          Length = 582

 Score =  359 bits (181), Expect = 6e-96
 Identities = 241/261 (92%)
 Strand = Plus / Minus

                                                                       
Query: 232 ttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaacgg 291
           |||||||||||||| |||||||||||||| ||||||||||| || ||||||||||| | |
Sbjct: 361 ttctggaactcccattcgctgttgtctagtgggcacacttggcgagtcttgagccacctg 302

                                                                       
Query: 292 ctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcg 351
           |||||||||||||||||||| ||||| || || || ||||| ||||||||||| ||||||
Sbjct: 301 ctgatgcagtggaagtggaaagcatgattacagacaccccatgcgacggtgcattcctcg 242

                                                                       
Query: 352 ctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcgg 411
           |||||||||||||||||||| ||||||||||||||||| || |||||||||||||| |||
Sbjct: 241 ctggtggcgctggcctggttggcctggcactcgatgcatagatccatgatgtggttacgg 182

                                                                       
Query: 412 cagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttt 471
           ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| 
Sbjct: 181 cagatggcgcagttgtccaccacgatgtcccacgcccagagcgcgacggcgttccacttc 122

                                
Query: 472 ttgatctcgaagcgcttgccc 492
           |||||||||||||||||||||
Sbjct: 121 ttgatctcgaagcgcttgccc 101

to top

>gb|AY112578.1| Zea mays CL885_1 mRNA sequence
          Length = 797

 Score =  329 bits (166), Expect = 6e-87
 Identities = 244/270 (90%)
 Strand = Plus / Plus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||| ||||||||||||||||| ||||| ||||  |||||||||||||| |||
Sbjct: 366 tagtggccatatttctggaactcccactcactgttatctaatgggcacacttgacgagtc 425

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           || ||||| | |||||||||||||||||| || ||||| || || ||||||||||| || 
Sbjct: 426 ttaagccacctgctgatgcagtggaagtgaaaagcatgattacagactccccaagcaaca 485

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||||||||||||||| |||||||| ||||||||||||||||||||||| || ||||||
Sbjct: 486 gtgcactcctcgctggtcgcgctggcttggttcgcctggcactcgatgcatagatccatg 545

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           ||||||||||||||||| |||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 546 atgtggttgcggcagatagcgcagttgtcgacgacgatatcccatgcccagagcgcgacg 605

                                         
Query: 460 gcgttccactttttgatctcgaagcgcttg 489
           ||||||||||| ||||||||||||||||||
Sbjct: 606 gcgttccacttcttgatctcgaagcgcttg 635

to top

>gb|BT017385.1| Zea mays clone EL01N0326H05.c mRNA sequence
          Length = 720

 Score =  321 bits (162), Expect = 1e-84
 Identities = 243/270 (90%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||| ||||||||||||||||| ||||| ||||  ||||||||||| || |||
Sbjct: 434 tagtggccatatttctggaactcccactcactgttatctaatgggcacacttggcgagtc 375

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           || ||||| | |||||||||||||||||| || ||||| || || || ||||||||||| 
Sbjct: 374 ttaagccacctgctgatgcagtggaagtgaaaagcatgattacagacaccccaagcgaca 315

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||||||||||||||| ||||| || ||||||||||||||||||||||| || ||||||
Sbjct: 314 gtgcactcctcgctggtcgcgctagcttggttcgcctggcactcgatgcatagatccatg 255

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 254 atgtggttgcggcagatggcgcagttgtcgacgacgatatcccatgcccagagcgcgacg 195

                                         
Query: 460 gcgttccactttttgatctcgaagcgcttg 489
           ||||||||||| ||||||||||||||||||
Sbjct: 194 gcgttccacttcttgatctcgaagcgcttg 165

to top

>ref|XM_549849.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 690

 Score =  313 bits (158), Expect = 3e-82
 Identities = 242/270 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||| ||||| || ||||| || ||||| ||||  ||||||||||| || |||
Sbjct: 429 tagtgcccatatttctgaaattcccattcactgttatctaacgggcacacttggcgagtc 370

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| | ||||||||| |||||||| || ||||| || || || ||||||||||| 
Sbjct: 369 ttgagccacctgctgatgcaatggaagtgaaaagcatgattacagacaccccaagcgaca 310

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 309 gtgcactcctcactggtggcgctggcctggttcgcctggcactcgatgcatagatccatg 250

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 249 atgtggttgcggcagatggcgcagttgtcgacgacgatatcccatgcccagagcgcgacg 190

                                         
Query: 460 gcgttccactttttgatctcgaagcgcttg 489
           ||||||||||| ||||||||||||||||||
Sbjct: 189 gcgttccacttcttgatctcgaagcgcttg 160

to top

>dbj|AK119792.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-175-A04, full
           insert sequence
          Length = 703

 Score =  313 bits (158), Expect = 3e-82
 Identities = 242/270 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||| ||||| || ||||| || ||||| ||||  ||||||||||| || |||
Sbjct: 441 tagtgcccatatttctgaaattcccattcactgttatctaacgggcacacttggcgagtc 382

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| | ||||||||| |||||||| || ||||| || || || ||||||||||| 
Sbjct: 381 ttgagccacctgctgatgcaatggaagtgaaaagcatgattacagacaccccaagcgaca 322

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 321 gtgcactcctcactggtggcgctggcctggttcgcctggcactcgatgcatagatccatg 262

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 261 atgtggttgcggcagatggcgcagttgtcgacgacgatatcccatgcccagagcgcgacg 202

                                         
Query: 460 gcgttccactttttgatctcgaagcgcttg 489
           ||||||||||| ||||||||||||||||||
Sbjct: 201 gcgttccacttcttgatctcgaagcgcttg 172

to top

>dbj|AK099287.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023127H11, full
            insert sequence
          Length = 1715

 Score =  313 bits (158), Expect = 3e-82
 Identities = 242/270 (89%)
 Strand = Plus / Minus

                                                                        
Query: 220  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
            ||||| ||||| ||||| || ||||| || ||||| ||||  ||||||||||| || |||
Sbjct: 1419 tagtgcccatatttctgaaattcccattcactgttatctaacgggcacacttggcgagtc 1360

                                                                        
Query: 280  ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
            |||||||| | ||||||||| |||||||| || ||||| || || || ||||||||||| 
Sbjct: 1359 ttgagccacctgctgatgcaatggaagtgaaaagcatgattacagacaccccaagcgaca 1300

                                                                        
Query: 340  gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
            ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 1299 gtgcactcctcactggtggcgctggcctggttcgcctggcactcgatgcatagatccatg 1240

                                                                        
Query: 400  atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
            |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 1239 atgtggttgcggcagatggcgcagttgtcgacgacgatatcccatgcccagagcgcgacg 1180

                                          
Query: 460  gcgttccactttttgatctcgaagcgcttg 489
            ||||||||||| ||||||||||||||||||
Sbjct: 1179 gcgttccacttcttgatctcgaagcgcttg 1150

to top

>dbj|AK059300.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-F02, full
           insert sequence
          Length = 721

 Score =  313 bits (158), Expect = 3e-82
 Identities = 242/270 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||| ||||| || ||||| || ||||| ||||  ||||||||||| || |||
Sbjct: 460 tagtgcccatatttctgaaattcccattcactgttatctaacgggcacacttggcgagtc 401

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| | ||||||||| |||||||| || ||||| || || || ||||||||||| 
Sbjct: 400 ttgagccacctgctgatgcaatggaagtgaaaagcatgattacagacaccccaagcgaca 341

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 340 gtgcactcctcactggtggcgctggcctggttcgcctggcactcgatgcatagatccatg 281

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 280 atgtggttgcggcagatggcgcagttgtcgacgacgatatcccatgcccagagcgcgacg 221

                                         
Query: 460 gcgttccactttttgatctcgaagcgcttg 489
           ||||||||||| ||||||||||||||||||
Sbjct: 220 gcgttccacttcttgatctcgaagcgcttg 191

to top

>dbj|AK073331.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033026G05, full
           insert sequence
          Length = 690

 Score =  305 bits (154), Expect = 8e-80
 Identities = 241/270 (89%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||| ||||| || ||||| || ||||| ||||  ||||||||||| || |||
Sbjct: 429 tagtgcccatatttctgaaattcccattcactgttatctaacgggcacacttggcgagtc 370

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| | ||||||||| |||||||| ||  |||| || || || ||||||||||| 
Sbjct: 369 ttgagccacctgctgatgcaatggaagtgaaaaacatgattacagacaccccaagcgaca 310

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 309 gtgcactcctcactggtggcgctggcctggttcgcctggcactcgatgcatagatccatg 250

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||||||||||||||||||||||||||| ||||| ||||| |||||||||||||||
Sbjct: 249 atgtggttgcggcagatggcgcagttgtcgacgacgatatcccatgcccagagcgcgacg 190

                                         
Query: 460 gcgttccactttttgatctcgaagcgcttg 489
           ||||||||||| ||||||||||||||||||
Sbjct: 189 gcgttccacttcttgatctcgaagcgcttg 160

to top

>gb|DQ294622.1| Arachis hypogaea RING-box protein (RBX1a) mRNA, complete cds
          Length = 355

 Score =  244 bits (123), Expect = 3e-61
 Identities = 240/279 (86%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||| ||||| |||||||||||||| || ||||||||||| ||||||||||||
Sbjct: 350 tagtggccatatttctgaaactcccactcgctattatctagagggcaaacttgacgggtc 291

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| | ||| ||||| |||||||| || |||||||||||||||||||| || || 
Sbjct: 290 ttgagccatctgcttatgcaatggaagtgaaaagcatggttgcaaactccccacgctaca 231

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||| |||||||| |||||||| ||||| || ||||||||||| |||||||| ||||||
Sbjct: 230 gtgcattcctcgctagtggcgctagcctgattagcctggcactcaatgcagagatccatg 171

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           || ||||| ||||| || |||||||| || || || || ||||| |||||||| || || 
Sbjct: 170 atatggttccggcaaatagcgcagttatcaacaactatatcccaagcccagagagcaaca 111

                                                  
Query: 460 gcgttccactttttgatctcgaagcgcttgcccttcttg 498
           |||||||| || ||||||||||||||||||  |||||||
Sbjct: 110 gcgttccatttcttgatctcgaagcgcttgggcttcttg 72

to top

>gb|AY119265.1| Drosophila melanogaster SD23839 full insert cDNA
          Length = 1181

 Score =  242 bits (122), Expect = 1e-60
 Identities = 233/270 (86%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 278
           |||||| || ||||||||||| |||||||||| |||||| || ||||| || || || ||
Sbjct: 488 ttagtggccgtacttctggaaatcccactcgcggttgtccagtgggcatacctggcgcgt 429

                                                                       
Query: 279 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 338
           ||| ||||| ||   |||||||||||| ||||| || |||||||| || ||||| || ||
Sbjct: 428 ctttagccagcgagagatgcagtggaaatggaaggcgtggttgcagacgccccaggccac 369

                                                                       
Query: 339 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 398
           ||||||||||||||| ||||||   |||||||||||||| ||||||||||| | ||||||
Sbjct: 368 ggtgcactcctcgctagtggcggacgcctggttcgcctgacactcgatgcacaagtccat 309

                                                                       
Query: 399 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 458
           |||||||||||||||||||||||||||||| |||||||||||||||||||| || || ||
Sbjct: 308 gatgtggttgcggcagatggcgcagttgtccaccacgatgtcccaggcccacagagccac 249

                                         
Query: 459 ggcgttccactttttgatctcgaagcgctt 488
           |||||||||||| || | ||| ||||||||
Sbjct: 248 ggcgttccacttcttcacctcaaagcgctt 219

to top

>ref|NM_130496.2| Drosophila melanogaster Roc1a CG16982-RA (Roc1a), mRNA
          Length = 1168

 Score =  242 bits (122), Expect = 1e-60
 Identities = 233/270 (86%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 278
           |||||| || ||||||||||| |||||||||| |||||| || ||||| || || || ||
Sbjct: 488 ttagtggccgtacttctggaaatcccactcgcggttgtccagtgggcatacctggcgcgt 429

                                                                       
Query: 279 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 338
           ||| ||||| ||   |||||||||||| ||||| || |||||||| || ||||| || ||
Sbjct: 428 ctttagccagcgagagatgcagtggaaatggaaggcgtggttgcagacgccccaggccac 369

                                                                       
Query: 339 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 398
           ||||||||||||||| ||||||   |||||||||||||| ||||||||||| | ||||||
Sbjct: 368 ggtgcactcctcgctagtggcggacgcctggttcgcctgacactcgatgcacaagtccat 309

                                                                       
Query: 399 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 458
           |||||||||||||||||||||||||||||| |||||||||||||||||||| || || ||
Sbjct: 308 gatgtggttgcggcagatggcgcagttgtccaccacgatgtcccaggcccacagagccac 249

                                         
Query: 459 ggcgttccactttttgatctcgaagcgctt 488
           |||||||||||| || | ||| ||||||||
Sbjct: 248 ggcgttccacttcttcacctcaaagcgctt 219

to top

>gb|DQ099098.1| Arachis stenosperma clone AS1RN18H05 microsatellite sequence
          Length = 692

 Score =  236 bits (119), Expect = 6e-59
 Identities = 239/279 (85%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||| ||||| |||||||| ||||| || ||||||||||| ||||||||||||
Sbjct: 416 tagtggccatatttctgaaactcccattcgctattatctagagggcaaacttgacgggtc 357

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| | ||| ||||| |||||||| || |||||||||||||||||||| || || 
Sbjct: 356 ttgagccatctgcttatgcaatggaagtgaaaagcatggttgcaaactccccacgctaca 297

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||| |||||||| |||||||| ||||| || ||||||||||| |||||||| ||||||
Sbjct: 296 gtgcattcctcgctagtggcgctagcctgattagcctggcactcaatgcagagatccatg 237

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           || ||||| ||||| || |||||||| || || || || ||||| |||||||| || || 
Sbjct: 236 atatggttccggcaaatagcgcagttatcaacaactatatcccaagcccagagagcaaca 177

                                                  
Query: 460 gcgttccactttttgatctcgaagcgcttgcccttcttg 498
           |||||||| || ||||||||||||||||||  |||||||
Sbjct: 176 gcgttccatttcttgatctcgaagcgcttgggcttcttg 138

to top

>ref|XM_314102.2| Anopheles gambiae str. PEST ENSANGP00000010437
           (ENSANGG00000007948), mRNA
          Length = 612

 Score =  214 bits (108), Expect = 2e-52
 Identities = 222/260 (85%)
 Strand = Plus / Minus

                                                                       
Query: 223 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 282
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 381 tgaccgtacttctggaactcccactctctgttgtcgagcggacagacctgccgggtcttc 322

                                                                       
Query: 283 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 342
           ||||| |||  |||||||||||||||||| ||||| || || || |||||||| || |||
Sbjct: 321 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgtg 262

                                                                       
Query: 343 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 402
           || |||||||||||||||   || ||||||||||||||||||||||| || |||||||||
Sbjct: 261 cattcctcgctggtggcggacgcttggttcgcctggcactcgatgcacagatccatgatg 202

                                                                       
Query: 403 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 462
           || || |||||||| || |||||||| |||||||||||||||||||| |  || || |||
Sbjct: 201 tgatttcggcagatcgcacagttgtccaccacgatgtcccaggcccacaaggctaccgcg 142

                               
Query: 463 ttccactttttgatctcgaa 482
           |||||||| |||| ||||||
Sbjct: 141 ttccacttcttgacctcgaa 122

to top

>dbj|AK066348.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013059F24, full
            insert sequence
          Length = 2340

 Score =  210 bits (106), Expect = 4e-51
 Identities = 109/110 (99%)
 Strand = Plus / Minus

                                                                        
Query: 220  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2091 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 2032

                                                              
Query: 280  ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactcc 329
            |||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 2031 ttgagccaacggctgatgcagtggaagtggaacgcatggttgcaaactcc 1982



 Score =  172 bits (87), Expect = 8e-40
 Identities = 105/111 (94%)
 Strand = Plus / Minus

                                                                       
Query: 388 cagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcc 447
           ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||
Sbjct: 233 cagaggtccatgatgtggttgcggcagatggcgcagttgtccacgacgatgtcccaggcc 174

                                                              
Query: 448 cagagcgcgacggcgttccactttttgatctcgaagcgcttgcccttcttg 498
           ||||| | ||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 173 cagagggagacagcgttccacttcttgatctcgaagcgcttgcccttcttg 123



 Score =  113 bits (57), Expect = 6e-22
 Identities = 60/61 (98%)
 Strand = Plus / Minus

                                                                       
Query: 328 ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 387
           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 423 ccccaagcgacggtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatg 364

            
Query: 388 c 388
           |
Sbjct: 363 c 363

to top

>gb|AY555146.1| Fragaria x ananassa putative ring-box protein mRNA, partial cds
          Length = 422

 Score =  206 bits (104), Expect = 5e-50
 Identities = 200/232 (86%)
 Strand = Plus / Minus

                                                                       
Query: 267 cacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaac 326
           |||||| |||||||||||||| | ||| ||||||||||||||||| |||||||| |||||
Sbjct: 422 cacttggcgggtcttgagccatctgctaatgcagtggaagtggaaggcatggttacaaac 363

                                                                       
Query: 327 tccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgat 386
            |||||||| || || |||||||| || || || || |||||||||||||||||||||||
Sbjct: 362 cccccaagcaacagtacactcctcactcgtagcactcgcctggttcgcctggcactcgat 303

                                                                       
Query: 387 gcagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggc 446
           |||||||||||| || ||||| | |||||||||||| || || || || |  ||||||||
Sbjct: 302 gcagaggtccataatatggttcctgcagatggcgcaattatccacaacaacatcccaggc 243

                                                               
Query: 447 ccagagcgcgacggcgttccactttttgatctcgaagcgcttgcccttcttg 498
           |||||| ||||||||||||||||| |||||||| || ||||||  |||||||
Sbjct: 242 ccagagagcgacggcgttccacttcttgatctcaaatcgcttgggcttcttg 191

to top

>emb|AL031581.1|DMC115C2 Drosophila melanogaster cosmid clone 115C2
          Length = 46630

 Score =  202 bits (102), Expect = 9e-49
 Identities = 192/222 (86%)
 Strand = Plus / Minus

                                                                         
Query: 219   ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 278
             |||||| || ||||||||||| |||||||||| |||||| || ||||| || || || ||
Sbjct: 25504 ttagtggccgtacttctggaaatcccactcgcggttgtccagtgggcatacctggcgcgt 25445

