Clone Name | rbasd16b01 |
---|---|
Clone Library Name | barley_pub |
>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA Length = 705 Score = 563 bits (284), Expect = e-157 Identities = 301/308 (97%) Strand = Plus / Minus Query: 241 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 416 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 357 Query: 301 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 360 |||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| Sbjct: 356 gacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagcagcgct 297 Query: 361 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtct 420 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 296 cttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccagtct 237 Query: 421 cttgacgccgctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagat 480 ||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| Sbjct: 236 cttgacgccgctgcagcaggccgcaggcggtttggcgccgttgccgcgggcataggagat 177 Query: 481 gcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggcggctacgan 540 ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| Sbjct: 176 gcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggcggctacgag 117 Query: 541 gagcatgg 548 |||||||| Sbjct: 116 gagcatgg 109
>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene Length = 1862 Score = 527 bits (266), Expect = e-146 Identities = 295/306 (96%) Strand = Plus / Minus Query: 241 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 300 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1386 agtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 1327 Query: 301 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 360 ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| Sbjct: 1326 gacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgct 1267 Query: 361 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtct 420 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 1266 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtct 1207 Query: 421 cttgacgccgctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagat 480 |||||||||||||||||||||| || |||||||||||||||||||||||||||| ||||| Sbjct: 1206 cttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagat 1147 Query: 481 gcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggcggctacgan 540 ||| ||||||||||||||||||||||||||||| |||||||||||||||| |||||||| Sbjct: 1146 gcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctacgag 1087 Query: 541 gagcat 546 |||||| Sbjct: 1086 gagcat 1081
>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene Length = 1567 Score = 515 bits (260), Expect = e-143 Identities = 295/308 (95%) Strand = Plus / Minus Query: 241 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 300 |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct: 1021 agtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgct 962 Query: 301 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 360 ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| Sbjct: 961 gacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgct 902 Query: 361 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtct 420 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 901 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtct 842 Query: 421 cttgacgccgctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagat 480 |||||| ||||||||||||||| || |||||||||||||||||||||||||||| ||||| Sbjct: 841 cttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagat 782 Query: 481 gcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggcggctacgan 540 ||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| Sbjct: 781 gcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagctacgat 722 Query: 541 gagcatgg 548 |||||||| Sbjct: 721 gagcatgg 714
>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds Length = 3238 Score = 515 bits (260), Expect = e-143 Identities = 295/308 (95%) Strand = Plus / Minus Query: 241 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 300 |||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| Sbjct: 2417 agtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgct 2358 Query: 301 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 360 ||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| Sbjct: 2357 gacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgct 2298 Query: 361 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtct 420 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 2297 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtct 2238 Query: 421 cttgacgccgctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagat 480 |||||| ||||||||||||||| || |||||||||||||||||||||||||||| ||||| Sbjct: 2237 cttgacaccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcataggagat 2178 Query: 481 gcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggcggctacgan 540 ||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||| Sbjct: 2177 gcaggggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtagctacgat 2118 Query: 541 gagcatgg 548 |||||||| Sbjct: 2117 gagcatgg 2110
>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor Length = 691 Score = 472 bits (238), Expect = e-130 Identities = 288/306 (94%) Strand = Plus / Minus Query: 241 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 300 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 371 agtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 312 Query: 301 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 360 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct: 311 gacgccgcacatggaggggatgccggcggccttgccagcgtttagcccacccgcagcgct 252 Query: 361 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtct 420 |||||||||||||||||||||||||||||||||||||||||| || |||||||||| ||| Sbjct: 251 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctgcgccggccaatct 192 Query: 421 cttgacgccgctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagat 480 ||||||||||||||||||||||| | || | || |||||||||||| |||||| || || Sbjct: 191 cttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggcataggaaat 132 Query: 481 gcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggcggctacgan 540 |||||||| |||||||||||||||||||||||| |||||||| |||||||||||||||| Sbjct: 131 gcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcggctacgag 72 Query: 541 gagcat 546 |||||| Sbjct: 71 gagcat 66
>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene, complete cds Length = 573 Score = 408 bits (206), Expect = e-111 Identities = 280/306 (91%) Strand = Plus / Minus Query: 241 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 300 |||||| |||||| |||||||||||||||||||||||| |||||||| |||||||||||| Sbjct: 442 agtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgct 383 Query: 301 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 360 |||||||||| ||||||||||||||||||||||||||||||| | |||| | |||||||| Sbjct: 382 gacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgct 323 Query: 361 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtct 420 |||||||||||||||| ||||||||||||||||||||||||| || |||||||||| ||| Sbjct: 322 cttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaatct 263 Query: 421 cttgacgccgctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagat 480 ||||||||||||||||||||||| | || | || |||||||||||| |||||| || || Sbjct: 262 cttgacgccgctgcagcaggccggaggcaggatgccgccgttgccgctggcataggaaat 203 Query: 481 gcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggcggctacgan 540 |||||||| |||||||||||||||||||||||| |||||||| |||||||||||||||| Sbjct: 202 gcaggggcgcaaggcagagctcacctgaccgcaggagatggctgcgtcggcggctacgag 143 Query: 541 gagcat 546 |||||| Sbjct: 142 gagcat 137
>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 343 bits (173), Expect = 4e-91 Identities = 265/297 (89%) Strand = Plus / Minus Query: 250 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 309 |||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||| Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289 Query: 310 catggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgca 369 | | | ||||||||| ||||||||||||||||| |||||| | |||||||||||||| || Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229 Query: 370 cttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacgcc 429 ||||||||||||||||||||||||||||||| |||| | || ||| || ||| | ||||| Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169 Query: 430 gctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagatgcaggggct 489 |||||||||||||||| ||| ||||||||||||||||| ||||| |||||||||||||| Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109 Query: 490 caaggcagagctcacctgaccgcangagatggccgcgtcggcggctacgangagcat 546 |||||||||||||||||||||||| || | |||||| || | |||| ||| |||||| Sbjct: 108 caaggcagagctcacctgaccgcacgatacggccgcctccgtggctgcgaggagcat 52
