ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd14j04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_464026.1| Oryza sativa (japonica cultivar-group), mRNA 105 5e-20
2dbj|AK060180.1| Oryza sativa (japonica cultivar-group) cDNA clon... 105 5e-20
3gb|AY103718.1| Zea mays PCO128797 mRNA sequence 86 4e-14
4dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 62 6e-07
5dbj|AP004997.2| Oryza sativa (japonica cultivar-group) genomic D... 62 6e-07
6ref|NM_203088.1| Arabidopsis thaliana EIF2 BETA AT5G20920 (EIF2 ... 42 0.60
7ref|NM_122100.2| Arabidopsis thaliana EIF2 BETA AT5G20920 (EIF2 ... 42 0.60
8ref|XM_718047.1| Candida albicans SC5314 cytosolic ribosomal aci... 42 0.60
9ref|XM_717900.1| Candida albicans SC5314 cytosolic ribosomal aci... 42 0.60
10ref|XM_716398.1| Candida albicans SC5314 hypothetical protein (C... 42 0.60
11ref|XM_716397.1| Candida albicans SC5314 cytosolic ribosomal aci... 42 0.60
12ref|XM_716126.1| Candida albicans SC5314 hypothetical protein (C... 42 0.60
13ref|XM_716125.1| Candida albicans SC5314 cytosolic ribosomal aci... 42 0.60
14gb|U80448.1| Caenorhabditis elegans cosmid F59A3, complete sequence 42 0.60
15gb|AC093131.2| Papio anubis clone RP41-51G4, complete sequence 42 0.60
16gb|BT000056.1| Arabidopsis thaliana translation initiation facto... 42 0.60
17emb|AL033497.1|CAC49C10 C.albicans cosmid Ca49C10 42 0.60
18ref|NM_204597.1| Gallus gallus eukaryotic translation initiation... 42 0.60
19gb|AY128324.1| Arabidopsis thaliana translation initiation facto... 42 0.60
20emb|CR385806.1| Gallus gallus finished cDNA, clone ChEST69l11 42 0.60
21ref|NM_182039.3| Caenorhabditis elegans F59A3.2b (F59A3.2) mRNA,... 42 0.60
22ref|NM_059216.2| Caenorhabditis elegans F59A3.2a (F59A3.2) mRNA,... 42 0.60
23emb|BX829594.1|CNS0A1BT Arabidopsis thaliana Full-length cDNA Co... 42 0.60
24gb|AF317662.1|AF317662 Candida albicans 60S acidic ribosomal pro... 42 0.60
25gb|AF317659.1|AF317659 Candida albicans 60S acidic ribosomal pro... 42 0.60
26emb|AJ294707.1|GGA294707 Gallus gallus mRNA for eukaryote initia... 42 0.60
27gb|AC109298.19| Mus musculus chromosome 3, clone RP24-271A4, com... 40 2.4
28gb|AC115803.17| Mus musculus chromosome 8, clone RP23-410F24, co... 40 2.4
29gb|AC160243.10| Mus musculus chromosome 8, clone RP24-130G22, co... 40 2.4
30gb|AC159455.1| Trypanosoma brucei chromosome 5 clone RPCI93-6E7,... 40 2.4
31ref|XM_456781.1| Debaryomyces hansenii CBS767 DhTRK1 (DhTRK1) pa... 40 2.4
32gb|AC124437.4| Mus musculus BAC clone RP24-257N6 from chromosome... 40 2.4
33gb|BT012971.1| Lycopersicon esculentum clone 114181F, mRNA sequence 40 2.4
34gb|AC132844.7| Mus musculus chromosome 17, clone RP24-481P13, co... 40 2.4
35ref|XM_968464.1| PREDICTED: Tribolium castaneum similar to CG116... 40 2.4
36emb|CR382133.1| Debaryomyces hansenii chromosome A of strain CBS... 40 2.4
37emb|AL161502.2|ATCHRIV14 Arabidopsis thaliana DNA chromosome 4, ... 40 2.4
38gb|AC124907.3| Equus caballus clone CH241-409I22, complete sequence 40 2.4
39gb|AC154413.3| Mus musculus BAC clone RP24-230J5 from chromosome... 40 2.4
40dbj|AK055518.1| Homo sapiens cDNA FLJ30956 fis, clone HCASM2000202 40 2.4
41gb|AC006436.5| Arabidopsis thaliana chromosome 2 clone F13J11 ma... 40 2.4
42gb|AC092612.3| Homo sapiens BAC clone RP11-174F8 from 4, complet... 40 2.4
43ref|XM_692734.1| PREDICTED: Danio rerio similar to bromodomain c... 40 2.4
44dbj|AK030962.1| Mus musculus adult male thymus cDNA, RIKEN full-... 40 2.4
45gb|AC073848.4|AC073848 Homo sapiens BAC clone RP11-669M16 from 4... 40 2.4
46gb|AF353095.1|AF353095 Arabidopsis thaliana protein synthesis in... 40 2.4
47dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.4
48gb|AY087810.1| Arabidopsis thaliana clone 3855 mRNA, complete se... 40 2.4
49gb|AF296834.1|F22D1 Arabidopsis thaliana BAC F22D1 40 2.4
50dbj|AP005247.3| Oryza sativa (japonica cultivar-group) genomic D... 40 2.4
51emb|AL929270.14| Mouse DNA sequence from clone RP23-100K15 on ch... 40 2.4
52ref|XM_320711.2| Anopheles gambiae str. PEST ENSANGP00000008820 ... 40 2.4
53gb|AC012392.1|AC012392 Genomic Sequence For Arabidopsis thaliana... 40 2.4
54gb|AC154853.2| Mus musculus BAC clone RP23-21C15 from 17, comple... 40 2.4
55gb|AF162444.1|T32N4 Arabidopsis thaliana BAC T32N4 40 2.4
56emb|AL162311.5|CNS01RHR Human chromosome 14 DNA sequence BAC R-3... 40 2.4
57emb|AJ620491.1| Olea europaea putative gypsy retrotransposon par... 40 2.4
58emb|AJ620490.1| Olea europaea putative gypsy retrotransposon par... 40 2.4
59gb|AC131698.4| Mus musculus BAC clone RP23-428E12 from 3, comple... 40 2.4
60gb|DP000020.1| Equus caballus target 1 genomic scaffold 40 2.4
61emb|AL672287.12| Mouse DNA sequence from clone RP23-151I8 on chr... 40 2.4
62gb|M27296.1|SUSEND16 Sea urchin (S.purpuratus) Endo16 gene, part... 40 2.4
63gb|AC153385.3| Mus musculus 6 BAC RP23-64D14 (Roswell Park Cance... 38 9.4
64gb|AC164397.6| Mus musculus chromosome 1, clone RP23-276M15, com... 38 9.4
65ref|XM_550396.1| Oryza sativa (japonica cultivar-group), mRNA 38 9.4
66gb|AC165958.2| Mus musculus BAC clone RP23-417I20 from chromosom... 38 9.4
67gb|AC169508.1| Mus musculus BAC clone RP23-167I21 from chromosom... 38 9.4
68ref|NM_212675.1| Danio rerio eukaryotic translation initiation f... 38 9.4
69gb|AC167468.2| Mus musculus BAC clone RP23-163J2 from chromosome... 38 9.4
70gb|AC139043.6| Mus musculus chromosome 3, clone RP23-321I11, com... 38 9.4
71ref|XM_368455.1| Magnaporthe grisea 70-15 chromosome VI hypothet... 38 9.4
72ref|XM_362595.1| Magnaporthe grisea 70-15 hypothetical protein (... 38 9.4
73ref|XM_418967.1| PREDICTED: Gallus gallus similar to chromosome ... 38 9.4
74gb|AC100986.9| Mus musculus chromosome 3, clone RP23-77E5, compl... 38 9.4
75gb|AY809024.1| Schistosoma japonicum SJCHGC08662 protein mRNA, p... 38 9.4
76gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome 38 9.4
77ref|NM_001040371.1| Danio rerio zgc:136620 (zgc:136620), mRNA 38 9.4
78gb|AC165348.3| Mus musculus BAC clone RP23-300C11 from chromosom... 38 9.4
79gb|AC121302.7| Mus musculus chromosome 13, clone RP23-163B12, co... 38 9.4
80emb|Z75548.1|CER90 Caenorhabditis elegans Cosmid R90, complete s... 38 9.4
81gb|AC138225.11| Mus musculus chromosome 1, clone RP23-164F17, co... 38 9.4