                                                                         
Query: 279   cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 338
             ||| ||||| ||   |||||||||||| ||||| || |||||||| || ||||| || ||
Sbjct: 25444 ctttagccagcgagagatgcagtggaaatggaaggcgtggttgcagacgccccaggccac 25385

                                                                         
Query: 339   ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 398
             ||||||||||||||| ||||||   |||||||||||||| ||||||||||| | ||||||
Sbjct: 25384 ggtgcactcctcgctagtggcggacgcctggttcgcctgacactcgatgcacaagtccat 25325

                                                       
Query: 399   gatgtggttgcggcagatggcgcagttgtcgaccacgatgtc 440
             |||||||||||||||||||||||||||||| |||||||||||
Sbjct: 25324 gatgtggttgcggcagatggcgcagttgtccaccacgatgtc 25283

to top

>gb|AC104602.3| Drosophila melanogaster X BAC RP98-16G6 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 161668

 Score =  202 bits (102), Expect = 9e-49
 Identities = 192/222 (86%)
 Strand = Plus / Minus

                                                                          
Query: 219    ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 278
              |||||| || ||||||||||| |||||||||| |||||| || ||||| || || || ||
Sbjct: 133697 ttagtggccgtacttctggaaatcccactcgcggttgtccagtgggcatacctggcgcgt 133638

                                                                          
Query: 279    cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 338
              ||| ||||| ||   |||||||||||| ||||| || |||||||| || ||||| || ||
Sbjct: 133637 ctttagccagcgagagatgcagtggaaatggaaggcgtggttgcagacgccccaggccac 133578

                                                                          
Query: 339    ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 398
              ||||||||||||||| ||||||   |||||||||||||| ||||||||||| | ||||||
Sbjct: 133577 ggtgcactcctcgctagtggcggacgcctggttcgcctgacactcgatgcacaagtccat 133518

                                                        
Query: 399    gatgtggttgcggcagatggcgcagttgtcgaccacgatgtc 440
              |||||||||||||||||||||||||||||| |||||||||||
Sbjct: 133517 gatgtggttgcggcagatggcgcagttgtccaccacgatgtc 133476

to top

>gb|AE003418.4| Drosophila melanogaster chromosome X, section 2 of 74 of the complete
              sequence
          Length = 315092

 Score =  202 bits (102), Expect = 9e-49
 Identities = 192/222 (86%)
 Strand = Plus / Minus

                                                                          
Query: 219    ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 278
              |||||| || ||||||||||| |||||||||| |||||| || ||||| || || || ||
Sbjct: 117064 ttagtggccgtacttctggaaatcccactcgcggttgtccagtgggcatacctggcgcgt 117005

                                                                          
Query: 279    cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 338
              ||| ||||| ||   |||||||||||| ||||| || |||||||| || ||||| || ||
Sbjct: 117004 ctttagccagcgagagatgcagtggaaatggaaggcgtggttgcagacgccccaggccac 116945

                                                                          
Query: 339    ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 398
              ||||||||||||||| ||||||   |||||||||||||| ||||||||||| | ||||||
Sbjct: 116944 ggtgcactcctcgctagtggcggacgcctggttcgcctgacactcgatgcacaagtccat 116885

                                                        
Query: 399    gatgtggttgcggcagatggcgcagttgtcgaccacgatgtc 440
              |||||||||||||||||||||||||||||| |||||||||||
Sbjct: 116884 gatgtggttgcggcagatggcgcagttgtccaccacgatgtc 116843

to top

>emb|BX006952.1|CNS08DJ0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 636

 Score =  198 bits (100), Expect = 1e-47
 Identities = 221/260 (85%), Gaps = 1/260 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 282
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 366 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 307

                                                                       
Query: 283 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 342
           ||||| |||  |||||||||||||||||| ||||| || || || |||||||| || |||
Sbjct: 306 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgtg 247

                                                                       
Query: 343 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 402
           || ||||||||||||| |  | | ||||||||||||||||||||||| || |||||||||
Sbjct: 246 cattcctcgctggtggtgacg-cttggttcgcctggcactcgatgcacagatccatgatg 188

                                                                       
Query: 403 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 462
           || || |||||||| || |||||||| |||||||||||||||||||| |  || || |||
Sbjct: 187 tgatttcggcagatcgcacagttgtccaccacgatgtcccaggcccacaaggctaccgcg 128

                               
Query: 463 ttccactttttgatctcgaa 482
           |||||||| |||| ||||||
Sbjct: 127 ttccacttcttgacctcgaa 108

to top

>emb|BX006498.1|CNS08D6E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 647

 Score =  198 bits (100), Expect = 1e-47
 Identities = 221/260 (85%), Gaps = 1/260 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 282
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 365 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 306

                                                                       
Query: 283 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 342
           ||||| |||  |||||||||||||||||| ||||| || || || |||||||| || |||
Sbjct: 305 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgtg 246

                                                                       
Query: 343 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 402
           || ||||||||||||| |  | | ||||||||||||||||||||||| || |||||||||
Sbjct: 245 cattcctcgctggtggtgacg-cttggttcgcctggcactcgatgcacagatccatgatg 187

                                                                       
Query: 403 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 462
           || || |||||||| || |||||||| |||||||||||||||||||| |  || || |||
Sbjct: 186 tgatttcggcagatcgctcagttgtccaccacgatgtcccaggcccacaaggctaccgcg 127

                               
Query: 463 ttccactttttgatctcgaa 482
           |||||||| |||| ||||||
Sbjct: 126 ttccacttcttgacctcgaa 107

to top

>emb|BX008661.1|CNS08EUH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score =  194 bits (98), Expect = 2e-46
 Identities = 225/266 (84%), Gaps = 1/266 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 282
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 442 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 383

                                                                       
Query: 283 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 342
           ||||| |||  |||| ||||||||||||| ||||| || || || |||||||| || |||
Sbjct: 382 agccatcgggagatgaagtggaagtggaacgcatgattacacacaccccaagccaccgtg 323

                                                                       
Query: 343 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 402
           || ||||||||||||| |  | | ||||||||||||||||||||||| || |||||||||
Sbjct: 322 cattcctcgctggtggtgacg-cttggttcgcctggcactcgatgcacagatccatgatg 264

                                                                       
Query: 403 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 462
           || || |||||||| || |||||||| |||||||||||||||||||| |  || || |||
Sbjct: 263 tgatttcggcagatcgcacagttgtccaccacgatgtcccaggcccacaaggctaccgcg 204

                                     
Query: 463 ttccactttttgatctcgaagcgctt 488
           |||||||| |||| |||||| |||||
Sbjct: 203 ttccacttcttgacctcgaaccgctt 178

to top

>emb|BX020496.1|CNS08NZ8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA30AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 694

 Score =  190 bits (96), Expect = 3e-45
 Identities = 220/260 (84%), Gaps = 1/260 (0%)
 Strand = Plus / Minus

                                                                       
Query: 223 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 282
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 443 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 384

                                                                       
Query: 283 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 342
           ||||| |||  |||||||||||||||||| ||||| || || || |||||||| || | |
Sbjct: 383 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgcg 324

                                                                       
Query: 343 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 402
           || ||||||||||||| |  | | ||||||||||||||||||||||| || |||||||||
Sbjct: 323 cattcctcgctggtggtgacg-cttggttcgcctggcactcgatgcacagatccatgatg 265

                                                                       
Query: 403 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 462
           || || |||||||| || |||||||| |||||||||||||||||||| |  || || |||
Sbjct: 264 tgatttcggcagatcgcacagttgtccaccacgatgtcccaggcccacaaggctaccgcg 205

                               
Query: 463 ttccactttttgatctcgaa 482
           |||||||| |||| ||||||
Sbjct: 204 ttccacttcttgacctcgaa 185

to top

>emb|BX012866.1|CNS08I3A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA2BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 537

 Score =  182 bits (92), Expect = 8e-43
 Identities = 218/260 (83%)
 Strand = Plus / Plus

                                                                       
Query: 229 tacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaa 288
           |||||||||||||||||||| |||||||| || || || || || |||||||| ||||| 
Sbjct: 139 tacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttcagccat 198

                                                                       
Query: 289 cggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcc 348
           |||  || ||||||||||||||| ||||| || || || |||||||| || ||||| |||
Sbjct: 199 cgggagaagcagtggaagtggaacgcatgattacacacaccccaagccaccgtgcattcc 258

                                                                       
Query: 349 tcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttg 408
           |||||||||||    || ||||||||||||||||||||||| |  ||||||||||| || 
Sbjct: 259 tcgctggtggctgacgcttggttcgcctggcactcgatgcacaaatccatgatgtgattt 318

                                                                       
Query: 409 cggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccac 468
           |||||||  || |||||||| |||||||||||||||||||| |  || || |||||||||
Sbjct: 319 cggcagaacgcacagttgtccaccacgatgtcccaggcccacaaggctaccgcgttccac 378

                               
Query: 469 tttttgatctcgaagcgctt 488
           || |||| |||||| |||||
Sbjct: 379 ttcttgacctcgaaccgctt 398

to top

>emb|BX006499.1|CNS08D6F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 648

 Score =  180 bits (91), Expect = 3e-42
 Identities = 224/267 (83%), Gaps = 1/267 (0%)
 Strand = Plus / Plus

                                                                       
Query: 223 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 282
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 226 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 285

                                                                       
Query: 283 agccaacggctgatgcagtggaagtggaatgc-atggttgcaaactccccaagcgacggt 341
           ||||| |||  || ||||||||||||||| || ||| || || || |||||||| || ||
Sbjct: 286 agccatcgggagaagcagtggaagtggaacgccatgattacacacaccccaagccaccgt 345

                                                                       
Query: 342 gcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgat 401
           ||| ||||||||||||||    || ||||||||||||||||||||||| || ||||||||
Sbjct: 346 gcattcctcgctggtggctgacgcttggttcgcctggcactcgatgcacagatccatgat 405

                                                                       
Query: 402 gtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggc 461
           ||| || |||||||  || |||||||| |||||||||||||||||||| |  || || ||
Sbjct: 406 gtgatttcggcagaacgcacagttgtccaccacgatgtcccaggcccacaaggctaccgc 465

                                      
Query: 462 gttccactttttgatctcgaagcgctt 488
           ||||||||| |||| |||||| |||||
Sbjct: 466 gttccacttcttgacctcgaaccgctt 492

to top

>ref|NM_122064.2| Arabidopsis thaliana RBX1 AT5G20570 (RBX1) mRNA, complete cds
          Length = 692

 Score =  178 bits (90), Expect = 1e-41
 Identities = 225/270 (83%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 278
           |||||||||||| ||||| ||||||||||| ||||| || |  || || |||||||| ||
Sbjct: 447 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 388

                                                                       
Query: 279 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 338
           ||| ||||| | |||||||||||| |||||||| || || |||||||| |||||||| ||
Sbjct: 387 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 328

                                                                       
Query: 339 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 398
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 327 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 268

                                                                       
Query: 399 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 458
           ||||||||| | |||||| || |||||||| || ||||| ||||| |||||||| || ||
Sbjct: 267 gatgtggtttctgcagatcgcacagttgtcaacaacgatatcccaagcccagagagcaac 208

                                         
Query: 459 ggcgttccactttttgatctcgaagcgctt 488
           |||| ||||||| || || ||||| |||||
Sbjct: 207 ggcgctccacttcttaatttcgaatcgctt 178

to top

>gb|AY114719.1| Arabidopsis thaliana ring-box protein-like (At5g20570) mRNA,
           complete cds
          Length = 544

 Score =  178 bits (90), Expect = 1e-41
 Identities = 225/270 (83%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 278
           |||||||||||| ||||| ||||||||||| ||||| || |  || || |||||||| ||
Sbjct: 357 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 298

                                                                       
Query: 279 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 338
           ||| ||||| | |||||||||||| |||||||| || || |||||||| |||||||| ||
Sbjct: 297 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 238

                                                                       
Query: 339 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 398
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 237 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 178

                                                                       
Query: 399 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 458
           ||||||||| | |||||| || |||||||| || ||||| ||||| |||||||| || ||
Sbjct: 177 gatgtggtttctgcagatcgcacagttgtcaacaacgatatcccaagcccagagagcaac 118

                                         
Query: 459 ggcgttccactttttgatctcgaagcgctt 488
           |||| ||||||| || || ||||| |||||
Sbjct: 117 ggcgctccacttcttaatttcgaatcgctt 88

to top

>gb|AY072430.1| Arabidopsis thaliana ring-box protein - like (At5g20570) mRNA,
           complete cds
          Length = 666

 Score =  178 bits (90), Expect = 1e-41
 Identities = 225/270 (83%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 278
           |||||||||||| ||||| ||||||||||| ||||| || |  || || |||||||| ||
Sbjct: 444 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 385

                                                                       
Query: 279 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 338
           ||| ||||| | |||||||||||| |||||||| || || |||||||| |||||||| ||
Sbjct: 384 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 325

                                                                       
Query: 339 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 398
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 324 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 265

                                                                       
Query: 399 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 458
           ||||||||| | |||||| || |||||||| || ||||| ||||| |||||||| || ||
Sbjct: 264 gatgtggtttctgcagatcgcacagttgtcaacaacgatatcccaagcccagagagcaac 205

                                         
Query: 459 ggcgttccactttttgatctcgaagcgctt 488
           |||| ||||||| || || ||||| |||||
Sbjct: 204 ggcgctccacttcttaatttcgaatcgctt 175

to top

>gb|AY052401.1| Arabidopsis thaliana ring box-1-like protein mRNA, complete cds
          Length = 357

 Score =  178 bits (90), Expect = 1e-41
 Identities = 225/270 (83%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 278
           |||||||||||| ||||| ||||||||||| ||||| || |  || || |||||||| ||
Sbjct: 357 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 298

                                                                       
Query: 279 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 338
           ||| ||||| | |||||||||||| |||||||| || || |||||||| |||||||| ||
Sbjct: 297 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 238

                                                                       
Query: 339 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 398
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 237 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 178

                                                                       
Query: 399 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 458
           ||||||||| | |||||| || |||||||| || ||||| ||||| |||||||| || ||
Sbjct: 177 gatgtggtttctgcagatcgcacagttgtcaacaacgatatcccaagcccagagagcaac 118

                                         
Query: 459 ggcgttccactttttgatctcgaagcgctt 488
           |||| ||||||| || || ||||| |||||
Sbjct: 117 ggcgctccacttcttaatttcgaatcgctt 88

to top

>gb|AY086913.1| Arabidopsis thaliana clone 29408 mRNA, complete sequence
          Length = 635

 Score =  178 bits (90), Expect = 1e-41
 Identities = 225/270 (83%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 278
           |||||||||||| ||||| ||||||||||| ||||| || |  || || |||||||| ||
Sbjct: 447 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 388

                                                                       
Query: 279 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 338
           ||| ||||| | |||||||||||| |||||||| || || |||||||| |||||||| ||
Sbjct: 387 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 328

                                                                       
Query: 339 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 398
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 327 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 268

                                                                       
Query: 399 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 458
           ||||||||| | |||||| || |||||||| || ||||| ||||| |||||||| || ||
Sbjct: 267 gatgtggtttctgcagatcgcacagttgtcaacaacgatatcccaagcccagagagcaac 208

                                         
Query: 459 ggcgttccactttttgatctcgaagcgctt 488
           |||| ||||||| || || ||||| |||||
Sbjct: 207 ggcgctccacttcttaatttcgaatcgctt 178

to top

>dbj|AK118181.1| Arabidopsis thaliana At5g20570 mRNA for putative ring-box protein,
           complete cds, clone: RAFL19-50-B14
          Length = 665

 Score =  178 bits (90), Expect = 1e-41
 Identities = 225/270 (83%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 278
           |||||||||||| ||||| ||||||||||| ||||| || |  || || |||||||| ||
Sbjct: 438 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 379

                                                                       
Query: 279 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 338
           ||| ||||| | |||||||||||| |||||||| || || |||||||| |||||||| ||
Sbjct: 378 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 319

                                                                       
Query: 339 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 398
            |||||||| || || ||||| |||||||| || ||||| |||||||| || || |||||
Sbjct: 318 agtgcactcttcacttgtggcactggcctgattagcctgacactcgatacaaagatccat 259

                                                                       
Query: 399 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 458
           ||||||||| | |||||| || |||||||| || ||||| ||||| |||||||| || ||
Sbjct: 258 gatgtggtttctgcagatcgcacagttgtcaacaacgatatcccaagcccagagagcaac 199

                                         
Query: 459 ggcgttccactttttgatctcgaagcgctt 488
           |||| ||||||| || || ||||| |||||
Sbjct: 198 ggcgctccacttcttaatttcgaatcgctt 169

to top

>gb|AY027936.1| Salmo salar hyperosmotic protein 21 mRNA, complete cds
          Length = 1933

 Score =  172 bits (87), Expect = 8e-40
 Identities = 210/251 (83%)
 Strand = Plus / Minus

                                                                        
Query: 220  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
            ||||| ||||| ||||| ||||||||||| ||||||||||| |||||||| || | ||||
Sbjct: 1703 tagtgtccatatttctgaaactcccactccctgttgtctagggggcacacctgcctggtc 1644

                                                                        
Query: 280  ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
            || | |||||||  ||| |||||||| ||||||||||| ||||| |||||||| || |||
Sbjct: 1643 ttcaaccaacgggagatacagtggaaatggaatgcatgattgcagactccccaggctacg 1584

                                                                        
Query: 340  gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
            |||||||||||    |||||   ||||||||| ||||||||||| |||||||| ||||| 
Sbjct: 1583 gtgcactcctctgatgtggcagaggcctggttagcctggcactctatgcagagatccata 1524

                                                                        
Query: 400  atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
            ||||| || |  |||||||| |||||||| ||||| |||||||||||||| || || || 
Sbjct: 1523 atgtgattcctacagatggcacagttgtccaccacaatgtcccaggcccaaagtgccact 1464

                       
Query: 460  gcgttccactt 470
            || ||||||||
Sbjct: 1463 gcattccactt 1453

to top

>gb|DQ000158.1| Salmo salar hyperosmotic protein 21 (Shop21) gene, Shop21-2 allele,
            complete cds
          Length = 2855

 Score =  172 bits (87), Expect = 8e-40
 Identities = 210/251 (83%)
 Strand = Plus / Minus