>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 343 bits (173), Expect = 4e-91 Identities = 265/297 (89%) Strand = Plus / Minus Query: 250 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 309 |||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||| Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289 Query: 310 catggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgca 369 | | | ||||||||| ||||||||||||||||| |||||| | |||||||||||||| || Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229 Query: 370 cttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacgcc 429 ||||||||||||||||||||||||||||||| |||| | || ||| || ||| | ||||| Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169 Query: 430 gctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagatgcaggggct 489 |||||||||||||||| ||| ||||||||||||||||| ||||| |||||||||||||| Sbjct: 168 gctgcagcaggccgcagacgggttggcgccgttgccgcgtgcataggagatgcaggggct 109 Query: 490 caaggcagagctcacctgaccgcangagatggccgcgtcggcggctacgangagcat 546 |||||||||||||||||||||||| || | |||||| || | |||| ||| |||||| Sbjct: 108 caaggcagagctcacctgaccgcacgatacggccgcctccgtggctgcgaggagcat 52
>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer protein precursor Length = 2122 Score = 341 bits (172), Expect = 1e-90 Identities = 242/266 (90%) Strand = Plus / Minus Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307 |||||||||||||||||||||||||| |||| ||||||||||||||||||||| |||||| Sbjct: 1619 gatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccg 1560 Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367 ||| | | ||||||||||||||||||||||||||| |||||| | ||||||||||||||| Sbjct: 1559 cactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgatg 1500 Query: 368 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 427 ||||||||||||||||||||||||||||||||| |||| | || ||| || ||| | ||| Sbjct: 1499 cacttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacg 1440 Query: 428 ccgctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagatgcagggg 487 |||||||||||||||||| || |||||||||||||||| ||||| |||||||||||| Sbjct: 1439 ccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcataggagatgcagggg 1380 Query: 488 ctcaaggcagagctcacctgaccgca 513 |||||||||||||||||||||||||| Sbjct: 1379 ctcaaggcagagctcacctgaccgca 1354
>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 604 Score = 333 bits (168), Expect = 4e-88 Identities = 241/266 (90%) Strand = Plus / Minus Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307 |||||||||||||||||||||||||| |||| |||||||||||| |||||||| |||||| Sbjct: 315 gatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaagggacgctaacgccg 256 Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367 ||| | | ||||||||||||||||||||||||||| |||||| | ||||||||||||||| Sbjct: 255 cactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgatg 196 Query: 368 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 427 ||||||||||||||||||||||||||||||||| |||| | || ||| || ||| | ||| Sbjct: 195 cacttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacg 136 Query: 428 ccgctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagatgcagggg 487 |||||||||||||||||| || |||||||||||||||| ||||| |||||||||||| Sbjct: 135 ccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcataggagatgcagggg 76 Query: 488 ctcaaggcagagctcacctgaccgca 513 |||||||||||||||||||||||||| Sbjct: 75 ctcaaggcagagctcacctgaccgca 50
>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 708 Score = 333 bits (168), Expect = 4e-88 Identities = 241/266 (90%) Strand = Plus / Minus Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307 |||||||||||||||||||||||||| |||| ||||||||||||||||| ||| |||||| Sbjct: 416 gatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggatgctaacgccg 357 Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367 ||| | | ||||||||||||||||||||||||||| |||||| | |||||||||||||| Sbjct: 356 cactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgata 297 Query: 368 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 427 ||||||||||||||||||||||||||||||||| |||| | || ||| || ||| | ||| Sbjct: 296 cacttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacg 237 Query: 428 ccgctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagatgcagggg 487 |||||||||||||||||| ||| |||||||||||||||| ||||| |||||||||||| Sbjct: 236 ccgctgcagcaggccgcagacgggctggcgccgttgccgcgtgcataggagatgcagggg 177 Query: 488 ctcaaggcagagctcacctgaccgca 513 |||||||||||||||||||||||||| Sbjct: 176 ctcaaggcagagctcacctgaccgca 151
>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer protein precursor Length = 2087 Score = 319 bits (161), Expect = 5e-84 Identities = 248/278 (89%) Strand = Plus / Minus Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307 |||||| ||||||||||||||||||| |||| ||||||||||||||||||||| |||||| Sbjct: 1607 gatcagtgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccg 1548 Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367 ||| | | |||||||||||||||||||||||| || |||||| | ||||||||||||||| Sbjct: 1547 cactttgtggggatgccggcggccttgccagcattgagcccagcagcagcgctcttgatg 1488 Query: 368 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 427 ||||||||| ||||||||||||||||||||||| |||| | || ||| || ||| | ||| Sbjct: 1487 cacttgcacaccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacg 1428 Query: 428 ccgctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagatgcagggg 487 |||||||||||||||||| || |||||||||||||||| ||||| |||||||||||| Sbjct: 1427 ccgctgcagcaggccgcagatgggctggcgccgttgccgcgtgcataggagatgcagggg 1368 Query: 488 ctcaaggcagagctcacctgaccgcangagatggccgc 525 |||||||||||||||||||||||||| || | |||||| Sbjct: 1367 ctcaaggcagagctcacctgaccgcacgatacggccgc 1330
>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 305 bits (154), Expect = 8e-80 Identities = 247/279 (88%) Strand = Plus / Minus Query: 250 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 309 ||||||||||||||||||||| ||||| | ||| ||||||||||||| |||||||||||| Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289 Query: 310 catggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgca 369 | ||||||||||||| |||||||| |||||||| |||||||| ||||| ||||| ||||| Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229 Query: 370 cttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacgcc 429 ||||||||||||||||||||||||||||||| | || ||||||||||| ||| |||| || Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgcgctgcgccggccagactcctgacacc 169 Query: 430 gctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagatgcaggggct 489 ||||||||||||||| | || ||| |||| ||||||| ||||| |||||||||||||| Sbjct: 168 actgcagcaggccgcaggtgggctggagccgctgccgcgtgcataggagatgcaggggct 109 Query: 490 caaggcagagctcacctgaccgcangagatggccgcgtc 528 |||||||||||||||||| || || ||||| || ||||| Sbjct: 108 caaggcagagctcacctggccacaggagattgcagcgtc 70
>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA Length = 660 Score = 303 bits (153), Expect = 3e-79 Identities = 179/189 (94%) Strand = Plus / Minus Query: 358 gctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccag 417 |||||||| |||| |||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226 Query: 418 tctcttgacgccgctgcagcaggccgcangcggtttggcgccgttgccgcgggcatanga 477 ||||||||||||||||||||||||| || |||||||||||||||||||||||||||| || Sbjct: 225 tctcttgacgccgctgcagcaggccacaggcggtttggcgccgttgccgcgggcatagga 166 Query: 478 gatgcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggcggctac 537 |||||| ||||||||||||||||||||||||||||| |||||||||||||||| |||||| Sbjct: 165 gatgcaagggctcaaggcagagctcacctgaccgcaggagatggccgcgtcggtggctac 106 Query: 538 gangagcat 546 || |||||| Sbjct: 105 gaggagcat 97