82gb|AC072028.14| Homo sapiens 3 BAC RP11-190C21 (Roswell Park Can... 38 9.4
83ref|XM_799742.1| Trypanosoma cruzi strain CL Brener dispersed ge... 38 9.4
84emb|CR720005.2|CNS0GII3 Tetraodon nigroviridis full-length cDNA 38 9.4
85emb|CR697488.2|CNS0G14S Tetraodon nigroviridis full-length cDNA 38 9.4
86emb|CR696725.2|CNS0G0JL Tetraodon nigroviridis full-length cDNA 38 9.4
87emb|CR679835.2|CNS0FNIF Tetraodon nigroviridis full-length cDNA 38 9.4
88emb|CR664557.2|CNS0FBQR Tetraodon nigroviridis full-length cDNA 38 9.4
89emb|CR651203.2|CNS0F1FT Tetraodon nigroviridis full-length cDNA 38 9.4
90emb|BX629346.17| Zebrafish DNA sequence from clone DKEY-16N21 in... 38 9.4
91gb|BC115198.1| Danio rerio similar to alpha globin regulatory el... 38 9.4
92emb|AL356141.9| Human DNA sequence from clone RP11-269L3 on chro... 38 9.4
93emb|AL161445.10| Human DNA sequence from clone RP11-326F20 on ch... 38 9.4
94gb|AC162918.3| Mus musculus BAC clone RP23-370K14 from chromosom... 38 9.4
95gb|AC154318.3| Mus musculus BAC clone RP23-316D19 from chromosom... 38 9.4
96emb|AL929176.4| Zebrafish DNA sequence from clone XX-187G17 in l... 38 9.4
97emb|AL109619.1|ATT19F6 Arabidopsis thaliana DNA chromosome 4, BA... 38 9.4
98emb|AL161561.2|ATCHRIV61 Arabidopsis thaliana DNA chromosome 4, ... 38 9.4
99emb|AL161560.2|ATCHRIV60 Arabidopsis thaliana DNA chromosome 4, ... 38 9.4
100emb|BX323026.5| Mouse DNA sequence from clone RP24-95F14 on chro... 38 9.4
101emb|BX276106.6| Zebrafish DNA sequence from clone DKEY-1N18 in l... 38 9.4
102gb|AC165442.1| Mus musculus BAC clone RP23-164P21 from chromosom... 38 9.4
103gb|BC066706.1| Danio rerio eukaryotic translation initiation fac... 38 9.4
104ref|NM_001025534.1| Danio rerio similar to alpha globin regulato... 38 9.4
105gb|AC090458.5| Homo sapiens chromosome 11, clone CTD-2572N17, co... 38 9.4
106gb|AC111151.3| Homo sapiens chromosome 11, clone CTD-2557D6, com... 38 9.4
107dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023 38 9.4
108ref|NM_166415.1| Drosophila melanogaster CG3216-RB, transcript v... 38 9.4
109dbj|AB232920.1| Oryzias latipes hox gene cluster, complete cds, ... 38 9.4
110dbj|AB207138.1| Oryzias latipes nppc3 and nppb genes for C-type ... 38 9.4
111ref|NM_136611.2| Drosophila melanogaster Mystery 45A CG8070-RA (... 38 9.4
112ref|NM_079319.2| Drosophila melanogaster Eukaryotic initiation f... 38 9.4
113gb|AY071253.1| Drosophila melanogaster RE29270 full length cDNA 38 9.4
114gb|AY070560.1| Drosophila melanogaster LD33051 full length cDNA 38 9.4
115ref|XM_692813.1| PREDICTED: Danio rerio similar to Eukaryotic tr... 38 9.4
116gb|AF173549.1|AF173549 Drosophila melanogaster mystery 45A mRNA,... 38 9.4
117gb|AC161147.6| Mus musculus BAC clone RP23-357G12 from chromosom... 38 9.4
118gb|AC091223.2| Drosophila melanogaster 3L BAC RP98-48G6 (Roswell... 38 9.4
119emb|BX649593.5| Zebrafish DNA sequence from clone CH211-12G4 in ... 38 9.4
120gb|AC025763.5| Homo sapiens chromosome 16 clone CTB-186A5, compl... 38 9.4
121gb|AC093049.1| Drosophila melanogaster, chromosome 2R, region 45... 38 9.4
122dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 38 9.4
123dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 38 9.4
124dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 38 9.4
125gb|AC139667.5| Homo sapiens 3 BAC RP11-88B8 (Roswell Park Cancer... 38 9.4
126gb|AC008186.5|AC008186 Drosophila melanogaster, chromosome 2R, r... 38 9.4
127gb|AC007888.7|AC007888 Drosophila melanogaster, chromosome 2R, r... 38 9.4
128gb|AC090523.1|AC090523 Caenorhabditis briggsae cosmid CB015N01, ... 38 9.4
129gb|AC016737.8| Homo sapiens BAC clone RP11-394I13 from 2, comple... 38 9.4
130gb|AC137643.3| Homo sapiens chromosome 16 clone RP11-95H3, compl... 38 9.4
131gb|AC037425.7|AC037425 Oryza sativa chromosome 10 BAC OSJNBa0055... 38 9.4
132dbj|AP003282.2| Oryza sativa (japonica cultivar-group) genomic D... 38 9.4
133gb|AC016651.8| Homo sapiens chromosome 5 clone RP1-251I12, compl... 38 9.4
134gb|AF296838.1|T29J13 Arabidopsis thaliana BAC T29J13 38 9.4
135emb|AJ620188.1| Solanum yellow leaf curl virus segment B, comple... 38 9.4
136dbj|AP003118.2| Oryza sativa (japonica cultivar-group) genomic D... 38 9.4
137emb|BX682227.3| Mouse DNA sequence from clone RP23-190N2 on chro... 38 9.4
138emb|AL808135.13| Mouse DNA sequence from clone RP23-186D8 on chr... 38 9.4
139emb|AL663069.10| Mouse DNA sequence from clone RP23-410P8 on chr... 38 9.4
140emb|AL953863.13| Zebrafish DNA sequence from clone CH211-113F11 ... 38 9.4
141emb|AL772362.8| Zebrafish DNA sequence from clone CH211-173K16 i... 38 9.4
142dbj|AK108226.1| Oryza sativa (japonica cultivar-group) cDNA clon... 38 9.4
143gb|AC154783.2| Mus musculus BAC clone RP24-466C8 from 12, comple... 38 9.4
144gb|AC007156.2|AC007156 Homo sapiens chromosome 18, clone hRPK.41... 38 9.4
145gb|AE003834.3| Drosophila melanogaster chromosome 2R, section 16... 38 9.4
146emb|AL133299.4|CNS01DUN Human chromosome 14 DNA sequence BAC R-6... 38 9.4
147gb|AE003541.3| Drosophila melanogaster chromosome 3L, section 44... 38 9.4
148gb|AE003452.5| Drosophila melanogaster chromosome 2R, section 60... 38 9.4
149dbj|AP005271.4| Homo sapiens genomic DNA, chromosome 18 clone:RP... 38 9.4
150gb|AC006074.1|AC006074 Drosophila melanogaster, chromosome 2R, r... 38 9.4
151dbj|AP005660.3| Homo sapiens genomic DNA, chromosome 8q23, clone... 38 9.4
152gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 38 9.4
153gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 38 9.4
154emb|AL928782.4|CNS08CCC Oryza sativa chromosome 12, . BAC OSJNBb... 38 9.4
155emb|BX842241.1|CNS0B0PM Oryza sativa chromosome 12, . Partial se... 38 9.4
156gb|AC005268.1|AC005268 Drosophila melanogaster DNA sequence (P1s... 38 9.4
157emb|AL929130.4| Zebrafish DNA sequence from clone CH211-287M16 i... 38 9.4
158emb|AL844896.7| Mouse DNA sequence from clone RP23-356L21 on chr... 38 9.4
159gb|L19197.1|DROEIF2BET Drosophila melanogaster eIF-2 beta-subuni... 38 9.4
160gb|AC002311.1| Arabidopsis thaliana chromosome I BAC T26J12 geno... 38 9.4
161gb|AC002343.1|ATAC002343 Arabidopsis thaliana chromosome IV BAC ... 38 9.4
162dbj|AP003692.2| Homo sapiens genomic DNA, chromosome 8q23, clone... 38 9.4