                                                                        
Query: 220  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
            ||||| ||||| ||||| ||||||||||| ||||||||||| |||||||| || | ||||
Sbjct: 2825 tagtgtccatatttctgaaactcccactccctgttgtctagggggcacacctgcctggtc 2766

                                                                        
Query: 280  ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
            || | |||||||  ||| |||||||| ||||||||||| ||||| |||||||| || |||
Sbjct: 2765 ttcaaccaacgggagatacagtggaaatggaatgcatgattgcagactccccaggctacg 2706

                                                                        
Query: 340  gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
            |||||||||||    |||||   ||||||||| ||||||||||| |||||||| ||||| 
Sbjct: 2705 gtgcactcctctgatgtggcagaggcctggttagcctggcactctatgcagagatccata 2646

                                                                        
Query: 400  atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
            ||||| || |  |||||||| |||||||| ||||| |||||||||||||| || || || 
Sbjct: 2645 atgtgattcctacagatggcacagttgtccaccacaatgtcccaggcccaaagtgccact 2586

                       
Query: 460  gcgttccactt 470
            || ||||||||
Sbjct: 2585 gcattccactt 2575

to top

>gb|DQ000157.1| Salmo salar hyperosmotic protein 21 (Shop21) gene, Shop21-1 allele,
            complete cds
          Length = 3985

 Score =  172 bits (87), Expect = 8e-40
 Identities = 210/251 (83%)
 Strand = Plus / Minus

                                                                        
Query: 220  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
            ||||| ||||| ||||| ||||||||||| ||||||||||| |||||||| || | ||||
Sbjct: 3955 tagtgtccatatttctgaaactcccactccctgttgtctagggggcacacctgcctggtc 3896

                                                                        
Query: 280  ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
            || | |||||||  ||| |||||||| ||||||||||| ||||| |||||||| || |||
Sbjct: 3895 ttcaaccaacgggagatacagtggaaatggaatgcatgattgcagactccccaggctacg 3836

                                                                        
Query: 340  gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
            |||||||||||    |||||   ||||||||| ||||||||||| |||||||| ||||| 
Sbjct: 3835 gtgcactcctctgatgtggcagaggcctggttagcctggcactctatgcagagatccata 3776

                                                                        
Query: 400  atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
            ||||| || |  |||||||| |||||||| ||||| |||||||||||||| || || || 
Sbjct: 3775 atgtgattcctacagatggcacagttgtccaccacaatgtcccaggcccaaagtgccact 3716

                       
Query: 460  gcgttccactt 470
            || ||||||||
Sbjct: 3715 gcattccactt 3705

to top

>gb|AY432709.1| Aedes aegypti ASAP ID: 35185 ubiquitin ligase mRNA sequence
          Length = 626

 Score =  170 bits (86), Expect = 3e-39
 Identities = 212/254 (83%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| ||||| || ||||| || |  ||||| ||||| || |||
Sbjct: 472 tagtgtccatacttttggaattcccattccctgttatccaacgggcagacttgtcgtgtc 413

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           || |||||||||  |||||||||||| |||||||| ||||| ||||| ||||| || || 
Sbjct: 412 ttcagccaacgggagatgcagtggaaatggaatgcgtggttacaaacaccccaggctaca 353

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||| || ||||| |||||    || || || |||||||| |||||||| || ||||| 
Sbjct: 352 gtgcattcttcgctagtggcagatgcttgatttgcctggcattcgatgcaaagatccata 293

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           ||||| |||||||| ||||||||||||||||||||||| ||||||||||| || || |||
Sbjct: 292 atgtgattgcggcaaatggcgcagttgtcgaccacgatatcccaggcccacagagctacg 233

                         
Query: 460 gcgttccacttttt 473
           ||||||||||||||
Sbjct: 232 gcgttccacttttt 219

to top

>gb|DQ440316.1| Aedes aegypti clone AET-4020 SCF ubiquitin ligase Rbx1 component
           mRNA, complete cds
          Length = 330

 Score =  170 bits (86), Expect = 3e-39
 Identities = 212/254 (83%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| ||||| || ||||| || |  ||||| ||||| || |||
Sbjct: 329 tagtgtccatacttttggaattcccattccctgttatccaacgggcagacttgtcgtgtc 270

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           || |||||||||  |||||||||||| |||||||| ||||| ||||| ||||| || || 
Sbjct: 269 ttcagccaacgggagatgcagtggaaatggaatgcgtggttacaaacaccccaggctaca 210

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||| || ||||| |||||    || || || |||||||| |||||||| || ||||| 
Sbjct: 209 gtgcattcttcgctagtggcagatgcttgatttgcctggcattcgatgcaaagatccata 150

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           ||||| |||||||| ||||||||||||||||||||||| ||||||||||| || || |||
Sbjct: 149 atgtgattgcggcaaatggcgcagttgtcgaccacgatatcccaggcccacagagctacg 90

                         
Query: 460 gcgttccacttttt 473
           ||||||||||||||
Sbjct: 89  gcgttccacttttt 76

to top

>emb|BX833527.1|CNS0A0LK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL60ZC05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 581

 Score =  170 bits (86), Expect = 3e-39
 Identities = 224/270 (82%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 278
           |||||||||||| ||||| ||||||||||| ||||| || |  || || |||||||| ||
Sbjct: 421 ttagtgaccatatttctgaaactcccactcactgttatccaatggacaaacttgacgagt 362

                                                                       
Query: 279 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 338
           ||| ||||| | |||||||||||| |||||||| || || |||||||| |||||||| ||
Sbjct: 361 ctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaaccccccaagctac 302

                                                                       
Query: 339 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 398
            |||||||| || || ||||  |||||||| || ||||| |||||||| || || |||||
Sbjct: 301 agtgcactcttcacttgtgggactggcctgattagcctgacactcgatacaaagatccat 242

                                                                       
Query: 399 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 458
           ||||||||| | |||||| || |||||||| || ||||| ||||| |||||||| || ||
Sbjct: 241 gatgtggtttctgcagatcgcacagttgtcaacaacgatatcccaagcccagagagcaac 182

                                         
Query: 459 ggcgttccactttttgatctcgaagcgctt 488
           |||| ||||||| || || ||||| |||||
Sbjct: 181 ggcgctccacttcttaatttcgaatcgctt 152

to top

>gb|AY302066.1| Populus tomentosa ring box protein mRNA, complete cds
          Length = 687

 Score =  163 bits (82), Expect = 7e-37
 Identities = 223/270 (82%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 278
           |||||| ||||||||||| |||||||||||||| || || |||||||||||||| |||||
Sbjct: 417 ttagtggccatacttctgaaactcccactcgctattatcgagagggcacacttggcgggt 358

                                                                       
Query: 279 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 338
            |||||||| |||||||| |||||||||||||| ||||||||||| || ||||| || ||
Sbjct: 357 tttgagccatcggctgatacagtggaagtggaaggcatggttgcacacaccccaggcaac 298

                                                                       
Query: 339 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 398
            |||||||||||||| || || || || || || || |||||||| ||||| || |||||
Sbjct: 297 agtgcactcctcgcttgtagcactagcttgatttgcttggcactcaatgcaaagatccat 238

                                                                       
Query: 399 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 458
           ||| ||||| |  || || ||||| || || ||||| || ||||| ||||| || || ||
Sbjct: 237 gatatggtttctacaaatagcgcaattatccaccacaatatcccaagcccaaagagcaac 178

                                         
Query: 459 ggcgttccactttttgatctcgaagcgctt 488
            || |||||||| || || ||||| |||||
Sbjct: 177 agcattccacttcttaatttcgaatcgctt 148

to top

>emb|BX037579.1|CNS0915R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 468

 Score =  161 bits (81), Expect = 3e-36
 Identities = 174/205 (84%)
 Strand = Plus / Plus

                                                                       
Query: 223 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 282
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 264 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 323

                                                                       
Query: 283 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 342
           ||||| |||  |||||||||||||||||| ||||| || || || |||||||| || |||
Sbjct: 324 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgtg 383

                                                                       
Query: 343 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 402
           || ||||||||||||||    || ||||||||||||||||||||||| || |||||||||
Sbjct: 384 cattcctcgctggtggctgacgcttggttcgcctggcactcgatgcacagatccatgatg 443

                                    
Query: 403 tggttgcggcagatggcgcagttgt 427
           || || |||||||| || |||||||
Sbjct: 444 tgatttcggcagatcgcacagttgt 468

to top

>emb|BX008706.1|CNS08EVQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA14BA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 499

 Score =  155 bits (78), Expect = 2e-34
 Identities = 189/222 (85%), Gaps = 3/222 (1%)
 Strand = Plus / Minus

                                                                       
Query: 223 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 282
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 264 tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 205

                                                                       
Query: 283 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 342
           ||||| |||  |||||||||||||||||| ||||| || || || |||||||| || |||
Sbjct: 204 agccatcgggagatgcagtggaagtggaacgcatgattacacacaccccaagccaccgtg 145

                                                                       
Query: 343 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 402
           || ||||||||||||| |   || ||||||||||||||||||||||| || |||||||||
Sbjct: 144 cattcctcgctggtggtg-acgcttggttcgcctggcactcgatgcacagatccatgatg 86

                                                     
Query: 403 tggttgcggcagatg-gcgcagttgtcga-ccacgatgtccc 442
           || || ||||||||| || |||||||| | ||||||||||||
Sbjct: 85  tgatttcggcagatgcgcacagttgtccagccacgatgtccc 44

to top

>emb|CR631384.2|CNS0EM59 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  151 bits (76), Expect = 3e-33
 Identities = 205/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| |||||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacggcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>ref|XM_363999.1| Magnaporthe grisea 70-15 hypothetical protein (MG08844.4) partial
           cds
          Length = 702

 Score =  149 bits (75), Expect = 1e-32
 Identities = 165/195 (84%)
 Strand = Plus / Minus

                                                                       
Query: 294 gatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcgct 353
           |||||||||||||||||| || || ||||| |  ||||| || || ||||||||||||||
Sbjct: 285 gatgcagtggaagtggaaagcgtgattgcagataccccaggcaacagtgcactcctcgct 226

                                                                       
Query: 354 ggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggca 413
            ||||||   || ||||| |||||||| || || || || ||||||||||| || | |||
Sbjct: 225 cgtggcggatgcttggtttgcctggcattcaatacaaagatccatgatgtgattcctgca 166

                                                                       
Query: 414 gatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttttt 473
           |||||||||||||||||| || |||||||| ||||||||||| |||||||||||||| ||
Sbjct: 165 gatggcgcagttgtcgacgacaatgtcccaagcccagagcgcaacggcgttccacttctt 106

                          
Query: 474 gatctcgaagcgctt 488
           || |||||| |||||
Sbjct: 105 gacctcgaatcgctt 91

to top

>emb|BX020497.1|CNS08NZ9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA30AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 228

 Score =  147 bits (74), Expect = 4e-32
 Identities = 173/206 (83%)
 Strand = Plus / Plus

                                                                       
Query: 223 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 282
           ||||| |||||||||||||||||||| |||||||| || || || || || |||||||| 
Sbjct: 23  tgaccgtacttctggaactcccactctctgttgtcgagtggacagacctgccgggtcttc 82

                                                                       
Query: 283 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 342
           ||||| |||  || ||||||||||||||| ||||| || || || |||||||| || | |
Sbjct: 83  agccatcgggagaagcagtggaagtggaacgcatgattacacacaccccaagccaccgcg 142

                                                                       
Query: 343 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 402
           || ||||||||||||||    || ||||||||||||||||||||||| || |||||||||
Sbjct: 143 cattcctcgctggtggctgacgcttggttcgcctggcactcgatgcacagatccatgatg 202

                                     
Query: 403 tggttgcggcagatggcgcagttgtc 428
           || || |||||||| || ||||||||
Sbjct: 203 tgatttcggcagatcgcacagttgtc 228

to top

>gb|AF480496.1| Oryza sativa clone BAC 49D11, complete sequence
          Length = 158050

 Score =  145 bits (73), Expect = 2e-31
 Identities = 73/73 (100%)
 Strand = Plus / Plus

                                                                         
Query: 257   ctagagggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcat 316
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 56962 ctagagggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcat 57021

                          
Query: 317   ggttgcaaactcc 329
             |||||||||||||
Sbjct: 57022 ggttgcaaactcc 57034



 Score =  113 bits (57), Expect = 6e-22
 Identities = 60/61 (98%)
 Strand = Plus / Plus

                                                                         
Query: 328   ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 387
             ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 58593 ccccaagcgacggtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatg 58652

              
Query: 388   c 388
             |
Sbjct: 58653 c 58653



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 51/53 (96%)
 Strand = Plus / Plus

                                                                  
Query: 388   cagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtc 440
             ||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 58783 cagaggtccatgatgtggttgcggcagatggcgcagttgtccacgacgatgtc 58835



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 55/59 (93%)
 Strand = Plus / Plus

                                                                        
Query: 440   cccaggcccagagcgcgacggcgttccactttttgatctcgaagcgcttgcccttcttg 498
             ||||||||||||| | ||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 58950 cccaggcccagagggagacagcgttccacttcttgatctcgaagcgcttgcccttcttg 59008



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 39/39 (100%)
 Strand = Plus / Plus

                                                    
Query: 220   tagtgaccatacttctggaactcccactcgctgttgtct 258
             |||||||||||||||||||||||||||||||||||||||
Sbjct: 56836 tagtgaccatacttctggaactcccactcgctgttgtct 56874

to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  145 bits (73), Expect = 2e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                            
Query: 257      ctagagggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcat 316
                ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 29305669 ctagagggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcat 29305610

                             
Query: 317      ggttgcaaactcc 329
                |||||||||||||
Sbjct: 29305609 ggttgcaaactcc 29305597



 Score =  113 bits (57), Expect = 6e-22
 Identities = 60/61 (98%)
 Strand = Plus / Minus

                                                                            
Query: 328      ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 387
                ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 29304038 ccccaagcgacggtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatg 29303979

                 
Query: 388      c 388
                |
Sbjct: 29303978 c 29303978



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                     
Query: 388      cagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtc 440
                ||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 29303848 cagaggtccatgatgtggttgcggcagatggcgcagttgtccacgacgatgtc 29303796



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                           
Query: 440      cccaggcccagagcgcgacggcgttccactttttgatctcgaagcgcttgcccttcttg 498
                ||||||||||||| | ||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 29303681 cccaggcccagagggagacagcgttccacttcttgatctcgaagcgcttgcccttcttg 29303623



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 39/39 (100%)
 Strand = Plus / Minus

                                                       
Query: 220      tagtgaccatacttctggaactcccactcgctgttgtct 258
                |||||||||||||||||||||||||||||||||||||||
Sbjct: 29305795 tagtgaccatacttctggaactcccactcgctgttgtct 29305757



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                     
Query: 503      cggcgccggcgcaggaggaggagggggcgccgggggc 539
                ||||| |||||  |||||||||||||||| |||||||
Sbjct: 23917981 cggcggcggcggcggaggaggagggggcggcgggggc 23918017



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 503      cggcgccggcgcaggaggag 522
                ||||||||||||||||||||
Sbjct: 25306324 cggcgccggcgcaggaggag 25306305



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 501     gccggcgccggcgcaggaggagga 524
               ||||||||||||| ||||||||||
Sbjct: 4595157 gccggcgccggcgaaggaggagga 4595134

to top

>dbj|AP005844.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBb0060O16
          Length = 164373

 Score =  145 bits (73), Expect = 2e-31
 Identities = 73/73 (100%)
 Strand = Plus / Minus

                                                                          
Query: 257    ctagagggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcat 316
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 103014 ctagagggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcat 102955

                           
Query: 317    ggttgcaaactcc 329
              |||||||||||||
Sbjct: 102954 ggttgcaaactcc 102942



 Score =  113 bits (57), Expect = 6e-22
 Identities = 60/61 (98%)
 Strand = Plus / Minus

                                                                          
Query: 328    ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 387
              ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 101383 ccccaagcgacggtgcactcctcgctggtggcgctcgcctggttcgcctggcactcgatg 101324

               
Query: 388    c 388
              |
Sbjct: 101323 c 101323



 Score = 89.7 bits (45), Expect = 9e-15
 Identities = 51/53 (96%)
 Strand = Plus / Minus

                                                                   
Query: 388    cagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtc 440
              ||||||||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 101193 cagaggtccatgatgtggttgcggcagatggcgcagttgtccacgacgatgtc 101141



 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                         
Query: 440    cccaggcccagagcgcgacggcgttccactttttgatctcgaagcgcttgcccttcttg 498
              ||||||||||||| | ||| ||||||||||| |||||||||||||||||||||||||||
Sbjct: 101026 cccaggcccagagggagacagcgttccacttcttgatctcgaagcgcttgcccttcttg 100968



 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 39/39 (100%)
 Strand = Plus / Minus

                                                     
Query: 220    tagtgaccatacttctggaactcccactcgctgttgtct 258
              |||||||||||||||||||||||||||||||||||||||
Sbjct: 103140 tagtgaccatacttctggaactcccactcgctgttgtct 103102

to top

>emb|CR712304.2|CNS0GCKC Tetraodon nigroviridis full-length cDNA
          Length = 468

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR711741.2|CNS0GC4P Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR718984.2|CNS0GHPQ Tetraodon nigroviridis full-length cDNA
          Length = 457

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 327 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 268

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 267 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 208

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 207 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 148

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 147 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 88

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 87  cacttttt 80

to top

>emb|CR718953.2|CNS0GHOV Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR718828.2|CNS0GHLE Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR718557.2|CNS0GHDV Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 333 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 274

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 273 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 214

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 213 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 154

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 153 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 94

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 93  cacttttt 86

to top

>emb|CR717778.2|CNS0GGS8 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR717707.2|CNS0GGQ9 Tetraodon nigroviridis full-length cDNA
          Length = 450

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 320 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 261

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 260 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 201

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 200 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 141

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 140 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 81

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 80  cacttttt 73

to top

>emb|CR717638.2|CNS0GGOC Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 164 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 105

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 104 cacttttt 97

to top

>emb|CR717357.2|CNS0GGGJ Tetraodon nigroviridis full-length cDNA
          Length = 461

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 334 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 275

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 274 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 215

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 214 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 155

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 154 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 95

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 94  cacttttt 87

to top

>emb|CR717269.2|CNS0GGE3 Tetraodon nigroviridis full-length cDNA
          Length = 469