>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds Length = 3448 Score = 165 bits (83), Expect = 2e-37 Identities = 244/299 (81%) Strand = Plus / Minus Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307 |||||| | |||||||||||||| ||||| |||||||||| |||||||| |||||||||| Sbjct: 3206 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 3147 Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367 ||| |||||||||| | || ||||| || | ||| |||||||| ||||| ||||||||| Sbjct: 3146 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 3087 Query: 368 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 427 ||| |||| |||||||||||||| ||||||||| | || |||||||| |||| | || Sbjct: 3086 cacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaact 3027 Query: 428 ccgctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagatgcagggg 487 ||| ||||||||| || |||| |||| ||| |||| || || |||| ||||| | Sbjct: 3026 ccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggag 2967 Query: 488 ctcaaggcagagctcacctgaccgcangagatggccgcgtcggcggctacgangagcat 546 || ||||||| ||||||||||||| ||||| |||||||||| |||||| | |||||| Sbjct: 2966 gccagggcagagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagcat 2908 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 149 ctcacatggagatcagatcagagcgtttattcatatatat 188 ||||||||||||||| |||||||| ||||||||| ||||| Sbjct: 3341 ctcacatggagatcatatcagagcatttattcatgtatat 3302
>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA, complete cds Length = 737 Score = 165 bits (83), Expect = 2e-37 Identities = 244/299 (81%) Strand = Plus / Minus Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307 |||||| | |||||||||||||| ||||| |||||||||| |||||||| |||||||||| Sbjct: 410 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 351 Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367 ||| |||||||||| | || ||||| || | ||| |||||||| ||||| ||||||||| Sbjct: 350 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 291 Query: 368 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 427 ||| |||| |||||||||||||| ||||||||| | || |||||||| |||| | || Sbjct: 290 cacctgcatgccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaact 231 Query: 428 ccgctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagatgcagggg 487 ||| ||||||||| || |||| |||| ||| |||| || || |||| ||||| | Sbjct: 230 ccggaacagcaggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggag 171 Query: 488 ctcaaggcagagctcacctgaccgcangagatggccgcgtcggcggctacgangagcat 546 || ||||||| ||||||||||||| ||||| |||||||||| |||||| | |||||| Sbjct: 170 gccagggcagagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagcat 112 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 149 ctcacatggagatcagatcagagcgtttattcatatatat 188 ||||||||||||||| |||||||| ||||||||| ||||| Sbjct: 545 ctcacatggagatcatatcagagcatttattcatgtatat 506
>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds Length = 348 Score = 163 bits (82), Expect = 7e-37 Identities = 237/290 (81%) Strand = Plus / Minus Query: 257 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 316 |||||||||||||| ||||| |||||||||| |||||||| ||||||||||||| ||||| Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282 Query: 317 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 376 ||||| | || ||||| || | ||| |||||||| ||||| |||||||||||| |||| Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222 Query: 377 gccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgcag 436 |||||||||||||| ||||||||| | || |||||||| |||| | || ||| ||| Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162 Query: 437 caggccgcangcggtttggcgccgttgccgcgggcatangagatgcaggggctcaaggca 496 |||||| || |||| |||| ||| |||| || || |||| ||||| | || |||| Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102 Query: 497 gagctcacctgaccgcangagatggccgcgtcggcggctacgangagcat 546 ||| ||||||||||||| ||||| |||||||||| |||||| | |||||| Sbjct: 101 gagttcacctgaccgcaggagatcgccgcgtcggaggctaccaggagcat 52
>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete cds Length = 345 Score = 159 bits (80), Expect = 1e-35 Identities = 206/249 (82%) Strand = Plus / Minus Query: 289 gtaggggacgctgacgccgcacatggaggggatgccggcggccttgccagcgttaagccc 348 ||||||||||||||||| |||| |||||||||| | |||||| |||| | || | ||| Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250 Query: 349 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggcagc 408 ||| ||||| |||||||||||| ||||||||||| ||||||||||| |||| | Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtcagcggcagtctgcacttg 190 Query: 409 gccggccagtctcttgacgccgctgcagcaggccgcangcggtttggcgccgttgccgcg 468 |||||||| |||| ||||||||||||||||||||||| ||| |||||||||||||||| Sbjct: 189 gccggccaatctcctgacgccgctgcagcaggccgcagacgggctggcgccgttgccgcg 130 Query: 469 ggcatangagatgcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtc 528 ||||| || | ||| |||| | ||| ||||||||||| ||||| ||||| |||||||| Sbjct: 129 tgcataggaaaggcacgggccaagggcggagctcacctggccgcaggagattgccgcgtc 70 Query: 529 ggcggctac 537 || |||||| Sbjct: 69 ggaggctac 61
>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA, complete cds Length = 730 Score = 157 bits (79), Expect = 5e-35 Identities = 235/288 (81%) Strand = Plus / Minus Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307 |||||| | |||||||||||||| ||||| |||||||| | ||||||||||||||||||| Sbjct: 429 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 370 Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367 ||| ||||||| ||||| ||||||||| | ||| ||||| || ||| | ||||||| | Sbjct: 369 cacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttgagg 310 Query: 368 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 427 ||| |||| | ||||||||||| ||||||||| | || |||||||| | || ||||| Sbjct: 309 cacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacg 250 Query: 428 ccgctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagatgcagggg 487 ||||||||||||||| || ||| ||| ||| |||| ||||| | || ||||||| Sbjct: 249 ccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggg 190 Query: 488 ctcaaggcagagctcacctgaccgcangagatggccgcgtcggcggct 535 ||||||||||||||||||| ||||| |||||||||||||| |||| Sbjct: 189 gtcaaggcagagctcacctggccgcagctgatggccgcgtcggaggct 142 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 149 ctcacatggagatcagatcagagcgtttattcatatatat 188 ||||||||||||||| |||||||| ||||||||| ||||| Sbjct: 550 ctcacatggagatcatatcagagcatttattcatgtatat 511
>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid transfer protein precursor Length = 496 Score = 157 bits (79), Expect = 5e-35 Identities = 235/288 (81%) Strand = Plus / Minus Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307 |||||| | |||||||||||||| ||||| |||||||| | ||||||||||||||||||| Sbjct: 370 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 311 Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367 ||| ||||||| ||||| ||||||||| | ||| ||||| || ||| | ||||||| | Sbjct: 310 cacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttgagg 251 Query: 368 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 427 ||| |||| | ||||||||||| ||||||||| | || |||||||| | || ||||| Sbjct: 250 cacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacg 191 Query: 428 ccgctgcagcaggccgcangcggtttggcgccgttgccgcgggcatangagatgcagggg 487 ||||||||||||||| || ||| ||| ||| |||| ||||| | || ||||||| Sbjct: 190 ccgctgcagcaggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggg 131 Query: 488 ctcaaggcagagctcacctgaccgcangagatggccgcgtcggcggct 535 ||||||||||||||||||| ||||| |||||||||||||| |||| Sbjct: 130 gtcaaggcagagctcacctggccgcagctgatggccgcgtcggaggct 83 Score = 56.0 bits (28), Expect = 1e-04 Identities = 37/40 (92%) Strand = Plus / Minus Query: 149 ctcacatggagatcagatcagagcgtttattcatatatat 188 ||||||||||||||| |||||||| ||||||||| ||||| Sbjct: 491 ctcacatggagatcatatcagagcatttattcatgtatat 452
>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds Length = 348 Score = 155 bits (78), Expect = 2e-34 Identities = 228/279 (81%) Strand = Plus / Minus Query: 257 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 316 |||||||||||||| ||||| |||||||| | |||||||||||||||||||||| ||||| Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282 Query: 317 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 376 || ||||| ||||||||| | ||| ||||| || ||| | ||||||| |||| |||| Sbjct: 281 ggaatgcctgcggccttgttggggttgagccctccggcaacactcttgaggcacctgcat 222 Query: 377 gccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgcag 436 | ||||||||||| ||||||||| | || |||||||| | || |||||||||||||| Sbjct: 221 gtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacgccgctgcag 162 Query: 437 caggccgcangcggtttggcgccgttgccgcgggcatangagatgcaggggctcaaggca 496 |||||| || ||| ||| ||| |||| ||||| | || ||||||| |||||||| Sbjct: 161 caggccccagacgggctggtcccgctgcccttcgcataggcgacgcagggggtcaaggca 102 Query: 497 gagctcacctgaccgcangagatggccgcgtcggcggct 535 ||||||||||| ||||| |||||||||||||| |||| Sbjct: 101 gagctcacctggccgcagctgatggccgcgtcggaggct 63
