ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd16a14
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA 363 3e-97
2emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene 355 8e-95
3emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid tra... 347 2e-92
4emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene 339 5e-90
5gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt... 339 5e-90
6gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer prote... 283 2e-73
7emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non sp... 238 1e-59
8emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for ... 230 3e-57
9emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific l... 222 7e-55
10gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid... 218 1e-53
11gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipi... 218 1e-53
12gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipi... 218 1e-53
13emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non sp... 214 2e-52
14gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) g... 139 9e-30
15gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein ... 139 9e-30
16gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) m... 137 3e-29
17emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA 131 2e-27
18gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid... 129 8e-27
19gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome... 119 8e-24
20dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 119 8e-24
21gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein ... 119 8e-24
22dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 8e-24
23dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 8e-24
24emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non sp... 119 8e-24
25gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 119 8e-24
26gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) m... 117 3e-23
27dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 115 1e-22
28emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 115 1e-22
29dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clon... 115 1e-22
30gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 115 1e-22
31emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136... 115 1e-22
32gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid tran... 107 3e-20
33emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein 107 3e-20
34dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 3e-20
35dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clon... 107 3e-20
36emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa... 107 3e-20
37gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) m... 107 3e-20
38emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA 103 5e-19
39gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT I... 100 7e-18
40gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT I... 100 7e-18
41emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid tr... 96 1e-16
42gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid tran... 88 3e-14
43emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, comp... 88 3e-14
44emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA 88 3e-14
45emb|X71667.1|SVLTP1 S.vulgare ltp1 gene 88 3e-14
46emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 88 3e-14
47dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
48dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
49gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT I... 88 3e-14
50gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4)... 86 1e-13
51emb|X71668.1|SVLTP2 S.vulgare ltp2 gene 84 4e-13
52dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 84 4e-13
53dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic D... 84 4e-13
54emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA 80 7e-12
55gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA,... 80 7e-12
56gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA... 80 7e-12
57gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transf... 80 7e-12
58gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfe... 80 7e-12
59gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transf... 80 7e-12
60gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholi... 80 7e-12
61gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholip... 80 7e-12
62gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transf... 80 7e-12
63gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfe... 80 7e-12
64gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transf... 80 7e-12
65gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfe... 80 7e-12
66gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfe... 80 7e-12
67gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfe... 80 7e-12
68gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transf... 80 7e-12
69gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transf... 80 7e-12
70gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfe... 80 7e-12
71gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transf... 80 7e-12
72gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transf... 80 7e-12
73gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholi... 80 7e-12
74gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholi... 80 7e-12
75gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholi... 80 7e-12
76gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phosphol... 80 7e-12
77gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholi... 80 7e-12
78gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholip... 80 7e-12
79gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholip... 80 7e-12
80gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholi... 80 7e-12
81gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholi... 80 7e-12
82gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholip... 80 7e-12
83gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholip... 80 7e-12
84gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholip... 80 7e-12
85dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 3e-11
86dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
87dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
88dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
89dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clon... 76 1e-10
90gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence 72 2e-09
91gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precurs... 72 2e-09
92gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfe... 72 2e-09
93gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholi... 72 2e-09
94gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholi... 72 2e-09
95gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholi... 72 2e-09
96gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phosphol... 72 2e-09
97gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholip... 72 2e-09
98gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholip... 72 2e-09
99gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholip... 72 2e-09
100gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholip... 72 2e-09
101gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholip... 72 2e-09
102gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phosphol... 72 2e-09
103gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholip... 72 2e-09
104gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3... 72 2e-09
105gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, co... 72 2e-09
106gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA,... 68 3e-08
107gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholip... 64 4e-07
108gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholip... 64 4e-07
109dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfe... 62 2e-06
110gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid... 58 3e-05
111gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein... 46 0.095
112gb|AC161418.4| Mus musculus BAC clone RP23-325K2 from chromosome... 42 1.5
113dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic D... 42 1.5
114dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
115dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
116dbj|AK100917.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 1.5
117gb|AC132475.4| Mus musculus BAC clone RP23-114P16 from 3, comple... 42 1.5
118gb|AC005222.1| Homo sapiens chromosome 16, cosmid clone RT163 (L... 40 5.9
119emb|AL121777.39|HSJ1057D4 Human DNA sequence from clone RP5-1057... 40 5.9
120emb|AL645904.13| Mouse DNA sequence from clone RP23-121P11 on ch... 40 5.9
121gb|AC012676.5| Homo sapiens chromosome 16 clone RP11-295D4, comp... 40 5.9
122gb|AE004829.1| Pseudomonas aeruginosa PAO1, section 390 of 529 o... 40 5.9
123dbj|AK073363.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
124dbj|AK070192.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
125dbj|AK062690.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
126dbj|AK061182.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
127dbj|AK059737.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
128dbj|AK059714.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 5.9
129gb|AY109327.1| Zea mays CL468_1 mRNA sequence 40 5.9
130gb|AF171094.1|AF171094 Lilium longiflorum lipid transfer protein... 40 5.9
131gb|AC158219.4| Mus musculus chromosome 8, clone RP23-189N10, com... 40 5.9 
>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA
          Length = 705

 Score =  363 bits (183), Expect = 3e-97
 Identities = 194/198 (97%)
 Strand = Plus / Minus

                                                                       
Query: 241 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 416 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 357

                                                                       
Query: 301 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 360
           |||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 356 gacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagcagcgct 297

                                                                       
Query: 361 cttgatgcacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtct 420
           |||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||
Sbjct: 296 cttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggcagcgccggccagtct 237

                             
Query: 421 cttgacgccgctgcagca 438
           ||||||||||||||||||
Sbjct: 236 cttgacgccgctgcagca 219
to top
>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene
          Length = 1862

 Score =  355 bits (179), Expect = 8e-95
 Identities = 193/198 (97%)
 Strand = Plus / Minus

                                                                        
Query: 241  agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 300
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1386 agtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 1327

                                                                        
Query: 301  gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 360
            ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 1326 gacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgct 1267

                                                                        
Query: 361  cttgatgcacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtct 420
            ||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||
Sbjct: 1266 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtct 1207

                              
Query: 421  cttgacgccgctgcagca 438
            ||||||||||||||||||
Sbjct: 1206 cttgacgccgctgcagca 1189
to top
>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor
          Length = 691

