Clone Name	rbasd14i13
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AF271362.1|AF271362 Lolium perenne nucleoside diphosphate kin...	690	0.0
2	ref|NM_197769.1| Oryza sativa (japonica cultivar-group) putative...	529	e-147
3	dbj|AK072751.1| Oryza sativa (japonica cultivar-group) cDNA clon...	529	e-147
4	gb|AY103833.1| Zea mays PCO135636 mRNA sequence	387	e-104
5	gb|U55019.1|SOU55019 Saccharum officinarum nucleoside diphosphat...	363	4e-97
6	gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 geno...	262	1e-66
7	dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D...	262	1e-66
8	gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome...	262	1e-66
9	ref|XM_478187.1| Oryza sativa (japonica cultivar-group), mRNA	196	6e-47
10	dbj|D16292.1|RICNDKR Oryza sativa mRNA for nucleoside diphosphat...	196	6e-47
11	gb|AY649743.1| Oryza sativa (japonica cultivar-group) nucleoside...	188	1e-44
12	dbj|AK121796.1| Oryza sativa (japonica cultivar-group) cDNA clon...	188	1e-44
13	gb|AY104578.1| Zea mays PCO113042 mRNA sequence	174	2e-40
14	gb|DQ097723.1| Arachis hypogaea nucleoside diphosphate kinase I ...	119	1e-23
15	gb|AF480463.1| Musa acuminata nucleoside diphosphate kinase mRNA...	117	4e-23
16	gb|AY389630.1| Hyacinthus orientalis nucleoside diphosphate kina...	103	7e-19
17	dbj|D10659.1|SPINDPKINI Spinach mRNA for nucleoside diphosphate ...	100	1e-17
18	gb|BT013034.1| Lycopersicon esculentum clone 114282R, mRNA sequence	98	4e-17
19	emb|X75324.1|LERNADNK L.esculentum (Ailsa Craig) mRNA for nucleo...	98	4e-17
20	ref|XM_323541.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE ...	84	6e-13
21	ref|XM_956069.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE ...	84	6e-13
22	ref|XM_676393.1| Aspergillus nidulans FGSC A4 nucleoside diphosp...	84	6e-13
23	ref|XM_570963.1| Cryptococcus neoformans var. neoformans JEC21 n...	84	6e-13
24	gb|AY057453.1| Emericella nidulans nucleoside diphosphate kinase...	84	6e-13
25	dbj|AB071599.1| Brassica rapa Bc-NDPK1 mRNA for nucleoside dipho...	80	1e-11
26	gb|AF072289.1|AF072289 Mesembryanthemum crystallinum nucleoside ...	80	1e-11
27	dbj|AB072238.1| Brassica rapa mRNA for NDPK I, complete cds	80	1e-11
28	dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D...	78	4e-11
29	dbj|D10431.1|RICT164 Oryza sativa mRNA for NDP kinase (T164 gene...	78	4e-11
30	dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic D...	78	4e-11
31	dbj|AP004266.3| Oryza sativa (japonica cultivar-group) genomic D...	78	4e-11
32	ref|XM_742902.1| Aspergillus fumigatus Af293 nucleoside diphosph...	70	9e-09
33	emb|AL807368.1|NC62D11 Neurospora crassa DNA linkage group V cos...	70	9e-09
34	emb|AL807373.1|NC21D9 Neurospora crassa DNA linkage group V cosm...	70	9e-09
35	dbj|D88148.1| Neurospora crassa mRNA for nucleoside diphosphate ...	70	9e-09
36	gb|AY324230.1| Aspergillus fumigatus nucleoside diphosphate kina...	68	4e-08
37	gb|U50150.1|GMU50150 Glycine max nucleoside diphosphate kinase m...	68	4e-08
38	gb|U72142.1|HAU72142 Helianthus annuus nucleoside diphosphate ki...	68	4e-08
39	gb|DQ440055.1| Aedes aegypti clone AE-307 nucleoside diphosphate...	66	1e-07
40	emb|CR938691.1| Single read from an extremity of a full-length c...	66	1e-07
41	emb|CR938428.1| Single read from an extremity of a full-length c...	66	1e-07
42	gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome	66	1e-07
43	gb|AF108881.1|AF108881 Capsicum annuum nucleoside diphosphate ki...	66	1e-07
44	ref|NM_117000.2| Arabidopsis thaliana NDPK1; ATP binding / nucle...	64	6e-07
45	emb|X69373.1|ATNDK A.thaliana mRNA for nucleoside diphosphate ki...	64	6e-07
46	gb|AY072518.1| Arabidopsis thaliana unknown protein mRNA, comple...	64	6e-07
47	gb|DQ066341.1| Ixodes scapularis isolate IS-6-12-J-cluster-432 n...	64	6e-07
48	gb|AF370529.1|AF370529 Arabidopsis thaliana Unknown protein mRNA...	64	6e-07
49	emb|BX827107.1|CNS0A38G Arabidopsis thaliana Full-length cDNA Co...	64	6e-07
50	emb|BX829087.1|CNS0A2O7 Arabidopsis thaliana Full-length cDNA Co...	64	6e-07
51	gb|AY089088.1| Arabidopsis thaliana clone 30158 mRNA, complete s...	64	6e-07
52	gb|AF017641.1|AF017641 Arabidopsis thaliana nucleoside diphospha...	64	6e-07
53	gb|DQ157699.1| Solanum chacoense cytosolic nucleoside diphosphat...	62	2e-06
54	emb|BX072516.1|CNS09S48 Single read from an extremity of a full-...	62	2e-06
55	emb|BX072515.1|CNS09S47 Single read from an extremity of a full-...	62	2e-06
56	emb|BX063953.1|CNS09LID Single read from an extremity of a full-...	62	2e-06
57	emb|BX051771.1|CNS09C3Z Single read from an extremity of a full-...	62	2e-06
58	emb|BX050874.1|CNS09BF2 Single read from an extremity of a full-...	62	2e-06
59	emb|BX048701.1|CNS099QP Single read from an extremity of a full-...	62	2e-06
60	emb|BX044675.1|CNS096MV Single read from an extremity of a full-...	62	2e-06
61	emb|BX039425.1|CNS092L1 Single read from an extremity of a full-...	62	2e-06
62	emb|BX038905.1|CNS0926L Single read from an extremity of a full-...	62	2e-06
63	emb|BX038259.1|CNS091ON Single read from an extremity of a full-...	62	2e-06
64	emb|BX038258.1|CNS091OM Single read from an extremity of a full-...	62	2e-06
65	emb|BX038115.1|CNS091KN Single read from an extremity of a full-...	62	2e-06
66	emb|BX037581.1|CNS0915T Single read from an extremity of a full-...	62	2e-06
67	emb|BX037580.1|CNS0915S Single read from an extremity of a full-...	62	2e-06
68	emb|BX036658.1|CNS090G6 Single read from an extremity of a full-...	62	2e-06