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 339 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 280

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 279 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 220

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 219 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 160

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 159 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 100

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 99  cacttttt 92

to top

>emb|CR717135.2|CNS0GGAG Tetraodon nigroviridis full-length cDNA
          Length = 469

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 339 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 280

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 279 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 220

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 219 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 160

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 159 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 100

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 99  cacttttt 92

to top

>emb|CR716834.2|CNS0GG23 Tetraodon nigroviridis full-length cDNA
          Length = 457

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 327 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 268

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 267 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 208

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 207 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 148

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 147 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 88

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 87  cacttttt 80

to top

>emb|CR716017.2|CNS0GFFH Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR715173.2|CNS0GES1 Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR714756.2|CNS0GEGG Tetraodon nigroviridis full-length cDNA
          Length = 457

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 327 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 268

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 267 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 208

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 207 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 148

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 147 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 88

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 87  cacttttt 80

to top

>emb|CR711398.2|CNS0GBV6 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR714255.2|CNS0GE2J Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 333 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 274

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 273 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 214

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 213 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 154

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 153 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 94

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 93  cacttttt 86

to top

>emb|CR713764.2|CNS0GDOW Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR713551.2|CNS0GDIZ Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 333 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 274

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 273 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 214

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 213 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 154

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 153 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 94

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 93  cacttttt 86

to top

>emb|CR713038.2|CNS0GD4Q Tetraodon nigroviridis full-length cDNA
          Length = 453

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 323 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 264

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 263 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 204

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 203 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 144

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 143 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 84

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 83  cacttttt 76

to top

>emb|CR712711.2|CNS0GCVN Tetraodon nigroviridis full-length cDNA
          Length = 460

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 150 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 91

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 90  cacttttt 83

to top

>emb|CR712093.2|CNS0GCEH Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR710993.2|CNS0GBJX Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR710591.2|CNS0GB8R Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 333 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 274

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 273 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 214

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 213 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 154

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 153 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 94

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 93  cacttttt 86

to top

>emb|CR710156.2|CNS0GAWO Tetraodon nigroviridis full-length cDNA
          Length = 486

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 356 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 297

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 296 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 237

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 236 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 177

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 176 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 117

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 116 cacttttt 109

to top

>emb|CR709913.2|CNS0GAPX Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 164 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 105

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 104 cacttttt 97

to top

>emb|CR709418.2|CNS0GAC6 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR709337.2|CNS0GA9X Tetraodon nigroviridis full-length cDNA
          Length = 453

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 323 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 264

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 263 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 204

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 203 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 144

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 143 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 84

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 83  cacttttt 76

to top

>emb|CR708996.2|CNS0GA0G Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR709183.2|CNS0GA5N Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 164 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 105

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 104 cacttttt 97

to top

>emb|CR709075.2|CNS0GA2N Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 334 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 275

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 274 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 215

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 214 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 155

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 154 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 95

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 94  cacttttt 87

to top

>emb|CR708377.2|CNS0G9J9 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR708266.2|CNS0G9G6 Tetraodon nigroviridis full-length cDNA
          Length = 462

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR708263.2|CNS0G9G3 Tetraodon nigroviridis full-length cDNA
          Length = 460

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 150 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 91

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 90  cacttttt 83

to top

>emb|CR707631.2|CNS0G8YJ Tetraodon nigroviridis full-length cDNA
          Length = 459

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 150 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 91

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 90  cacttttt 83

to top

>emb|CR707603.2|CNS0G8XR Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR705966.2|CNS0G7OA Tetraodon nigroviridis full-length cDNA
          Length = 472

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 342 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 283

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 282 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 223

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 222 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 163

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 162 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 103

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 102 cacttttt 95

to top

>emb|CR706999.2|CNS0G8GZ Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR706688.2|CNS0G88C Tetraodon nigroviridis full-length cDNA
          Length = 469

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 339 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 280

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 279 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 220

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 219 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 160

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 159 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 100

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 99  cacttttt 92

to top

>emb|CR706606.2|CNS0G862 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR706092.2|CNS0G7RS Tetraodon nigroviridis full-length cDNA
          Length = 707

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 577 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 518

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 517 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 458

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 457 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 398

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 397 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 338

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 337 cacttttt 330

to top

>emb|CR705735.2|CNS0G7HV Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR705000.2|CNS0G6XG Tetraodon nigroviridis full-length cDNA
          Length = 460

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcaaaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 150 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 91

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 90  cacttttt 83

to top

>emb|CR704952.2|CNS0G6W4 Tetraodon nigroviridis full-length cDNA
          Length = 462

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 333 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 274

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 273 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 214

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 213 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 154

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 153 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 94

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 93  cacttttt 86

to top

>emb|CR704915.2|CNS0G6V3 Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 164 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 105

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 104 cacttttt 97

to top

>emb|CR705166.2|CNS0G722 Tetraodon nigroviridis full-length cDNA
          Length = 454

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 150 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 91

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 90  cacttttt 83

to top

>emb|CR704225.2|CNS0G6BX Tetraodon nigroviridis full-length cDNA
          Length = 469

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 339 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 280

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 279 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 220

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 219 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 160

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 159 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 100

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 99  cacttttt 92

to top

>emb|CR702171.2|CNS0G4QV Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR696134.2|CNS0G036 Tetraodon nigroviridis full-length cDNA
          Length = 460

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 150 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 91

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 90  cacttttt 83

to top

>emb|CR685564.2|CNS0FRXK Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 334 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 275

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 274 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 215

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 214 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 155

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 154 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 95

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 94  cacttttt 87

to top

>emb|CR683717.2|CNS0FQI9 Tetraodon nigroviridis full-length cDNA
          Length = 463

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR633484.2|CNS0ENRM Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR632165.2|CNS0EMQZ Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  143 bits (72), Expect = 7e-31
 Identities = 204/248 (82%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>ref|XM_677021.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8844.2), mRNA
          Length = 351

 Score =  141 bits (71), Expect = 3e-30
 Identities = 203/247 (82%)
 Strand = Plus / Minus

                                                                       
Query: 229 tacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaa 288
           |||||||| |||||||| ||  |||| || |||||||||||||||||||| || ||||| 
Sbjct: 341 tacttctgaaactcccagtctttgttatcgagagggcacacttgacgggttttcagccag 282

                                                                       
Query: 289 cggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcc 348
           |||   || |||||||| ||||||||||||||||||| ||||||||| || |||||||||
Sbjct: 281 cgggaaatacagtggaaatggaatgcatggttgcaaattccccaagcaactgtgcactcc 222

                                                                       
Query: 349 tcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttg 408
           ||| ||||||    | | ||||| || || |||||||||||||| ||||| |||||||| 
Sbjct: 221 tcggtggtggatgagccttggtttgcttgacactcgatgcagagatccataatgtggtta 162

                                                                       
Query: 409 cggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccac 468
           ||||| || || ||||| || || ||||| ||||| ||||| || || || || ||||||
Sbjct: 161 cggcaaatagcacagttatcaacaacgatatcccacgcccatagagcaacagcattccac 102

                  
Query: 469 tttttga 475
           || ||||
Sbjct: 101 ttcttga 95

to top

>emb|CR718972.2|CNS0GHPE Tetraodon nigroviridis full-length cDNA
          Length = 474

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  |||  ||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatatagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 164 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 105

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 104 cacttttt 97

to top

>emb|CR716350.2|CNS0GFON Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| | |||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagataccgtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR715418.2|CNS0GEYU Tetraodon nigroviridis full-length cDNA
          Length = 464

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||| ||| | |||||| || |||||||| || | ||| || | |
Sbjct: 334 ccatatttctgaaactcccgctcccggttgtccagtgggcacacctgtctggttttcaac 275

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 274 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 215

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 214 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 155

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 154 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 95

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 94  cacttttt 87

to top

>emb|CR715040.2|CNS0GEOC Tetraodon nigroviridis full-length cDNA
          Length = 514

 Score =  135 bits (68), Expect = 2e-28
 Identities = 200/244 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 384 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 325

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 324 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 265

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           ||||||   |||||    |||||||| |||||||| || || || || |||||||| |||
Sbjct: 264 tcctcggatgtggcagaagcctggttggcctggcattctatacacagatccatgatatgg 205

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 204 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 145

               
Query: 466 cact 469
           ||||
Sbjct: 144 cact 141

to top

>emb|CR708622.2|CNS0G9Q2 Tetraodon nigroviridis full-length cDNA
          Length = 461

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 334 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 275

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| |||||||| || || ||||| || || ||||||
Sbjct: 274 cagcgggagatacagtggaagtggaacgcatggttacacacaccccaggccaccgtgcac 215

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 214 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 155

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 154 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 95

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 94  cacttttt 87

to top

>emb|CR707762.2|CNS0G926 Tetraodon nigroviridis full-length cDNA
          Length = 475

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 285

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| ||| |||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcccggcattctatacacagatccatgatgtgg 165

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 164 ttccagcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 105

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 104 cacttttt 97

to top

>emb|CR707479.2|CNS0G8UB Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||| | |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggctggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR684241.2|CNS0FQWT Tetraodon nigroviridis full-length cDNA
          Length = 460

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 330 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 271

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 270 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 211

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 210 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 151

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 150 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 91

                   
Query: 466 cacttttt 473
           || |||||
Sbjct: 90  catttttt 83

to top

>emb|CR670549.2|CNS0FGD7 Tetraodon nigroviridis full-length cDNA
          Length = 465

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| ||   ||| || | |
Sbjct: 335 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtttggttttcaac 276

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 275 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 216

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 215 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 156

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 155 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 96

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 95  cacttttt 88

to top

>emb|CR659058.2|CNS0F7I0 Tetraodon nigroviridis full-length cDNA
          Length = 457

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 327 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtctggttttcaac 268

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 267 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 208

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 207 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 148

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 147 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 88

                   
Query: 466 cacttttt 473
           || |||||
Sbjct: 87  catttttt 80

to top

>emb|CR632856.2|CNS0ENA6 Tetraodon nigroviridis full-length cDNA
          Length = 455

 Score =  135 bits (68), Expect = 2e-28
 Identities = 203/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||| ||||| | |||||| || |||||||| || | ||| || | |
Sbjct: 329 ccatatttctgaaactctcactcccggttgtccagtgggcacacctgtctggttttcaac 270

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 269 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 210

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 209 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 150

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 149 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 90

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 89  cacttttt 82

to top

>gb|BC081497.1| Danio rerio im:7137515, mRNA (cDNA clone IMAGE:7251344), partial
           cds
          Length = 536

 Score =  133 bits (67), Expect = 7e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 282
           |||||||||||||| ||||||||||| |||||||| || || |||||||| | |||||| 
Sbjct: 333 tgaccatacttctgaaactcccactctctgttgtccagtggacacacttgtctggtcttc 274

                                                                       
Query: 283 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 342
           ||||| |||  |||||||||||| || || || || ||||| |||||||| || || || 
Sbjct: 273 agccagcgggagatgcagtggaaatgaaaagcgtgattgcagactccccaggccaccgta 214

                                                                       
Query: 343 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 402
           ||||||||   ||||||    ||||| || ||||| ||||| || ||||||||||| |||
Sbjct: 213 cactcctctgaggtggcagacgcctgattggcctgacactcaatacagaggtccataatg 154

                                                                       
Query: 403 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 462
           || || | ||||||||| |||||||| || || |||||||| ||||| || || || |||
Sbjct: 153 tgatttctgcagatggcacagttgtccactacaatgtcccatgcccacagagccacagcg 94

                      
Query: 463 ttccacttttt 473
           |||||||||||
Sbjct: 93  ttccacttttt 83

to top

>ref|XM_688824.1| PREDICTED: Danio rerio similar to RING-box protein 1 (Rbx1)
           (LOC565545), mRNA
          Length = 544

 Score =  133 bits (67), Expect = 7e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 282
           |||||||||||||| ||||||||||| |||||||| || || |||||||| | |||||| 
Sbjct: 337 tgaccatacttctgaaactcccactctctgttgtccagtggacacacttgtctggtcttc 278

                                                                       
Query: 283 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 342
           ||||| |||  |||||||||||| || || || || ||||| |||||||| || || || 
Sbjct: 277 agccagcgggagatgcagtggaaatgaaaagcgtgattgcagactccccaggccaccgta 218

                                                                       
Query: 343 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 402
           ||||||||   ||||||    ||||| || ||||| ||||| || ||||||||||| |||
Sbjct: 217 cactcctctgaggtggcagacgcctgattggcctgacactcaatacagaggtccataatg 158

                                                                       
Query: 403 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 462
           || || | ||||||||| |||||||| || || |||||||| ||||| || || || |||
Sbjct: 157 tgatttctgcagatggcacagttgtccactacaatgtcccatgcccacagagccacagcg 98

                      
Query: 463 ttccacttttt 473
           |||||||||||
Sbjct: 97  ttccacttttt 87

to top

>gb|BC107831.1| Danio rerio im:7137515, mRNA (cDNA clone IMAGE:7221021), partial
           cds
          Length = 570

 Score =  133 bits (67), Expect = 7e-28
 Identities = 205/251 (81%)
 Strand = Plus / Minus

                                                                       
Query: 223 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 282
           |||||||||||||| ||||||||||| |||||||| || || |||||||| | |||||| 
Sbjct: 366 tgaccatacttctgaaactcccactctctgttgtccagtggacacacttgtctggtcttc 307

                                                                       
Query: 283 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 342
           ||||| |||  |||||||||||| || || || || ||||| |||||||| || || || 
Sbjct: 306 agccagcgggagatgcagtggaaatgaaaagcgtgattgcagactccccaggccaccgta 247

                                                                       
Query: 343 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 402
           ||||||||   ||||||    ||||| || ||||| ||||| || ||||||||||| |||
Sbjct: 246 cactcctctgaggtggcagacgcctgattggcctgacactcaatacagaggtccataatg 187

                                                                       
Query: 403 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 462
           || || | ||||||||| |||||||| || || |||||||| ||||| || || || |||
Sbjct: 186 tgatttctgcagatggcacagttgtccactacaatgtcccatgcccacagagccacagcg 127

                      
Query: 463 ttccacttttt 473
           |||||||||||
Sbjct: 126 ttccacttttt 116

to top

>emb|CR659962.2|CNS0F874 Tetraodon nigroviridis full-length cDNA
          Length = 472

 Score =  127 bits (64), Expect = 4e-26
 Identities = 202/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||| ||||| ||||||||||| | |||||| || |||||||| ||   ||| || | |
Sbjct: 344 ccatatttctgaaactcccactcccggttgtccagtgggcacacctgtttggttttcaac 285

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || |||  ||| |||||||||||||| ||||||||||| || ||||| || || ||||||
Sbjct: 284 cagcgggagatacagtggaagtggaacgcatggttgcacacaccccaggccaccgtgcac 225

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           |||||    |||||    |||||||| |||||||| || || || || ||||||||||||
Sbjct: 224 tcctcagatgtggcagaagcctggttggcctggcattctatacacagatccatgatgtgg 165

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||||||
Sbjct: 164 ttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagcgttc 105

                   
Query: 466 cacttttt 473
           || |||||
Sbjct: 104 catttttt 97

to top

>ref|XM_382673.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG02497.1)
           partial mRNA
          Length = 333

 Score =  119 bits (60), Expect = 1e-23
 Identities = 156/188 (82%)
 Strand = Plus / Minus

                                                                       
Query: 295 atgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcgctg 354
           ||||| ||||||||||||||||||||||| |  ||||| || || ||||| || ||||||
Sbjct: 257 atgcaatggaagtggaatgcatggttgcagataccccaggccacagtgcattcttcgctg 198

                                                                       
Query: 355 gtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggcag 414
           || ||    || ||||||||||| || || ||||| || ||||| ||||| || ||||||
Sbjct: 197 gtagcagatgcttggttcgcctgacattctatgcacagatccataatgtgattacggcag 138

                                                                       
Query: 415 atggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccactttttg 474
           ||||||||||| ||||||||||| ||||| ||||| || || || ||||||||||| |||
Sbjct: 137 atggcgcagttatcgaccacgatatcccaagcccaaagggctacagcgttccacttcttg 78

                   
Query: 475 atctcgaa 482
           | ||||||
Sbjct: 77  acctcgaa 70

to top

>ref|NM_001034135.1| Rattus norvegicus ring-box 1 (Rbx1), mRNA
          Length = 1549

 Score =  119 bits (60), Expect = 1e-23
 Identities = 201/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           |||||||| |||||||||||||| |||||||| |  |||||||| || | ||| ||||||
Sbjct: 325 ccatacttttggaactcccactctctgttgtccaaggggcacacctgcctggttttgagc 266

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || ||   |||||||||||| || || || ||||| || ||||||||||| || ||||||
Sbjct: 265 caccgagagatgcagtggaaatgaaaagcgtggttacagactccccaagcaaccgtgcac 206

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           || ||    || ||   ||||||||| ||||| |||||||| || || ||||| ||||||
Sbjct: 205 tcttccgaagtagctgaggcctggttggcctgacactcgatacaaagatccataatgtgg 146

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| ||||| || ||||| || |||||||||||||| || || || |||
Sbjct: 145 ttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctactgcattc 86

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 85  cacttttt 78

to top

>gb|BC100258.1| Rattus norvegicus ring-box 1, mRNA (cDNA clone MGC:116275
           IMAGE:7444286), complete cds
          Length = 1549

 Score =  119 bits (60), Expect = 1e-23
 Identities = 201/248 (81%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           |||||||| |||||||||||||| |||||||| |  |||||||| || | ||| ||||||
Sbjct: 325 ccatacttttggaactcccactctctgttgtccaaggggcacacctgcctggttttgagc 266

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || ||   |||||||||||| || || || ||||| || ||||||||||| || ||||||
Sbjct: 265 caccgagagatgcagtggaaatgaaaagcgtggttacagactccccaagcaaccgtgcac 206

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           || ||    || ||   ||||||||| ||||| |||||||| || || ||||| ||||||
Sbjct: 205 tcttccgaagtagctgaggcctggttggcctgacactcgatacaaagatccataatgtgg 146

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| ||||| || ||||| || |||||||||||||| || || || |||
Sbjct: 145 ttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctactgcattc 86

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 85  cacttttt 78

to top

>gb|AY440092.1| Armigeres subalbatus ASAP ID: 42179 ubiquitin ligase mRNA sequence
          Length = 559