 Score =  347 bits (175), Expect = 2e-92
 Identities = 192/198 (96%)
 Strand = Plus / Minus

                                                                       
Query: 241 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 300
           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 371 agtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 312

                                                                       
Query: 301 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 360
           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 311 gacgccgcacatggaggggatgccggcggccttgccagcgtttagcccacccgcagcgct 252

                                                                       
Query: 361 cttgatgcacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtct 420
           ||||||||||||||||||||||||||||||| |||||||||| || |||||||||| |||
Sbjct: 251 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctgcgccggccaatct 192

                             
Query: 421 cttgacgccgctgcagca 438
           ||||||||||||||||||
Sbjct: 191 cttgacgccgctgcagca 174
to top
>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene
          Length = 1567

 Score =  339 bits (171), Expect = 5e-90
 Identities = 191/198 (96%)
 Strand = Plus / Minus

                                                                        
Query: 241  agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 300
            |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||
Sbjct: 1021 agtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgct 962

                                                                        
Query: 301  gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 360
            ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 961  gacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgct 902

                                                                        
Query: 361  cttgatgcacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtct 420
            ||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||
Sbjct: 901  cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtct 842

                              
Query: 421  cttgacgccgctgcagca 438
            |||||| |||||||||||
Sbjct: 841  cttgacaccgctgcagca 824
to top
>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds
          Length = 3238

 Score =  339 bits (171), Expect = 5e-90
 Identities = 191/198 (96%)
 Strand = Plus / Minus

                                                                        
Query: 241  agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 300
            |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||
Sbjct: 2417 agtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtaggggacgct 2358

                                                                        
Query: 301  gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 360
            ||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||
Sbjct: 2357 gacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgcagcgct 2298

                                                                        
Query: 361  cttgatgcacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtct 420
            ||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||
Sbjct: 2297 cttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccagtct 2238

                              
Query: 421  cttgacgccgctgcagca 438
            |||||| |||||||||||
Sbjct: 2237 cttgacaccgctgcagca 2220
to top
>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene,
           complete cds
          Length = 573

 Score =  283 bits (143), Expect = 2e-73
 Identities = 184/198 (92%)
 Strand = Plus / Minus

                                                                       
Query: 241 agtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgct 300
           |||||| |||||| |||||||||||||||||||||||| |||||||| ||||||||||||
Sbjct: 442 agtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtaggggacgct 383

                                                                       
Query: 301 gacgccgcacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgct 360
           |||||||||| ||||||||||||||||||||||||||||||| | |||| | ||||||||
Sbjct: 382 gacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcggcagcgct 323

                                                                       
Query: 361 cttgatgcacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtct 420
           |||||||||||||||| |||||||||||||| |||||||||| || |||||||||| |||
Sbjct: 322 cttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgcgccggccaatct 263

                             
Query: 421 cttgacgccgctgcagca 438
           ||||||||||||||||||
Sbjct: 262 cttgacgccgctgcagca 245
to top
>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2122

 Score =  238 bits (120), Expect = 1e-59
 Identities = 173/191 (90%)
 Strand = Plus / Minus

                                                                        
Query: 248  gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307
            |||||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||
Sbjct: 1619 gatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccg 1560

                                                                        
Query: 308  cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367
            ||| | | ||||||||||||||||||||||||||| |||||| | |||||||||||||||
Sbjct: 1559 cactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgatg 1500

                                                                        
Query: 368  cacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtctcttgacg 427
            |||||||||||||||||||||||| |||||||| |||| | || ||| || ||| | |||
Sbjct: 1499 cacttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacg 1440

                       
Query: 428  ccgctgcagca 438
            |||||||||||
Sbjct: 1439 ccgctgcagca 1429
to top
>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific
           lipid transfer protein precursor (ltp9.2 gene)
          Length = 604

 Score =  230 bits (116), Expect = 3e-57
 Identities = 172/191 (90%)
 Strand = Plus / Minus

                                                                       
Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307
           |||||||||||||||||||||||||| |||| |||||||||||| |||||||| ||||||
Sbjct: 315 gatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaagggacgctaacgccg 256

                                                                       
Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367
           ||| | | ||||||||||||||||||||||||||| |||||| | |||||||||||||||
Sbjct: 255 cactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgatg 196

                                                                       
Query: 368 cacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtctcttgacg 427
           |||||||||||||||||||||||| |||||||| |||| | || ||| || ||| | |||
Sbjct: 195 cacttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacg 136

                      
Query: 428 ccgctgcagca 438
           |||||||||||
Sbjct: 135 ccgctgcagca 125
to top
>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer
           protein precursor (ltp9.2 gene)
          Length = 708

 Score =  222 bits (112), Expect = 7e-55
 Identities = 171/191 (89%)
 Strand = Plus / Minus

                                                                       
Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307
           |||||||||||||||||||||||||| |||| ||||||||||||||||| ||| ||||||
Sbjct: 416 gatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggatgctaacgccg 357

                                                                       
Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367
           ||| | | ||||||||||||||||||||||||||| |||||| | |||||||||||||| 
Sbjct: 356 cactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgata 297

                                                                       
Query: 368 cacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtctcttgacg 427
           |||||||||||||||||||||||| |||||||| |||| | || ||| || ||| | |||
Sbjct: 296 cacttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacg 237

                      
Query: 428 ccgctgcagca 438
           |||||||||||
Sbjct: 236 ccgctgcagca 226
to top
>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  218 bits (110), Expect = 1e-53
 Identities = 169/189 (89%)
 Strand = Plus / Minus

                                                                       
Query: 250 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 309
           |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 310 catggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgca 369
           | | | ||||||||| ||||||||||||||||| |||||| | |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 370 cttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtctcttgacgcc 429
           |||||||||||||||||||||| |||||||| |||| | || ||| || ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                    
Query: 430 gctgcagca 438
           |||||||||
Sbjct: 168 gctgcagca 160
to top
>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  218 bits (110), Expect = 1e-53
 Identities = 169/189 (89%)
 Strand = Plus / Minus

                                                                       
Query: 250 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 309
           |||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||
Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289

                                                                       
Query: 310 catggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgca 369
           | | | ||||||||| ||||||||||||||||| |||||| | |||||||||||||| ||
Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229

                                                                       
Query: 370 cttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtctcttgacgcc 429
           |||||||||||||||||||||| |||||||| |||| | || ||| || ||| | |||||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacgcc 169