69	emb|BX032742.1|CNS08XFE Single read from an extremity of a full-...	62	2e-06
70	emb|BX031659.1|CNS08WLB Single read from an extremity of a full-...	62	2e-06
71	emb|BX031658.1|CNS08WLA Single read from an extremity of a full-...	62	2e-06
72	emb|BX025663.1|CNS08RYR Single read from an extremity of a full-...	62	2e-06
73	emb|BX025662.1|CNS08RYQ Single read from an extremity of a full-...	62	2e-06
74	emb|BX025230.1|CNS08RMQ Single read from an extremity of a full-...	62	2e-06
75	emb|BX024508.1|CNS08R2O Single read from an extremity of a full-...	62	2e-06
76	emb|BX024507.1|CNS08R2N Single read from an extremity of a full-...	62	2e-06
77	emb|BX023654.1|CNS08QEY Single read from an extremity of a full-...	62	2e-06
78	emb|BX022916.1|CNS08PUG Single read from an extremity of a full-...	62	2e-06
79	emb|BX022915.1|CNS08PUF Single read from an extremity of a full-...	62	2e-06
80	emb|BX021481.1|CNS08OQL Single read from an extremity of a full-...	62	2e-06
81	emb|BX021480.1|CNS08OQK Single read from an extremity of a full-...	62	2e-06
82	emb|BX021192.1|CNS08OIK Single read from an extremity of a full-...	62	2e-06
83	emb|BX021174.1|CNS08OI2 Single read from an extremity of a full-...	62	2e-06
84	emb|BX018153.1|CNS08M65 Single read from an extremity of a full-...	62	2e-06
85	emb|BX018054.1|CNS08M3E Single read from an extremity of a full-...	62	2e-06
86	emb|BX017467.1|CNS08LN3 Single read from an extremity of a full-...	62	2e-06
87	emb|BX017466.1|CNS08LN2 Single read from an extremity of a full-...	62	2e-06
88	emb|BX017206.1|CNS08LFU Single read from an extremity of a full-...	62	2e-06
89	emb|BX016645.1|CNS08L09 Single read from an extremity of a full-...	62	2e-06
90	emb|BX014282.1|CNS08J6M Single read from an extremity of a full-...	62	2e-06
91	emb|BX009575.1|CNS08FJV Single read from an extremity of a full-...	62	2e-06
92	emb|BX009569.1|CNS08FJP Single read from an extremity of a full-...	62	2e-06
93	emb|BX009487.1|CNS08FHF Single read from an extremity of a full-...	62	2e-06
94	emb|BX007945.1|CNS08EAL Single read from an extremity of a full-...	62	2e-06
95	emb|BX007944.1|CNS08EAK Single read from an extremity of a full-...	62	2e-06
96	emb|BX006734.1|CNS08DCY Single read from an extremity of a full-...	62	2e-06
97	emb|BX006733.1|CNS08DCX Single read from an extremity of a full-...	62	2e-06
98	emb|BX006020.1|CNS08CT4 Single read from an extremity of a full-...	62	2e-06
99	dbj|AB226030.1| Aspergillus oryzae cDNA, contig sequence: AoEST2886	62	2e-06
100	dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102	62	2e-06
101	ref|XM_308641.2| Anopheles gambiae str. PEST ENSANGP00000011253 ...	62	2e-06
102	gb|AY231961.1| Drosophila yakuba clone yak-em_awd mRNA sequence	60	9e-06
103	emb|BX025692.1|CNS08RZK Single read from an extremity of a full-...	60	9e-06
104	emb|X13107.1|DMAWDR Drosophila melanogaster awd mRNA ( abnormal ...	60	9e-06
105	gb|AY113576.1| Drosophila melanogaster RH27794 full insert cDNA	60	9e-06
106	ref|NM_057413.3| Drosophila melanogaster abnormal wing discs CG2...	60	9e-06
107	gb|AC007469.7|AC007469 Drosophila melanogaster, chromosome 3R, r...	60	9e-06
108	gb|AY157739.1| Glycine max nucleoside diphosphate kinase mRNA, c...	60	9e-06
109	dbj|AK065933.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	9e-06
110	emb|AM055942.1| Toxoplasma gondii, strain RH, genomic DNA chromo...	60	9e-06
111	gb|AE003779.2| Drosophila melanogaster chromosome 3R, section 11...	60	9e-06
112	gb|BT001459.1| Drosophila melanogaster GM19775 full insert cDNA	60	9e-06
113	ref|XM_363038.1| Magnaporthe grisea 70-15 hypothetical protein (...	58	4e-05
114	gb|AY194364.1| Vitis vinifera nucleoside-diphosphate kinase (Ndp...	58	4e-05
115	emb|BX049071.1|CNS09A0Z Single read from an extremity of a full-...	58	4e-05
116	emb|BX021302.1|CNS08OLM Single read from an extremity of a full-...	58	4e-05
117	emb|BX013424.1|CNS08IIS Single read from an extremity of a full-...	58	4e-05
118	ref|XM_780291.1| PREDICTED: Strongylocentrotus purpuratus simila...	58	4e-05
119	gb|AY157740.1| Glycine max nucleoside diphosphate kinase mRNA, c...	58	4e-05
120	emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segmen...	56	1e-04
121	dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete g...	56	1e-04
122	dbj|AB107688.1| Thermus thermophilus ndk gene for nucleoside dip...	56	1e-04
123	gb|AE017221.1| Thermus thermophilus HB27, complete genome	56	1e-04
124	gb|AY440076.1| Armigeres subalbatus ASAP ID: 39023 nucleoside di...	54	6e-04
125	ref|XM_386148.1| Gibberella zeae PH-1 chromosome 3 hypothetical ...	54	6e-04
126	emb|BX062211.1|CNS09K5Z Single read from an extremity of a full-...	54	6e-04
127	emb|BX022612.1|CNS08PM0 Single read from an extremity of a full-...	54	6e-04
128	emb|BX017207.1|CNS08LFV Single read from an extremity of a full-...	54	6e-04
129	gb|DQ215035.1| Taeniopygia guttata clone 0058P0031C09 nucleoside...	52	0.002
130	gb|DQ215034.1| Taeniopygia guttata clone 0058P0024B11 nucleoside...	52	0.002
131	gb|DQ215039.1| Taeniopygia guttata clone 0058P0028E06 nucleoside...	52	0.002
132	gb|DQ215038.1| Taeniopygia guttata clone 0058P0001H07 nucleoside...	52	0.002
133	gb|DQ215037.1| Taeniopygia guttata clone 0065P0005G12 nucleoside...	52	0.002
134	gb|DQ215036.1| Taeniopygia guttata clone 0061P0021A02 nucleoside...	52	0.002
135	emb|X71388.1|PSNDKP1 P.sativum ndk-p1 mRNA for nucleoside diphos...	52	0.002
136	gb|AY130398.1| Petromyzon marinus nucleoside diphosphate kinase ...	52	0.002