 Score =  115 bits (58), Expect = 2e-22
 Identities = 220/274 (80%)
 Strand = Plus / Minus

                                                                       
Query: 215 catcttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgac 274
           |||| ||||| ||||| |||||||||||||| || ||||| || | ||| || ||||| |
Sbjct: 429 catcctagtgtccatatttctggaactcccattccctgttatccaaaggacagacttgtc 370

                                                                       
Query: 275 gggtcttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaag 334
           | ||||| |||||||||  |||||||||||| ||||||||||| ||||| || ||||| |
Sbjct: 369 gtgtctttagccaacgggagatgcagtggaaatggaatgcatgattgcagacaccccagg 310

                                                                       
Query: 335 cgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggt 394
           | || ||||||||||||||||| ||    || || || |||||||| |||||||| |  |
Sbjct: 309 ccactgtgcactcctcgctggtagcagaagcttgattagcctggcattcgatgcataaat 250

                                                                       
Query: 395 ccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcg 454
           |||| || ||  | || || || ||||||||||| || || |||||||| ||||| | ||
Sbjct: 249 ccataatatgactacgacaaatagcgcagttgtccacaacaatgtcccaagcccacaacg 190

                                             
Query: 455 cgacggcgttccactttttgatctcgaagcgctt 488
           | || || ||||||||||| | |||||| |||||
Sbjct: 189 ctacagcattccactttttcacctcgaaccgctt 156

to top

>ref|XM_748960.1| Aspergillus fumigatus Af293 ubiquitin ligase subunit HrtA
           (Afu5g05790) partial mRNA
          Length = 363

 Score =  113 bits (57), Expect = 6e-22
 Identities = 99/113 (87%)
 Strand = Plus / Minus

                                                                       
Query: 370 ttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtcg 429
           |||||||||||||| || || |  ||||||||||||||||||||||| || |||||||||
Sbjct: 212 ttcgcctggcactcaatacacaaatccatgatgtggttgcggcagattgcacagttgtcg 153

                                                                
Query: 430 accacgatgtcccaggcccagagcgcgacggcgttccactttttgatctcgaa 482
           || ||||| ||||||||||| |  |||||||| ||||||||||||| ||||||
Sbjct: 152 acgacgatatcccaggcccacaaagcgacggcattccactttttgacctcgaa 100



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 295 atgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctc 350
           |||||||| || ||||||||||||||||||| |||||| || || |||||||||||
Sbjct: 287 atgcagtgaaaatggaatgcatggttgcaaattccccaggctactgtgcactcctc 232

to top

>ref|NM_114151.1| Arabidopsis thaliana ubiquitin-protein ligase AT3G42830 mRNA,
           complete cds
          Length = 348

 Score =  111 bits (56), Expect = 2e-21
 Identities = 194/240 (80%)
 Strand = Plus / Minus

                                                                       
Query: 219 ttagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggt 278
           |||||||||||| |||||||| |||||||||| |   ||||| || ||||||||||| ||
Sbjct: 348 ttagtgaccatatttctggaattcccactcgcagacatctagtggacacacttgacgagt 289

                                                                       
Query: 279 cttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgac 338
            |||||||| | |||||| ||||||||||| || || ||||||||||| |||||||| ||
Sbjct: 288 tttgagccatctgctgatacagtggaagtgaaaggcgtggttgcaaaccccccaagcaac 229

                                                                       
Query: 339 ggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccat 398
            ||||| ||||| || ||||| || || || || ||  | || || || ||||| |||||
Sbjct: 228 agtgcattcctcactagtggcactagcttgattagctagacattcaatacagagatccat 169

                                                                       
Query: 399 gatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 458
           |||||| || |  || || |||||||| || || ||||| ||||| |||||||| |||||
Sbjct: 168 gatgtgattcctacaaattgcgcagttatcaacaacgatatcccaagcccagagagcgac 109

to top

>gb|BC051473.1| Mus musculus ring-box 1, mRNA (cDNA clone MGC:62905 IMAGE:1430400),
           complete cds
          Length = 531

 Score =  111 bits (56), Expect = 2e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 332 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 273

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 272 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 213

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 212 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 153

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 152 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 93

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 92  cacttttt 85

to top

>ref|NM_019712.2| Mus musculus ring-box 1 (Rbx1), mRNA
          Length = 1612

 Score =  111 bits (56), Expect = 2e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 320 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 261

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 260 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 201

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 200 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 141

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 140 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 81

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 80  cacttttt 73

to top

>gb|BC083057.1| Mus musculus ring-box 1, mRNA (cDNA clone IMAGE:5329240), ****
           WARNING: chimeric clone ****
          Length = 2818

 Score =  111 bits (56), Expect = 2e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 325 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 266

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 265 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 206

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 205 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 146

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 145 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 86

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 85  cacttttt 78

to top

>gb|BC056992.1| Mus musculus ring-box 1, mRNA (cDNA clone MGC:66938 IMAGE:6818827),
           complete cds
          Length = 1612

 Score =  111 bits (56), Expect = 2e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 320 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 261

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 260 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 201

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 200 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 141

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 140 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 81

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 80  cacttttt 73

to top

>dbj|AK152012.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830045D16 product:ring-box 1,
           full insert sequence
          Length = 503

 Score =  111 bits (56), Expect = 2e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 334 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 275

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 274 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 215

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 214 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 155

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 154 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 95

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 94  cacttttt 87

to top

>dbj|AK159571.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched
           library, clone:I420024J09 product:ring-box 1, full
           insert sequence
          Length = 503

 Score =  111 bits (56), Expect = 2e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 334 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 275

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 274 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 215

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 214 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 155

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 154 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 95

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 94  cacttttt 87

to top

>gb|BC027396.1| Mus musculus ring-box 1, mRNA (cDNA clone MGC:35907 IMAGE:4952242),
           complete cds
          Length = 1616

 Score =  111 bits (56), Expect = 2e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 326 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 267

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 266 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 207

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 206 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 147

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 146 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 87

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 86  cacttttt 79

to top

>gb|AF140599.1|AF140599 Mus musculus ring-box protein 1 (Rbx1) mRNA, complete cds
          Length = 504

 Score =  111 bits (56), Expect = 2e-21
 Identities = 200/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 337 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 278

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 277 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 218

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 217 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 158

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| ||||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 157 ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggccactgcattc 98

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 97  cacttttt 90

to top

>ref|XM_957982.1| Neurospora crassa OR74A hypothetical protein (NCU06224.1) partial
           mRNA
          Length = 351

 Score =  109 bits (55), Expect = 1e-20
 Identities = 202/251 (80%)
 Strand = Plus / Minus

                                                                       
Query: 232 ttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaacgg 291
           |||||||||||||| || |||||||| |||||||| |||||||| | ||||||||| |  
Sbjct: 338 ttctggaactcccaatctctgttgtcgagagggcatacttgacgcgccttgagccatctc 279

                                                                       
Query: 292 ctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcg 351
             |||||| ||||| ||||| ||||| |||||||  ||||| || || ||||| || || 
Sbjct: 278 gagatgcaatggaaatggaacgcatgattgcaaataccccacgcaaccgtgcattcttct 219

                                                                       
Query: 352 ctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcgg 411
             ||||||    | |||||| ||||||||||| || || || |||||||| ||||| || 
Sbjct: 218 gaggtggccgatgactggttggcctggcactcaatacacagatccatgatatggtttcga 159

                                                                       
Query: 412 cagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttt 471
           |||||||| ||||||||||| || || ||||| ||||| || || || ||||||||||| 
Sbjct: 158 cagatggcacagttgtcgacgacaatatcccaagcccaaagggccaccgcgttccacttc 99

                      
Query: 472 ttgatctcgaa 482
           |||| ||||||
Sbjct: 98  ttgacctcgaa 88

to top

>ref|XM_326078.1| Neurospora crassa OR74A hypothetical protein (NCU06224.1) partial
           mRNA
          Length = 351

 Score =  109 bits (55), Expect = 1e-20
 Identities = 202/251 (80%)
 Strand = Plus / Minus

                                                                       
Query: 232 ttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaacgg 291
           |||||||||||||| || |||||||| |||||||| |||||||| | ||||||||| |  
Sbjct: 338 ttctggaactcccaatctctgttgtcgagagggcatacttgacgcgccttgagccatctc 279

                                                                       
Query: 292 ctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcg 351
             |||||| ||||| ||||| ||||| |||||||  ||||| || || ||||| || || 
Sbjct: 278 gagatgcaatggaaatggaacgcatgattgcaaataccccacgcaaccgtgcattcttct 219

                                                                       
Query: 352 ctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcgg 411
             ||||||    | |||||| ||||||||||| || || || |||||||| ||||| || 
Sbjct: 218 gaggtggccgatgactggttggcctggcactcaatacacagatccatgatatggtttcga 159

                                                                       
Query: 412 cagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttt 471
           |||||||| ||||||||||| || || ||||| ||||| || || || ||||||||||| 
Sbjct: 158 cagatggcacagttgtcgacgacaatatcccaagcccaaagggccaccgcgttccacttc 99

                      
Query: 472 ttgatctcgaa 482
           |||| ||||||
Sbjct: 98  ttgacctcgaa 88

to top

>gb|DQ446722.1| Arabidopsis thaliana clone pENTR221-At3g42830 ring-box protein
           Roc1/Rbx1/Hrt1 (At3g42830) mRNA, complete cds
          Length = 348

 Score =  107 bits (54), Expect = 4e-20
 Identities = 192/238 (80%)
 Strand = Plus / Minus

                                                                       
Query: 221 agtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtct 280
           |||||||||| |||||||| |||||||||| |   ||||| || ||||||||||| || |
Sbjct: 346 agtgaccatatttctggaattcccactcgcagacatctagtggacacacttgacgagttt 287

                                                                       
Query: 281 tgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacgg 340
           ||||||| | |||||| ||||||||||| || || ||||||||||| |||||||| || |
Sbjct: 286 tgagccatctgctgatacagtggaagtgaaaggcgtggttgcaaaccccccaagcaacag 227

                                                                       
Query: 341 tgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatga 400
           |||| ||||| || ||||| || || || || ||  | || || || ||||| |||||||
Sbjct: 226 tgcattcctcactagtggcactagcttgattagctagacattcaatacagagatccatga 167

                                                                     
Query: 401 tgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgac 458
           |||| || |  || || |||||||| || || ||||| ||||| |||||||| |||||
Sbjct: 166 tgtgattcctacaaattgcgcagttatcaacaacgatatcccaagcccagagagcgac 109

to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
              complete sequence
          Length = 43261740

 Score =  105 bits (53), Expect = 1e-19
 Identities = 59/61 (96%)
 Strand = Plus / Minus

                                                                          
Query: 328    ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 387
              ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 371384 ccccaagcgacagtgcactcctcactggtggcgctggcctggttcgcctggcactcgatg 371325

               
Query: 388    c 388
              |
Sbjct: 371324 c 371324



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                                
Query: 440    cccaggcccagagcgcgacggcgttccactttttgatctcgaagcgcttg 489
              |||| |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 371070 cccatgcccagagcgcgacggcgttccacttcttgatctcgaagcgcttg 371021



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 43/44 (97%)
 Strand = Plus / Minus

                                                          
Query: 394    tccatgatgtggttgcggcagatggcgcagttgtcgaccacgat 437
              |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 371213 tccatgatgtggttgcggcagatggcgcagttgtcgacgacgat 371170



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                      
Query: 262    gggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatg 317
              ||||||||||| || ||||||||||| | ||||||||| |||||||| || |||||
Sbjct: 373024 gggcacacttggcgagtcttgagccacctgctgatgcaatggaagtgaaaagcatg 372969



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 501     gccggcgccggcgcaggaggaggagg 526
               |||||||||||||| |||||||||||
Sbjct: 7452183 gccggcgccggcgccggaggaggagg 7452208

to top

>dbj|AP002863.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0005A05
          Length = 190834

 Score =  105 bits (53), Expect = 1e-19
 Identities = 59/61 (96%)
 Strand = Plus / Minus

                                                                          
Query: 328    ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 387
              ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 123222 ccccaagcgacagtgcactcctcactggtggcgctggcctggttcgcctggcactcgatg 123163

               
Query: 388    c 388
              |
Sbjct: 123162 c 123162



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                                
Query: 440    cccaggcccagagcgcgacggcgttccactttttgatctcgaagcgcttg 489
              |||| |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 122908 cccatgcccagagcgcgacggcgttccacttcttgatctcgaagcgcttg 122859



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 43/44 (97%)
 Strand = Plus / Minus

                                                          
Query: 394    tccatgatgtggttgcggcagatggcgcagttgtcgaccacgat 437
              |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 123051 tccatgatgtggttgcggcagatggcgcagttgtcgacgacgat 123008



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                      
Query: 262    gggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatg 317
              ||||||||||| || ||||||||||| | ||||||||| |||||||| || |||||
Sbjct: 124862 gggcacacttggcgagtcttgagccacctgctgatgcaatggaagtgaaaagcatg 124807

to top

>dbj|AP002845.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0482C06
          Length = 182779

 Score =  105 bits (53), Expect = 1e-19
 Identities = 59/61 (96%)
 Strand = Plus / Minus

                                                                         
Query: 328   ccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatg 387
             ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||
Sbjct: 11585 ccccaagcgacagtgcactcctcactggtggcgctggcctggttcgcctggcactcgatg 11526

              
Query: 388   c 388
             |
Sbjct: 11525 c 11525



 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 48/50 (96%)
 Strand = Plus / Minus

                                                               
Query: 440   cccaggcccagagcgcgacggcgttccactttttgatctcgaagcgcttg 489
             |||| |||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 11271 cccatgcccagagcgcgacggcgttccacttcttgatctcgaagcgcttg 11222



 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 43/44 (97%)
 Strand = Plus / Minus

                                                         
Query: 394   tccatgatgtggttgcggcagatggcgcagttgtcgaccacgat 437
             |||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 11414 tccatgatgtggttgcggcagatggcgcagttgtcgacgacgat 11371



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                     
Query: 262   gggcacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatg 317
             ||||||||||| || ||||||||||| | ||||||||| |||||||| || |||||
Sbjct: 13225 gggcacacttggcgagtcttgagccacctgctgatgcaatggaagtgaaaagcatg 13170

to top

>dbj|AK003159.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1100001E18 product:ring-box 1,
           full insert sequence
          Length = 507

 Score =  103 bits (52), Expect = 6e-19
 Identities = 199/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 339 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 280

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 279 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 220

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 219 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 160

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | |||||||||  |||| || ||||| ||||||||||||||||| || || || |||
Sbjct: 159 ttcctgcagatggcaaagttatcaaccacaatgtcccaggcccagagggccactgcattc 100

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 99  cacttttt 92

to top

>dbj|AK004114.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110035J03 product:ring-box 1,
           full insert sequence
          Length = 969

 Score =  103 bits (52), Expect = 6e-19
 Identities = 199/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 341 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 282

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 281 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 222

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 221 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 162

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| ||||| || ||||| |||||||| |||||||| || || || |||
Sbjct: 161 ttcctgcagatggcacagttatcaaccacaatgtcccacgcccagagggccactgcattc 102

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 101 cacttttt 94

to top

>dbj|AK183716.1| Mus musculus cDNA, clone:Y0G0126N24, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000023036, based on BLAT search
          Length = 416

 Score =  103 bits (52), Expect = 6e-19
 Identities = 199/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 271 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 212

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 211 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 152

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 151 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 92

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| ||||| || ||||| ||||||||||||||||| |  || || |||
Sbjct: 91  ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggtcactgcattc 32

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 31  cacttttt 24

to top

>dbj|AK182752.1| Mus musculus cDNA, clone:Y0G0123J24, strand:plus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000023036, based on BLAT search
          Length = 398

 Score =  103 bits (52), Expect = 6e-19
 Identities = 199/248 (80%)
 Strand = Plus / Minus

                                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
           ||||||||||||||||||||||| |||||||| |  || ||||| || |  || ||||||
Sbjct: 271 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctcgttttgagc 212

                                                                       
Query: 286 caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
           || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 211 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 152

                                                                       
Query: 346 tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
           || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 151 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 92

                                                                       
Query: 406 ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
           || | ||||||||| ||||| || ||||| ||||||||||||||||| |  || || |||
Sbjct: 91  ttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagggtcactgcattc 32

                   
Query: 466 cacttttt 473
           ||||||||
Sbjct: 31  cacttttt 24

to top

>gb|DQ311404.1| Bombyx mori ring box protein mRNA, complete cds
          Length = 1058

 Score =  101 bits (51), Expect = 2e-18
 Identities = 201/251 (80%)
 Strand = Plus / Minus

                                                                       
Query: 223 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 282
           ||||||||||| ||||||||||| || || |||||||| || || ||||| || ||||| 
Sbjct: 721 tgaccatacttttggaactcccattctctattgtctagtggacaaacttgtcgagtcttc 662

                                                                       
Query: 283 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 342
           | |||||||   || |||||||| ||||||||||| || ||||| |||||||| || |||
Sbjct: 661 aaccaacgggaaatacagtggaaatggaatgcatgattacaaacaccccaagcaactgtg 602

                                                                       
Query: 343 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 402
           || || || || |||||   ||| || || || ||||| ||||| || || ||||| |||
Sbjct: 601 cattcttcactagtggctgaggcttgatttgcttggcattcgatacacagatccattatg 542

                                                                       
Query: 403 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 462
           || || ||||| || || ||||||||||| || || ||||| |||||||| || || || 
Sbjct: 541 tgatttcggcaaatagcacagttgtcgacaacaatatcccaagcccagagtgctactgca 482

                      
Query: 463 ttccacttttt 473
           |||||||||||
Sbjct: 481 ttccacttttt 471

to top

>ref|NM_073095.4| Caenorhabditis elegans yeast RBX (ring finger protein) homolog
           family member (rbx-1) (rbx-1) mRNA, complete cds
          Length = 664

 Score =  101 bits (51), Expect = 2e-18
 Identities = 102/119 (85%)
 Strand = Plus / Minus

                                                                       
Query: 370 ttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtcg 429
           ||||| |||||||||||||| || ||||||||||| |||||||| || ||||||||||||
Sbjct: 277 ttcgcttggcactcgatgcacagatccatgatgtgattgcggcaaatagcgcagttgtcg 218