>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 147 bits (74), Expect = 4e-32 Identities = 235/290 (81%) Strand = Plus / Minus Query: 257 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 316 ||||||||||| || ||||| |||||||||| |||||||| ||||||||||||| ||||| Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282 Query: 317 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 376 ||||| | || ||||| || | ||| |||||||| ||||| |||||||||||| |||| Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222 Query: 377 gccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacgccgctgcag 436 |||||||||||||| ||||||||| | || |||||||| |||| | || ||| ||| Sbjct: 221 gccgcttgcttgtcggcggtgctccgcgctaagccggccaatctcctaactccggaacag 162 Query: 437 caggccgcangcggtttggcgccgttgccgcgggcatangagatgcaggggctcaaggca 496 |||||| || |||| |||| ||| |||| || || |||| ||||| | || |||| Sbjct: 161 caggccccaggcgggctggccccgctgccttttgcgtaggagacgcaggaggccagggca 102 Query: 497 gagctcacctgaccgcangagatggccgcgtcggcggctacgangagcat 546 ||| ||||||||||||| | ||| |||||||||| |||||| | |||||| Sbjct: 101 gagttcacctgaccgcaggggatcgccgcgtcggaggctaccaggagcat 52
>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0086N07 map S790A, complete sequence Length = 178523 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Plus Query: 261 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 320 |||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||| Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080 Query: 321 tgccggcggccttgccagcgttaagccc 348 ||| |||||| ||||| ||||| ||||| Sbjct: 94081 tgctggcggcgttgccggcgttgagccc 94108
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 261 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 320 |||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||| Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000 Query: 321 tgccggcggccttgccagcgttaagccc 348 ||| |||||| ||||| ||||| ||||| Sbjct: 13089999 tgctggcggcgttgccggcgttgagccc 13089972 Score = 107 bits (54), Expect = 4e-20 Identities = 78/86 (90%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| |||||||||||||| |||||||||||||||||||||| | ||||||||| Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382 Query: 323 ccggcggccttgccagcgttaagccc 348 | |||||| ||||| ||||| ||||| Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356 Score = 87.7 bits (44), Expect = 4e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 692704 ctggcggcattgccggcgtt 692685 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||||| ||||||||||||||||| | ||||| ||||| ||||||||||| Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410 Query: 323 ccggcg 328 |||||| Sbjct: 679409 ccggcg 679404 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 tgacgccgctgcagcaggccgc 444 |||||||||||||||||||||| Sbjct: 692595 tgacgccgctgcagcaggccgc 692574 Score = 40.1 bits (20), Expect = 7.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330 |||| ||||||||||| || ||||||||||||||| Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 425 acgccgctgcagcaggccgc 444 |||||||||||||||||||| Sbjct: 702270 acgccgctgcagcaggccgc 702251
>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full insert sequence Length = 843 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 261 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 320 |||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||| Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400 Query: 321 tgccggcggccttgccagcgttaagccc 348 ||| |||||| ||||| ||||| ||||| Sbjct: 399 tgctggcggcgttgccggcgttgagccc 372
>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full insert sequence Length = 846 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 261 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 320 |||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||| Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399 Query: 321 tgccggcggccttgccagcgttaagccc 348 ||| |||||| ||||| ||||| ||||| Sbjct: 398 tgctggcggcgttgccggcgttgagccc 371
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 119 bits (60), Expect = 1e-23 Identities = 81/88 (92%) Strand = Plus / Minus Query: 261 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 320 |||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||| Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179 Query: 321 tgccggcggccttgccagcgttaagccc 348 ||| |||||| ||||| ||||| ||||| Sbjct: 13170178 tgctggcggcgttgccggcgttgagccc 13170151 Score = 107 bits (54), Expect = 4e-20 Identities = 78/86 (90%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| |||||||||||||| |||||||||||||||||||||| | ||||||||| Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382 Query: 323 ccggcggccttgccagcgttaagccc 348 | |||||| ||||| ||||| ||||| Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356 Score = 87.7 bits (44), Expect = 4e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 692704 ctggcggcattgccggcgtt 692685 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||||| ||||||||||||||||| | ||||| ||||| ||||||||||| Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410 Query: 323 ccggcg 328 |||||| Sbjct: 679409 ccggcg 679404 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 tgacgccgctgcagcaggccgc 444 |||||||||||||||||||||| Sbjct: 692595 tgacgccgctgcagcaggccgc 692574 Score = 40.1 bits (20), Expect = 7.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330 |||| ||||||||||| || ||||||||||||||| Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 425 acgccgctgcagcaggccgc 444 |||||||||||||||||||| Sbjct: 702270 acgccgctgcagcaggccgc 702251
>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA Length = 724 Score = 115 bits (58), Expect = 2e-22 Identities = 164/198 (82%), Gaps = 1/198 (0%) Strand = Plus / Minus Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307 |||||| | ||||||||||||||||| |||||||| | ||||||||||||||||||| Sbjct: 420 gatcagtggatcttagagcagtcgacactggcgctgatcgtgtaggggacgctgacgccg 361 Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367 ||| ||||||||||||| |||||| |||| ||||| | | || ||| | ||||||| | Sbjct: 360 cacctggaggggatgcctgcggccctgccggcgttgtacgcgccggca-cactcttgagg 302 Query: 368 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 427 ||| |||||| ||||||||||| ||||||||| | || |||||||| ||||||||| Sbjct: 301 cacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttgact 242 Query: 428 ccgctgcagcaggccgca 445 ||||| |||||| ||||| Sbjct: 241 ccgctacagcagcccgca 224 Score = 73.8 bits (37), Expect = 5e-10 Identities = 59/66 (89%), Gaps = 2/66 (3%) Strand = Plus / Minus Query: 481 gcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggcggctacgan 540 |||||||| |||||||||||||||||| ||||| | |||| ||||||||||||||||| Sbjct: 189 gcaggggcccaaggcagagctcacctggccgcaggtgatg--cgcgtcggcggctacgag 132 Query: 541 gagcat 546 |||||| Sbjct: 131 gagcat 126
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 115 bits (58), Expect = 2e-22 Identities = 79/86 (91%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684 Query: 323 ccggcggccttgccagcgttaagccc 348 | |||||| ||||| ||||| ||||| Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658 Score = 87.7 bits (44), Expect = 4e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 732556 ctggcggcattgccggcgtt 732537 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||||| |||||| |||||||||| | ||||||||||| ||||||||||| Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668 Query: 323 ccggcg 328 |||||| Sbjct: 722667 ccggcg 722662 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 tgacgccgctgcagcaggccgc 444 |||||||||||||||||||||| Sbjct: 732447 tgacgccgctgcagcaggccgc 732426 Score = 40.1 bits (20), Expect = 7.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330 |||| ||||||||||| || ||||||||||||||| Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 425 acgccgctgcagcaggccgc 444 |||||||||||||||||||| Sbjct: 736572 acgccgctgcagcaggccgc 736553
>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 Length = 511 Score = 115 bits (58), Expect = 2e-22 Identities = 79/86 (91%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354 Query: 323 ccggcggccttgccagcgttaagccc 348 | |||||| ||||| ||||| ||||| Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full insert sequence Length = 995 Score = 115 bits (58), Expect = 2e-22 Identities = 79/86 (91%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611 Query: 323 ccggcggccttgccagcgttaagccc 348 | |||||| ||||| ||||| ||||| Sbjct: 610 ctggcggcgttgccggcgttgagccc 585 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 425 acgccgctgcagcaggccgc 444 |||||||||||||||||||| Sbjct: 499 acgccgctgcagcaggccgc 480