>ref|XM_464026.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1875

 Score =  105 bits (53), Expect = 5e-20
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                        
Query: 60   cttcttctttttctgggccttggcaattgtcttcctgtcaacgnaagcangtagntcctc 119
            ||||||||||||||| ||||||||||    ||| ||||| | | | ||  |||| |||||
Sbjct: 1857 cttcttctttttctgagccttggcaacctccttactgtcgatgtaggctagtagttcctc 1798

                                                                        
Query: 120  ttgcctgataagagcctcgngcagagccttctttgttacantgagctcagcttccagngc 179
            ||||||||||||||||||  | || ||||||||||||||| | || ||||||||||| ||
Sbjct: 1797 ttgcctgataagagcctcatgtagggccttctttgttacaataagttcagcttccagcgc 1738

                       
Query: 180  atccacacggc 190
            |||||||||||
Sbjct: 1737 atccacacggc 1727



to top

>dbj|AK060180.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-001-B05, full
            insert sequence
          Length = 1467

 Score =  105 bits (53), Expect = 5e-20
 Identities = 110/131 (83%)
 Strand = Plus / Minus

                                                                        
Query: 60   cttcttctttttctgggccttggcaattgtcttcctgtcaacgnaagcangtagntcctc 119
            ||||||||||||||| ||||||||||    ||| ||||| | | | ||  |||| |||||
Sbjct: 1252 cttcttctttttctgagccttggcaacctccttactgtcgatgtaggctagtagttcctc 1193

                                                                        
Query: 120  ttgcctgataagagcctcgngcagagccttctttgttacantgagctcagcttccagngc 179
            ||||||||||||||||||  | || ||||||||||||||| | || ||||||||||| ||
Sbjct: 1192 ttgcctgataagagcctcatgtagggccttctttgttacaataagttcagcttccagcgc 1133

                       
Query: 180  atccacacggc 190
            |||||||||||
Sbjct: 1132 atccacacggc 1122



to top

>gb|AY103718.1| Zea mays PCO128797 mRNA sequence
          Length = 1097

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 134/164 (81%), Gaps = 3/164 (1%)
 Strand = Plus / Minus

                                                                       
Query: 25  tctctctccttgtcctagtagcaagacattggcttcttcttctttttctgggccttggca 84
           |||| |||||||||||||||||||  ||||| |||  |||||||| |||| |||||||||
Sbjct: 943 tctccctccttgtcctagtagcaaagcattg-ctt--tcttctttctctgagccttggca 887

                                                                       
Query: 85  attgtcttcctgtcaacgnaagcangtagntcctcttgcctgataagagcctcgngcaga 144
           ||    || | ||| | | | ||| | || |||||||||||||||||||||||| ||| |
Sbjct: 886 atctctttgcggtcgatgtacgcaagcagttcctcttgcctgataagagcctcgtgcaaa 827

                                                       
Query: 145 gccttctttgttacantgagctcagcttccagngcatccacacg 188
           ||||||||||||||| | || || |||||||  ||||| |||||
Sbjct: 826 gccttctttgttacaattagttcggcttccaatgcatcgacacg 783



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                            
Query: 146     ccttctttgttacantgagctcagcttccagngcatccacacggc 190
               |||||||||||||| | || ||||||||||| |||||||||||||
Sbjct: 1747794 ccttctttgttacaataagttcagcttccagcgcatccacacggc 1747750



 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 65/78 (83%)
 Strand = Plus / Minus

                                                                           
Query: 60      cttcttctttttctgggccttggcaattgtcttcctgtcaacgnaagcangtagntcctc 119
               ||||||||||||||| ||||||||||    ||| ||||| | | | ||  |||| |||||
Sbjct: 1747986 cttcttctttttctgagccttggcaacctccttactgtcgatgtaggctagtagttcctc 1747927

                                 
Query: 120     ttgcctgataagagcctc 137
               ||||||||||||||||||
Sbjct: 1747926 ttgcctgataagagcctc 1747909



to top

>dbj|AP004997.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0030G11
          Length = 143943

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                          
Query: 146   ccttctttgttacantgagctcagcttccagngcatccacacggc 190
             |||||||||||||| | || ||||||||||| |||||||||||||
Sbjct: 65806 ccttctttgttacaataagttcagcttccagcgcatccacacggc 65762



 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 65/78 (83%)
 Strand = Plus / Minus

                                                                         
Query: 60    cttcttctttttctgggccttggcaattgtcttcctgtcaacgnaagcangtagntcctc 119
             ||||||||||||||| ||||||||||    ||| ||||| | | | ||  |||| |||||
Sbjct: 65998 cttcttctttttctgagccttggcaacctccttactgtcgatgtaggctagtagttcctc 65939

                               
Query: 120   ttgcctgataagagcctc 137
             ||||||||||||||||||
Sbjct: 65938 ttgcctgataagagcctc 65921



to top

>ref|NM_203088.1| Arabidopsis thaliana EIF2 BETA AT5G20920 (EIF2 BETA) transcript
           variant AT5G20920.2 mRNA, complete cds
          Length = 1151

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 53  ttggcttcttcttctttttct 73
           |||||||||||||||||||||
Sbjct: 280 ttggcttcttcttctttttct 260



to top

>ref|NM_122100.2| Arabidopsis thaliana EIF2 BETA AT5G20920 (EIF2 BETA) transcript
           variant AT5G20920.1 mRNA, complete cds
          Length = 1194

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 53  ttggcttcttcttctttttct 73
           |||||||||||||||||||||
Sbjct: 323 ttggcttcttcttctttttct 303



to top

>ref|XM_718047.1| Candida albicans SC5314 cytosolic ribosomal acidic protein P2B
           (CaO19_5928), mRNA
          Length = 336

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 53  ttggcttcttcttctttttct 73
           |||||||||||||||||||||
Sbjct: 293 ttggcttcttcttctttttct 273



to top

>ref|XM_717900.1| Candida albicans SC5314 cytosolic ribosomal acidic protein P2B
           (CaO19_13349), mRNA
          Length = 336

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 53  ttggcttcttcttctttttct 73
           |||||||||||||||||||||
Sbjct: 293 ttggcttcttcttctttttct 273



to top

>ref|XM_716398.1| Candida albicans SC5314 hypothetical protein (CaO19_2993), mRNA
          Length = 315

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 53 ttggcttcttcttctttttct 73
          |||||||||||||||||||||
Sbjct: 22 ttggcttcttcttctttttct 42



to top

>ref|XM_716397.1| Candida albicans SC5314 cytosolic ribosomal acidic protein P1A
           (CaO19_2992), mRNA
          Length = 321

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 53  ttggcttcttcttctttttct 73
           |||||||||||||||||||||
Sbjct: 278 ttggcttcttcttctttttct 258



to top

>ref|XM_716126.1| Candida albicans SC5314 hypothetical protein (CaO19_10510), mRNA
          Length = 315

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 53 ttggcttcttcttctttttct 73
          |||||||||||||||||||||
Sbjct: 22 ttggcttcttcttctttttct 42



to top

>ref|XM_716125.1| Candida albicans SC5314 cytosolic ribosomal acidic protein P1A
           (CaO19_10509), mRNA
          Length = 321

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 53  ttggcttcttcttctttttct 73
           |||||||||||||||||||||
Sbjct: 278 ttggcttcttcttctttttct 258



to top

>gb|U80448.1| Caenorhabditis elegans cosmid F59A3, complete sequence
          Length = 42663

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 56    gcttcttcttctttttctggg 76
             |||||||||||||||||||||
Sbjct: 11543 gcttcttcttctttttctggg 11523



to top

>gb|AC093131.2| Papio anubis clone RP41-51G4, complete sequence
          Length = 181049

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    cttcttcttctttttctgggc 77
             |||||||||||||||||||||
Sbjct: 70678 cttcttcttctttttctgggc 70698



to top

>gb|BT000056.1| Arabidopsis thaliana translation initiation factor eIF-2 beta
           chain-like protein (At5g20920) mRNA, complete cds
          Length = 844

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 53  ttggcttcttcttctttttct 73
           |||||||||||||||||||||
Sbjct: 211 ttggcttcttcttctttttct 191



to top

>emb|AL033497.1|CAC49C10 C.albicans cosmid Ca49C10
          Length = 37825

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 53   ttggcttcttcttctttttct 73
            |||||||||||||||||||||
Sbjct: 3465 ttggcttcttcttctttttct 3485



to top

>ref|NM_204597.1| Gallus gallus eukaryotic translation initiation factor 2, subunit 2
           beta, 38kDa (EIF2S2), mRNA
          Length = 1405