                                                                      
Query: 430 accacgatgtcccaggcccagagcgcgacggcgttccactttttgatctcgaagcgctt 488
           |||   |||||||||||||| || ||||||||  |||| || |||| |||||| |||||
Sbjct: 217 acctgaatgtcccaggcccaaagtgcgacggcactccatttcttgacctcgaaacgctt 159

to top

>gb|AC084553.1|CBRG33P21 Caenorhabditis briggsae cosmid G33P21, complete sequence
          Length = 40197

 Score =  101 bits (51), Expect = 2e-18
 Identities = 90/103 (87%)
 Strand = Plus / Minus

                                                                        
Query: 373  gcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtcgacc 432
            ||||||||||||||||| || ||||||||||| |||||||| ||||||||||||||||| 
Sbjct: 5345 gcctggcactcgatgcacagatccatgatgtgattgcggcaaatggcgcagttgtcgact 5286

                                                       
Query: 433  acgatgtcccaggcccagagcgcgacggcgttccactttttga 475
               |||||||| |||||||| ||||| ||  ||||||||||||
Sbjct: 5285 tgaatgtcccacgcccagagagcgacagcactccactttttga 5243



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 271  tgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatggttgca 323
            ||||| ||||||||||||||   |||||||||||| ||||| ||||| |||||
Sbjct: 5447 tgacgtgtcttgagccaacgagagatgcagtggaaatggaacgcatgattgca 5395

to top

>dbj|AB077287.1| Caenorhabditis elegans Ce-rbx-1 mRNA for RING-H2 finger protein
           Rbx1, complete cds
          Length = 361

 Score =  101 bits (51), Expect = 2e-18
 Identities = 102/119 (85%)
 Strand = Plus / Minus

                                                                       
Query: 370 ttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtcg 429
           ||||| |||||||||||||| || ||||||||||| |||||||| || ||||||||||||
Sbjct: 181 ttcgcttggcactcgatgcacagatccatgatgtgattgcggcaaatagcgcagttgtcg 122

                                                                      
Query: 430 accacgatgtcccaggcccagagcgcgacggcgttccactttttgatctcgaagcgctt 488
           |||   |||||||||||||| || ||||||||  |||| || |||| |||||| |||||
Sbjct: 121 acctgaatgtcccaggcccaaagtgcgacggcactccatttcttgacctcgaaacgctt 63

to top

>ref|NM_014248.2| Homo sapiens ring-box 1 (RBX1), mRNA
          Length = 521

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 344 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 285

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 284 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 225

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 224 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 165

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 164 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 105

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 104 gcattccacttttt 91

to top

>ref|XM_597082.2| PREDICTED: Bos taurus similar to RING-box protein 1 (Rbx1),
           transcript variant 1 (LOC518880), mRNA
          Length = 832

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 356 tagtgcccatacttttggaattcccactctctgttgtccaacggacacacctgccgtgtt 297

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||   ||||||||||||||| || |||||||| || || ||||| || |||
Sbjct: 296 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagacgccccacgccacg 237

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           |||||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 236 gtgcactcttcagaagtagcggacgcctggttggcttgacattctatgcaaagatccata 177

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 176 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 117

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 116 gcattccacttttt 103

to top

>gb|BC017370.1| Homo sapiens ring-box 1, mRNA (cDNA clone IMAGE:4065797), partial
           cds
          Length = 554

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 348 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 289

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 288 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 229

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 228 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 169

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 168 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 109

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 108 gcattccacttttt 95

to top

>gb|BC105329.1| Bos taurus similar to RING-box protein 1 (Rbx1), transcript variant
           1, mRNA (cDNA clone MGC:127542 IMAGE:7949130), complete
           cds
          Length = 1504

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 348 tagtgcccatacttttggaattcccactctctgttgtccaacggacacacctgccgtgtt 289

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||   ||||||||||||||| || |||||||| || || ||||| || |||
Sbjct: 288 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagacgccccacgccacg 229

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           |||||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 228 gtgcactcttcagaagtagcggacgcctggttggcttgacattctatgcaaagatccata 169

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 168 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 109

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 108 gcattccacttttt 95

to top

>gb|AY099360.1| Homo sapiens ZYP protein mRNA, partial cds
          Length = 306

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 289 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 230

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 229 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 170

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 169 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 110

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 109 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 50

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 49  gcattccacttttt 36

to top

>gb|BC001466.2| Homo sapiens ring-box 1, mRNA (cDNA clone MGC:1481 IMAGE:3138751),
           complete cds
          Length = 535

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 331 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 272

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 271 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 212

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 211 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 152

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 151 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 92

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 91  gcattccacttttt 78

to top

>gb|AF142059.1|AF142059 Homo sapiens RING finger protein (ROC1) mRNA, complete cds
          Length = 327

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 326 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 267

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 266 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 207

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 206 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 147

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 146 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 87

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 86  gcattccacttttt 73

to top

>emb|CR456560.1| Homo sapiens RBX1 full length open reading frame (ORF) cDNA clone
           (cDNA clone C22ORF:pGEM.RBX1)
          Length = 535

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 344 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 285

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 284 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 225

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 224 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 165

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 164 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 105

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 104 gcattccacttttt 91

to top

>gb|AF140598.1|AF140598 Homo sapiens ring-box protein 1 (RBX1) mRNA, complete cds
          Length = 508

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 332 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 273

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 272 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 213

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 212 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 153

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 152 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 93

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 92  gcattccacttttt 79

to top

>gb|AF085906.1|HUMYQ60A05 Homo sapiens full length insert cDNA clone YQ60A05
          Length = 497

 Score = 99.6 bits (50), Expect = 9e-18
 Identities = 203/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 307 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 248

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 247 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 188

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 187 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 128

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 127 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 68

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 67  gcattccacttttt 54

to top

>gb|AC112970.18| Mus musculus chromosome 17, clone RP24-443D19, complete sequence
          Length = 172747

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 198/248 (79%)
 Strand = Plus / Minus

                                                                          
Query: 226    ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
              ||||||||||||||||||||||| |||||||| |  || ||||| || |   | ||||||
Sbjct: 114187 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctctttttgagc 114128

                                                                          
Query: 286    caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
              || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 114127 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 114068

                                                                          
Query: 346    tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
              || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 114067 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 114008

                                                                          
Query: 406    ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
              || | ||||||||| ||||| || ||||| |||| |||||||||||| || || || |||
Sbjct: 114007 ttcctgcagatggcacagttatcaaccacaatgttccaggcccagagggccacagcattc 113948

                      
Query: 466    cacttttt 473
              ||||||||
Sbjct: 113947 cacttttt 113940

to top

>emb|Z70757.1|CEZK287 Caenorhabditis elegans Cosmid ZK287, complete sequence
          Length = 39874

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 81/92 (88%)
 Strand = Plus / Plus

                                                                         
Query: 370   ttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtcg 429
             ||||| |||||||||||||| || ||||||||||| |||||||| || ||||||||||||
Sbjct: 27216 ttcgcttggcactcgatgcacagatccatgatgtgattgcggcaaatagcgcagttgtcg 27275

                                             
Query: 430   accacgatgtcccaggcccagagcgcgacggc 461
             |||   |||||||||||||| || ||||||||
Sbjct: 27276 acctgaatgtcccaggcccaaagtgcgacggc 27307

to top

>emb|CR974451.9| Mouse DNA sequence from clone RP24-180B11 on chromosome 17, complete
              sequence
          Length = 188873

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 198/248 (79%)
 Strand = Plus / Plus

                                                                          
Query: 226    ccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagc 285
              ||||||||||||||||||||||| |||||||| |  || ||||| || |   | ||||||
Sbjct: 160026 ccatacttctggaactcccactctctgttgtccaacggacacacctgcctctttttgagc 160085

                                                                          
Query: 286    caacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcac 345
              || ||   |||||||||||| || || ||||||||||| |||||||| || || || |||
Sbjct: 160086 catcgagagatgcagtggaaatgaaaagcatggttgcagactccccatgcaaccgtacac 160145

                                                                          
Query: 346    tcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtgg 405
              || |||   || ||    |||||||| ||||| || ||||| || || ||||| ||||||
Sbjct: 160146 tcttcggaagtagctgacgcctggttggcctgacattcgatacaaagatccataatgtgg 160205

                                                                          
Query: 406    ttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttc 465
              || | ||||||||| ||||| || ||||| |||| |||||||||||| || || || |||
Sbjct: 160206 ttcctgcagatggcacagttatcaaccacaatgttccaggcccagagggccacagcattc 160265

                      
Query: 466    cacttttt 473
              ||||||||
Sbjct: 160266 cacttttt 160273

to top

>ref|XM_515153.1| PREDICTED: Pan troglodytes similar to RBX1 protein (LOC458860),
           mRNA
          Length = 1436

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 866 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 807

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||    |||||||||||||| || |||||||| || |||||||| ||||| 
Sbjct: 806 ttgagccagcgagaaatgcagtggaagtgaaaagcatggttacagactccccatgcgaca 747

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           || ||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 746 gtacactcttctgaagtagcggacgcctggttagcttgacattctatgcaaagatccata 687

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 686 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 627

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 626 gcattccacttttt 613

to top

>ref|XM_881804.1| PREDICTED: Bos taurus similar to RING-box protein 1 (Rbx1),
           transcript variant 2 (LOC518880), mRNA
          Length = 862

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 199/250 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 472 tagtgcccatacttttggaattcccactctctgttgtccaacggacacacctgccgtgtt 413

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||   ||||||||||||||| || |||||||| || || ||||| || |||
Sbjct: 412 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagacgccccacgccacg 353

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           |||||||| ||    || |||   |||||||| || || || || ||||| || ||||| 
Sbjct: 352 gtgcactcttcagaagtagcggacgcctggttggcttgacattctatgcaaagatccata 293

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| || || 
Sbjct: 292 atgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagggctact 233

                     
Query: 460 gcgttccact 469
           || |||||||
Sbjct: 232 gcattccact 223

to top

>emb|CT033337.1| Platynereis dumerilii EST IB0AAA22BD06EM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 348 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 289

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 288 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 229

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 228 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 169

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 168 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 109

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 108 gcattccacttttt 95

to top

>emb|CT033336.1| Platynereis dumerilii EST IB0AAA22BD06FM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Plus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 214 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 273

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 274 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 333

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 334 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 393

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 394 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 453

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 454 gcattccacttttt 467

to top

>emb|CT032976.1| Platynereis dumerilii EST IB0AAA28CF05EM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 348 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 289

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 288 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 229

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 228 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 169

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 168 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 109

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 108 gcattccacttttt 95

to top

>emb|CT032975.1| Platynereis dumerilii EST IB0AAA28CF05FM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Plus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 214 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 273

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 274 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 333

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 334 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 393

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 394 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 453

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 454 gcattccacttttt 467

to top

>emb|CT032443.1| Platynereis dumerilii EST IB0AAA38AF03EM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 348 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 289

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 288 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 229

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 228 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 169

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 168 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 109

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 108 gcattccacttttt 95

to top

>emb|CT032442.1| Platynereis dumerilii EST IB0AAA38AF03FM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Plus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 214 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 273

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 274 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 333

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 334 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 393

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 394 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 453

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 454 gcattccacttttt 467

to top

>emb|CT032439.1| Platynereis dumerilii EST IB0AAA38AH04FM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Plus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 214 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 273

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 274 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 333

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 334 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 393

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 394 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 453

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 454 gcattccacttttt 467

to top

>emb|CT032267.1| Platynereis dumerilii EST IB0AAA42AB12EM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 348 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 289

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 288 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 229

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 228 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 169

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 168 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 109

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 108 gcattccacttttt 95

to top

>emb|CT032266.1| Platynereis dumerilii EST IB0AAA42AB12FM1
          Length = 561

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 202/254 (79%)
 Strand = Plus / Plus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| ||||||||||| || ||||| || ||||| ||||  ||||||||||| |  |||
Sbjct: 214 tagtgcccatacttctgaaattcccattctctgttatctaaggggcacacttgtctagtc 273

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           || ||||| |     |||||||| |||||||| ||||| |||||||||||||||||||| 
Sbjct: 274 ttcagccatcttgatatgcagtgaaagtggaaagcatgattgcaaactccccaagcgact 333

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||| ||||| ||||||||    || || || ||||| || || || || | |||||| 
Sbjct: 334 gtgcattcctcactggtggctgacgcttgattggcctgacattctatacacaagtccata 393

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           ||||| || |  ||||||||||||||||| || || || ||||| ||||| || || || 
Sbjct: 394 atgtgattcctacagatggcgcagttgtcaacaacaatatcccaagcccatagtgctaca 453

                         
Query: 460 gcgttccacttttt 473
           || |||||||||||
Sbjct: 454 gcattccacttttt 467

to top

>ref|XM_756798.1| Ustilago maydis 521 hypothetical protein (UM05744.1) partial mRNA
          Length = 483

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 145/179 (81%)
 Strand = Plus / Minus

                                                                       
Query: 241 tcccactcgctgttgtctagagggcacacttgacgggtcttgagccaacggctgatgcag 300
           ||||| || |||||||| || ||||| || ||||| ||||||||||| ||    ||||||
Sbjct: 389 tcccaatctctgttgtcgagcgggcatacctgacgtgtcttgagccatcgtgaaatgcag 330

                                                                       
Query: 301 tggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcgctggtggcg 360
           ||||||||||| |||||||||||    ||||||||||||||||| || ||  | || || 
Sbjct: 329 tggaagtggaaagcatggttgcattgaccccaagcgacggtgcattcttccgtagtagca 270

                                                                      
Query: 361 ctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggc 419
             | ||||||| |||||||| |||||||| || ||||| |||||||| | |||||||||
Sbjct: 269 gagccctggttggcctggcattcgatgcaaagatccataatgtggtttctgcagatggc 211

to top

>gb|DQ213704.1| Taeniopygia guttata clone 0058P0062F10 RBX1 protein-like mRNA,
           complete sequence
          Length = 519

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 212/269 (78%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||||||||| || |||||||| || || || ||||| || || 
Sbjct: 338 tagtgtccatacttttggaactcccattccctgttgtccagtggacatacttggcgtgtt 279

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||   |||||||||||||||||| || || ||||| || ||||| || || 
Sbjct: 278 ttgagccagcgagagatgcagtggaagtggaaagcgtgattgcagacgccccatgcaact 219

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||| |||||   ||| ||    || ||||| || || || || ||||| || ||||| 
Sbjct: 218 gtgcattcctcagaggtagccgatgcttggttggcttgacattctatgcacagatccata 159

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||| | ||| ||||| ||||| || ||||| |||||||| ||||| || || |||
Sbjct: 158 atgtggtttctgcaaatggcacagttatcaaccacaatgtcccatgcccacagagctacg 99

                                        
Query: 460 gcgttccactttttgatctcgaagcgctt 488
           |||||||| || || |  |||||||||||
Sbjct: 98  gcgttccatttcttcacttcgaagcgctt 70

to top

>gb|AC010010.6| Drosophila melanogaster 3L BAC RP98-13F6 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 167977

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                       
Query: 372    cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtc 428
              |||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||
Sbjct: 120733 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatggcacagttgtc 120677

to top

>ref|NM_144356.2| Drosophila melanogaster Roc1b CG16988-RA (Roc1b), mRNA
          Length = 514

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 372 cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtc 428
           |||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||
Sbjct: 269 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatggcacagttgtc 213

to top

>ref|NM_138189.2| Drosophila melanogaster CG6905-RA (CG6905), mRNA
          Length = 3359

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                     
Query: 372  cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtc 428
            |||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||
Sbjct: 2948 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatggcacagttgtc 3004

to top

>gb|AY070810.1| Drosophila melanogaster AT21612 full length cDNA
          Length = 553

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 372 cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtc 428
           |||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||
Sbjct: 269 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatggcacagttgtc 213

to top

>gb|AY061302.1| Drosophila melanogaster LD21614 full length cDNA
          Length = 3185

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Plus

                                                                     
Query: 372  cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtc 428
            |||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||
Sbjct: 2768 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatggcacagttgtc 2824

to top

>gb|AF218290.1|AF218290 Drosophila melanogaster ring finger protein ROC1B gene, complete
           cds
          Length = 750

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                    
Query: 372 cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtc 428
           |||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||
Sbjct: 397 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatggcacagttgtc 341

to top

>gb|AE003468.3| Drosophila melanogaster chromosome 3L, section 2 of 83 of the complete
             sequence
          Length = 307657

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 53/57 (92%)
 Strand = Plus / Minus

                                                                      
Query: 372   cgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtc 428
             |||||||||||||||||| |||| |||||||||||| ||||||||||| ||||||||
Sbjct: 38329 cgcctggcactcgatgcacaggttcatgatgtggttacggcagatggcacagttgtc 38273

to top

>emb|CR686693.2|CNS0FSSX Tetraodon nigroviridis full-length cDNA
          Length = 365

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 64/72 (88%)
 Strand = Plus / Minus

                                                                       
Query: 402 gtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggc 461
           |||||| | ||||||||| |||||||| ||||| |||||||||||||| ||||| || ||
Sbjct: 163 gtggttcctgcagatggcacagttgtccaccacaatgtcccaggcccacagcgccacagc 104

                       
Query: 462 gttccacttttt 473
           ||||||||||||
Sbjct: 103 gttccacttttt 92



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 226 ccatacttctggaactcccactcgctgttgtctagagggcacac 269
           ||||| ||||| ||||||||||| | |||||| || ||||||||
Sbjct: 237 ccatatttctgaaactcccactcccggttgtccagtgggcacac 194

to top

>emb|X73608.1|HSTEST H.sapiens mRNA for testican
          Length = 3484

 Score = 79.8 bits (40), Expect = 9e-12
 Identities = 145/180 (80%)
 Strand = Plus / Plus

                                                                       
Query: 294 gatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcgct 353
           ||||||||||||||| || |||||||| || |||||||| ||||| || ||||| ||   
Sbjct: 51  gatgcagtggaagtgaaaagcatggttacagactccccatgcgacagtacactcttctga 110

                                                                       
Query: 354 ggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggca 413
            || |||   |||||||| || || || || ||||| || ||||| |||||||| | |||
Sbjct: 111 agtagcggacgcctggttagcttgacattctatgcaaagatccataatgtggttcctgca 170

                                                                       
Query: 414 gatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttttt 473
           |||||| ||||| || ||||| || |||||||||||||| || || || |||||||||||
Sbjct: 171 gatggcacagttatcaaccacaatatcccaggcccagagggctactgcattccacttttt 230

to top

>ref|XM_531722.2| PREDICTED: Canis familiaris similar to RING-box protein 1 (Rbx1)
           (LOC474494), mRNA
          Length = 1469