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 115 bits (58), Expect = 2e-22 Identities = 79/86 (91%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684 Query: 323 ccggcggccttgccagcgttaagccc 348 | |||||| ||||| ||||| ||||| Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658 Score = 87.7 bits (44), Expect = 4e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 732556 ctggcggcattgccggcgtt 732537 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||||| |||||| |||||||||| | ||||||||||| ||||||||||| Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668 Query: 323 ccggcg 328 |||||| Sbjct: 722667 ccggcg 722662 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 tgacgccgctgcagcaggccgc 444 |||||||||||||||||||||| Sbjct: 732447 tgacgccgctgcagcaggccgc 732426 Score = 40.1 bits (20), Expect = 7.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330 |||| ||||||||||| || ||||||||||||||| Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 425 acgccgctgcagcaggccgc 444 |||||||||||||||||||| Sbjct: 736572 acgccgctgcagcaggccgc 736553
>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118211 Score = 115 bits (58), Expect = 2e-22 Identities = 79/86 (91%) Strand = Plus / Plus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450 Query: 323 ccggcggccttgccagcgttaagccc 348 | |||||| ||||| ||||| ||||| Sbjct: 42451 ctggcggcgttgccggcgttgagccc 42476 Score = 87.7 bits (44), Expect = 4e-14 Identities = 71/80 (88%) Strand = Plus / Plus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 46518 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 46577 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 46578 ctggcggcattgccggcgtt 46597 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Plus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||||| |||||| |||||||||| | ||||||||||| ||||||||||| Sbjct: 56407 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 56466 Query: 323 ccggcg 328 |||||| Sbjct: 56467 ccggcg 56472 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 423 tgacgccgctgcagcaggccgc 444 |||||||||||||||||||||| Sbjct: 46687 tgacgccgctgcagcaggccgc 46708 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 425 acgccgctgcagcaggccgc 444 |||||||||||||||||||| Sbjct: 42562 acgccgctgcagcaggccgc 42581 Score = 40.1 bits (20), Expect = 7.4 Identities = 32/36 (88%) Strand = Plus / Plus Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330 |||| ||||||||||| || ||||||||||||||| Sbjct: 33579 gacgttgacgccgcacttgccggggatgccggcggc 33614
>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1 mRNA, complete cds Length = 530 Score = 107 bits (54), Expect = 4e-20 Identities = 78/86 (90%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| |||||||||||||| |||||||||||||||||||||| | ||||||||| Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367 Query: 323 ccggcggccttgccagcgttaagccc 348 | |||||| ||||| ||||| ||||| Sbjct: 366 ctggcggcgttgccggcgttgagccc 341 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 425 acgccgctgcagcaggccgc 444 |||||||||||||||||||| Sbjct: 255 acgccgctgcagcaggccgc 236
>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor Length = 627 Score = 107 bits (54), Expect = 4e-20 Identities = 162/198 (81%) Strand = Plus / Minus Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307 |||||| | ||||| ||||||||||| |||||||| | ||||||||||||||||||| Sbjct: 352 gatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgacgccg 293 Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367 ||| ||||||||||||| |||||| |||| ||||| | | || || | ||||||| | Sbjct: 292 cacctggaggggatgcctgcggccctgccggcgttgtacgcgccggcgacactcttgagg 233 Query: 368 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 427 ||| |||||| ||||||||||| ||||||||| | || |||||||| ||||||||| Sbjct: 232 cacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttgact 173 Query: 428 ccgctgcagcaggccgca 445 ||||| |||||| ||||| Sbjct: 172 ccgctacagcagcccgca 155 Score = 95.6 bits (48), Expect = 1e-16 Identities = 61/66 (92%) Strand = Plus / Minus Query: 481 gcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggcggctacgan 540 |||||||| |||||||||||||||||| ||||| | ||||||||||||||||||||||| Sbjct: 119 gcaggggcccaaggcagagctcacctggccgcaggtgatggccgcgtcggcggctacgag 60 Query: 541 gagcat 546 |||||| Sbjct: 59 gagcat 54
>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein Length = 799 Score = 107 bits (54), Expect = 4e-20 Identities = 78/86 (90%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||| |||| |||||||||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379 Query: 323 ccggcggccttgccagcgttaagccc 348 | |||||| ||||| ||||| ||||| Sbjct: 378 ctggcggcgttgccggcgttgagccc 353 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 425 acgccgctgcagcaggccgc 444 |||||||||||||||||||| Sbjct: 267 acgccgctgcagcaggccgc 248
>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full insert sequence Length = 2882 Score = 107 bits (54), Expect = 4e-20 Identities = 78/86 (90%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| |||||||||||||| |||||||||||||||||||||| | ||||||||| Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386 Query: 323 ccggcggccttgccagcgttaagccc 348 | |||||| ||||| ||||| ||||| Sbjct: 2385 ctggcggcgttgccggcgttgagccc 2360 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 425 acgccgctgcagcaggccgc 444 |||||||||||||||||||| Sbjct: 2274 acgccgctgcagcaggccgc 2255
>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full insert sequence Length = 551 Score = 107 bits (54), Expect = 4e-20 Identities = 78/86 (90%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| |||||||||||||| |||||||||||||||||||||| | ||||||||| Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263 Query: 323 ccggcggccttgccagcgttaagccc 348 | |||||| ||||| ||||| ||||| Sbjct: 262 ctggcggcgttgccggcgttgagccc 237
>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from chromosome 11 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 181322 Score = 107 bits (54), Expect = 4e-20 Identities = 78/86 (90%) Strand = Plus / Plus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| |||||||||||||| |||||||||||||||||||||| | ||||||||| Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590 Query: 323 ccggcggccttgccagcgttaagccc 348 | |||||| ||||| ||||| ||||| Sbjct: 40591 ctggcggcgttgccggcgttgagccc 40616 Score = 87.7 bits (44), Expect = 4e-14 Identities = 71/80 (88%) Strand = Plus / Plus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 50208 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 50267 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 50268 ctggcggcattgccggcgtt 50287 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Plus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||||| ||||||||||||||||| | ||||| ||||| ||||||||||| Sbjct: 63503 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 63562 Query: 323 ccggcg 328 |||||| Sbjct: 63563 ccggcg 63568 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 423 tgacgccgctgcagcaggccgc 444 |||||||||||||||||||||| Sbjct: 50377 tgacgccgctgcagcaggccgc 50398 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 425 acgccgctgcagcaggccgc 444 |||||||||||||||||||| Sbjct: 40702 acgccgctgcagcaggccgc 40721 Score = 40.1 bits (20), Expect = 7.4 Identities = 32/36 (88%) Strand = Plus / Plus Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330 |||| ||||||||||| || ||||||||||||||| Sbjct: 28127 gacgttgacgccgcacttgccggggatgccggcggc 28162
>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds Length = 799 Score = 107 bits (54), Expect = 4e-20 Identities = 78/86 (90%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||| |||| |||||||||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379 Query: 323 ccggcggccttgccagcgttaagccc 348 | |||||| ||||| ||||| ||||| Sbjct: 378 ctggcggcgttgccggcgttgagccc 353 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 425 acgccgctgcagcaggccgc 444 |||||||||||||||||||| Sbjct: 267 acgccgctgcagcaggccgc 248
>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds Length = 507 Score = 99.6 bits (50), Expect = 9e-18 Identities = 77/86 (89%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||| || |||||||||||||| |||||||||||||||||||||| | ||||||||| Sbjct: 373 gagcagtggatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 314 Query: 323 ccggcggccttgccagcgttaagccc 348 | |||||| ||||| ||||| ||||| Sbjct: 313 ctggcggcgttgccggcgttgagccc 288 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 425 acgccgctgcagcaggccgc 444 |||||||||||||||||||| Sbjct: 202 acgccgctgcagcaggccgc 183