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 53  ttggcttcttcttctttttct 73
           |||||||||||||||||||||
Sbjct: 336 ttggcttcttcttctttttct 316



to top

>gb|AY128324.1| Arabidopsis thaliana translation initiation factor eIF-2 beta
           chain-like protein (At5g20920) mRNA, complete cds
          Length = 1095

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 53  ttggcttcttcttctttttct 73
           |||||||||||||||||||||
Sbjct: 282 ttggcttcttcttctttttct 262



to top

>emb|CR385806.1| Gallus gallus finished cDNA, clone ChEST69l11
          Length = 1390

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 53  ttggcttcttcttctttttct 73
           |||||||||||||||||||||
Sbjct: 345 ttggcttcttcttctttttct 325



to top

>ref|NM_182039.3| Caenorhabditis elegans F59A3.2b (F59A3.2) mRNA, complete cds
          Length = 2131

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 56 gcttcttcttctttttctggg 76
          |||||||||||||||||||||
Sbjct: 86 gcttcttcttctttttctggg 66



to top

>ref|NM_059216.2| Caenorhabditis elegans F59A3.2a (F59A3.2) mRNA, complete cds
          Length = 2943

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 56 gcttcttcttctttttctggg 76
          |||||||||||||||||||||
Sbjct: 86 gcttcttcttctttttctggg 66



to top

>emb|BX829594.1|CNS0A1BT Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB23ZF01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1040

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 53  ttggcttcttcttctttttct 73
           |||||||||||||||||||||
Sbjct: 280 ttggcttcttcttctttttct 260



to top

>gb|AF317662.1|AF317662 Candida albicans 60S acidic ribosomal protein type P2-B (p2B) gene,
           complete cds
          Length = 481

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 53  ttggcttcttcttctttttct 73
           |||||||||||||||||||||
Sbjct: 300 ttggcttcttcttctttttct 280



to top

>gb|AF317659.1|AF317659 Candida albicans 60S acidic ribosomal protein type P1-A (p1A) gene,
           complete cds
          Length = 398

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 53  ttggcttcttcttctttttct 73
           |||||||||||||||||||||
Sbjct: 285 ttggcttcttcttctttttct 265



to top

>emb|AJ294707.1|GGA294707 Gallus gallus mRNA for eukaryote initiation factor 2B (EIF2B gene)
          Length = 1405

 Score = 42.1 bits (21), Expect = 0.60
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 53  ttggcttcttcttctttttct 73
           |||||||||||||||||||||
Sbjct: 336 ttggcttcttcttctttttct 316



to top

>gb|AC109298.19| Mus musculus chromosome 3, clone RP24-271A4, complete sequence
          Length = 191546

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 54     tggcttcttcttctttttct 73
              ||||||||||||||||||||
Sbjct: 103768 tggcttcttcttctttttct 103787



to top

>gb|AC115803.17| Mus musculus chromosome 8, clone RP23-410F24, complete sequence
          Length = 169100

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 50  acattggcttcttcttctttttct 73
           ||||||||||||||||||| ||||
Sbjct: 697 acattggcttcttcttcttcttct 674



to top

>gb|AC160243.10| Mus musculus chromosome 8, clone RP24-130G22, complete sequence
          Length = 154337

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 50    acattggcttcttcttctttttct 73
             ||||||||||||||||||| ||||
Sbjct: 21293 acattggcttcttcttcttcttct 21316



to top

>gb|AC159455.1| Trypanosoma brucei chromosome 5 clone RPCI93-6E7, complete sequence
          Length = 170328

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 57   cttcttcttctttttctgggcctt 80
            |||||||||||||| |||||||||
Sbjct: 5309 cttcttcttcttttcctgggcctt 5332



to top

>ref|XM_456781.1| Debaryomyces hansenii CBS767 DhTRK1 (DhTRK1) partial mRNA
          Length = 3153

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 53   ttggcttcttcttctttttc 72
            ||||||||||||||||||||
Sbjct: 1552 ttggcttcttcttctttttc 1533



to top

>gb|AC124437.4| Mus musculus BAC clone RP24-257N6 from chromosome 3, complete sequence
          Length = 149145

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 44     agcaagacattggcttcttc 63
              ||||||||||||||||||||
Sbjct: 146875 agcaagacattggcttcttc 146894



to top

>gb|BT012971.1| Lycopersicon esculentum clone 114181F, mRNA sequence
          Length = 865

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 54 tggcttcttcttctttttct 73
          ||||||||||||||||||||
Sbjct: 51 tggcttcttcttctttttct 32



to top

>gb|AC132844.7| Mus musculus chromosome 17, clone RP24-481P13, complete sequence
          Length = 225183

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 24    gtctctctccttgtcctagt 43
             ||||||||||||||||||||
Sbjct: 17800 gtctctctccttgtcctagt 17781



to top

>ref|XM_968464.1| PREDICTED: Tribolium castaneum similar to CG11670-PA (LOC662364),
           mRNA
          Length = 246

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 58  ttcttcttctttttctgggc 77
           ||||||||||||||||||||
Sbjct: 233 ttcttcttctttttctgggc 214



to top

>emb|CR382133.1| Debaryomyces hansenii chromosome A of strain CBS767 of Debaryomyces
              hansenii
          Length = 1249565

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 53     ttggcttcttcttctttttc 72
              ||||||||||||||||||||
Sbjct: 871349 ttggcttcttcttctttttc 871368



to top

>emb|AL161502.2|ATCHRIV14 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 14
          Length = 198563

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 56     gcttcttcttctttttctgg 75
              ||||||||||||||||||||
Sbjct: 122686 gcttcttcttctttttctgg 122667



to top

>gb|AC124907.3| Equus caballus clone CH241-409I22, complete sequence
          Length = 202157

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 25    tctctctccttgtcctagtagcaa 48
             |||||||||||||||||| |||||
Sbjct: 43405 tctctctccttgtcctagcagcaa 43382



to top

>gb|AC154413.3| Mus musculus BAC clone RP24-230J5 from chromosome 13, complete sequence
          Length = 174730

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 54    tggcttcttcttctttttct 73
             ||||||||||||||||||||
Sbjct: 86485 tggcttcttcttctttttct 86466



to top

>dbj|AK055518.1| Homo sapiens cDNA FLJ30956 fis, clone HCASM2000202
          Length = 1981

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 54 tggcttcttcttctttttct 73
          ||||||||||||||||||||
Sbjct: 24 tggcttcttcttctttttct 5



to top

>gb|AC006436.5| Arabidopsis thaliana chromosome 2 clone F13J11 map mi398, complete
             sequence
          Length = 104009

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    gcttcttcttctttttctgg 75
             ||||||||||||||||||||
Sbjct: 42368 gcttcttcttctttttctgg 42387



to top

>gb|AC092612.3| Homo sapiens BAC clone RP11-174F8 from 4, complete sequence
          Length = 145706

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 25    tctctctccttgtcctagta 44
             ||||||||||||||||||||
Sbjct: 10341 tctctctccttgtcctagta 10322



to top

>ref|XM_692734.1| PREDICTED: Danio rerio similar to bromodomain containing 2
            (LOC569354), mRNA
          Length = 1859

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 54   tggcttcttcttctttttct 73
            ||||||||||||||||||||
Sbjct: 1739 tggcttcttcttctttttct 1720



to top

>dbj|AK030962.1| Mus musculus adult male thymus cDNA, RIKEN full-length enriched
            library, clone:5830471B11 product:unclassifiable, full
            insert sequence
          Length = 4788

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 54   tggcttcttcttctttttct 73
            ||||||||||||||||||||
Sbjct: 4656 tggcttcttcttctttttct 4675



to top

>gb|AC073848.4|AC073848 Homo sapiens BAC clone RP11-669M16 from 4, complete sequence
          Length = 163636

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 54     tggcttcttcttctttttct 73
              ||||||||||||||||||||
Sbjct: 113858 tggcttcttcttctttttct 113839



to top

>gb|AF353095.1|AF353095 Arabidopsis thaliana protein synthesis initiation factor eIF2 beta
           mRNA, complete cds
          Length = 1160

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 54  tggcttcttcttctttttct 73
           ||||||||||||||||||||
Sbjct: 308 tggcttcttcttctttttct 289