137	dbj|AB121067.1| Halogeometricum borinquense ndk gene for nucleos...	52	0.002
138	dbj|D86052.1|PEAPNDKN1 Pisum sativum mRNA for PNDKN1, complete cds	52	0.002
139	ref|XM_753830.1| Ustilago maydis 521 hypothetical protein (UM027...	50	0.009
140	emb|BX009576.1|CNS08FJW Single read from an extremity of a full-...	50	0.009
141	ref|NM_205047.1| Gallus gallus non-metastatic cells 2, protein (...	50	0.009
142	gb|DQ372081.1| Sus scrofa nm23-H2 mRNA, complete cds	50	0.009
143	gb|AE005044.1| Halobacterium sp. NRC-1 section 75 of 170 of the ...	50	0.009
144	dbj|AB126060.1| Codonopsis lanceolata NDPK 1 mRNA for nucloeside...	50	0.009
145	gb|AF043542.1|AF043542 Gallus gallus nucleoside diphosphate kina...	50	0.009
146	gb|J05207.1|MXANDK M.xanthus nucleoside 5'-diphosphate phosphotr...	50	0.009
147	gb|U10283.1|FBU10283 Flaveria bidentis clone pNDK-b nucleoside d...	50	0.009
148	gb|U10282.1|FBU10282 Flaveria bidentis clone pNDK-a nucleoside d...	50	0.009
149	dbj|AB036344.1| Halobacterium cutirubrum rpl7AE, rps28E, rpl24E,...	50	0.009
150	gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr...	48	0.034
151	emb|BX038906.1|CNS0926M Single read from an extremity of a full-...	48	0.034
152	emb|BX038116.1|CNS091KO Single read from an extremity of a full-...	48	0.034
153	emb|BX021303.1|CNS08OLN Single read from an extremity of a full-...	48	0.034
154	emb|BX021175.1|CNS08OI3 Single read from an extremity of a full-...	48	0.034
155	emb|AJ308817.1|CAR308817 Coffea arabica microsatellite DNA, clon...	48	0.034
156	emb|X69376.1|ATNDK13 A.thaliana gene for nucleoside diphosphate ...	46	0.14
157	emb|AL161514.2|ATCHRIV26 Arabidopsis thaliana DNA chromosome 4, ...	46	0.14
158	emb|AL117386.1|ATT30A10 Arabidopsis thaliana DNA chromosome 4, B...	46	0.14
159	gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome	46	0.14
160	gb|DQ413209.1| Acyrthosiphon pisum isolate WHAP0107 abnormal win...	46	0.14
161	emb|AL116259.1|CNS01D1N Botrytis cinerea strain T4 cDNA library	46	0.14
162	emb|AL116136.1|CNS01CY8 Botrytis cinerea strain T4 cDNA library	46	0.14
163	emb|AL115859.1|CNS01CQJ Botrytis cinerea strain T4 cDNA library	46	0.14
164	emb|AL115323.1|CNS01CBN Botrytis cinerea strain T4 cDNA library	46	0.14
165	emb|AL114869.1|CNS01BZ1 Botrytis cinerea strain T4 cDNA library	46	0.14
166	emb|AL114309.1|CNS01BJH Botrytis cinerea strain T4 cDNA library	46	0.14
167	emb|AL111481.1|CNS019CX Botrytis cinerea strain T4 cDNA library	46	0.14
168	gb|AY962601.1| Nicotiana tabacum nucleoside diphosphate kinase m...	46	0.14
169	dbj|AB121070.1| Natronomonas pharaonis ndk gene for nucleoside d...	46	0.14
170	emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome	46	0.14
171	gb|AF069544.1|AF069544 Mycobacterium smegmatis nucleoside diphos...	46	0.14
172	gb|BT019474.1| Synthetic construct Homo sapiens non-metastatic c...	44	0.54
173	gb|BT019438.1| Homo sapiens non-metastatic cells 4, protein expr...	44	0.54
174	gb|BT019437.1| Synthetic construct Homo sapiens non-metastatic c...	44	0.54
175	gb|BT019436.1| Synthetic construct Homo sapiens non-metastatic c...	44	0.54
176	gb|BT019435.1| Synthetic construct Homo sapiens non-metastatic c...	44	0.54
177	gb|BC004880.2| Homo sapiens non-metastatic cells 4, protein expr...	44	0.54
178	ref|NM_005009.2| Homo sapiens non-metastatic cells 4, protein ex...	44	0.54
179	ref|XM_824577.1| Trypanosoma brucei TREU927 nucleoside diphospha...	44	0.54
180	ref|XM_809769.1| Trypanosoma cruzi strain CL Brener hypothetical...	44	0.54
181	ref|XM_814613.1| Trypanosoma cruzi strain CL Brener hypothetical...	44	0.54
182	emb|CR857184.1| Pongo pygmaeus mRNA; cDNA DKFZp468E0516 (from cl...	44	0.54
183	emb|CR621504.1| full-length cDNA clone CS0DC014YN11 of Neuroblas...	44	0.54
184	emb|CR613066.1| full-length cDNA clone CS0DF035YK02 of Fetal bra...	44	0.54
185	dbj|AK094439.1| Homo sapiens cDNA FLJ37120 fis, clone BRACE20223...	44	0.54
186	emb|CR597313.1| full-length cDNA clone CS0DC018YA06 of Neuroblas...	44	0.54
187	emb|CR595773.1| full-length cDNA clone CS0DC003YM19 of Neuroblas...	44	0.54
188	emb|CR592051.1| full-length cDNA clone CS0DF021YM10 of Fetal bra...	44	0.54
189	gb|AF295650.1| Beta vulgaris nucleotide diphosphate kinase (ndk)...	44	0.54
190	ref|NR_001577.1| Homo sapiens non-metastatic cells 2, protein (N...	44	0.54
191	gb|AY335611.1| Synthetic construct Homo sapiens non-metastatic c...	44	0.54
192	dbj|AB232529.1| Haloarcula quadrata ndk gene for nucleoside diph...	44	0.54
193	dbj|AB232528.1| Haloarcula sinaiiensis ndk gene for nucleoside d...	44	0.54
194	gb|U85976.1|HSU85976 Human nucleoside diphosphate kinase (NDK) p...	44	0.54
195	gb|AF164200.1|AF164200 Trypanosoma brucei putative DNA replicati...	44	0.54
196	gb|AY888350.1| Synthetic construct Homo sapiens clone FLH008002....	44	0.54
197	gb|AY888349.1| Synthetic construct Homo sapiens clone FLH008001....	44	0.54
198	gb|AY890948.1| Synthetic construct Homo sapiens clone FLH008000....	44	0.54
199	gb|AY890947.1| Synthetic construct Homo sapiens clone FLH007999....	44	0.54
200	gb|AY890946.1| Synthetic construct Homo sapiens clone FLH007998....	44	0.54
201	gb|AY890945.1| Synthetic construct Homo sapiens clone FLH007997....	44	0.54
202	dbj|AB126343.1| Haloarcula sinaiiensis ndk gene for nucleoside d...	44	0.54
203	dbj|AB126342.1| Haloarcula quadrata ndk gene for nucleoside diph...	44	0.54
204	dbj|AB126341.1| Haloarcula japonica ndk gene for nucleoside diph...	44	0.54
205	dbj|AB126340.1| Haloarcula hispanica ndk gene for nucleoside dip...	44	0.54