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 189/239 (79%)
 Strand = Plus / Minus

                                                                       
Query: 235 tggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaacggctg 294
           ||||| |||||||| |||||||| |  || ||||| || || || |||||||| ||   |
Sbjct: 611 tggaattcccactctctgttgtccaacggacacacctgccgtgttttgagccagcgagag 552

                                                                       
Query: 295 atgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcgctg 354
           |||||||||||||| || |||||||| || |||||||| || || |||||||| ||    
Sbjct: 551 atgcagtggaagtgaaaagcatggttacagactccccatgcaacagtgcactcttcagaa 492

                                                                       
Query: 355 gtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggcag 414
           || ||    |||||||| || || || || ||||| || ||||| |||||||| | ||||
Sbjct: 491 gtagcagacgcctggttagcttgacattctatgcaaagatccataatgtggttcctgcag 432

                                                                      
Query: 415 atggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttttt 473
           ||||| ||||| || ||||| || |||||||||||||| || || || |||||||||||
Sbjct: 431 atggcacagttatcaaccacaatatcccaggcccagagagctactgcattccacttttt 373

to top

>emb|CT027911.1| Xenopus tropicalis finished cDNA, clone TEgg095b23
          Length = 561

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 209/266 (78%)
 Strand = Plus / Minus

                                                                       
Query: 223 tgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttg 282
           |||||||||||||| || |||||||| || || || || ||||| ||||| || ||||| 
Sbjct: 334 tgaccatacttctgaaattcccactctctattatccagcgggcaaacttgtcgagtcttc 275

                                                                       
Query: 283 agccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtg 342
           ||||| ||    ||||| |||||||| |||||||| || || || ||||| || || |||
Sbjct: 274 agccagcgtgaaatgcaatggaagtgaaatgcatgattacacacaccccatgccacagtg 215

                                                                       
Query: 343 cactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatgatg 402
           || |||||    || ||    || ||||| || |||||||| ||||| | ||||||||||
Sbjct: 214 cattcctcagaagtagcagaagcttggtttgcttggcactctatgcacaagtccatgatg 155

                                                                       
Query: 403 tggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacggcg 462
           ||||| | ||||||||| || ||||| || || |||||||||||||| || || || || 
Sbjct: 154 tggttcctgcagatggcacaattgtccactacaatgtcccaggcccaaagggcaactgca 95

                                     
Query: 463 ttccactttttgatctcgaagcgctt 488
           |||||||| || | ||| ||||||||
Sbjct: 94  ttccacttcttaacctcaaagcgctt 69

to top

>dbj|AB220470.1| Macaca fascicularis mRNA, clone QflA-19125: similar to Homo sapiens
           ring-box 1 (RBX1), mRNA, NM_014248.2
          Length = 1465

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 101/122 (82%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 339 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 280

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||   ||||||||||||||| || |||||||| || |||||||| ||||||
Sbjct: 279 ttgagccagcgagagatgcagtggaagtgaaaagcatggttacagactccccatgcgacg 220

             
Query: 340 gt 341
           ||
Sbjct: 219 gt 218



 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 364 gcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcag 423
           |||||||| || || || || ||||| || ||||| |||||||| | ||||||||| |||
Sbjct: 195 gcctggttagcttgacattctatgcaaagatccataatgtggttcctgcagatggcacag 136

                                                             
Query: 424 ttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttttt 473
           || || ||||| || |||||||||||||| || || || |||||||||||
Sbjct: 135 ttatcaaccacaatatcccaggcccagagggctactgcattccacttttt 86

to top

>dbj|AK149259.1| Mus musculus adult retina cDNA, RIKEN full-length enriched library,
            clone:A930003C07 product:ring-box 1, full insert sequence
          Length = 2670

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 89/106 (83%)
 Strand = Plus / Minus

                                                                        
Query: 364  gcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcag 423
            |||||||| ||||| || ||||| || || ||||| |||||||| | ||||||||| |||
Sbjct: 1442 gcctggttggcctgacattcgatacaaagatccataatgtggttcctgcagatggcacag 1383

                                                          
Query: 424  ttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccact 469
            || || ||||| ||||||||||||||||| || || || |||||||
Sbjct: 1382 ttatcaaccacaatgtcccaggcccagagggccactgcattccact 1337

to top

>gb|DQ306845.1| Hevea brasiliensis isolate SSH116 mRNA sequence
          Length = 330

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| ||||||||||| |||||  |||||||||||||||||| |
Sbjct: 265 tagtggccatacttttggaaatcccactcgctattgtcaggagggcacacttgacggggc 324

                 
Query: 280 ttgagc 285
           ||||||
Sbjct: 325 ttgagc 330

to top

>gb|DQ306836.1| Hevea brasiliensis isolate SSH107 mRNA sequence
          Length = 330

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||| ||||||||||| |||||  |||||||||||||||||| |
Sbjct: 265 tagtggccatacttttggaaatcccactcgctattgtcaggagggcacacttgacggggc 324

                 
Query: 280 ttgagc 285
           ||||||
Sbjct: 325 ttgagc 330

to top

>gb|DQ213705.1| Taeniopygia guttata clone 0063P0003E09 RBX1 protein-like mRNA,
           complete sequence
          Length = 527

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 211/269 (78%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| |||||||| ||||||||||| || |||||||| || || || ||||| || || 
Sbjct: 346 tagtgtccatacttttggaactcccattccctgttgtccagtggacatacttggcgtgtt 287

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||   |||||||||||||||||| || || ||||| || ||| | || || 
Sbjct: 286 ttgagccagcgagagatgcagtggaagtggaaagcgtgattgcagacgcccaatgcaact 227

                                                                       
Query: 340 gtgcactcctcgctggtggcgctggcctggttcgcctggcactcgatgcagaggtccatg 399
           ||||| |||||   ||| ||    || ||||| || || || || ||||| || ||||| 
Sbjct: 226 gtgcattcctcagaggtagccgatgcttggttggcttgacattctatgcacagatccata 167

                                                                       
Query: 400 atgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagcgcgacg 459
           |||||||| | ||| ||||| ||||| || ||||| |||||||| ||||| || || |||
Sbjct: 166 atgtggtttctgcaaatggcacagttatcaaccacaatgtcccatgcccacagagctacg 107

                                        
Query: 460 gcgttccactttttgatctcgaagcgctt 488
           |||||||| || || |  |||||||||||
Sbjct: 106 gcgttccatttcttcacttcgaagcgctt 78

to top

>emb|CT032440.1| Platynereis dumerilii EST IB0AAA38AH04EM1
          Length = 561

 Score = 73.8 bits (37), Expect = 5e-10
 Identities = 58/65 (89%)
 Strand = Plus / Minus

                                                                       
Query: 295 atgcagtggaagtggaatgcatggttgcaaactccccaagcgacggtgcactcctcgctg 354
           |||||||| |||||||| ||||| |||||||||||||||||||| ||||| |||||  ||
Sbjct: 273 atgcagtgaaagtggaaagcatgattgcaaactccccaagcgactgtgcattcctcattg 214

                
Query: 355 gtggc 359
           |||||
Sbjct: 213 gtggc 209

to top

>ref|XM_416239.1| PREDICTED: Gallus gallus similar to RBX1 protein (LOC418001), mRNA
          Length = 1242

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                        
Query: 220  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
            ||||| || ||||| ||||||||||| || |||||||| || ||||| ||||| || || 
Sbjct: 1079 tagtgtccgtacttttggaactcccattccctgttgtccagtgggcatacttggcgagtt 1020

                                                                        
Query: 280  ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
            |||||||| ||   |||||||||||||||||| || || ||||| || ||||| || || 
Sbjct: 1019 ttgagccagcgagagatgcagtggaagtggaaagcgtgattgcagacaccccatgcaacc 960

                    
Query: 340  gtgcactc 347
            ||||||||
Sbjct: 959  gtgcactc 952



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 83/104 (79%)
 Strand = Plus / Minus

                                                                       
Query: 385 atgcagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccag 444
           ||||| || ||||| || ||||| | ||| ||||| ||||| || ||||| |||||||| 
Sbjct: 914 atgcatagatccataatatggtttctgcaaatggcacagttatcaaccacaatgtcccat 855

                                                       
Query: 445 gcccagagcgcgacggcgttccactttttgatctcgaagcgctt 488
           ||||| || || || |||||||| || || |  |||||||||||
Sbjct: 854 gcccacagagctactgcgttccatttcttcacttcgaagcgctt 811

to top

>emb|CR390140.1| Gallus gallus finished cDNA, clone ChEST162j5
          Length = 484

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 105/128 (82%)
 Strand = Plus / Minus

                                                                       
Query: 220 tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
           ||||| || ||||| ||||||||||| || |||||||| || ||||| ||||| || || 
Sbjct: 321 tagtgtccgtacttttggaactcccattccctgttgtccagtgggcatacttggcgagtt 262

                                                                       
Query: 280 ttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaactccccaagcgacg 339
           |||||||| ||   |||||||||||||||||| || || ||||| || ||||| || || 
Sbjct: 261 ttgagccagcgagagatgcagtggaagtggaaagcgtgattgcagacaccccatgcaacc 202

                   
Query: 340 gtgcactc 347
           ||||||||
Sbjct: 201 gtgcactc 194



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 83/104 (79%)
 Strand = Plus / Minus

                                                                       
Query: 385 atgcagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccag 444
           ||||| || ||||| || ||||| | ||| ||||| ||||| || ||||| |||||||| 
Sbjct: 156 atgcatagatccataatatggtttctgcaaatggcacagttatcaaccacaatgtcccat 97

                                                       
Query: 445 gcccagagcgcgacggcgttccactttttgatctcgaagcgctt 488
           ||||| || || || |||||||| || || |  |||||||||||
Sbjct: 96  gcccacagagctactgcgttccatttcttcacttcgaagcgctt 53

to top

>emb|BX470254.7| Zebrafish DNA sequence from clone CH211-256M1 in linkage group 3,
             complete sequence
          Length = 146746

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 66/77 (85%)
 Strand = Plus / Minus

                                                                         
Query: 229   tacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaa 288
             |||||||| ||||||||||| |||||||| || || |||||||| | |||||| ||||| 
Sbjct: 98511 tacttctgaaactcccactctctgttgtccagtggacacacttgtctggtcttcagccag 98452

                              
Query: 289   cggctgatgcagtggaa 305
             |||  ||||||||||||
Sbjct: 98451 cgggagatgcagtggaa 98435



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                         
Query: 388   cagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcc 447
             ||||||||||| ||||| || | ||||||||| |||||||| || || |||||||| |||
Sbjct: 97428 cagaggtccataatgtgatttctgcagatggcacagttgtccactacaatgtcccatgcc 97369

                                   
Query: 448   cagagcgcgacggcgttccact 469
             || || || || ||||||||||
Sbjct: 97368 cacagagccacagcgttccact 97347

to top

>gb|AC109153.13| Mus musculus chromosome 15, clone RP23-51J23, complete sequence
          Length = 222164

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                         
Query: 394   tccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagc 453
             ||||| |||||||| | ||||||||| ||||| || ||||| ||||||||||||||||| 
Sbjct: 63642 tccataatgtggttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagg 63701

                             
Query: 454   gcgacggcgttccact 469
             || || || |||||||
Sbjct: 63702 gccactgcattccact 63717



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 229   tacttctggaactcccactcgctgttgtc 257
             |||||||||||||||||||| ||||||||
Sbjct: 57939 tacttctggaactcccactctctgttgtc 57967

to top

>emb|AL954851.5| Zebrafish DNA sequence from clone CH211-280J3, complete sequence
          Length = 177221

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 65/76 (85%)
 Strand = Plus / Plus

                                                                          
Query: 230    acttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaac 289
              ||||||| ||||||||||| |||||||| || || |||||||| | |||||| ||||| |
Sbjct: 108354 acttctgaaactcccactctctgttgtccagtggacacacttgtctggtcttcagccagc 108413

                              
Query: 290    ggctgatgcagtggaa 305
              ||  ||||||||||||
Sbjct: 108414 gggagatgcagtggaa 108429



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 69/82 (84%)
 Strand = Plus / Plus

                                                                          
Query: 388    cagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcc 447
              ||||||||||| ||||| || | ||||||||| |||||||| || || |||||||| |||
Sbjct: 109445 cagaggtccataatgtgatttctgcagatggcacagttgtccactacaatgtcccatgcc 109504

                                    
Query: 448    cagagcgcgacggcgttccact 469
              || || || || ||||||||||
Sbjct: 109505 cacagagccacagcgttccact 109526

to top

>gb|AC160528.9| Mus musculus chromosome 15, clone RP23-310L8, complete sequence
          Length = 174502

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                         
Query: 394   tccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagc 453
             ||||| |||||||| | ||||||||| ||||| || ||||| ||||||||||||||||| 
Sbjct: 18852 tccataatgtggttcctgcagatggcacagttatcaaccacaatgtcccaggcccagagg 18793

                             
Query: 454   gcgacggcgttccact 469
             || || || |||||||
Sbjct: 18792 gccactgcattccact 18777



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                          
Query: 229   tacttctggaactcccactcgctgttgtc 257
             |||||||||||||||||||| ||||||||
Sbjct: 24555 tacttctggaactcccactctctgttgtc 24527

to top

>gb|DQ103593.1| Olimarabidopsis pumila clone BAC 44L14, complete sequence
          Length = 118342

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                         
Query: 265   cacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatggttgcaa 324
             ||||||||||| ||||||||||| | ||||||||| || ||||| || || |||||||||
Sbjct: 93115 cacacttgacgagtcttgagccatctgctgatgcaatgaaagtgaaaggcgtggttgcaa 93174

               
Query: 325   ac 326
             ||
Sbjct: 93175 ac 93176



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 223   tgaccatacttctggaactcccactcgctgtt 254
             |||||||| |||||||| ||||||||||||||
Sbjct: 92982 tgaccatatttctggaattcccactcgctgtt 93013

to top

>dbj|AK005127.1| Mus musculus adult male cerebellum cDNA, RIKEN full-length enriched
           library, clone:1500002P15 product:ring-box 1, full
           insert sequence
          Length = 1623

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 364 gcctggttcgcctggcactcgatgcagaggtccatgatgtggttgcggcagatggcgcag 423
           |||||||| ||||  || ||||| || || ||||| |||||||| | |||  |||| |||
Sbjct: 204 gcctggttggcctaacattcgatacaaagatccataatgtggttcctgcaattggcacag 145

                                                             
Query: 424 ttgtcgaccacgatgtcccaggcccagagcgcgacggcgttccacttttt 473
           || || ||||| ||||||||||||||||| || || || |||||||||||
Sbjct: 144 ttatcaaccacaatgtcccaggcccagagggccactgcattccacttttt 95



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                           
Query: 226 ccatacttctggaactcccactcgctgttgtc 257
           ||||||||||||||||||||||| ||||||||
Sbjct: 341 ccatacttctggaactcccactctctgttgtc 310

to top

>emb|AL138639.1|ATT21C14 Arabidopsis thaliana DNA chromosome 3, BAC clone T21C14
          Length = 79677

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 54/62 (87%)
 Strand = Plus / Plus

                                                                         
Query: 265   cacacttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatggttgcaa 324
             ||||||||||| || |||||||| | |||||| ||||||||||| || || |||||||||
Sbjct: 61327 cacacttgacgagttttgagccatctgctgatacagtggaagtgaaaggcgtggttgcaa 61386

               
Query: 325   ac 326
             ||
Sbjct: 61387 ac 61388



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 219   ttagtgaccatacttctggaactcccactcgc 250
             |||||||||||| |||||||| ||||||||||
Sbjct: 61191 ttagtgaccatatttctggaattcccactcgc 61222

to top

>ref|XM_962490.1| PREDICTED: Tribolium castaneum similar to CG16982-PA (LOC655935),
           mRNA
          Length = 375

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 119/149 (79%)
 Strand = Plus / Minus

                                                                       
Query: 325 actccccaagcgacggtgcactcctcgctggtggcgctggcctggttcgcctggcactcg 384
           ||||||||||| || || ||||| || ||||| ||   |||||| || ||||| ||||| 
Sbjct: 236 actccccaagcaactgtacactcttcactggtcgctgaggcctgatttgcctgacactca 177

                                                                       
Query: 385 atgcagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccag 444
           || || |  ||||| || || ||||| || ||||| || || ||||||||||| ||||| 
Sbjct: 176 atacataaatccataatatgattgcgacaaatggcacaattatcgaccacgatatcccaa 117

                                        
Query: 445 gcccagagcgcgacggcgttccacttttt 473
           ||||| | ||| |||||||||||||||||
Sbjct: 116 gcccacaacgctacggcgttccacttttt 88

to top

>emb|AL080242.11|HSA554C12 Human DNA sequence from clone RP11-554C12 on chromosome 22, complete
             sequence
          Length = 46391

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                         
Query: 394   tccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggcccagagc 453
             ||||| |||||||| | ||||||||| ||||| || ||||| || |||||||||||||| 
Sbjct: 24300 tccataatgtggttcctgcagatggcacagttatcaaccacaatatcccaggcccagagg 24241

                             
Query: 454   gcgacggcgttccact 469
             || || || |||||||
Sbjct: 24240 gctactgcattccact 24225



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 72/89 (80%)
 Strand = Plus / Minus

                                                                         
Query: 229   tacttctggaactcccactcgctgttgtctagagggcacacttgacgggtcttgagccaa 288
             ||||| ||||| |||||||| |||||||| |  || ||||| || || || |||||||| 
Sbjct: 38559 tacttttggaattcccactctctgttgtccaatggacacacctgtcgtgttttgagccag 38500

                                          
Query: 289   cggctgatgcagtggaagtggaatgcatg 317
             ||   ||||||||||||||| || |||||
Sbjct: 38499 cgagagatgcagtggaagtgaaaagcatg 38471

to top

>dbj|AB225693.1| Aspergillus oryzae cDNA, contig sequence: AoEST2548
          Length = 889

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 60/71 (84%)
 Strand = Plus / Minus

                                                                       
Query: 379 cactcgatgcagaggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatg 438
           |||||||| || ||||||||||| || || ||||| || ||||| |||||||| ||||| 
Sbjct: 473 cactcgatacacaggtccatgatatgattacggcaaattgcgcaattgtcgacaacgata 414