>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds Length = 805 Score = 99.6 bits (50), Expect = 9e-18 Identities = 78/86 (90%), Gaps = 1/86 (1%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| |||||||||||||| |||||| ||||||||||||||| ||||||||||| Sbjct: 412 gagcagtcgatggaagcgctgatggtgtaggg-acgctgacgccgcacttggaggggatg 354 Query: 323 ccggcggccttgccagcgttaagccc 348 | |||||| ||||| ||||| ||||| Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA Length = 732 Score = 95.6 bits (48), Expect = 1e-16 Identities = 61/66 (92%) Strand = Plus / Minus Query: 481 gcaggggctcaaggcagagctcacctgaccgcangagatggccgcgtcggcggctacgan 540 |||||||| |||||||||||||||||| ||||| | ||||||||||||||||||||||| Sbjct: 190 gcaggggcccaaggcagagctcacctggccgcaggtgatggccgcgtcggcggctacgag 131 Query: 541 gagcat 546 |||||| Sbjct: 130 gagcat 125 Score = 91.7 bits (46), Expect = 2e-15 Identities = 160/198 (80%) Strand = Plus / Minus Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307 |||||| | ||||| ||||||||||| |||||||| | ||||||||||||||| ||| Sbjct: 423 gatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgaccccg 364 Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367 ||| ||||||||||||| |||||| | || ||||| | | || || | ||||||| | Sbjct: 363 cacctggaggggatgcctgcggcccttccggcgttgtacgcgccggcgacactcttgagg 304 Query: 368 cacttgcacgccgcttgcttgtcagcggtgctctgggcagcgccggccagtctcttgacg 427 ||| |||||| ||||||||||| ||||||||| | || |||||||| ||||||||| Sbjct: 303 cacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttgact 244 Query: 428 ccgctgcagcaggccgca 445 ||||| |||||| ||||| Sbjct: 243 ccgctacagcagcccgca 226
>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1 mRNA, complete cds Length = 647 Score = 87.7 bits (44), Expect = 4e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 469 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 410 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 409 ctggcggcattgccggcgtt 390 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 tgacgccgctgcagcaggccgc 444 |||||||||||||||||||||| Sbjct: 300 tgacgccgctgcagcaggccgc 279
>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS Length = 1485 Score = 87.7 bits (44), Expect = 4e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 701 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 642 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 641 ctggcggcattgccggcgtt 622 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 tgacgccgctgcagcaggccgc 444 |||||||||||||||||||||| Sbjct: 532 tgacgccgctgcagcaggccgc 511
>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA Length = 717 Score = 87.7 bits (44), Expect = 4e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 294 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 235 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 234 ctggcggcgttgccggcgtt 215 Score = 44.1 bits (22), Expect = 0.48 Identities = 27/29 (93%) Strand = Plus / Minus Query: 497 gagctcacctgaccgcangagatggccgc 525 ||||||||||| ||||| ||||||||||| Sbjct: 54 gagctcacctgcccgcaggagatggccgc 26
>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene Length = 1499 Score = 87.7 bits (44), Expect = 4e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||||||||||||||||| ||||||||||| Sbjct: 997 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 938 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 937 ctggcggcgttgccggcgtt 918 Score = 44.1 bits (22), Expect = 0.48 Identities = 27/29 (93%) Strand = Plus / Minus Query: 497 gagctcacctgaccgcangagatggccgc 525 ||||||||||| ||||| ||||||||||| Sbjct: 754 gagctcacctgcccgcaggagatggccgc 726
>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 Length = 692 Score = 87.7 bits (44), Expect = 4e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 331 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 272 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 271 ctggcggcattgccggcgtt 252 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 tgacgccgctgcagcaggccgc 444 |||||||||||||||||||||| Sbjct: 162 tgacgccgctgcagcaggccgc 141
>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full insert sequence Length = 1003 Score = 87.7 bits (44), Expect = 4e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 654 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 595 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 594 ctggcggcattgccggcgtt 575 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 tgacgccgctgcagcaggccgc 444 |||||||||||||||||||||| Sbjct: 485 tgacgccgctgcagcaggccgc 464
>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full insert sequence Length = 840 Score = 87.7 bits (44), Expect = 4e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 437 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 378 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 377 ctggcggcattgccggcgtt 358 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 tgacgccgctgcagcaggccgc 444 |||||||||||||||||||||| Sbjct: 268 tgacgccgctgcagcaggccgc 247
>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds Length = 845 Score = 87.7 bits (44), Expect = 4e-14 Identities = 71/80 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 419 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 360 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 359 ctggcggcattgccggcgtt 340 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 tgacgccgctgcagcaggccgc 444 |||||||||||||||||||||| Sbjct: 250 tgacgccgctgcagcaggccgc 229
>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene Length = 1800 Score = 83.8 bits (42), Expect = 6e-13 Identities = 66/74 (89%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 965 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 906 Query: 323 ccggcggccttgcc 336 | |||||||||||| Sbjct: 905 ctggcggccttgcc 892
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 83.8 bits (42), Expect = 6e-13 Identities = 60/66 (90%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||||| ||||||||||||||||| | ||||||||||| ||||||||||| Sbjct: 14437064 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 14437005 Query: 323 ccggcg 328 |||||| Sbjct: 14437004 ccggcg 14436999 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 150 tcacatggagatcagatcaga 170 ||||||||||||||||||||| Sbjct: 22847882 tcacatggagatcagatcaga 22847902
>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1116_C12 Length = 116758 Score = 83.8 bits (42), Expect = 6e-13 Identities = 60/66 (90%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||||| ||||||||||||||||| | ||||||||||| ||||||||||| Sbjct: 45562 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 45503 Query: 323 ccggcg 328 |||||| Sbjct: 45502 ccggcg 45497
>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds Length = 695 Score = 79.8 bits (40), Expect = 9e-12 Identities = 61/68 (89%) Strand = Plus / Minus Query: 275 gaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcggccttg 334 |||| |||||||| |||||||| ||||||||||||| |||||||||||| |||||| ||| Sbjct: 325 gaagggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattg 266 Query: 335 ccagcgtt 342 || ||||| Sbjct: 265 ccggcgtt 258 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 tgacgccgctgcagcaggccgc 444 |||||||||||||||||||||| Sbjct: 168 tgacgccgctgcagcaggccgc 147
>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds Length = 770 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 423 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 364 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 363 ctggcggcgttgccggcgtt 344
>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1 (plt1) gene, partial cds Length = 698 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 333 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 274 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 273 ctggcggcgttgccggcgtt 254
>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 265 ctggcggcgttgccggcgtt 246 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 419 ctcttgacgccgctgcagcag 439 ||||||||||||||||||||| Sbjct: 160 ctcttgacgccgctgcagcag 140
>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 265 ctggcggcgttgccggcgtt 246 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 419 ctcttgacgccgctgcagcag 439 ||||||||||||||||||||| Sbjct: 160 ctcttgacgccgctgcagcag 140