206	dbj|AB126339.1| Haloarcula californiae ndk gene for nucleoside d...	44	0.54
207	dbj|AB126338.1| Haloarcula argentinensis ndk gene for nucleoside...	44	0.54
208	dbj|AB121068.1| Halorubrum saccharovorum ndk gene for nucleoside...	44	0.54
209	dbj|AB121064.1| Haloarcula sinaiiensis ndk gene for nucleoside d...	44	0.54
210	dbj|AB121063.1| Haloarcula hispanica ndk gene for nucleoside dip...	44	0.54
211	gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c...	44	0.54
212	gb|AC004263.1|AC004263 Homo sapiens PAC clone 278C19 from 12q, c...	44	0.54
213	gb|AF086133.1|HUMZA87H07 Homo sapiens full length insert cDNA cl...	44	0.54
214	gb|BC017067.1| Homo sapiens non-metastatic cells 4, protein expr...	44	0.54
215	emb|CT033698.1| Platynereis dumerilii EST IB0AAA15DD08EM1	44	0.54
216	emb|CT032612.1| Platynereis dumerilii EST IB0AAA35BD04EM1	44	0.54
217	emb|CT032450.1| Platynereis dumerilii EST IB0AAA38AD09EM1	44	0.54
218	emb|Y07604.1|HSNM23H4 H.sapiens mRNA for nucleoside-diphosphate ...	44	0.54
219	ref|XM_476035.1| Oryza sativa (japonica cultivar-group), predic...	42	2.1
220	gb|AC136217.4| Oryza sativa (japonica cultivar-group) chromosome...	42	2.1
221	gb|BT017115.1| Zea mays clone EL01N0363H10.c mRNA sequence	42	2.1
222	gb|AC119951.12| Mus musculus chromosome 9, clone RP24-448C4, com...	42	2.1
223	ref|XM_420097.1| PREDICTED: Gallus gallus similar to nucleoside ...	42	2.1
224	gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete...	42	2.1
225	gb|AC120386.12| Mus musculus chromosome 9, clone RP24-294A16, co...	42	2.1
226	emb|CR685311.2|CNS0FRQJ Tetraodon nigroviridis full-length cDNA	42	2.1
227	emb|AL583826.16| Human DNA sequence from clone RP11-434B7 on chr...	42	2.1
228	emb|AL355483.14| Human DNA sequence from clone RP4-784A16 on chr...	42	2.1
229	ref|XM_962410.1| PREDICTED: Tribolium castaneum similar to CG221...	42	2.1
230	ref|XM_780229.1| PREDICTED: Strongylocentrotus purpuratus simila...	42	2.1
231	gb|DQ445499.1| Graphocephala atropunctata isolate WHGA0016 putat...	42	2.1
232	dbj|AK061858.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	2.1
233	gb|AY585937.1| Paxillus involutus strain ATCC 200175 nucleoside ...	42	2.1
234	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	42	2.1
235	dbj|AB121066.1| Halobacterium salinarum ndk gene for nucleoside ...	42	2.1
236	dbj|AK066391.1| Oryza sativa (japonica cultivar-group) cDNA clon...	42	2.1
237	gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete...	42	2.1
238	emb|CT032611.1| Platynereis dumerilii EST IB0AAA35BD04FM1	42	2.1
239	gb|AC144455.5| Oryza sativa (japonica cultivar-group) chromosome...	42	2.1
240	emb|AL845442.7| Mouse DNA sequence from clone RP23-392D9 on chro...	42	2.1
241	gb|CP000097.1| Synechococcus sp. CC9902, complete genome	40	8.4
242	gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome	40	8.4
243	gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome	40	8.4
244	gb|AC126023.3| Mus musculus BAC clone RP24-422I18 from chromosom...	40	8.4
245	gb|AC130843.3| Mus musculus BAC clone RP24-501N9 from chromosome...	40	8.4
246	ref|XM_753334.1| Ustilago maydis 521 hypothetical protein (UM022...	40	8.4
247	emb|CT025688.6| Mouse DNA sequence from clone RP24-310A8 on chro...	40	8.4
248	gb|AC122026.3| Mus musculus BAC clone RP24-390D21 from chromosom...	40	8.4
249	gb|AC113272.11| Mus musculus chromosome 1, clone RP23-379C24, co...	40	8.4
250	emb|BX248409.5| Human DNA sequence from clone RP11-360D2 on chro...	40	8.4
251	gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome	40	8.4
252	emb|AL109921.21|HSDJ383J4 Human DNA sequence from clone RP3-383J...	40	8.4
253	emb|AL110114.1|HSJ868P24 Human DNA sequence from clone RP5-868P2...	40	8.4
254	emb|BX033272.1|CNS08XU4 Single read from an extremity of a full-...	40	8.4
255	emb|BX018154.1|CNS08M66 Single read from an extremity of a full-...	40	8.4
256	emb|X95643.1|SCNDKGEN S.coelicolor ndk gene	40	8.4
257	emb|CR555306.1| Azoarcus sp. EbN1 complete genome	40	8.4
258	emb|AL939113.1|SCO939113 Streptomyces coelicolor A3(2) complete ...	40	8.4
259	emb|AL663115.11| Mouse DNA sequence from clone RP23-452C23 on ch...	40	8.4
260	emb|BX323072.9| Zebrafish DNA sequence from clone CH211-271G18, ...	40	8.4
261	gb|AC108451.9| Homo sapiens chromosome 15, clone RP11-379K22, co...	40	8.4
262	gb|AC108450.4| Homo sapiens chromosome 15, clone RP11-153O17, co...	40	8.4
263	emb|BX537282.9| Zebrafish DNA sequence from clone DKEY-90A24 in ...	40	8.4
264	gb|AE005900.1| Caulobacter crescentus CB15 section 226 of 359 of...	40	8.4
265	gb|AC161475.6| Pan troglodytes BAC clone CH251-252J1 from chromo...	40	8.4
266	gb|CP000157.1| Erythrobacter litoralis HTCC2594, complete genome	40	8.4
267	dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ...	40	8.4
268	dbj|AB121062.1| Halomicrobium mukohataei ndk gene for nucleoside...	40	8.4
269	gb|AY107446.1| Zea mays PCO061918 mRNA sequence	40	8.4
270	dbj|AP001891.4| Homo sapiens genomic DNA, chromosome 11q, clone:...	40	8.4
271	gb|DQ114965.1| Moneuplotes crassus clone pEC20 putative nucleosi...	40	8.4
272	gb|AC004663.1|AC004663 Homo sapiens chromosome 19, cosmid R29783...	40	8.4
273	gb|AF058895.1|HSNTCH15 Homo sapiens Notch3 (NOTCH3) gene, exons ...	40	8.4
274	gb|U97669.1|HSU97669 Homo sapiens Notch3 (NOTCH3) mRNA, complete...	40	8.4
275	gb|AC139244.4| Mus musculus BAC clone RP23-324J8 from 16, comple...	40	8.4
276	ref|NM_000435.1| Homo sapiens Notch homolog 3 (Drosophila) (NOTC...	40	8.4