                    
Query: 430 gctgcagca 438
           |||||||||
Sbjct: 168 gctgcagca 160
to top
>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  218 bits (110), Expect = 1e-53
 Identities = 169/189 (89%)
 Strand = Plus / Minus

                                                                       
Query: 250 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 309
           ||||||||||||||||||||| ||||| | ||| ||||||||||||| ||||||||||||
Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289

                                                                       
Query: 310 catggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgca 369
           | ||||||||||||| |||||||| |||||||| |||||||| ||||| ||||| |||||
Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229

                                                                       
Query: 370 cttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtctcttgacgcc 429
           |||||||||||||||||||||| |||||||| | || ||||||||||| ||| |||| ||
Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgcgctgcgccggccagactcctgacacc 169

                    
Query: 430 gctgcagca 438
            ||||||||
Sbjct: 168 actgcagca 160
to top
>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer
            protein precursor
          Length = 2087

 Score =  214 bits (108), Expect = 2e-52
 Identities = 170/191 (89%)
 Strand = Plus / Minus

                                                                        
Query: 248  gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307
            |||||| ||||||||||||||||||| |||| ||||||||||||||||||||| ||||||
Sbjct: 1607 gatcagtgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccg 1548

                                                                        
Query: 308  cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367
            ||| | | |||||||||||||||||||||||| || |||||| | |||||||||||||||
Sbjct: 1547 cactttgtggggatgccggcggccttgccagcattgagcccagcagcagcgctcttgatg 1488

                                                                        
Query: 368  cacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtctcttgacg 427
            ||||||||| |||||||||||||| |||||||| |||| | || ||| || ||| | |||
Sbjct: 1487 cacttgcacaccgcttgcttgtcagcggtgctccgggctgagctggctagactcctaacg 1428

                       
Query: 428  ccgctgcagca 438
            |||||||||||
Sbjct: 1427 ccgctgcagca 1417
to top
>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds
          Length = 3448

 Score =  139 bits (70), Expect = 9e-30
 Identities = 132/153 (86%)
 Strand = Plus / Minus

                                                                        
Query: 248  gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307
            |||||| | |||||||||||||| ||||| |||||||||| |||||||| ||||||||||
Sbjct: 3206 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 3147

                                                                        
Query: 308  cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367
            ||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||||
Sbjct: 3146 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 3087

                                             
Query: 368  cacttgcacgccgcttgcttgtcancggtgctc 400
            ||| |||| ||||||||||||||  ||||||||
Sbjct: 3086 cacctgcatgccgcttgcttgtcggcggtgctc 3054



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 149  ctcacatggagatcagatcagagcgtttattcatatatat 188
            ||||||||||||||| |||||||| ||||||||| |||||
Sbjct: 3341 ctcacatggagatcatatcagagcatttattcatgtatat 3302
to top
>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA,
           complete cds
          Length = 737

 Score =  139 bits (70), Expect = 9e-30
 Identities = 132/153 (86%)
 Strand = Plus / Minus

                                                                       
Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307
           |||||| | |||||||||||||| ||||| |||||||||| |||||||| ||||||||||
Sbjct: 410 gatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccg 351

                                                                       
Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367
           ||| |||||||||| |  || ||||| || | ||| |||||||| ||||| |||||||||
Sbjct: 350 cacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgatg 291

                                            
Query: 368 cacttgcacgccgcttgcttgtcancggtgctc 400
           ||| |||| ||||||||||||||  ||||||||
Sbjct: 290 cacctgcatgccgcttgcttgtcggcggtgctc 258



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 149 ctcacatggagatcagatcagagcgtttattcatatatat 188
           ||||||||||||||| |||||||| ||||||||| |||||
Sbjct: 545 ctcacatggagatcatatcagagcatttattcatgtatat 506
to top
>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds
          Length = 348

 Score =  137 bits (69), Expect = 3e-29
 Identities = 125/144 (86%)
 Strand = Plus / Minus

                                                                       
Query: 257 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 316
           |||||||||||||| ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 317 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 376
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                   
Query: 377 gccgcttgcttgtcancggtgctc 400
           ||||||||||||||  ||||||||
Sbjct: 221 gccgcttgcttgtcggcggtgctc 198
to top
>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA
          Length = 660

 Score =  131 bits (66), Expect = 2e-27
 Identities = 77/81 (95%)
 Strand = Plus / Minus

                                                                       
Query: 358 gctcttgatgcacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccag 417
           |||||||| |||| |||||||||||||||||||| ||||||||||||| |||||||||||
Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgcgccggccag 226

                                
Query: 418 tctcttgacgccgctgcagca 438
           |||||||||||||||||||||
Sbjct: 225 tctcttgacgccgctgcagca 205
to top
>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein
           1 precursor, mRNA, complete cds
          Length = 348

 Score =  129 bits (65), Expect = 8e-27
 Identities = 124/144 (86%)
 Strand = Plus / Minus

                                                                       
Query: 257 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 316
           ||||||||||| || ||||| |||||||||| |||||||| ||||||||||||| |||||
Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282

                                                                       
Query: 317 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 376
           ||||| |  || ||||| || | ||| |||||||| ||||| |||||||||||| |||| 
Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222

                                   
Query: 377 gccgcttgcttgtcancggtgctc 400
           ||||||||||||||  ||||||||
Sbjct: 221 gccgcttgcttgtcggcggtgctc 198
to top
>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBa0086N07 map S790A, complete sequence
          Length = 178523

 Score =  119 bits (60), Expect = 8e-24
 Identities = 81/88 (92%)
 Strand = Plus / Plus

                                                                         
Query: 261   tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 320
             |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080

                                         
Query: 321   tgccggcggccttgccagcgttaagccc 348
             ||| |||||| ||||| ||||| |||||
Sbjct: 94081 tgctggcggcgttgccggcgttgagccc 94108
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  119 bits (60), Expect = 8e-24
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                            
Query: 261      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 320
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000

                                            
Query: 321      tgccggcggccttgccagcgttaagccc 348
                ||| |||||| ||||| ||||| |||||
Sbjct: 13089999 tgctggcggcgttgccggcgttgagccc 13089972



 Score =  107 bits (54), Expect = 3e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 263    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 323    ccggcggccttgccagcgttaagccc 348
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 263    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 323    ccggcggccttgccagcgtt 342
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 263    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 323    ccggcg 328
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 295    gacgctgacgccgcacatggaggggatgccggcggc 330
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810
to top
>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA,
           complete cds
          Length = 730