>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 804 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 374 ctggcggcgttgccggcgtt 355
>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 391 ctggcggcgttgccggcgtt 372 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 419 ctcttgacgccgctgcagcag 439 ||||||||||||||||||||| Sbjct: 286 ctcttgacgccgctgcagcag 266
>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 613 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 258 ctggcggcgttgccggcgtt 239
>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2) gene, partial cds Length = 613 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 258 ctggcggcgttgccggcgtt 239
>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 829 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 414 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 355 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 354 ctggcggcgttgccggcgtt 335
>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer protein 2 (plt2) gene, complete cds Length = 816 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 818 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 832 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 820 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 79.8 bits (40), Expect = 9e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full insert sequence Length = 718 Score = 77.8 bits (39), Expect = 3e-11 Identities = 57/63 (90%) Strand = Plus / Plus Query: 280 gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcggccttgccagc 339 |||||||| |||||||| ||||||||||||| |||||||||||| |||||| ||||| || Sbjct: 97 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggc 156 Query: 340 gtt 342 ||| Sbjct: 157 gtt 159 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Plus Query: 423 tgacgccgctgcagcaggccgc 444 |||||||||||||||||||||| Sbjct: 249 tgacgccgctgcagcaggccgc 270
>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full insert sequence Length = 793 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||||| |||||| |||||||||| | ||||||||||| ||||||||||| Sbjct: 430 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 371 Query: 323 ccggcg 328 |||||| Sbjct: 370 ccggcg 365
>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full insert sequence Length = 3876 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||||| |||||| |||||||||| | ||||||||||| ||||||||||| Sbjct: 3516 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 3457 Query: 323 ccggcg 328 |||||| Sbjct: 3456 ccggcg 3451
>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full insert sequence Length = 792 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||||| |||||| |||||||||| | ||||||||||| ||||||||||| Sbjct: 432 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 373 Query: 323 ccggcg 328 |||||| Sbjct: 372 ccggcg 367
>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full insert sequence Length = 745 Score = 75.8 bits (38), Expect = 1e-10 Identities = 59/66 (89%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||||| ||||||||||||||||| | ||||| ||||| ||||||||||| Sbjct: 434 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 375 Query: 323 ccggcg 328 |||||| Sbjct: 374 ccggcg 369
>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence Length = 827 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375 Query: 323 ccggcggc 330 | |||||| Sbjct: 374 ctggcggc 367
>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete cds Length = 840 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 |||||||||| ||| | |||||||| |||||||| ||||||||||| ||||||||||| Sbjct: 414 gagcagtcgatggaggggctgatggtgtaggggatcgtgacgccgcacttggaggggatg 355 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 354 ctggcggcattgccggcgtt 335 Score = 44.1 bits (22), Expect = 0.48 Identities = 22/22 (100%) Strand = Plus / Minus Query: 423 tgacgccgctgcagcaggccgc 444 |||||||||||||||||||||| Sbjct: 245 tgacgccgctgcagcaggccgc 224
>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 699 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||| ||| Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggagggtatg 259 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 258 ctggcggcgttgccggcgtt 239
>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 780 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 416 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 357 Query: 323 ccggcggc 330 | |||||| Sbjct: 356 ctggcggc 349
>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 714 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 341 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 282 Query: 323 ccggcggc 330 | |||||| Sbjct: 281 ctggcggc 274
>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 648 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 440 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 381 Query: 323 ccggcggc 330 | |||||| Sbjct: 380 ctggcggc 373
>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer protein 1 (plt1) gene, complete cds Length = 829 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394 Query: 323 ccggcggc 330 | |||||| Sbjct: 393 ctggcggc 386
>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 455 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 396 Query: 323 ccggcggc 330 | |||||| Sbjct: 395 ctggcggc 388
>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 821 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391 Query: 323 ccggcggc 330 | |||||| Sbjct: 390 ctggcggc 383
>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 832 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394 Query: 323 ccggcggc 330 | |||||| Sbjct: 393 ctggcggc 386
>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 835 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391 Query: 323 ccggcggc 330 | |||||| Sbjct: 390 ctggcggc 383
>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 814 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391 Query: 323 ccggcggc 330 | |||||| Sbjct: 390 ctggcggc 383
>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||| |||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 71.9 bits (36), Expect = 2e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| |||| |||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356 Query: 323 ccggcggccttgccagcgtt 342 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end Length = 677 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 264 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 205 Query: 323 ccggcggc 330 | |||||| Sbjct: 204 ctggcggc 197
>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone 9C2 Length = 813 Score = 71.9 bits (36), Expect = 2e-09 Identities = 60/68 (88%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||||||| ||||||||||| Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392 Query: 323 ccggcggc 330 | |||||| Sbjct: 391 ctggcggc 384
>gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA, complete cds Length = 766 Score = 67.9 bits (34), Expect = 3e-08 Identities = 58/66 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||||| |||||| |||||||||| | |||| |||||| ||||||||||| Sbjct: 384 gagcagtcggtggaagggctgatagcgtaggggatgttgaccccgcacttggaggggatg 325 Query: 323 ccggcg 328 |||||| Sbjct: 324 ccggcg 319
>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 709 Score = 63.9 bits (32), Expect = 5e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| ||||||| ||||||||||||| ||||||||||| Sbjct: 319 gagcagtcggtggaggtgctgatggtataggggatgctgacgccgcacttggaggggatg 260 Query: 323 ccggcggc 330 | |||||| Sbjct: 259 ctggcggc 252
>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 686 Score = 63.9 bits (32), Expect = 5e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||| | |||||||| |||||||| ||||||||| ||| ||||||||||| Sbjct: 320 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccacacttggaggggatg 261 Query: 323 ccggcggc 330 | |||||| Sbjct: 260 ctggcggc 253 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 419 ctcttgacgccgctgcagcag 439 ||||||||||||||||||||| Sbjct: 155 ctcttgacgccgctgcagcag 135
>dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfer protein Length = 372 Score = 61.9 bits (31), Expect = 2e-06 Identities = 55/63 (87%) Strand = Plus / Minus Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322 ||||||||| ||||| ||||||| ||||||||| | ||||| ||||| ||||||||||| Sbjct: 141 gagcagtcggtggaagggctgatgccgtaggggatgttgacgtcgcacttggaggggatg 82 Query: 323 ccg 325 ||| Sbjct: 81 ccg 79