---

>gb|AF271362.1|AF271362 Lolium perenne nucleoside diphosphate kinase (NDPK) mRNA, complete
           cds
          Length = 720

 Score =  690 bits (348), Expect = 0.0
 Identities = 420/444 (94%)
 Strand = Plus / Minus

                                                                       
Query: 171 gcctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccag 230
           ||||| |||||||||||||||||||||||  ||||| | || || |||||||||||||| 
Sbjct: 515 gcctcgtagatccagttgtgctggctgctggtccacccggcgagaccctcagggaaccac 456

                                                                       
Query: 231 agggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccg 290
           ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||
Sbjct: 455 agggcaatctccttcctggcattctcaactgagtcgcttccatggatgacgttcctgccg 396

                                                                       
Query: 291 atgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggcg 350
           ||||| |||||||||||||||||||||||||| ||||| |||||||||||||||||||||
Sbjct: 395 atgtcaacggcgaagtcaccacggatggtgccaggctcagaggccagggggttggtggcg 336

                                                                       
Query: 351 ccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgacgacc 410
           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| 
Sbjct: 335 ccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatggcgacgacg 276

                                                                       
Query: 411 gggccggagacgatgtactccacgagcccagcgaagaagggtttggaggacagatcggcg 470
           |||||||||||||||||||||||||||||  |||||||||| ||||||||||||||||||
Sbjct: 275 gggccggagacgatgtactccacgagcccgccgaagaagggcttggaggacagatcggcg 216

                                                                       
Query: 471 tagtgctgctcggcgaacgacttctccacgttctggagcttcatgcctttaaggtagaag 530
           ||||||||||| ||||||||||||||||||||||||||||| | ||| || |||||||||
Sbjct: 215 tagtgctgctcagcgaacgacttctccacgttctggagcttgaggcccttgaggtagaag 156

                                                                       
Query: 531 cccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggc 590
           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Sbjct: 155 cccttcttctcgaagcggctgatgatctcgccgatgaggcccctctggacgccgtcgggc 96

                                   
Query: 591 ttgatcatgatgaaggtctgctcc 614
           ||||||||||||||||||||||||
Sbjct: 95  ttgatcatgatgaaggtctgctcc 72

---

>ref|NM_197769.1| Oryza sativa (japonica cultivar-group) putative nucleoside
           diphosphate kinase (OSJNBa0027P10.4), mRNA
          Length = 800

 Score =  529 bits (267), Expect = e-147
 Identities = 399/443 (90%)
 Strand = Plus / Minus

                                                                       
Query: 172 cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 231
           |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 520 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 461

                                                                       
Query: 232 gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccga 291
           | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||| |
Sbjct: 460 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgccaa 401

                                                                       
Query: 292 tgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggcgc 351
           ||||||| |||||||| |||||||||||||| ||||| | |||||||||||||||||| |
Sbjct: 400 tgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggttggtggccc 341

                                                                       
Query: 352 caatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgacgaccg 411
           | | || |||||| || |||| ||||||   |||||||||||||||||| |||||||| |
Sbjct: 340 cgacgagcttgcggccggtggagacgacctgcttgccctcccagaccatggcgacgacgg 281

                                                                       
Query: 412 ggccggagacgatgtactccacgagcccagcgaagaagggtttggaggacagatcggcgt 471
           ||||||||||||||||||||||||||||  |||||||||| |||||||||||||||||||
Sbjct: 280 ggccggagacgatgtactccacgagccctccgaagaagggcttggaggacagatcggcgt 221

                                                                       
Query: 472 agtgctgctcggcgaacgacttctccacgttctggagcttcatgcctttaaggtagaagc 531
           |||||| ||||||||||||||||||||||||   |||||||||| |||| |||||||| |
Sbjct: 220 agtgcttctcggcgaacgacttctccacgttgatgagcttcatggctttgaggtagaatc 161

                                                                       
Query: 532 ccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggct 591
           |||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||
Sbjct: 160 ccttcttctcgaagcggccgatgacctcgccaatgaggcccctctggacgccgtcgggct 101

                                  
Query: 592 tgatcatgatgaaggtctgctcc 614
           |||||||||||||||||||||||
Sbjct: 100 tgatcatgatgaaggtctgctcc 78

---

>dbj|AK072751.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023136C24, full
           insert sequence
          Length = 734

 Score =  529 bits (267), Expect = e-147
 Identities = 399/443 (90%)
 Strand = Plus / Minus

                                                                       
Query: 172 cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 231
           |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 532 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 473

                                                                       
Query: 232 gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccga 291
           | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||| |
Sbjct: 472 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgccaa 413

                                                                       
Query: 292 tgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggcgc 351
           ||||||| |||||||| |||||||||||||| ||||| | |||||||||||||||||| |
Sbjct: 412 tgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggttggtggccc 353

                                                                       
Query: 352 caatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgacgaccg 411
           | | || |||||| || |||| ||||||   |||||||||||||||||| |||||||| |
Sbjct: 352 cgacgagcttgcggccggtggagacgacctgcttgccctcccagaccatggcgacgacgg 293

                                                                       
Query: 412 ggccggagacgatgtactccacgagcccagcgaagaagggtttggaggacagatcggcgt 471
           ||||||||||||||||||||||||||||  |||||||||| |||||||||||||||||||
Sbjct: 292 ggccggagacgatgtactccacgagccctccgaagaagggcttggaggacagatcggcgt 233

                                                                       
Query: 472 agtgctgctcggcgaacgacttctccacgttctggagcttcatgcctttaaggtagaagc 531
           |||||| ||||||||||||||||||||||||   |||||||||| |||| |||||||| |
Sbjct: 232 agtgcttctcggcgaacgacttctccacgttgatgagcttcatggctttgaggtagaatc 173

                                                                       
Query: 532 ccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggct 591
           |||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||
Sbjct: 172 ccttcttctcgaagcggccgatgacctcgccaatgaggcccctctggacgccgtcgggct 113

                                  
Query: 592 tgatcatgatgaaggtctgctcc 614
           |||||||||||||||||||||||
Sbjct: 112 tgatcatgatgaaggtctgctcc 90