 Score =  119 bits (60), Expect = 8e-24
 Identities = 158/191 (82%)
 Strand = Plus / Minus

                                                                       
Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307
           |||||| | |||||||||||||| ||||| |||||||| | |||||||||||||||||||
Sbjct: 429 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 370

                                                                       
Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367
           ||| ||||||| ||||| |||||||||   | ||| ||||| || ||| | ||||||| |
Sbjct: 369 cacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttgagg 310

                                                                       
Query: 368 cacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtctcttgacg 427
           ||| |||| |  |||||||||||  |||||||| | ||   |||||||| | || |||||
Sbjct: 309 cacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacg 250

                      
Query: 428 ccgctgcagca 438
           |||||||||||
Sbjct: 249 ccgctgcagca 239



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 149 ctcacatggagatcagatcagagcgtttattcatatatat 188
           ||||||||||||||| |||||||| ||||||||| |||||
Sbjct: 550 ctcacatggagatcatatcagagcatttattcatgtatat 511
to top
>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full
           insert sequence
          Length = 843

 Score =  119 bits (60), Expect = 8e-24
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                       
Query: 261 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 320
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400

                                       
Query: 321 tgccggcggccttgccagcgttaagccc 348
           ||| |||||| ||||| ||||| |||||
Sbjct: 399 tgctggcggcgttgccggcgttgagccc 372
to top
>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full
           insert sequence
          Length = 846

 Score =  119 bits (60), Expect = 8e-24
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                       
Query: 261 tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 320
           |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399

                                       
Query: 321 tgccggcggccttgccagcgttaagccc 348
           ||| |||||| ||||| ||||| |||||
Sbjct: 398 tgctggcggcgttgccggcgttgagccc 371
to top
>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid
           transfer protein precursor
          Length = 496

 Score =  119 bits (60), Expect = 8e-24
 Identities = 158/191 (82%)
 Strand = Plus / Minus

                                                                       
Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307
           |||||| | |||||||||||||| ||||| |||||||| | |||||||||||||||||||
Sbjct: 370 gatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccg 311

                                                                       
Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367
           ||| ||||||| ||||| |||||||||   | ||| ||||| || ||| | ||||||| |
Sbjct: 310 cacttggagggaatgcctgcggccttgttggggttgagccctccggcaacactcttgagg 251

                                                                       
Query: 368 cacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtctcttgacg 427
           ||| |||| |  |||||||||||  |||||||| | ||   |||||||| | || |||||
Sbjct: 250 cacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacg 191

                      
Query: 428 ccgctgcagca 438
           |||||||||||
Sbjct: 190 ccgctgcagca 180



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 149 ctcacatggagatcagatcagagcgtttattcatatatat 188
           ||||||||||||||| |||||||| ||||||||| |||||
Sbjct: 491 ctcacatggagatcatatcagagcatttattcatgtatat 452
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  119 bits (60), Expect = 8e-24
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                            
Query: 261      tagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggagggga 320
                |||||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||
Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179

                                            
Query: 321      tgccggcggccttgccagcgttaagccc 348
                ||| |||||| ||||| ||||| |||||
Sbjct: 13170178 tgctggcggcgttgccggcgttgagccc 13170151



 Score =  107 bits (54), Expect = 3e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                          
Query: 263    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
              |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382

                                        
Query: 323    ccggcggccttgccagcgttaagccc 348
              | |||||| ||||| ||||| |||||
Sbjct: 702381 ctggcggcgttgccggcgttgagccc 702356



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 263    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705

                                  
Query: 323    ccggcggccttgccagcgtt 342
              | |||||| ||||| |||||
Sbjct: 692704 ctggcggcattgccggcgtt 692685



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 263    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
              |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410

                    
Query: 323    ccggcg 328
              ||||||
Sbjct: 679409 ccggcg 679404



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 295    gacgctgacgccgcacatggaggggatgccggcggc 330
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 714845 gacgttgacgccgcacttgccggggatgccggcggc 714810
to top
>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds
          Length = 348

 Score =  117 bits (59), Expect = 3e-23
 Identities = 151/182 (82%)
 Strand = Plus / Minus

                                                                       
Query: 257 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggag 316
           |||||||||||||| ||||| |||||||| | |||||||||||||||||||||| |||||
Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282

                                                                       
Query: 317 gggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatgcacttgcac 376
           || ||||| |||||||||   | ||| ||||| || ||| | ||||||| |||| |||| 
Sbjct: 281 ggaatgcctgcggccttgttggggttgagccctccggcaacactcttgaggcacctgcat 222

                                                                       
Query: 377 gccgcttgcttgtcancggtgctctgggcagcgccggccagtctcttgacgccgctgcag 436
           |  |||||||||||  |||||||| | ||   |||||||| | || ||||||||||||||
Sbjct: 221 gtagcttgcttgtcggcggtgctccgcgctaagccggccaatttcctgacgccgctgcag 162

             
Query: 437 ca 438
           ||
Sbjct: 161 ca 160
to top
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12,
              complete sequence
          Length = 27566993

 Score =  115 bits (58), Expect = 1e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                          
Query: 263    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 323    ccggcggccttgccagcgttaagccc 348
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 263    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 323    ccggcggccttgccagcgtt 342
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 263    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 323    ccggcg 328
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 295    gacgctgacgccgcacatggaggggatgccggcggc 330
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520
to top
>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15
          Length = 511

 Score =  115 bits (58), Expect = 1e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354

                                     
Query: 323 ccggcggccttgccagcgttaagccc 348
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
to top
>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full
           insert sequence
          Length = 995

 Score =  115 bits (58), Expect = 1e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611

                                     
Query: 323 ccggcggccttgccagcgttaagccc 348
           | |||||| ||||| ||||| |||||
Sbjct: 610 ctggcggcgttgccggcgttgagccc 585
to top
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  115 bits (58), Expect = 1e-22
 Identities = 79/86 (91%)
 Strand = Plus / Minus

                                                                          
Query: 263    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
              |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684

                                        
Query: 323    ccggcggccttgccagcgttaagccc 348
              | |||||| ||||| ||||| |||||
Sbjct: 736683 ctggcggcgttgccggcgttgagccc 736658



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                          
Query: 263    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
              |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557

                                  
Query: 323    ccggcggccttgccagcgtt 342
              | |||||| ||||| |||||
Sbjct: 732556 ctggcggcattgccggcgtt 732537