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 56       gcttcttcttctttttctgg 75
                ||||||||||||||||||||
Sbjct: 12950155 gcttcttcttctttttctgg 12950174



to top

>gb|AY087810.1| Arabidopsis thaliana clone 3855 mRNA, complete sequence
          Length = 1134

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 54  tggcttcttcttctttttct 73
           ||||||||||||||||||||
Sbjct: 321 tggcttcttcttctttttct 302



to top

>gb|AF296834.1|F22D1 Arabidopsis thaliana BAC F22D1
          Length = 96102

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 54    tggcttcttcttctttttct 73
             ||||||||||||||||||||
Sbjct: 39926 tggcttcttcttctttttct 39945



to top

>dbj|AP005247.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0077F02
          Length = 172442

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    gcttcttcttctttttctgg 75
             ||||||||||||||||||||
Sbjct: 24452 gcttcttcttctttttctgg 24471



to top

>emb|AL929270.14| Mouse DNA sequence from clone RP23-100K15 on chromosome X, complete
              sequence
          Length = 115038

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 50     acattggcttcttcttctttttct 73
              ||||||| ||||||||||||||||
Sbjct: 112746 acattggtttcttcttctttttct 112723



to top

>ref|XM_320711.2| Anopheles gambiae str. PEST ENSANGP00000008820 (ENSANGG00000006647),
            partial mRNA
          Length = 1782

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 58   ttcttcttctttttctgggccttggcaa 85
            |||||||||||||||||  |||||||||
Sbjct: 1775 ttcttcttctttttctgctccttggcaa 1748



to top

>gb|AC012392.1|AC012392 Genomic Sequence For Arabidopsis thaliana clone C17L7, Chromosome IV,
              complete sequence
          Length = 183147

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 56     gcttcttcttctttttctgg 75
              ||||||||||||||||||||
Sbjct: 130423 gcttcttcttctttttctgg 130442



to top

>gb|AC154853.2| Mus musculus BAC clone RP23-21C15 from 17, complete sequence
          Length = 170353

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 24     gtctctctccttgtcctagt 43
              ||||||||||||||||||||
Sbjct: 107978 gtctctctccttgtcctagt 107959



to top

>gb|AF162444.1|T32N4 Arabidopsis thaliana BAC T32N4
          Length = 80196

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    gcttcttcttctttttctgg 75
             ||||||||||||||||||||
Sbjct: 61161 gcttcttcttctttttctgg 61142



to top

>emb|AL162311.5|CNS01RHR Human chromosome 14 DNA sequence BAC R-317N8 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 167127

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 58    ttcttcttctttttctgggc 77
             ||||||||||||||||||||
Sbjct: 20033 ttcttcttctttttctgggc 20052



to top

>emb|AJ620491.1| Olea europaea putative gypsy retrotransposon partial integrase
           pseudogene and LTR, clone Oeg05
          Length = 964

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 53  ttggcttcttcttctttttc 72
           ||||||||||||||||||||
Sbjct: 515 ttggcttcttcttctttttc 496



to top

>emb|AJ620490.1| Olea europaea putative gypsy retrotransposon partial integrase
           pseudogene and LTR, clone Oeg04
          Length = 1390

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 53  ttggcttcttcttctttttc 72
           ||||||||||||||||||||
Sbjct: 513 ttggcttcttcttctttttc 494



to top

>gb|AC131698.4| Mus musculus BAC clone RP23-428E12 from 3, complete sequence
          Length = 191438

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 44     agcaagacattggcttcttc 63
              ||||||||||||||||||||
Sbjct: 170554 agcaagacattggcttcttc 170535



to top

>gb|DP000020.1| Equus caballus target 1 genomic scaffold
          Length = 1907055

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 25     tctctctccttgtcctagtagcaa 48
              |||||||||||||||||| |||||
Sbjct: 551599 tctctctccttgtcctagcagcaa 551576



to top

>emb|AL672287.12| Mouse DNA sequence from clone RP23-151I8 on chromosome X, complete
             sequence
          Length = 81776

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 50    acattggcttcttcttctttttct 73
             ||||||| ||||||||||||||||
Sbjct: 79484 acattggtttcttcttctttttct 79461



to top

>gb|M27296.1|SUSEND16 Sea urchin (S.purpuratus) Endo16 gene, partial cds
          Length = 794

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 57  cttcttcttctttttctggg 76
           ||||||||||||||||||||
Sbjct: 778 cttcttcttctttttctggg 759



to top

>gb|AC153385.3| Mus musculus 6 BAC RP23-64D14 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 226269

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 65     tctttttctgggccttggc 83
              |||||||||||||||||||
Sbjct: 103231 tctttttctgggccttggc 103249



to top

>gb|AC164397.6| Mus musculus chromosome 1, clone RP23-276M15, complete sequence
          Length = 196086

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 64     ttctttttctgggccttgg 82
              |||||||||||||||||||
Sbjct: 113810 ttctttttctgggccttgg 113792



to top

>ref|XM_550396.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1090

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 50  acattggcttcttcttctt 68
           |||||||||||||||||||
Sbjct: 806 acattggcttcttcttctt 788



to top

>gb|AC165958.2| Mus musculus BAC clone RP23-417I20 from chromosome 16, complete
             sequence
          Length = 186202

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 26    ctctctccttgtcctagta 44
             |||||||||||||||||||
Sbjct: 80312 ctctctccttgtcctagta 80330



to top

>gb|AC169508.1| Mus musculus BAC clone RP23-167I21 from chromosome 16, complete
             sequence
          Length = 211870

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 26    ctctctccttgtcctagta 44
             |||||||||||||||||||
Sbjct: 32834 ctctctccttgtcctagta 32852



to top

>ref|NM_212675.1| Danio rerio eukaryotic translation initiation factor 2, subunit 2
           beta (eif2s2), mRNA
          Length = 1317

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 55  ggcttcttcttctttttct 73
           |||||||||||||||||||
Sbjct: 128 ggcttcttcttctttttct 110



to top

>gb|AC167468.2| Mus musculus BAC clone RP23-163J2 from chromosome 10, complete sequence
          Length = 219954

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 53    ttggcttcttcttcttttt 71
             |||||||||||||||||||
Sbjct: 53300 ttggcttcttcttcttttt 53318



to top

>gb|AC139043.6| Mus musculus chromosome 3, clone RP23-321I11, complete sequence
          Length = 194537

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 66    ctttttctgggccttggca 84
             |||||||||||||||||||
Sbjct: 47727 ctttttctgggccttggca 47745



to top

>ref|XM_368455.1| Magnaporthe grisea 70-15 chromosome VI hypothetical protein
           (MG00789.4) partial mRNA
          Length = 1005

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 55  ggcttcttcttctttttct 73
           |||||||||||||||||||
Sbjct: 371 ggcttcttcttctttttct 353



to top

>ref|XM_362595.1| Magnaporthe grisea 70-15 hypothetical protein (MG08178.4) partial
           mRNA
          Length = 2817

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 60  cttcttctttttctgggccttgg 82
           |||||||||||||||| ||||||
Sbjct: 522 cttcttctttttctggcccttgg 500



to top

>ref|XM_418967.1| PREDICTED: Gallus gallus similar to chromosome 6 open reading frame
            145 (LOC420880), mRNA
          Length = 3128

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 54   tggcttcttcttctttttc 72
            |||||||||||||||||||
Sbjct: 2807 tggcttcttcttctttttc 2825



to top

>gb|AC100986.9| Mus musculus chromosome 3, clone RP23-77E5, complete sequence
          Length = 112141

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 55    ggcttcttcttctttttct 73
             |||||||||||||||||||
Sbjct: 59261 ggcttcttcttctttttct 59279



to top

>gb|AY809024.1| Schistosoma japonicum SJCHGC08662 protein mRNA, partial cds
          Length = 760

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 53  ttggcttcttcttcttttt 71
           |||||||||||||||||||
Sbjct: 386 ttggcttcttcttcttttt 368



to top

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 59      tcttcttctttttctgggc 77
               |||||||||||||||||||
Sbjct: 4590540 tcttcttctttttctgggc 4590558



to top

>ref|NM_001040371.1| Danio rerio zgc:136620 (zgc:136620), mRNA
          Length = 2965