---

>gb|AY103833.1| Zea mays PCO135636 mRNA sequence
          Length = 929

 Score =  387 bits (195), Expect = e-104
 Identities = 372/431 (86%)
 Strand = Plus / Minus

                                                                       
Query: 177 tagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccagagggcg 236
           |||||||||  |||||||||||||  ||| |||||| ||||||| |||||||| ||||| 
Sbjct: 709 tagatccaggggtgctggctgctctgccaatcagcagggccctcggggaaccacagggca 650

                                                                       
Query: 237 atctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccgatgtcg 296
           ||||||||  | ||| ||||||    ||| |||||||| |||||||||||||| ||||||
Sbjct: 649 atctccttattagcactctcaatgctgtcacttccatgaatgacattcctgccaatgtcg 590

                                                                       
Query: 297 acggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggcgccaatg 356
           || || ||||| |||||||||||||||||||| || ||||||||||||||||||||||||
Sbjct: 589 acagcaaagtcgccacggatggtgccgggctcagaagccagggggttggtggcgccaatg 530

                                                                       
Query: 357 atcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccg 416
           |||||||| ||||| | ||||||||||||||||||||||||||| || || || ||||| 
Sbjct: 529 atcttgcggccagttgtgacgacgctcttgccctcccagaccatggccaccacagggcca 470

                                                                       
Query: 417 gagacgatgtactccacgagcccagcgaagaagggtttggaggacagatcggcgtagtgc 476
           |||| |||||| |||||||| ||   ||||||||| |||||||  |||||||||||||||
Sbjct: 469 gagatgatgtagtccacgaggccctggaagaagggcttggaggcgagatcggcgtagtgc 410

                                                                       
Query: 477 tgctcggcgaacgacttctccacgttctggagcttcatgcctttaaggtagaagcccttc 536
           | ||| || |||||| |||||||||||   ||||||| | | || |||||||||||||||
Sbjct: 409 ttctcagcaaacgacctctccacgttcacaagcttcaaggccttgaggtagaagcccttc 350

                                                                       
Query: 537 ttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggcttgatc 596
           ||||| || |||||||||| ||| || ||||||||||||||||||||||| |||||||||
Sbjct: 349 ttctcaaaacggctgatgatctcaccaatgaggcccctctggacgccgtcaggcttgatc 290

                      
Query: 597 atgatgaaggt 607
           |||||||||||
Sbjct: 289 atgatgaaggt 279

---

>gb|U55019.1|SOU55019 Saccharum officinarum nucleoside diphosphate kinase (SoNDPK1) mRNA,
           complete cds
          Length = 742

 Score =  363 bits (183), Expect = 4e-97
 Identities = 369/431 (85%)
 Strand = Plus / Minus

                                                                       
Query: 177 tagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccagagggcg 236
           |||||||||  |||||||||||||  ||| ||||| |||||||| |||||||| || || 
Sbjct: 498 tagatccaggggtgctggctgctctgccaatcagcgaggccctcggggaaccacagagca 439

                                                                       
Query: 237 atctccttcctggcattctcaactgagtcgcttccatggatgacattcctgccgatgtcg 296
           ||||||||  | ||| ||||||    ||| |||||||||||||||||||| || ||||||
Sbjct: 438 atctccttgttagcactctcaatgctgtcacttccatggatgacattccttccaatgtcg 379

                                                                       
Query: 297 acggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggcgccaatg 356
           || || ||||| ||||||||||| |||||||| ||  ||||||||||||||||||| |||
Sbjct: 378 acagcaaagtcgccacggatggttccgggctcagaaaccagggggttggtggcgccgatg 319

                                                                       
Query: 357 atcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccg 416
           |||||||| ||||| | ||||||||||||||||||||||||||| || || || ||||| 
Sbjct: 318 atcttgcggccagttgtgacgacgctcttgccctcccagaccatggccaccacagggcca 259

                                                                       
Query: 417 gagacgatgtactccacgagcccagcgaagaagggtttggaggacagatcggcgtagtgc 476
           |||| |||||| |||||||| ||   ||||||||| |||||||| ||||| |||||||||
Sbjct: 258 gagatgatgtagtccacgaggccctggaagaagggcttggaggatagatcagcgtagtgc 199

                                                                       
Query: 477 tgctcggcgaacgacttctccacgttctggagcttcatgcctttaaggtagaagcccttc 536
           | ||||||||||||| |||||||||||   ||||||| | | || |||||||||||||||
Sbjct: 198 ttctcggcgaacgacctctccacgttcacaagcttcaaggccttgaggtagaagcccttc 139

                                                                       
Query: 537 ttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggcttgatc 596
           |||||||| ||||| |||| ||| || ||||||||||||||||||||||| |||||||||
Sbjct: 138 ttctcgaaacggctaatgatctcaccaatgaggcccctctggacgccgtcaggcttgatc 79

                      
Query: 597 atgatgaaggt 607
           ||||| |||||
Sbjct: 78  atgataaaggt 68

---

>gb|AC084763.4| Oryza sativa chromosome 10 BAC OSJNBa0027P10 genomic sequence, complete
             sequence
          Length = 141307

 Score =  262 bits (132), Expect = 1e-66
 Identities = 207/232 (89%)
 Strand = Plus / Plus

                                                                         
Query: 284   cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 343
             |||||| |||||||| |||||||| |||||||||||||| ||||| | ||||||||||||
Sbjct: 54738 cctgccaatgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggtt 54797

                                                                         
Query: 344   ggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagc 403
             |||||| || | || |||||| || |||| ||||||   |||||||||||||||||| ||
Sbjct: 54798 ggtggccccgacgagcttgcggccggtggagacgacctgcttgccctcccagaccatggc 54857

                                                                         
Query: 404   gacgaccgggccggagacgatgtactccacgagcccagcgaagaagggtttggaggacag 463
             |||||| |||||||||||||||||||||||||||||  |||||||||| |||||||||||
Sbjct: 54858 gacgacggggccggagacgatgtactccacgagccctccgaagaagggcttggaggacag 54917

                                                                 
Query: 464   atcggcgtagtgctgctcggcgaacgacttctccacgttctggagcttcatg 515
             |||||||||||||| ||||||||||||||||||||||||   ||||||||||
Sbjct: 54918 atcggcgtagtgcttctcggcgaacgacttctccacgttgatgagcttcatg 54969



 Score =  121 bits (61), Expect = 3e-24
 Identities = 103/117 (88%)
 Strand = Plus / Plus

                                                                         
Query: 172   cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 231
             |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 53331 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 53390

                                                                      
Query: 232   gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgc 288
             | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||
Sbjct: 53391 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgc 53447



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 49/49 (100%)
 Strand = Plus / Plus

                                                              
Query: 566   gaggcccctctggacgccgtcgggcttgatcatgatgaaggtctgctcc 614
             |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 55403 gaggcccctctggacgccgtcgggcttgatcatgatgaaggtctgctcc 55451