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                          
Query: 263    gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
              |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668

                    
Query: 323    ccggcg 328
              ||||||
Sbjct: 722667 ccggcg 722662



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                  
Query: 295    gacgctgacgccgcacatggaggggatgccggcggc 330
              |||| ||||||||||| ||  |||||||||||||||
Sbjct: 745555 gacgttgacgccgcacttgccggggatgccggcggc 745520
to top
>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 118211

 Score =  115 bits (58), Expect = 1e-22
 Identities = 79/86 (91%)
 Strand = Plus / Plus

                                                                         
Query: 263   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
             |||||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450

                                       
Query: 323   ccggcggccttgccagcgttaagccc 348
             | |||||| ||||| ||||| |||||
Sbjct: 42451 ctggcggcgttgccggcgttgagccc 42476



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                         
Query: 263   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 46518 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 46577

                                 
Query: 323   ccggcggccttgccagcgtt 342
             | |||||| ||||| |||||
Sbjct: 46578 ctggcggcattgccggcgtt 46597



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                         
Query: 263   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
             |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 56407 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 56466

                   
Query: 323   ccggcg 328
             ||||||
Sbjct: 56467 ccggcg 56472



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 295   gacgctgacgccgcacatggaggggatgccggcggc 330
             |||| ||||||||||| ||  |||||||||||||||
Sbjct: 33579 gacgttgacgccgcacttgccggggatgccggcggc 33614
to top
>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1
           mRNA, complete cds
          Length = 530

 Score =  107 bits (54), Expect = 3e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367

                                     
Query: 323 ccggcggccttgccagcgttaagccc 348
           | |||||| ||||| ||||| |||||
Sbjct: 366 ctggcggcgttgccggcgttgagccc 341
to top
>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein
          Length = 799

 Score =  107 bits (54), Expect = 3e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 323 ccggcggccttgccagcgttaagccc 348
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353
to top
>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full
            insert sequence
          Length = 2882

 Score =  107 bits (54), Expect = 3e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                        
Query: 263  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
            |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386

                                      
Query: 323  ccggcggccttgccagcgttaagccc 348
            | |||||| ||||| ||||| |||||
Sbjct: 2385 ctggcggcgttgccggcgttgagccc 2360
to top
>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full
           insert sequence
          Length = 551

 Score =  107 bits (54), Expect = 3e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263

                                     
Query: 323 ccggcggccttgccagcgttaagccc 348
           | |||||| ||||| ||||| |||||
Sbjct: 262 ctggcggcgttgccggcgttgagccc 237
to top
>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from
             chromosome 11 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 181322

 Score =  107 bits (54), Expect = 3e-20
 Identities = 78/86 (90%)
 Strand = Plus / Plus

                                                                         
Query: 263   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
             |||||||||| |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590

                                       
Query: 323   ccggcggccttgccagcgttaagccc 348
             | |||||| ||||| ||||| |||||
Sbjct: 40591 ctggcggcgttgccggcgttgagccc 40616



 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Plus

                                                                         
Query: 263   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
             |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 50208 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 50267

                                 
Query: 323   ccggcggccttgccagcgtt 342
             | |||||| ||||| |||||
Sbjct: 50268 ctggcggcattgccggcgtt 50287



 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Plus

                                                                         
Query: 263   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
             |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 63503 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 63562

                   
Query: 323   ccggcg 328
             ||||||
Sbjct: 63563 ccggcg 63568



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 32/36 (88%)
 Strand = Plus / Plus

                                                 
Query: 295   gacgctgacgccgcacatggaggggatgccggcggc 330
             |||| ||||||||||| ||  |||||||||||||||
Sbjct: 28127 gacgttgacgccgcacttgccggggatgccggcggc 28162
to top
>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds
          Length = 799

 Score =  107 bits (54), Expect = 3e-20
 Identities = 78/86 (90%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           ||||| |||| |||||||||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379

                                     
Query: 323 ccggcggccttgccagcgttaagccc 348
           | |||||| ||||| ||||| |||||
Sbjct: 378 ctggcggcgttgccggcgttgagccc 353
to top
>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA
          Length = 724

 Score =  103 bits (52), Expect = 5e-19
 Identities = 157/191 (82%), Gaps = 1/191 (0%)
 Strand = Plus / Minus

                                                                       
Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307
           |||||| | |||||||||||||||||    |||||||| | |||||||||||||||||||
Sbjct: 420 gatcagtggatcttagagcagtcgacactggcgctgatcgtgtaggggacgctgacgccg 361

                                                                       
Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367
           ||| ||||||||||||| |||||| |||| |||||   | | || ||| | ||||||| |
Sbjct: 360 cacctggaggggatgcctgcggccctgccggcgttgtacgcgccggca-cactcttgagg 302

                                                                       
Query: 368 cacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtctcttgacg 427
           ||| ||||||  |||||||||||  |||||||| | ||   |||||||| ||||||||| 
Sbjct: 301 cacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttgact 242

                      
Query: 428 ccgctgcagca 438
           ||||| |||||
Sbjct: 241 ccgctacagca 231
to top
>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds
          Length = 507

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           ||||||| || |||||||||||||| |||||||||||||||||||||| | |||||||||
Sbjct: 373 gagcagtggatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 314

                                     
Query: 323 ccggcggccttgccagcgttaagccc 348
           | |||||| ||||| ||||| |||||
Sbjct: 313 ctggcggcgttgccggcgttgagccc 288
to top
>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds
          Length = 805

 Score = 99.6 bits (50), Expect = 7e-18
 Identities = 78/86 (90%), Gaps = 1/86 (1%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||| |||||||||||||| |||||| ||||||||||||||| |||||||||||
Sbjct: 412 gagcagtcgatggaagcgctgatggtgtaggg-acgctgacgccgcacttggaggggatg 354

                                     
Query: 323 ccggcggccttgccagcgttaagccc 348
           | |||||| ||||| ||||| |||||
Sbjct: 353 ctggcggcgttgccggcgttgagccc 328
to top
>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor
          Length = 627

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 155/191 (81%)
 Strand = Plus / Minus

                                                                       
Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307
           |||||| | ||||| |||||||||||    |||||||| | |||||||||||||||||||
Sbjct: 352 gatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgacgccg 293