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 57   cttcttcttctttttctgggcct 79
            |||||||||||| ||||||||||
Sbjct: 2626 cttcttcttcttcttctgggcct 2604



to top

>gb|AC165348.3| Mus musculus BAC clone RP23-300C11 from chromosome 3, complete
            sequence
          Length = 198637

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 55   ggcttcttcttctttttct 73
            |||||||||||||||||||
Sbjct: 9793 ggcttcttcttctttttct 9775



to top

>gb|AC121302.7| Mus musculus chromosome 13, clone RP23-163B12, complete sequence
          Length = 190256

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 57     cttcttcttctttttctgg 75
              |||||||||||||||||||
Sbjct: 166714 cttcttcttctttttctgg 166732



to top

>emb|Z75548.1|CER90 Caenorhabditis elegans Cosmid R90, complete sequence
          Length = 25360

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 55    ggcttcttcttctttttct 73
             |||||||||||||||||||
Sbjct: 20102 ggcttcttcttctttttct 20084



to top

>gb|AC138225.11| Mus musculus chromosome 1, clone RP23-164F17, complete sequence
          Length = 239758

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 64     ttctttttctgggccttgg 82
              |||||||||||||||||||
Sbjct: 145254 ttctttttctgggccttgg 145272



to top

>gb|AC072028.14| Homo sapiens 3 BAC RP11-190C21 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 186739

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 53    ttggcttcttcttcttttt 71
             |||||||||||||||||||
Sbjct: 45826 ttggcttcttcttcttttt 45844



to top

>ref|XM_799742.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1
            (DGF-1) (Tc00.1047053510637.9) partial mRNA
          Length = 6191

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 58   ttcttcttctttttctgggcctt 80
            ||||| |||||||||||||||||
Sbjct: 5665 ttctttttctttttctgggcctt 5687



to top

>emb|CR720005.2|CNS0GII3 Tetraodon nigroviridis full-length cDNA
          Length = 1764

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 55  ggcttcttcttctttttct 73
           |||||||||||||||||||
Sbjct: 174 ggcttcttcttctttttct 156



to top

>emb|CR697488.2|CNS0G14S Tetraodon nigroviridis full-length cDNA
          Length = 1645

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                             
Query: 55 ggcttcttcttctttttct 73
          |||||||||||||||||||
Sbjct: 50 ggcttcttcttctttttct 32



to top

>emb|CR696725.2|CNS0G0JL Tetraodon nigroviridis full-length cDNA
          Length = 1766

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 55  ggcttcttcttctttttct 73
           |||||||||||||||||||
Sbjct: 172 ggcttcttcttctttttct 154



to top

>emb|CR679835.2|CNS0FNIF Tetraodon nigroviridis full-length cDNA
          Length = 1454

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 55  ggcttcttcttctttttct 73
           |||||||||||||||||||
Sbjct: 172 ggcttcttcttctttttct 154



to top

>emb|CR664557.2|CNS0FBQR Tetraodon nigroviridis full-length cDNA
          Length = 1454

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 55  ggcttcttcttctttttct 73
           |||||||||||||||||||
Sbjct: 172 ggcttcttcttctttttct 154



to top

>emb|CR651203.2|CNS0F1FT Tetraodon nigroviridis full-length cDNA
          Length = 1728

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 55  ggcttcttcttctttttct 73
           |||||||||||||||||||
Sbjct: 145 ggcttcttcttctttttct 127



to top

>emb|BX629346.17| Zebrafish DNA sequence from clone DKEY-16N21 in linkage group 6, complete
              sequence
          Length = 214213

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 55     ggcttcttcttctttttct 73
              |||||||||||||||||||
Sbjct: 101605 ggcttcttcttctttttct 101587



to top

>gb|BC115198.1| Danio rerio similar to alpha globin regulatory element containing
            gene, mRNA (cDNA clone MGC:136620 IMAGE:7039976),
            complete cds
          Length = 2965

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 57   cttcttcttctttttctgggcct 79
            |||||||||||| ||||||||||
Sbjct: 2626 cttcttcttcttcttctgggcct 2604



to top

>emb|AL356141.9| Human DNA sequence from clone RP11-269L3 on chromosome 10, complete
             sequence
          Length = 87871

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 58    ttcttcttctttttctggg 76
             |||||||||||||||||||
Sbjct: 31429 ttcttcttctttttctggg 31411



to top

>emb|AL161445.10| Human DNA sequence from clone RP11-326F20 on chromosome 9 Contains the
             B4GALT1 gene for UDP-Gal:betaGlcNAc beta 1,4-
             galactosyltransferase, polypeptide 1 (GGTB2), a novel
             gene, the SPINK4 gene for  serine protease inhibitor,
             Kazal type 4 (PEC-60), the 3' end of the BAG1 gene for
             BCL2-associated athanogene and a CpG island, complete
             sequence
          Length = 163396

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 55    ggcttcttcttctttttct 73
             |||||||||||||||||||
Sbjct: 85582 ggcttcttcttctttttct 85600



to top

>gb|AC162918.3| Mus musculus BAC clone RP23-370K14 from chromosome 10, complete
             sequence
          Length = 165624

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 53    ttggcttcttcttcttttt 71
             |||||||||||||||||||
Sbjct: 88147 ttggcttcttcttcttttt 88129



to top

>gb|AC154318.3| Mus musculus BAC clone RP23-316D19 from chromosome 12, complete
             sequence
          Length = 176391

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 53    ttggcttcttcttcttttt 71
             |||||||||||||||||||
Sbjct: 91080 ttggcttcttcttcttttt 91062



to top

>emb|AL929176.4| Zebrafish DNA sequence from clone XX-187G17 in linkage group 3 Contains
             two novel genes similar to hbaa1 (hemoglobin alpha-adult
             1), the ba1 gene for ba1 globin, a novel gene similar to
             ba1, a novel gene for alpha and a novel gene for beta
             globin, a novel gene, a novel gene similar to human CGTHBA
             (conserved gene telomeric to alpha globin cluster), a
             novel gene similar to human MPG (N-methylpurine-DNA
             glycosylase) and two CpG islands, complete sequence
          Length = 100902

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 57    cttcttcttctttttctgggcct 79
             |||||||||||| ||||||||||
Sbjct: 74409 cttcttcttcttcttctgggcct 74387



to top

>emb|AL109619.1|ATT19F6 Arabidopsis thaliana DNA chromosome 4, BAC clone T19F6, partial
             sequence (ESSA project)
          Length = 77567

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 57    cttcttcttctttttctgg 75
             |||||||||||||||||||
Sbjct: 59811 cttcttcttctttttctgg 59793



to top

>emb|AL161561.2|ATCHRIV61 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 61
          Length = 198402

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 57   cttcttcttctttttctgg 75
            |||||||||||||||||||
Sbjct: 3106 cttcttcttctttttctgg 3088



to top

>emb|AL161560.2|ATCHRIV60 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 60
          Length = 196677

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 57     cttcttcttctttttctgg 75
              |||||||||||||||||||
Sbjct: 194783 cttcttcttctttttctgg 194765



to top

>emb|BX323026.5| Mouse DNA sequence from clone RP24-95F14 on chromosome 11 Contains the
             Ppm1d gene for magnesium-dependent protein phosphatase 1D
             delta isoform, the 5' end of the Bcas3 gene for breast
             carcinoma amplified sequence 3 and a CpG island, complete
             sequence
          Length = 130030

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 57    cttcttcttctttttctgg 75
             |||||||||||||||||||
Sbjct: 11306 cttcttcttctttttctgg 11288



to top

>emb|BX276106.6| Zebrafish DNA sequence from clone DKEY-1N18 in linkage group 6,
             complete sequence
          Length = 220671

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 55    ggcttcttcttctttttct 73
             |||||||||||||||||||
Sbjct: 23840 ggcttcttcttctttttct 23822



to top

>gb|AC165442.1| Mus musculus BAC clone RP23-164P21 from chromosome 10, complete sequence
          Length = 209583

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 61     ttcttctttttctgggcct 79
              |||||||||||||||||||
Sbjct: 195171 ttcttctttttctgggcct 195153



to top

>gb|BC066706.1| Danio rerio eukaryotic translation initiation factor 2, subunit 2
           beta, mRNA (cDNA clone MGC:77084 IMAGE:6960321),
           complete cds
          Length = 1317

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 55  ggcttcttcttctttttct 73
           |||||||||||||||||||
Sbjct: 128 ggcttcttcttctttttct 110



to top

>ref|NM_001025534.1| Danio rerio similar to alpha globin regulatory element containing
            gene (bY187G17.8), mRNA
          Length = 2503