                      
Query: 439 tcccaggccca 449
           ||||| |||||
Sbjct: 413 tcccacgccca 403

to top

>gb|AF296833.1|F7C8 Arabidopsis thaliana BAC F7C8
          Length = 70169

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                        
Query: 268   acttgacgggtcttgagccaacggctgatgcagtggaagtggaatgcatggttgcaaac 326
             |||||||| ||||| ||||| | |||||||||||| |||||||| || || ||||||||
Sbjct: 59986 acttgacgagtctttagccatctgctgatgcagtgaaagtggaaggcgtgattgcaaac 60044



 Score = 48.1 bits (24), Expect = 0.030
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                                 
Query: 219   ttagtgaccatacttctggaactcccactcgctgtt 254
             |||||||||||| ||||| ||||||||||| |||||
Sbjct: 59856 ttagtgaccatatttctgaaactcccactcactgtt 59891



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 394   tccatgatgtggttgcggcagatggcgcagttgtcgaccacgat 437
             |||||||||||||| | |||||| || |||||||| || |||||
Sbjct: 60864 tccatgatgtggtttctgcagatcgcacagttgtcaacaacgat 60907

to top

>dbj|AK090764.1| Homo sapiens cDNA FLJ33445 fis, clone BRALZ2000263
          Length = 1871

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 80/98 (81%)
 Strand = Plus / Minus

                                                                        
Query: 220  tagtgaccatacttctggaactcccactcgctgttgtctagagggcacacttgacgggtc 279
            ||||| |||||||| ||||| |||||||| |||||||| |  || ||||| || || || 
Sbjct: 1696 tagtgcccatacttttggaattcccactctctgttgtccaatggacacacctgtcgtgtt 1637

                                                  
Query: 280  ttgagccaacggctgatgcagtggaagtggaatgcatg 317
            |||||||| ||   ||||||||||||||| || |||||
Sbjct: 1636 ttgagccagcgagagatgcagtggaagtgaaaagcatg 1599

to top

>dbj|AK116119.1| Ciona intestinalis cDNA, clone:citb010m18, full insert sequence
          Length = 830

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 224 gaccatacttctggaactcccactc 248
           |||||||||||||||||||||||||
Sbjct: 364 gaccatacttctggaactcccactc 340

to top

>ref|XM_392227.2| PREDICTED: Apis mellifera similar to ENSANGP00000010437
           (LOC408691), mRNA
          Length = 731

 Score = 48.1 bits (24), Expect = 0.030
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 294 gatgcagtggaagtggaatgcatggttgcaaactccccaagcgacggt 341
           |||||| ||||| ||||||||||| ||||| || |||||||| |||||
Sbjct: 289 gatgcaatggaaatggaatgcatgattgcatacaccccaagctacggt 242

to top

>ref|NM_187604.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 897

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 501 gccggcgccggcgcaggaggaggagggggcgccgg 535
           ||||| ||||| |||||||||||||| ||||||||
Sbjct: 234 gccggtgccggtgcaggaggaggaggaggcgccgg 268

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 501     gccggcgccggcgcaggaggaggagggggcgccgg 535
               ||||| ||||| |||||||||||||| ||||||||
Sbjct: 6536202 gccggtgccggtgcaggaggaggaggaggcgccgg 6536236



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 501      gccggcgccggcgcaggaggagga 524
                ||||||||||||| ||||||||||
Sbjct: 28984586 gccggcgccggcggaggaggagga 28984609

to top

>gb|AC107226.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0081P02, complete sequence
          Length = 162425

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                
Query: 501   gccggcgccggcgcaggaggaggagggggcgccgg 535
             ||||| ||||| |||||||||||||| ||||||||
Sbjct: 78964 gccggtgccggtgcaggaggaggaggaggcgccgg 78998

to top

>gb|BC034498.1| Homo sapiens WD repeat domain 26, mRNA (cDNA clone IMAGE:4831010),
           partial cds
          Length = 2886

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 503 cggcgccggcgcaggaggaggagggggcgccgggggcca 541
           ||||| |||||  |||||||||||||||| |||||||||
Sbjct: 19  cggcggcggcggtggaggaggagggggcggcgggggcca 57

to top

>emb|AL662947.3|OSJN00148 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0073L04,
             complete sequence
          Length = 143301

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 500   agccggcgccggcgcaggaggaggagg 526
             ||||||||||||||||||| |||||||
Sbjct: 22382 agccggcgccggcgcaggaagaggagg 22356

to top

>dbj|AP007150.1| Aspergillus oryzae RIB40 genomic DNA, SC009
          Length = 1913118

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                          
Query: 391     aggtccatgatgtggttgcggcagatggcgcagttgtcgaccacgatgtcccaggccca 449
               ||||||||||| || || ||||| || ||||| |||||||| ||||| ||||| |||||
Sbjct: 1833983 aggtccatgatatgattacggcaaattgcgcaattgtcgacaacgatatcccacgccca 1834041

to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 500      agccggcgccggcgcaggaggaggagg 526
                ||||||||||||||||||| |||||||
Sbjct: 20291749 agccggcgccggcgcaggaagaggagg 20291723

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                                  
Query: 501     gccggcgccggcgcaggaggaggagggggcgccgg 535
               ||||| ||||| |||||||||||||| ||||||||
Sbjct: 6535415 gccggtgccggtgcaggaggaggaggaggcgccgg 6535449



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 501      gccggcgccggcgcaggaggagga 524
                ||||||||||||| ||||||||||
Sbjct: 29076008 gccggcgccggcggaggaggagga 29076031

to top

>gb|AF156371.1| Nicotiana tabacum clone PR29 mRNA sequence
          Length = 472

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 222 gtgaccatacttctggaactcccactcgctg 252
           ||||||||| ||||| |||||||||||||||
Sbjct: 323 gtgaccatatttctgaaactcccactcgctg 353

to top

>gb|AC099790.3| Homo sapiens chromosome 1 clone RP11-397G23, complete sequence
          Length = 213942

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                    
Query: 503   cggcgccggcgcaggaggaggagggggcgccgggggcca 541
             ||||| |||||  |||||||||||||||| |||||||||
Sbjct: 90223 cggcggcggcggtggaggaggagggggcggcgggggcca 90185

to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 347     cctcgctggtggcgctggcctgg 369
               |||||||||||||||||||||||
Sbjct: 4254043 cctcgctggtggcgctggcctgg 4254065



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 471     tttgatctcgaagcgcttgc 490
               ||||||||||||||||||||
Sbjct: 4619478 tttgatctcgaagcgcttgc 4619459

to top

>dbj|AB209887.1| Homo sapiens mRNA for WD repeat domain 26 variant protein
          Length = 6623

 Score = 46.1 bits (23), Expect = 0.12
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 503 cggcgccggcgcaggaggaggagggggcgccgggggcca 541
           ||||| |||||  |||||||||||||||| |||||||||
Sbjct: 233 cggcggcggcggtggaggaggagggggcggcgggggcca 271

to top

>ref|NM_188653.1| Oryza sativa (japonica cultivar-group), Ozsa8256 predicted mRNA
          Length = 1146

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 501 gccggcgccggcgcaggaggaggagg 526
           |||||||||||||| |||||||||||
Sbjct: 171 gccggcgccggcgccggaggaggagg 146

to top

>ref|XM_550562.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1005

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 501 gccggcgccggcgcaggaggaggagg 526
           ||||||| ||||||||||||||||||
Sbjct: 265 gccggcggcggcgcaggaggaggagg 240

to top

>ref|XM_550658.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 612

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 501 gccggcgccggcgcaggaggaggagg 526
           |||| |||||||||||||||||||||
Sbjct: 282 gccgccgccggcgcaggaggaggagg 257

to top

>ref|XM_480356.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1743

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 501  gccggcgccggcgcaggaggaggagg 526
            |||||||||||||| |||||||||||
Sbjct: 1583 gccggcgccggcgccggaggaggagg 1608

to top

>ref|XM_507147.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1120_C08.22 mRNA
          Length = 2059

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 501  gccggcgccggcgcaggaggaggagg 526
            |||||||||||||| |||||||||||
Sbjct: 1583 gccggcgccggcgccggaggaggagg 1608

to top

>gb|AC120527.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0011J22 map R10571S, complete sequence
          Length = 154441

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 501   gccggcgccggcgcaggaggaggagg 526
             |||||||||||||||||||| |||||
Sbjct: 26561 gccggcgccggcgcaggaggcggagg 26536

to top

>gb|AC147812.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0073K23
              map near R10571S, complete sequence
          Length = 161073

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 501    gccggcgccggcgcaggaggaggagg 526
              |||||||||||||||||||| |||||
Sbjct: 125862 gccggcgccggcgcaggaggcggagg 125837

to top

>gb|AY257863.1| Oryza sativa (japonica cultivar-group) chromosome 11 genomic sequence
          Length = 42748

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 501   gccggcgccggcgcaggaggaggagg 526
             |||||||||||||||||||| |||||
Sbjct: 42642 gccggcgccggcgcaggaggcggagg 42667

to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 498      gcagccggcgccggcgcaggaggagg 523
                ||||||||||||| ||||||||||||
Sbjct: 24664499 gcagccggcgccgccgcaggaggagg 24664524



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 510      ggcgcaggaggaggaggggg 529
                ||||||||||||||||||||
Sbjct: 27522539 ggcgcaggaggaggaggggg 27522558



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 503      cggcgccggcgcaggaggaggagg 526
                ||||| ||||||||||||||||||
Sbjct: 21726085 cggcggcggcgcaggaggaggagg 21726062



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 501     gccggcgccggcgcaggaggaggagggg 528
               ||||||| ||||| ||||||||||||||
Sbjct: 5699025 gccggcggcggcggaggaggaggagggg 5698998

to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
               sequence
          Length = 28386948

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 501     gccggcgccggcgcaggaggaggagg 526
               |||||||||||||||||||| |||||
Sbjct: 3288424 gccggcgccggcgcaggaggcggagg 3288449

to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 501     gccggcgccggcgcaggaggaggagg 526
               |||||||||||||| |||||||||||
Sbjct: 4576669 gccggcgccggcgccggaggaggagg 4576694

to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
               sequence
          Length = 30731886

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 501     gccggcgccggcgcaggaggaggagg 526
               |||| |||||||||||||||||||||
Sbjct: 2737834 gccgccgccggcgcaggaggaggagg 2737859



 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                         
Query: 501     gccggcgccggcgcaggaggaggagg 526
               ||||||| ||||||||||||||||||
Sbjct: 1360632 gccggcggcggcgcaggaggaggagg 1360607



 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 501     gccggcgccggcgcaggaggaggag 525
               |||| ||||||||||||||||||||
Sbjct: 7856731 gccgccgccggcgcaggaggaggag 7856755



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 503     cggcgccggcgcaggaggaggagg 526
               ||||||||||| ||||||||||||
Sbjct: 8188247 cggcgccggcggaggaggaggagg 8188224

to top

>dbj|AP002481.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
              clone:P0702F03
          Length = 141111

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 501    gccggcgccggcgcaggaggaggagg 526
              |||||||||||||| |||||||||||
Sbjct: 113211 gccggcgccggcgccggaggaggagg 113236

to top

>dbj|AP001539.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
            clone:P0708G02
          Length = 168976

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 501  gccggcgccggcgcaggaggaggagg 526
            |||||||||||||| |||||||||||
Sbjct: 975  gccggcgccggcgccggaggaggagg 1000

to top

>dbj|AP003878.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1120_C08
          Length = 150300

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 501    gccggcgccggcgcaggaggaggagg 526
              |||||||||||||| |||||||||||
Sbjct: 100517 gccggcgccggcgccggaggaggagg 100542

to top

>dbj|AP006554.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0529C07
          Length = 174011

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 501    gccggcgccggcgcaggaggaggagg 526
              |||| |||||||||||||||||||||
Sbjct: 149581 gccgccgccggcgcaggaggaggagg 149606

to top

>dbj|AP001168.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6,
             clone:P0425F02
          Length = 176979

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 501   gccggcgccggcgcaggaggaggagg 526
             ||||||| ||||||||||||||||||
Sbjct: 69171 gccggcggcggcgcaggaggaggagg 69146

to top

>dbj|AK120816.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023014O08, full
           insert sequence
          Length = 1687

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 501 gccggcgccggcgcaggaggaggagg 526
           |||||||||||||| |||||||||||
Sbjct: 504 gccggcgccggcgccggaggaggagg 479

to top

>dbj|AK102200.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033087E11, full
           insert sequence
          Length = 1005

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 501 gccggcgccggcgcaggaggaggagg 526
           ||||||| ||||||||||||||||||
Sbjct: 265 gccggcggcggcgcaggaggaggagg 240

to top

>dbj|AK072269.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023008O22, full
            insert sequence
          Length = 1743

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 501  gccggcgccggcgcaggaggaggagg 526
            |||||||||||||| |||||||||||
Sbjct: 1583 gccggcgccggcgccggaggaggagg 1608

to top

>dbj|AK070877.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023065C06, full
            insert sequence
          Length = 2059

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 501  gccggcgccggcgcaggaggaggagg 526
            |||||||||||||| |||||||||||
Sbjct: 1583 gccggcgccggcgccggaggaggagg 1608

to top

>dbj|AK069966.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023038A10, full
           insert sequence
          Length = 1917

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 498 gcagccggcgccggcgcaggaggagg 523
           ||||||||||||| ||||||||||||
Sbjct: 79  gcagccggcgccgccgcaggaggagg 54

to top

>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 501     gccggcgccggcgcaggaggaggagg 526
               |||||||||||||||||||| |||||
Sbjct: 3297137 gccggcgccggcgcaggaggcggagg 3297162

to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                          
Query: 498      gcagccggcgccggcgcaggaggagg 523
                ||||||||||||| ||||||||||||
Sbjct: 24592705 gcagccggcgccgccgcaggaggagg 24592730



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 510      ggcgcaggaggaggaggggg 529
                ||||||||||||||||||||
Sbjct: 27448097 ggcgcaggaggaggaggggg 27448116



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 503      cggcgccggcgcaggaggaggagg 526
                ||||| ||||||||||||||||||
Sbjct: 21654430 cggcggcggcgcaggaggaggagg 21654407



 Score = 40.1 bits (20), Expect = 7.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 501     gccggcgccggcgcaggaggaggagggg 528
               ||||||| ||||| ||||||||||||||
Sbjct: 5699018 gccggcggcggcggaggaggaggagggg 5698991

to top

>emb|AL954852.5|CNS08CD6 Oryza sativa chromosome 12, . BAC OJ1573_A06 of library Monsanto from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 143895

 Score = 44.1 bits (22), Expect = 0.47
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 498    gcagccggcgccggcgcaggaggagg 523
              ||||||||||||| ||||||||||||
Sbjct: 109365 gcagccggcgccgccgcaggaggagg 109390

to top

>ref|XM_466656.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1399

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 503 cggcgccggcgcaggaggaggagggggcgccgggggc 539
           ||||| |||||  |||||||||||||||| |||||||
Sbjct: 244 cggcggcggcggcggaggaggagggggcggcgggggc 208

to top

>ref|XM_506859.1| PREDICTED Oryza sativa (japonica cultivar-group), OSJNBa0030C08.39
           mRNA
          Length = 1432

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 503 cggcgccggcgcaggaggaggagggggcgccgggggc 539
           ||||| |||||  |||||||||||||||| |||||||
Sbjct: 210 cggcggcggcggcggaggaggagggggcggcgggggc 174

to top

>emb|AL160408.24| Human DNA sequence from clone RP4-781K5 on chromosome 1q42.1-43,
            complete sequence
          Length = 132887

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 510  ggcgcaggaggaggagggggcgccg 534
            |||| ||||||||||||||||||||
Sbjct: 4733 ggcggaggaggaggagggggcgccg 4757

to top

>emb|AL008726.3|HS337O18 Human DNA sequence from clone RP3-337O18 on chromosome 20q12-13.1
            Contains the PLPT gene for phospholipid transfer protein,
            the PPGB gene for protective protein for
            beta-galactosidase (galactosialidosis), the PTE1 gene for
            peroxisomal acyl-CoA thioesterase, the C20orf161 gene,
            the C20orf162 gene, the C20orf163, the C20orf164 gene,
            the C20orf165 gene, the 5' end of an variant of the TNNC2
            gene for fast troponin C2 and three CpG islands, complete
            sequence
          Length = 86080

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 508  ccggcgcaggaggaggagggg 528
            |||||||||||||||||||||
Sbjct: 6542 ccggcgcaggaggaggagggg 6522

to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 500     agccggcgccggcgcaggagg 520
               |||||||||||||||||||||
Sbjct: 5788843 agccggcgccggcgcaggagg 5788823

to top

>dbj|AP005107.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0431E05
          Length = 146091

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 501   gccggcgccggcgcaggaggaggag 525
             |||| ||||||||||||||||||||
Sbjct: 71113 gccgccgccggcgcaggaggaggag 71137

to top

>dbj|AP006438.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
              clone:OSJNBa0030C08
          Length = 163423

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                   
Query: 503    cggcgccggcgcaggaggaggagggggcgccgggggc 539
              ||||| |||||  |||||||||||||||| |||||||
Sbjct: 139647 cggcggcggcggcggaggaggagggggcggcgggggc 139683

to top

>dbj|AP004881.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0496E03
          Length = 138622

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 503   cggcgccggcgcaggaggaggagggggcgccgggggc 539
             ||||| |||||  |||||||||||||||| |||||||
Sbjct: 51945 cggcggcggcggcggaggaggagggggcggcgggggc 51981

to top

>dbj|AK105867.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-204-A08, full
           insert sequence
          Length = 1432

 Score = 42.1 bits (21), Expect = 1.9
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 503 cggcgccggcgcaggaggaggagggggcgccgggggc 539
           ||||| |||||  |||||||||||||||| |||||||
Sbjct: 210 cggcggcggcggcggaggaggagggggcggcgggggc 174


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,423,723
Number of Sequences: 3902068
Number of extensions: 4423723
Number of successful extensions: 106305
Number of sequences better than 10.0: 326
Number of HSP's better than 10.0 without gapping: 335
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 103443
Number of HSP's gapped (non-prelim): 2783
length of query: 542
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 519
effective length of database: 17,143,297,704
effective search space: 8897371508376
effective search space used: 8897371508376
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result