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                            
Query: 516   cctttaaggtagaagcccttcttctcgaagcggctgatgacctcgcc 562
             ||||| |||||||| ||||||||||||||||||| ||||||||||||
Sbjct: 55264 cctttgaggtagaatcccttcttctcgaagcggccgatgacctcgcc 55310

---

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  262 bits (132), Expect = 1e-66
 Identities = 207/232 (89%)
 Strand = Plus / Plus

                                                                            
Query: 284      cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 343
                |||||| |||||||| |||||||| |||||||||||||| ||||| | ||||||||||||
Sbjct: 21740055 cctgccaatgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggtt 21740114

                                                                            
Query: 344      ggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagc 403
                |||||| || | || |||||| || |||| ||||||   |||||||||||||||||| ||
Sbjct: 21740115 ggtggccccgacgagcttgcggccggtggagacgacctgcttgccctcccagaccatggc 21740174

                                                                            
Query: 404      gacgaccgggccggagacgatgtactccacgagcccagcgaagaagggtttggaggacag 463
                |||||| |||||||||||||||||||||||||||||  |||||||||| |||||||||||
Sbjct: 21740175 gacgacggggccggagacgatgtactccacgagccctccgaagaagggcttggaggacag 21740234

                                                                    
Query: 464      atcggcgtagtgctgctcggcgaacgacttctccacgttctggagcttcatg 515
                |||||||||||||| ||||||||||||||||||||||||   ||||||||||
Sbjct: 21740235 atcggcgtagtgcttctcggcgaacgacttctccacgttgatgagcttcatg 21740286



 Score =  121 bits (61), Expect = 3e-24
 Identities = 103/117 (88%)
 Strand = Plus / Plus

                                                                            
Query: 172      cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 231
                |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 21738648 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 21738707

                                                                         
Query: 232      gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgc 288
                | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||
Sbjct: 21738708 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgc 21738764



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 49/49 (100%)
 Strand = Plus / Plus

                                                                 
Query: 566      gaggcccctctggacgccgtcgggcttgatcatgatgaaggtctgctcc 614
                |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21740720 gaggcccctctggacgccgtcgggcttgatcatgatgaaggtctgctcc 21740768



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                               
Query: 516      cctttaaggtagaagcccttcttctcgaagcggctgatgacctcgcc 562
                ||||| |||||||| ||||||||||||||||||| ||||||||||||
Sbjct: 21740581 cctttgaggtagaatcccttcttctcgaagcggccgatgacctcgcc 21740627

---

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  262 bits (132), Expect = 1e-66
 Identities = 207/232 (89%)
 Strand = Plus / Plus

                                                                            
Query: 284      cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 343
                |||||| |||||||| |||||||| |||||||||||||| ||||| | ||||||||||||
Sbjct: 21751718 cctgccaatgtcgacagcgaagtcgccacggatggtgcccggctcagcggccagggggtt 21751777

                                                                            
Query: 344      ggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagc 403
                |||||| || | || |||||| || |||| ||||||   |||||||||||||||||| ||
Sbjct: 21751778 ggtggccccgacgagcttgcggccggtggagacgacctgcttgccctcccagaccatggc 21751837

                                                                            
Query: 404      gacgaccgggccggagacgatgtactccacgagcccagcgaagaagggtttggaggacag 463
                |||||| |||||||||||||||||||||||||||||  |||||||||| |||||||||||
Sbjct: 21751838 gacgacggggccggagacgatgtactccacgagccctccgaagaagggcttggaggacag 21751897

                                                                    
Query: 464      atcggcgtagtgctgctcggcgaacgacttctccacgttctggagcttcatg 515
                |||||||||||||| ||||||||||||||||||||||||   ||||||||||
Sbjct: 21751898 atcggcgtagtgcttctcggcgaacgacttctccacgttgatgagcttcatg 21751949



 Score =  121 bits (61), Expect = 3e-24
 Identities = 103/117 (88%)
 Strand = Plus / Plus

                                                                            
Query: 172      cctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccaga 231
                |||||||||||||   ||||||| ||||||||||||| || | ||||||||||||||| |
Sbjct: 21750311 cctcatagatccatgggtgctggttgctcctccactcggcgatgccctcagggaaccaca 21750370

                                                                         
Query: 232      gggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgc 288
                | || |||||||||||||| ||||| || ||||||||||| ||||||||||||||||
Sbjct: 21750371 gagcaatctccttcctggcgttctcgaccgagtcgcttccgtggatgacattcctgc 21750427



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 49/49 (100%)
 Strand = Plus / Plus

                                                                 
Query: 566      gaggcccctctggacgccgtcgggcttgatcatgatgaaggtctgctcc 614
                |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 21752383 gaggcccctctggacgccgtcgggcttgatcatgatgaaggtctgctcc 21752431



 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                               
Query: 516      cctttaaggtagaagcccttcttctcgaagcggctgatgacctcgcc 562
                ||||| |||||||| ||||||||||||||||||| ||||||||||||
Sbjct: 21752244 cctttgaggtagaatcccttcttctcgaagcggccgatgacctcgcc 21752290

---

>ref|XM_478187.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 450

 Score =  196 bits (99), Expect = 6e-47
 Identities = 339/419 (80%)
 Strand = Plus / Minus

                                                                       
Query: 196 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 255
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 421 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 362

                                                                       
Query: 256 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 315
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 361 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 302

                                                                       
Query: 316 tggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtccagtggcga 375
           ||||||||||  | |   ||  |||  ||||||| ||||||||| |||| |||||||| |
Sbjct: 301 tggtgccgggggctgcctcccagggcctggtggccccaatgatcctgcggccagtggcaa 242

                                                                       
Query: 376 cgacgctcttgccctcccagaccatagcgacgaccgggccggagacgatgtactccacga 435
           | ||   ||| || ||||| ||||| || ||||| ||||| |||| |||||||||||| |
Sbjct: 241 caacatccttcccttcccaaaccatcgcaacgacggggccagagatgatgtactccacca 182

                                                                       
Query: 436 gcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcggcgaacgacttct 495
            ||||| ||||||||| |||  ||| || ||||| ||||||||||  || || ||| |||
Sbjct: 181 acccagggaagaagggcttgtcggaaaggtcggcatagtgctgctgtgcaaaggacctct 122

                                                                       
Query: 496 ccacgttctggagcttcatgcctttaaggtagaagcccttcttctcgaagcggctgatga 555
           |||| |||  || |||||| ||  | |||||||| || ||||||||||| | ||||||||
Sbjct: 121 ccacattcatgaacttcatccccctcaggtagaatcctttcttctcgaacctgctgatga 62

                                                                      
Query: 556 cctcgccgatgaggcccctctggacgccgtcgggcttgatcatgatgaaggtctgctcc 614
             || || || ||||| |||||||||||||| ||||||||||||||||||| |||||||
Sbjct: 61  tgtctccaatcaggcctctctggacgccgtcaggcttgatcatgatgaaggactgctcc 3