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 57   cttcttcttctttttctgggcct 79
            |||||||||||| ||||||||||
Sbjct: 2181 cttcttcttcttcttctgggcct 2159



to top

>gb|AC090458.5| Homo sapiens chromosome 11, clone CTD-2572N17, complete sequence
          Length = 142233

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 60     cttcttctttttctgggcc 78
              |||||||||||||||||||
Sbjct: 101612 cttcttctttttctgggcc 101630



to top

>gb|AC111151.3| Homo sapiens chromosome 11, clone CTD-2557D6, complete sequence
          Length = 131271

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 60    cttcttctttttctgggcc 78
             |||||||||||||||||||
Sbjct: 82465 cttcttctttttctgggcc 82447



to top

>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023
          Length = 2661830

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 50      acattggcttcttcttctt 68
               |||||||||||||||||||
Sbjct: 1336658 acattggcttcttcttctt 1336676



to top

>ref|NM_166415.1| Drosophila melanogaster CG3216-RB, transcript variant B (CG3216),
            mRNA
          Length = 3426

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 63   cttctttttctgggccttg 81
            |||||||||||||||||||
Sbjct: 1636 cttctttttctgggccttg 1654



to top

>dbj|AB232920.1| Oryzias latipes hox gene cluster, complete cds, contains hoxBa, evx
              homologue on hoxBa
          Length = 235883

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 55     ggcttcttcttctttttct 73
              |||||||||||||||||||
Sbjct: 138198 ggcttcttcttctttttct 138216



to top

>dbj|AB207138.1| Oryzias latipes nppc3 and nppb genes for C-type natriuretic peptide-3
             precursor, B-type natriuretic peptide precursor, complete
             cds
          Length = 38866

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 55    ggcttcttcttctttttct 73
             |||||||||||||||||||
Sbjct: 28715 ggcttcttcttctttttct 28733



to top

>ref|NM_136611.2| Drosophila melanogaster Mystery 45A CG8070-RA (Mys45A), mRNA
          Length = 2391

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 58  ttcttcttctttttctgggcctt 80
           ||||| |||||||||||||||||
Sbjct: 915 ttctttttctttttctgggcctt 893



to top

>ref|NM_079319.2| Drosophila melanogaster Eukaryotic initiation factor 2 CG4153-RA
           (eIF-2beta), mRNA
          Length = 1136

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 55  ggcttcttcttctttttct 73
           |||||||||||||||||||
Sbjct: 346 ggcttcttcttctttttct 328



to top

>gb|AY071253.1| Drosophila melanogaster RE29270 full length cDNA
          Length = 1150

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 55  ggcttcttcttctttttct 73
           |||||||||||||||||||
Sbjct: 346 ggcttcttcttctttttct 328



to top

>gb|AY070560.1| Drosophila melanogaster LD33051 full length cDNA
          Length = 2390

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 58  ttcttcttctttttctgggcctt 80
           ||||| |||||||||||||||||
Sbjct: 900 ttctttttctttttctgggcctt 878



to top

>ref|XM_692813.1| PREDICTED: Danio rerio similar to Eukaryotic translation initiation
           factor 2, subunit 2 beta (LOC569429), mRNA
          Length = 1332

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 55  ggcttcttcttctttttct 73
           |||||||||||||||||||
Sbjct: 173 ggcttcttcttctttttct 155



to top

>gb|AF173549.1|AF173549 Drosophila melanogaster mystery 45A mRNA, complete cds
          Length = 2139

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 58  ttcttcttctttttctgggcctt 80
           ||||| |||||||||||||||||
Sbjct: 833 ttctttttctttttctgggcctt 811



to top

>gb|AC161147.6| Mus musculus BAC clone RP23-357G12 from chromosome 6, complete sequence
          Length = 225957

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 53     ttggcttcttcttcttttt 71
              |||||||||||||||||||
Sbjct: 163207 ttggcttcttcttcttttt 163189



to top

>gb|AC091223.2| Drosophila melanogaster 3L BAC RP98-48G6 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 170988

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 55    ggcttcttcttctttttct 73
             |||||||||||||||||||
Sbjct: 94957 ggcttcttcttctttttct 94975



to top

>emb|BX649593.5| Zebrafish DNA sequence from clone CH211-12G4 in linkage group 18,
             complete sequence
          Length = 71293

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 57    cttcttcttctttttctgggcct 79
             |||||||||||| ||||||||||
Sbjct: 69337 cttcttcttcttcttctgggcct 69315



to top

>gb|AC025763.5| Homo sapiens chromosome 16 clone CTB-186A5, complete sequence
          Length = 194690

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 55     ggcttcttcttctttttct 73
              |||||||||||||||||||
Sbjct: 165435 ggcttcttcttctttttct 165417



to top

>gb|AC093049.1| Drosophila melanogaster, chromosome 2R, region 45A-45A, BAC clone
            BACR08E17, complete sequence
          Length = 178262

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 58   ttcttcttctttttctgggcctt 80
            ||||| |||||||||||||||||
Sbjct: 9368 ttctttttctttttctgggcctt 9346



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 55      ggcttcttcttctttttct 73
               |||||||||||||||||||
Sbjct: 7092367 ggcttcttcttctttttct 7092349



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 53       ttggcttcttcttcttttt 71
                |||||||||||||||||||
Sbjct: 17494152 ttggcttcttcttcttttt 17494170



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 50      acattggcttcttcttctt 68
               |||||||||||||||||||
Sbjct: 4214322 acattggcttcttcttctt 4214340



 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 47      aagacattggcttcttctt 65
               |||||||||||||||||||
Sbjct: 3703883 aagacattggcttcttctt 3703901



to top

>gb|AC139667.5| Homo sapiens 3 BAC RP11-88B8 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 135668

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 49    gacattggcttcttcttcttttt 71
             |||||| ||||||||||||||||
Sbjct: 59631 gacattagcttcttcttcttttt 59653



to top

>gb|AC008186.5|AC008186 Drosophila melanogaster, chromosome 2R, region 45A-46A, BAC clone
             BACR10M14, complete sequence
          Length = 189757

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 58    ttcttcttctttttctgggcctt 80
             ||||| |||||||||||||||||
Sbjct: 40682 ttctttttctttttctgggcctt 40704



to top

>gb|AC007888.7|AC007888 Drosophila melanogaster, chromosome 2R, region 57B6-57B13, BAC clone
             BACR10P11, complete sequence
          Length = 164035

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 63    cttctttttctgggccttg 81
             |||||||||||||||||||
Sbjct: 47282 cttctttttctgggccttg 47300



to top

>gb|AC090523.1|AC090523 Caenorhabditis briggsae cosmid CB015N01, complete sequence
          Length = 98319

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 57    cttcttcttctttttctgg 75
             |||||||||||||||||||
Sbjct: 46214 cttcttcttctttttctgg 46232



to top

>gb|AC016737.8| Homo sapiens BAC clone RP11-394I13 from 2, complete sequence
          Length = 196085

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 51     cattggcttcttcttctttttct 73
              |||||||||||||||||| ||||
Sbjct: 129085 cattggcttcttcttcttcttct 129107



to top

>gb|AC137643.3| Homo sapiens chromosome 16 clone RP11-95H3, complete sequence
          Length = 159836

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 55    ggcttcttcttctttttct 73
             |||||||||||||||||||
Sbjct: 91955 ggcttcttcttctttttct 91973



to top

>gb|AC037425.7|AC037425 Oryza sativa chromosome 10 BAC OSJNBa0055P24 genomic sequence, complete
              sequence
          Length = 134058

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 53     ttggcttcttcttcttttt 71
              |||||||||||||||||||
Sbjct: 123147 ttggcttcttcttcttttt 123165



to top

>dbj|AP003282.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0583G08
          Length = 135295

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 47     aagacattggcttcttctt 65
              |||||||||||||||||||
Sbjct: 112363 aagacattggcttcttctt 112381



to top

>gb|AC016651.8| Homo sapiens chromosome 5 clone RP1-251I12, complete sequence
          Length = 117963

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 57     cttcttcttctttttctgg 75
              |||||||||||||||||||
Sbjct: 102959 cttcttcttctttttctgg 102977



to top

>gb|AF296838.1|T29J13 Arabidopsis thaliana BAC T29J13
          Length = 100592

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 54    tggcttcttcttctttttc 72
             |||||||||||||||||||
Sbjct: 52732 tggcttcttcttctttttc 52750



to top

>emb|AJ620188.1| Solanum yellow leaf curl virus segment B, complete sequence
          Length = 2702