                                                                       
Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367
           ||| ||||||||||||| |||||| |||| |||||   | | || ||  | ||||||| |
Sbjct: 292 cacctggaggggatgcctgcggccctgccggcgttgtacgcgccggcgacactcttgagg 233

                                                                       
Query: 368 cacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtctcttgacg 427
           ||| ||||||  |||||||||||  |||||||| | ||   |||||||| ||||||||| 
Sbjct: 232 cacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttgact 173

                      
Query: 428 ccgctgcagca 438
           ||||| |||||
Sbjct: 172 ccgctacagca 162
to top
>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1
           mRNA, complete cds
          Length = 647

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 469 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 410

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 409 ctggcggcattgccggcgtt 390
to top
>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS
          Length = 1485

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 701 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 642

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 641 ctggcggcattgccggcgtt 622
to top
>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA
          Length = 717

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 294 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 235

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 234 ctggcggcgttgccggcgtt 215
to top
>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene
          Length = 1499

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 997 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 938

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 937 ctggcggcgttgccggcgtt 918
to top
>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1
          Length = 692

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 331 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 272

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 271 ctggcggcattgccggcgtt 252
to top
>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full
           insert sequence
          Length = 1003

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 654 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 595

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 594 ctggcggcattgccggcgtt 575
to top
>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full
           insert sequence
          Length = 840

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 437 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 378

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 377 ctggcggcattgccggcgtt 358
to top
>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds
          Length = 845

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||| ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 419 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 360

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 359 ctggcggcattgccggcgtt 340
to top
>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete
           cds
          Length = 345

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 123/150 (82%)
 Strand = Plus / Minus

                                                                       
Query: 289 gtaggggacgctgacgccgcacatggaggggatgccggcggccttgccagcgttaagccc 348
           ||||||||||||||||| |||| ||||||||||  | |||||| ||||  | || | |||
Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250

                                                                       
Query: 349 acccgcagcgctcttgatgcacttgcacgccgcttgcttgtcancggtgctctgggcagc 408
           ||| ||||| ||||||||||||  ||||||||||| ||||||| |||   ||||  |   
Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtcagcggcagtctgcacttg 190

                                         
Query: 409 gccggccagtctcttgacgccgctgcagca 438
           |||||||| |||| ||||||||||||||||
Sbjct: 189 gccggccaatctcctgacgccgctgcagca 160
to top
>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene
          Length = 1800

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 66/74 (89%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 965 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 906

                         
Query: 323 ccggcggccttgcc 336
           | ||||||||||||
Sbjct: 905 ctggcggccttgcc 892
to top
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                            
Query: 263      gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
                |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||||
Sbjct: 14437064 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 14437005

                      
Query: 323      ccggcg 328
                ||||||
Sbjct: 14437004 ccggcg 14436999



 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 150      tcacatggagatcagatcaga 170
                |||||||||||||||||||||
Sbjct: 22847882 tcacatggagatcagatcaga 22847902
to top
>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1116_C12
          Length = 116758

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 60/66 (90%)
 Strand = Plus / Minus

                                                                         
Query: 263   gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
             |||||||||  ||||| ||||||||||||||||| | ||||||||||| |||||||||||
Sbjct: 45562 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 45503

                   
Query: 323   ccggcg 328
             ||||||
Sbjct: 45502 ccggcg 45497
to top
>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA
          Length = 732

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 153/191 (80%)
 Strand = Plus / Minus

                                                                       
Query: 248 gatcagcgaatcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccg 307
           |||||| | ||||| |||||||||||    |||||||| | ||||||||||||||| |||
Sbjct: 423 gatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgaccccg 364

                                                                       
Query: 308 cacatggaggggatgccggcggccttgccagcgttaagcccacccgcagcgctcttgatg 367
           ||| ||||||||||||| |||||| | || |||||   | | || ||  | ||||||| |
Sbjct: 363 cacctggaggggatgcctgcggcccttccggcgttgtacgcgccggcgacactcttgagg 304

                                                                       
Query: 368 cacttgcacgccgcttgcttgtcancggtgctctgggcagcgccggccagtctcttgacg 427
           ||| ||||||  |||||||||||  |||||||| | ||   |||||||| ||||||||| 
Sbjct: 303 cacctgcacgtagcttgcttgtcggcggtgctccgcgctaagccggccaatctcttgact 244

                      
Query: 428 ccgctgcagca 438
           ||||| |||||
Sbjct: 243 ccgctacagca 233
to top
>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 695

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 61/68 (89%)
 Strand = Plus / Minus

                                                                       
Query: 275 gaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcggccttg 334
           |||| |||||||| |||||||| ||||||||||||| |||||||||||| |||||| |||
Sbjct: 325 gaagggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattg 266

                   
Query: 335 ccagcgtt 342
           || |||||
Sbjct: 265 ccggcgtt 258
to top
>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds
          Length = 770

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 423 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 364

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 363 ctggcggcgttgccggcgtt 344
to top
>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 698

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 333 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 274

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 273 ctggcggcgttgccggcgtt 254
to top
>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 514

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 419 ctcttgacgccgctgcagca 438
           ||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagca 141
to top
>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1
           (plt1) gene, partial cds
          Length = 514

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 265 ctggcggcgttgccggcgtt 246



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 419 ctcttgacgccgctgcagca 438
           ||||||||||||||||||||
Sbjct: 160 ctcttgacgccgctgcagca 141
to top
>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 804

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 374 ctggcggcgttgccggcgtt 355
to top
>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 391 ctggcggcgttgccggcgtt 372



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 419 ctcttgacgccgctgcagca 438
           ||||||||||||||||||||
Sbjct: 286 ctcttgacgccgctgcagca 267
to top
>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 635

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2)
           gene, partial cds
          Length = 639

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 284 ctggcggcgttgccggcgtt 265
to top
>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2
           (plt2) gene, partial cds
          Length = 613

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239
to top
>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2)
           gene, partial cds
          Length = 613

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239
to top
>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 829

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 414 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 355

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcgttgccggcgtt 335
to top
>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 816

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 826

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 818

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 822

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 832

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 820

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full
           insert sequence
          Length = 718

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Plus

                                                                       
Query: 280 gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcggccttgccagc 339
           |||||||| |||||||| ||||||||||||| |||||||||||| |||||| ||||| ||
Sbjct: 97  gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggc 156

              
Query: 340 gtt 342
           |||
Sbjct: 157 gtt 159
to top
>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full
           insert sequence
          Length = 793

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 430 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 371