>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6 (Ltp6) gene, promoter and complete cds Length = 3257 Score = 58.0 bits (29), Expect = 3e-05 Identities = 44/49 (89%) Strand = Plus / Minus Query: 280 gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcg 328 ||||||||||||||||| | ||||||||||| || ||||||||||||| Sbjct: 2770 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722
>gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein (BG14) mRNA, complete cds Length = 841 Score = 46.1 bits (23), Expect = 0.12 Identities = 41/47 (87%) Strand = Plus / Minus Query: 282 tgatggcgtaggggacgctgacgccgcacatggaggggatgccggcg 328 ||||||||||||||| ||||||||||| || ||||||||||||| Sbjct: 401 tgatggcgtaggggatattgacgccgcacttgctggggatgccggcg 355
>gb|AC159631.2| Mus musculus BAC clone RP24-177F21 from chromosome 12, complete sequence Length = 171538 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 488 ctcaaggcagagctcacctgaccgc 512 |||||||||||| |||||||||||| Sbjct: 24731 ctcaaggcagagatcacctgaccgc 24755
>gb|AC161418.4| Mus musculus BAC clone RP23-325K2 from chromosome 3, complete sequence Length = 202765 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 aaagtaaaaaacaaccatagt 96 ||||||||||||||||||||| Sbjct: 67013 aaagtaaaaaacaaccatagt 67033
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 386 ttgtcagcggtgctctgggca 406 ||||||||||||||||||||| Sbjct: 11569463 ttgtcagcggtgctctgggca 11569483
>dbj|AP005383.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1034_C08 Length = 154441 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 386 ttgtcagcggtgctctgggca 406 ||||||||||||||||||||| Sbjct: 123597 ttgtcagcggtgctctgggca 123617
>dbj|AP004694.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0467G09 Length = 158204 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 386 ttgtcagcggtgctctgggca 406 ||||||||||||||||||||| Sbjct: 29734 ttgtcagcggtgctctgggca 29754
>dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0006O15 Length = 139723 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 150 tcacatggagatcagatcaga 170 ||||||||||||||||||||| Sbjct: 81220 tcacatggagatcagatcaga 81240
>dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-B12, full insert sequence Length = 685 Score = 42.1 bits (21), Expect = 1.9 Identities = 45/53 (84%) Strand = Plus / Minus Query: 257 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 309 ||||| |||||||||||||| | |||||||| | ||| |||| ||||||||| Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397
>dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-156-H07, full insert sequence Length = 654 Score = 42.1 bits (21), Expect = 1.9 Identities = 45/53 (84%) Strand = Plus / Minus Query: 257 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 309 ||||| |||||||||||||| | |||||||| | ||| |||| ||||||||| Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397
>dbj|AK100917.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023133E20, full insert sequence Length = 5035 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 150 tcacatggagatcagatcaga 170 ||||||||||||||||||||| Sbjct: 4798 tcacatggagatcagatcaga 4818
>gb|AY109327.1| Zea mays CL468_1 mRNA sequence Length = 2907 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 419 ctcttgacgccgctgcagcag 439 ||||||||||||||||||||| Sbjct: 2805 ctcttgacgccgctgcagcag 2785
>gb|AC132475.4| Mus musculus BAC clone RP23-114P16 from 3, complete sequence Length = 215899 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 76 aaagtaaaaaacaaccatagt 96 ||||||||||||||||||||| Sbjct: 210967 aaagtaaaaaacaaccatagt 210987
>gb|AC005222.1| Homo sapiens chromosome 16, cosmid clone RT163 (LANL), complete sequence Length = 40619 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 gcgcccatggtgggcagtgg 245 |||||||||||||||||||| Sbjct: 25417 gcgcccatggtgggcagtgg 25398
>emb|AL121777.39|HSJ1057D4 Human DNA sequence from clone RP5-1057D4 on chromosome 20 Contains the SRMP1 gene for spermidine synthase pseudogene 1, the 5' end of the gene for a novel protein similar to glucosamine-6-sulfatases (SULF2) (sulfatase 2, H-SULF2, KIAA1247) and a CpG island, complete sequence Length = 131888 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 136 gactcctttctccctcacat 155 |||||||||||||||||||| Sbjct: 88928 gactcctttctccctcacat 88909
>emb|AL645904.13| Mouse DNA sequence from clone RP23-121P11 on chromosome 11 Contains the gene for a novel protein (1700121K02Rik), the Hnrph1 gene for heterogeneous nuclear ribonucleoprotein H1, the Rufy1 gene for RUN and FYVE domain containing 1, a novel pseudogene and three CpG islands, complete sequence Length = 193696 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Plus Query: 55 gtgtctcctcaaagggagag 74 |||||||||||||||||||| Sbjct: 170117 gtgtctcctcaaagggagag 170136
>gb|AC012676.5| Homo sapiens chromosome 16 clone RP11-295D4, complete sequence Length = 172071 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 226 gcgcccatggtgggcagtgg 245 |||||||||||||||||||| Sbjct: 84403 gcgcccatggtgggcagtgg 84384
>gb|AE004829.1| Pseudomonas aeruginosa PAO1, section 390 of 529 of the complete genome Length = 10201 Score = 40.1 bits (20), Expect = 7.4 Identities = 23/24 (95%) Strand = Plus / Minus Query: 313 ggaggggatgccggcggccttgcc 336 |||| ||||||||||||||||||| Sbjct: 4301 ggagaggatgccggcggccttgcc 4278
>dbj|AK073363.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033030A16, full insert sequence Length = 760 Score = 40.1 bits (20), Expect = 7.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330 |||| ||||||||||| || ||||||||||||||| Sbjct: 400 gacgttgacgccgcacttgccggggatgccggcggc 365
>dbj|AK070192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023041I08, full insert sequence Length = 2914 Score = 40.1 bits (20), Expect = 7.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330 |||| ||||||||||| || ||||||||||||||| Sbjct: 2487 gacgttgacgccgcacttgccggggatgccggcggc 2452
>dbj|AK062690.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-A02, full insert sequence Length = 646 Score = 40.1 bits (20), Expect = 7.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330 |||| ||||||||||| || ||||||||||||||| Sbjct: 394 gacgttgacgccgcacttgccggggatgccggcggc 359
>dbj|AK061182.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-D09, full insert sequence Length = 928 Score = 40.1 bits (20), Expect = 7.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330 |||| ||||||||||| || ||||||||||||||| Sbjct: 399 gacgttgacgccgcacttgccggggatgccggcggc 364
>dbj|AK059737.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-D08, full insert sequence Length = 853 Score = 40.1 bits (20), Expect = 7.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330 |||| ||||||||||| || ||||||||||||||| Sbjct: 394 gacgttgacgccgcacttgccggggatgccggcggc 359
>dbj|AK059714.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-F09, full insert sequence Length = 773 Score = 40.1 bits (20), Expect = 7.4 Identities = 32/36 (88%) Strand = Plus / Minus Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330 |||| ||||||||||| || ||||||||||||||| Sbjct: 399 gacgttgacgccgcacttgccggggatgccggcggc 364
>gb|AF171094.1|AF171094 Lilium longiflorum lipid transfer protein precursor (LTP) mRNA, complete cds Length = 650 Score = 40.1 bits (20), Expect = 7.4 Identities = 35/40 (87%) Strand = Plus / Minus Query: 289 gtaggggacgctgacgccgcacatggaggggatgccggcg 328 |||||||| | ||||||||||| || ||||||||||||| Sbjct: 349 gtaggggatgttgacgccgcacttgccggggatgccggcg 310
>gb|AC158219.4| Mus musculus chromosome 8, clone RP23-189N10, complete sequence Length = 215819 Score = 40.1 bits (20), Expect = 7.4 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 aaagggagagcaaagtaaaa 84 |||||||||||||||||||| Sbjct: 74357 aaagggagagcaaagtaaaa 74338 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,461,598 Number of Sequences: 3902068 Number of extensions: 3461598 Number of successful extensions: 73290 Number of sequences better than 10.0: 135 Number of HSP's better than 10.0 without gapping: 138 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 72689 Number of HSP's gapped (non-prelim): 586 length of query: 548 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 525 effective length of database: 17,143,297,704 effective search space: 9000231294600 effective search space used: 9000231294600 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)