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 58   ttcttcttctttttctggg 76
            |||||||||||||||||||
Sbjct: 2228 ttcttcttctttttctggg 2210



to top

>dbj|AP003118.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:OJ1174_D05
          Length = 128525

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 50    acattggcttcttcttctt 68
             |||||||||||||||||||
Sbjct: 52289 acattggcttcttcttctt 52307



to top

>emb|BX682227.3| Mouse DNA sequence from clone RP23-190N2 on chromosome X, complete
             sequence
          Length = 76641

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 57    cttcttcttctttttctgg 75
             |||||||||||||||||||
Sbjct: 72674 cttcttcttctttttctgg 72656



to top

>emb|AL808135.13| Mouse DNA sequence from clone RP23-186D8 on chromosome X, complete
             sequence
          Length = 155880

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 57    cttcttcttctttttctgg 75
             |||||||||||||||||||
Sbjct: 69249 cttcttcttctttttctgg 69231



to top

>emb|AL663069.10| Mouse DNA sequence from clone RP23-410P8 on chromosome 11, complete
             sequence
          Length = 55963

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 60    cttcttctttttctgggcc 78
             |||||||||||||||||||
Sbjct: 34960 cttcttctttttctgggcc 34978



to top

>emb|AL953863.13| Zebrafish DNA sequence from clone CH211-113F11 in linkage group 14,
             complete sequence
          Length = 163814

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 57    cttcttcttctttttctgggcct 79
             |||||||||||| ||||||||||
Sbjct: 95401 cttcttcttcttcttctgggcct 95423



to top

>emb|AL772362.8| Zebrafish DNA sequence from clone CH211-173K16 in linkage group 13,
            complete sequence
          Length = 165993

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 56   gcttcttcttctttttctg 74
            |||||||||||||||||||
Sbjct: 3447 gcttcttcttctttttctg 3429



to top

>dbj|AK108226.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-140-F04, full
           insert sequence
          Length = 1089

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 50  acattggcttcttcttctt 68
           |||||||||||||||||||
Sbjct: 805 acattggcttcttcttctt 787



to top

>gb|AC154783.2| Mus musculus BAC clone RP24-466C8 from 12, complete sequence
          Length = 167125

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 53    ttggcttcttcttcttttt 71
             |||||||||||||||||||
Sbjct: 19045 ttggcttcttcttcttttt 19063



to top

>gb|AC007156.2|AC007156 Homo sapiens chromosome 18, clone hRPK.419_J_16, complete sequence
          Length = 203591

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 78     cttggcaattgtcttcctg 96
              |||||||||||||||||||
Sbjct: 143011 cttggcaattgtcttcctg 142993



to top

>gb|AE003834.3| Drosophila melanogaster chromosome 2R, section 16 of 73 of the complete
             sequence
          Length = 243313

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 58    ttcttcttctttttctgggcctt 80
             ||||| |||||||||||||||||
Sbjct: 47524 ttctttttctttttctgggcctt 47546



to top

>emb|AL133299.4|CNS01DUN Human chromosome 14 DNA sequence BAC R-62H20 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 164935

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 63    cttctttttctgggccttg 81
             |||||||||||||||||||
Sbjct: 46347 cttctttttctgggccttg 46329



to top

>gb|AE003541.3| Drosophila melanogaster chromosome 3L, section 44 of 83 of the complete
              sequence
          Length = 265524

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 55     ggcttcttcttctttttct 73
              |||||||||||||||||||
Sbjct: 215109 ggcttcttcttctttttct 215127



to top

>gb|AE003452.5| Drosophila melanogaster chromosome 2R, section 60 of 73 of the complete
              sequence
          Length = 303438

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 63     cttctttttctgggccttg 81
              |||||||||||||||||||
Sbjct: 203986 cttctttttctgggccttg 203968



to top

>dbj|AP005271.4| Homo sapiens genomic DNA, chromosome 18 clone:RP11-752I5, complete
              sequence
          Length = 200108

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 78     cttggcaattgtcttcctg 96
              |||||||||||||||||||
Sbjct: 128404 cttggcaattgtcttcctg 128422



to top

>gb|AC006074.1|AC006074 Drosophila melanogaster, chromosome 2R, region 44F12-45A4, P1 clones
            DS05998, DS07727, DS05175, and DS01885, complete sequence
          Length = 204617

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 58   ttcttcttctttttctgggcctt 80
            ||||| |||||||||||||||||
Sbjct: 1180 ttctttttctttttctgggcctt 1158



to top

>dbj|AP005660.3| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1090H4, complete
              sequence
          Length = 161970

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 116    cctcttgcctgataagagc 134
              |||||||||||||||||||
Sbjct: 155653 cctcttgcctgataagagc 155635



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                   
Query: 53       ttggcttcttcttcttttt 71
                |||||||||||||||||||
Sbjct: 17503192 ttggcttcttcttcttttt 17503210



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 55      ggcttcttcttctttttct 73
               |||||||||||||||||||
Sbjct: 7092246 ggcttcttcttctttttct 7092228



to top

>emb|AL928782.4|CNS08CCC Oryza sativa chromosome 12, . BAC OSJNBb0069I24 of library OSJNBb from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 68450

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 55    ggcttcttcttctttttct 73
             |||||||||||||||||||
Sbjct: 60053 ggcttcttcttctttttct 60035



to top

>emb|BX842241.1|CNS0B0PM Oryza sativa chromosome 12, . Partial sequence from chromosome 12
           of cultivar Nipponbare of ssp. japonica of Oryza sativa
           (rice), complete sequence
          Length = 45687

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 55  ggcttcttcttctttttct 73
           |||||||||||||||||||
Sbjct: 667 ggcttcttcttctttttct 649



to top

>gb|AC005268.1|AC005268 Drosophila melanogaster DNA sequence (P1s DS03550 (D225) and DS02397
             (D206)), complete sequence
          Length = 89791

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 63    cttctttttctgggccttg 81
             |||||||||||||||||||
Sbjct: 75743 cttctttttctgggccttg 75761



to top

>emb|AL929130.4| Zebrafish DNA sequence from clone CH211-287M16 in linkage group
          18, complete sequence
          Length = 149702

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                 
Query: 57 cttcttcttctttttctgggcct 79
          |||||||||||| ||||||||||
Sbjct: 44 cttcttcttcttcttctgggcct 22



to top

>emb|AL844896.7| Mouse DNA sequence from clone RP23-356L21 on chromosome 2, complete
             sequence
          Length = 83203

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 83    caattgtcttcctgtcaac 101
             |||||||||||||||||||
Sbjct: 48264 caattgtcttcctgtcaac 48282



to top

>gb|L19197.1|DROEIF2BET Drosophila melanogaster eIF-2 beta-subunit mRNA, complete cds
          Length = 1099

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 55  ggcttcttcttctttttct 73
           |||||||||||||||||||
Sbjct: 311 ggcttcttcttctttttct 293



to top

>gb|AC002311.1| Arabidopsis thaliana chromosome I BAC T26J12 genomic sequence, complete
             sequence
          Length = 85855

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 56    gcttcttcttctttttctg 74
             |||||||||||||||||||
Sbjct: 72490 gcttcttcttctttttctg 72508



to top

>gb|AC002343.1|ATAC002343 Arabidopsis thaliana chromosome IV BAC T19F6 genomic sequence, complete
             sequence
          Length = 116156

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 57    cttcttcttctttttctgg 75
             |||||||||||||||||||
Sbjct: 17829 cttcttcttctttttctgg 17847



to top

>dbj|AP003692.2| Homo sapiens genomic DNA, chromosome 8q23, clone: KB1608C10, complete
             sequence
          Length = 149110

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 116   cctcttgcctgataagagc 134
             |||||||||||||||||||
Sbjct: 37146 cctcttgcctgataagagc 37128


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,586,095
Number of Sequences: 3902068
Number of extensions: 2586095
Number of successful extensions: 696814
Number of sequences better than 10.0: 162
Number of HSP's better than 10.0 without gapping: 162
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 694377
Number of HSP's gapped (non-prelim): 2436
length of query: 190
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 168
effective length of database: 17,147,199,772
effective search space: 2880729561696
effective search space used: 2880729561696
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top