                 
Query: 323 ccggcg 328
           ||||||
Sbjct: 370 ccggcg 365
to top
>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full
            insert sequence
          Length = 3876

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                        
Query: 263  gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
            |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 3516 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 3457

                  
Query: 323  ccggcg 328
            ||||||
Sbjct: 3456 ccggcg 3451
to top
>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full
           insert sequence
          Length = 792

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||||| |||||| |||||||||| | ||||||||||| |||||||||||
Sbjct: 432 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 373

                 
Query: 323 ccggcg 328
           ||||||
Sbjct: 372 ccggcg 367
to top
>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full
           insert sequence
          Length = 745

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 59/66 (89%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||||| ||||||||||||||||| | ||||| ||||| |||||||||||
Sbjct: 434 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 375

                 
Query: 323 ccggcg 328
           ||||||
Sbjct: 374 ccggcg 369
to top
>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence
          Length = 827

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375

                   
Query: 323 ccggcggc 330
           | ||||||
Sbjct: 374 ctggcggc 367
to top
>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete
           cds
          Length = 840

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||| ||| | |||||||| ||||||||   ||||||||||| |||||||||||
Sbjct: 414 gagcagtcgatggaggggctgatggtgtaggggatcgtgacgccgcacttggaggggatg 355

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 354 ctggcggcattgccggcgtt 335
to top
>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1)
           gene, partial cds
          Length = 699

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| ||||||| |||
Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggagggtatg 259

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 258 ctggcggcgttgccggcgtt 239
to top
>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 780

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 416 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 357

                   
Query: 323 ccggcggc 330
           | ||||||
Sbjct: 356 ctggcggc 349
to top
>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 714

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 341 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 282

                   
Query: 323 ccggcggc 330
           | ||||||
Sbjct: 281 ctggcggc 274
to top
>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 648

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 440 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 381

                   
Query: 323 ccggcggc 330
           | ||||||
Sbjct: 380 ctggcggc 373
to top
>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 829

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 323 ccggcggc 330
           | ||||||
Sbjct: 393 ctggcggc 386
to top
>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 831

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 455 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 396

                   
Query: 323 ccggcggc 330
           | ||||||
Sbjct: 395 ctggcggc 388
to top
>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 821

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 323 ccggcggc 330
           | ||||||
Sbjct: 390 ctggcggc 383
to top
>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 832

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394

                   
Query: 323 ccggcggc 330
           | ||||||
Sbjct: 393 ctggcggc 386
to top
>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 835

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 323 ccggcggc 330
           | ||||||
Sbjct: 390 ctggcggc 383
to top
>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer
           protein 1 (plt1) gene, complete cds
          Length = 814

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391

                   
Query: 323 ccggcggc 330
           | ||||||
Sbjct: 390 ctggcggc 383
to top
>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer
           protein 2 (plt2) gene, complete cds
          Length = 824

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||| ||||||
Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356

                               
Query: 323 ccggcggccttgccagcgtt 342
           | |||||| ||||| |||||
Sbjct: 355 ctggcggcgttgccggcgtt 336
to top
>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end
          Length = 677

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 264 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 205

                   
Query: 323 ccggcggc 330
           | ||||||
Sbjct: 204 ctggcggc 197
to top
>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone
           9C2
          Length = 813

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 60/68 (88%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||||||| |||||||||||
Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392

                   
Query: 323 ccggcggc 330
           | ||||||
Sbjct: 391 ctggcggc 384
to top
>gb|AF051369.1|AF051369 Oryza sativa lipid transfer protein mRNA, complete cds
          Length = 766

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 58/66 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||||| |||||| |||||||||| | |||| |||||| |||||||||||
Sbjct: 384 gagcagtcggtggaagggctgatagcgtaggggatgttgaccccgcacttggaggggatg 325

                 
Query: 323 ccggcg 328
           ||||||
Sbjct: 324 ccggcg 319
to top
>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 709

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | ||||||||  ||||||| ||||||||||||| |||||||||||
Sbjct: 319 gagcagtcggtggaggtgctgatggtataggggatgctgacgccgcacttggaggggatg 260

                   
Query: 323 ccggcggc 330
           | ||||||
Sbjct: 259 ctggcggc 252
to top
>gb|DQ147195.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer
           protein 1 (plt1) gene, partial cds
          Length = 686

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||| | |||||||| |||||||| ||||||||| ||| |||||||||||
Sbjct: 320 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccacacttggaggggatg 261

                   
Query: 323 ccggcggc 330
           | ||||||
Sbjct: 260 ctggcggc 253



 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 419 ctcttgacgccgctgcagca 438
           ||||||||||||||||||||
Sbjct: 155 ctcttgacgccgctgcagca 136
to top
>dbj|D10955.1|RIC323PTP Oryza sativa mRNA for phospholipid trasfer protein
          Length = 372

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 55/63 (87%)
 Strand = Plus / Minus

                                                                       
Query: 263 gagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgcacatggaggggatg 322
           |||||||||  ||||| ||||||| ||||||||| | ||||| ||||| |||||||||||
Sbjct: 141 gagcagtcggtggaagggctgatgccgtaggggatgttgacgtcgcacttggaggggatg 82

              
Query: 323 ccg 325
           |||
Sbjct: 81  ccg 79
to top
>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6
            (Ltp6) gene, promoter and complete cds
          Length = 3257

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 44/49 (89%)
 Strand = Plus / Minus

                                                             
Query: 280  gctgatggcgtaggggacgctgacgccgcacatggaggggatgccggcg 328
            ||||||||||||||||| | ||||||||||| ||  |||||||||||||
Sbjct: 2770 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722
to top
>gb|AY057932.1| Bromus inermis nonspecific lipid transfer protein (BG14) mRNA,
           complete cds
          Length = 841

 Score = 46.1 bits (23), Expect = 0.095
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 282 tgatggcgtaggggacgctgacgccgcacatggaggggatgccggcg 328
           |||||||||||||||   ||||||||||| ||  |||||||||||||
Sbjct: 401 tgatggcgtaggggatattgacgccgcacttgctggggatgccggcg 355
to top
>gb|AC161418.4| Mus musculus BAC clone RP23-325K2 from chromosome 3, complete sequence
          Length = 202765

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 76    aaagtaaaaaacaaccatagt 96
             |||||||||||||||||||||
Sbjct: 67013 aaagtaaaaaacaaccatagt 67033
to top
>dbj|AP005640.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0006O15
          Length = 139723

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 150   tcacatggagatcagatcaga 170
             |||||||||||||||||||||
Sbjct: 81220 tcacatggagatcagatcaga 81240
to top
>dbj|AK119692.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-157-B12, full
           insert sequence
          Length = 685

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 257 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 309
           ||||| |||||||||||||| | |||||||| | ||| ||||  |||||||||
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397
to top
>dbj|AK119677.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-156-H07, full
           insert sequence
          Length = 654

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 257 atcttagagcagtcgacggaagcgctgatggcgtaggggacgctgacgccgca 309
           ||||| |||||||||||||| | |||||||| | ||| ||||  |||||||||
Sbjct: 449 atcttggagcagtcgacggaggtgctgatggggaaggcgacggagacgccgca 397
to top
>dbj|AK100917.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023133E20, full
            insert sequence
          Length = 5035

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 150  tcacatggagatcagatcaga 170
            |||||||||||||||||||||
Sbjct: 4798 tcacatggagatcagatcaga 4818
to top
>gb|AC132475.4| Mus musculus BAC clone RP23-114P16 from 3, complete sequence
          Length = 215899

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 76     aaagtaaaaaacaaccatagt 96
              |||||||||||||||||||||
Sbjct: 210967 aaagtaaaaaacaaccatagt 210987
to top
>gb|AC005222.1| Homo sapiens chromosome 16, cosmid clone RT163 (LANL), complete
             sequence
          Length = 40619

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 226   gcgcccatggtgggcagtgg 245
             ||||||||||||||||||||
Sbjct: 25417 gcgcccatggtgggcagtgg 25398
to top
>emb|AL121777.39|HSJ1057D4 Human DNA sequence from clone RP5-1057D4 on chromosome 20 Contains the
             SRMP1 gene for spermidine synthase pseudogene 1, the 5'
             end of the gene for a novel protein similar to
             glucosamine-6-sulfatases (SULF2) (sulfatase 2, H-SULF2,
             KIAA1247) and a CpG island, complete sequence
          Length = 131888

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 136   gactcctttctccctcacat 155
             ||||||||||||||||||||
Sbjct: 88928 gactcctttctccctcacat 88909
to top
>emb|AL645904.13| Mouse DNA sequence from clone RP23-121P11 on chromosome 11 Contains the
              gene for a novel protein (1700121K02Rik), the Hnrph1 gene
              for heterogeneous nuclear ribonucleoprotein H1, the Rufy1
              gene for RUN and FYVE domain containing 1, a novel
              pseudogene and three CpG islands, complete sequence
          Length = 193696

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 55     gtgtctcctcaaagggagag 74
              ||||||||||||||||||||
Sbjct: 170117 gtgtctcctcaaagggagag 170136
to top
>gb|AC012676.5| Homo sapiens chromosome 16 clone RP11-295D4, complete sequence
          Length = 172071

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 226   gcgcccatggtgggcagtgg 245
             ||||||||||||||||||||
Sbjct: 84403 gcgcccatggtgggcagtgg 84384
to top
>gb|AE004829.1| Pseudomonas aeruginosa PAO1, section 390 of 529 of the complete
            genome
          Length = 10201

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 313  ggaggggatgccggcggccttgcc 336
            |||| |||||||||||||||||||
Sbjct: 4301 ggagaggatgccggcggccttgcc 4278
to top
>dbj|AK073363.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033030A16, full
           insert sequence
          Length = 760

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330
           |||| ||||||||||| ||  |||||||||||||||
Sbjct: 400 gacgttgacgccgcacttgccggggatgccggcggc 365
to top
>dbj|AK070192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023041I08, full
            insert sequence
          Length = 2914

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 295  gacgctgacgccgcacatggaggggatgccggcggc 330
            |||| ||||||||||| ||  |||||||||||||||
Sbjct: 2487 gacgttgacgccgcacttgccggggatgccggcggc 2452
to top
>dbj|AK062690.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-A02, full
           insert sequence
          Length = 646

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330
           |||| ||||||||||| ||  |||||||||||||||
Sbjct: 394 gacgttgacgccgcacttgccggggatgccggcggc 359
to top
>dbj|AK061182.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-D09, full
           insert sequence
          Length = 928

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330
           |||| ||||||||||| ||  |||||||||||||||
Sbjct: 399 gacgttgacgccgcacttgccggggatgccggcggc 364
to top
>dbj|AK059737.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-D08, full
           insert sequence
          Length = 853

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330
           |||| ||||||||||| ||  |||||||||||||||
Sbjct: 394 gacgttgacgccgcacttgccggggatgccggcggc 359
to top
>dbj|AK059714.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-F09, full
           insert sequence
          Length = 773

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 295 gacgctgacgccgcacatggaggggatgccggcggc 330
           |||| ||||||||||| ||  |||||||||||||||
Sbjct: 399 gacgttgacgccgcacttgccggggatgccggcggc 364
to top
>gb|AY109327.1| Zea mays CL468_1 mRNA sequence
          Length = 2907

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 419  ctcttgacgccgctgcagca 438
            ||||||||||||||||||||
Sbjct: 2805 ctcttgacgccgctgcagca 2786
to top
>gb|AF171094.1|AF171094 Lilium longiflorum lipid transfer protein precursor (LTP) mRNA,
           complete cds
          Length = 650

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 35/40 (87%)
 Strand = Plus / Minus

                                                   
Query: 289 gtaggggacgctgacgccgcacatggaggggatgccggcg 328
           |||||||| | ||||||||||| ||  |||||||||||||
Sbjct: 349 gtaggggatgttgacgccgcacttgccggggatgccggcg 310
to top
>gb|AC158219.4| Mus musculus chromosome 8, clone RP23-189N10, complete sequence
          Length = 215819

 Score = 40.1 bits (20), Expect = 5.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 65    aaagggagagcaaagtaaaa 84
             ||||||||||||||||||||
Sbjct: 74357 aaagggagagcaaagtaaaa 74338


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,943,271
Number of Sequences: 3902068
Number of extensions: 2943271
Number of successful extensions: 59542
Number of sequences better than 10.0: 131
Number of HSP's better than 10.0 without gapping: 134
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59117
Number of HSP's gapped (non-prelim): 414
length of query: 438
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 416
effective length of database: 17,147,199,772
effective search space: 7133235105152
effective search space used: 7133235105152
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top