---

>dbj|D16292.1|RICNDKR Oryza sativa mRNA for nucleoside diphosphate kinase, complete cds
          Length = 683

 Score =  196 bits (99), Expect = 6e-47
 Identities = 339/419 (80%)
 Strand = Plus / Minus

                                                                       
Query: 196 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 255
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 442 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 383

                                                                       
Query: 256 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 315
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 382 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 323

                                                                       
Query: 316 tggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtccagtggcga 375
           ||||||||||  | |   ||  |||  ||||||| ||||||||| |||| |||||||| |
Sbjct: 322 tggtgccgggggctgcctcccagggcctggtggccccaatgatcctgcggccagtggcaa 263

                                                                       
Query: 376 cgacgctcttgccctcccagaccatagcgacgaccgggccggagacgatgtactccacga 435
           | ||   ||| || ||||| ||||| || ||||| ||||| |||| |||||||||||| |
Sbjct: 262 caacatccttcccttcccaaaccatcgcaacgacggggccagagatgatgtactccacca 203

                                                                       
Query: 436 gcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcggcgaacgacttct 495
            ||||| ||||||||| |||  ||| || ||||| ||||||||||  || || ||| |||
Sbjct: 202 acccagggaagaagggcttgtcggaaaggtcggcatagtgctgctgtgcaaaggacctct 143

                                                                       
Query: 496 ccacgttctggagcttcatgcctttaaggtagaagcccttcttctcgaagcggctgatga 555
           |||| |||  || |||||| ||  | |||||||| || ||||||||||| | ||||||||
Sbjct: 142 ccacattcatgaacttcatccccctcaggtagaatcctttcttctcgaacctgctgatga 83

                                                                      
Query: 556 cctcgccgatgaggcccctctggacgccgtcgggcttgatcatgatgaaggtctgctcc 614
             || || || ||||| |||||||||||||| ||||||||||||||||||| |||||||
Sbjct: 82  tgtctccaatcaggcctctctggacgccgtcaggcttgatcatgatgaaggactgctcc 24

---

>gb|AY649743.1| Oryza sativa (japonica cultivar-group) nucleoside diphosphate
           kinase 1 mRNA, complete cds
          Length = 683

 Score =  188 bits (95), Expect = 1e-44
 Identities = 338/419 (80%)
 Strand = Plus / Minus

                                                                       
Query: 196 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 255
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 421 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 362

                                                                       
Query: 256 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 315
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 361 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 302

                                                                       
Query: 316 tggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtccagtggcga 375
           ||||||||||  | |   ||  |||  ||||||| ||||||||| |||| |||||||| |
Sbjct: 301 tggtgccgggggctgcctcccagggcctggtggccccaatgatcctgcggccagtggcaa 242

                                                                       
Query: 376 cgacgctcttgccctcccagaccatagcgacgaccgggccggagacgatgtactccacga 435
           | ||   ||| || ||||| ||||| || ||||| ||||| |||| |||||||||||| |
Sbjct: 241 caacatccttcccttcccaaaccatcgcaacgacggggccagagatgatgtactccacca 182

                                                                       
Query: 436 gcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcggcgaacgacttct 495
            ||||| ||||||||| |||  ||| || ||||| ||||||||||  || || ||| |||
Sbjct: 181 acccagggaagaagggcttgtcggaaaggtcggcatagtgctgctgtgcaaaggacctct 122

                                                                       
Query: 496 ccacgttctggagcttcatgcctttaaggtagaagcccttcttctcgaagcggctgatga 555
           |||| |||  || |||||| ||  | ||| |||| || ||||||||||| | ||||||||
Sbjct: 121 ccacattcatgaacttcatccccctcaggaagaatcctttcttctcgaacctgctgatga 62

                                                                      
Query: 556 cctcgccgatgaggcccctctggacgccgtcgggcttgatcatgatgaaggtctgctcc 614
             || || || ||||| |||||||||||||| ||||||||||||||||||| |||||||
Sbjct: 61  tgtctccaatcaggcctctctggacgccgtcaggcttgatcatgatgaaggactgctcc 3

---

>dbj|AK121796.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033095O19, full
           insert sequence
          Length = 866

 Score =  188 bits (95), Expect = 1e-44
 Identities = 332/411 (80%)
 Strand = Plus / Minus

                                                                       
Query: 196 tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 255
           |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 540 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 481

                                                                       
Query: 256 caactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacgga 315
           | || |||||||| |||||||||||||||||||| |  || |||||  ||||| ||||||
Sbjct: 480 ccacggagtcgctcccatggatgacattcctgccaacttccacggcatagtcagcacgga 421

                                                                       
Query: 316 tggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtccagtggcga 375
           ||||||||||  | |   ||  |||  ||||||| ||||||||| |||| |||||||| |
Sbjct: 420 tggtgccgggggctgcctcccagggcctggtggccccaatgatcctgcggccagtggcaa 361

                                                                       
Query: 376 cgacgctcttgccctcccagaccatagcgacgaccgggccggagacgatgtactccacga 435
           | ||   ||| || ||||| ||||| || ||||| ||||| |||| |||||||||||| |
Sbjct: 360 caacatccttcccttcccaaaccatcgcaacgacggggccagagatgatgtactccacca 301

                                                                       
Query: 436 gcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcggcgaacgacttct 495
            ||||| ||||||||| |||  ||| || ||||| ||||||||||  || || ||| |||
Sbjct: 300 acccagggaagaagggcttgtcggaaaggtcggcatagtgctgctgtgcaaaggacctct 241

                                                                       
Query: 496 ccacgttctggagcttcatgcctttaaggtagaagcccttcttctcgaagcggctgatga 555
           |||| |||  || |||||| ||  | |||||||| || ||||||||||| | ||||||||
Sbjct: 240 ccacattcatgaacttcatccccctcaggtagaatcctttcttctcgaacctgctgatga 181

                                                              
Query: 556 cctcgccgatgaggcccctctggacgccgtcgggcttgatcatgatgaagg 606
             || || || ||||| |||||||||||||| |||||||||||||||||||
Sbjct: 180 tgtctccaatcaggcctctctggacgccgtcaggcttgatcatgatgaagg 130

---

>gb|AY104578.1| Zea mays PCO113042 mRNA sequence
          Length = 943

 Score =  174 bits (88), Expect = 2e-40
 Identities = 226/272 (83%)
 Strand = Plus / Minus

                                                                       
Query: 343 tggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatag 402
           ||||||| ||||||||| |||| |||||    ||||||  ||| |||||||| ||||| |
Sbjct: 451 tggtggccccaatgatcctgcggccagtcaacacgacgtccttcccctcccacaccatcg 392

                                                                       
Query: 403 cgacgaccgggccggagacgatgtactccacgagcccagcgaagaagggtttggaggaca 462
           | || || |||||||| | |||||||||||| | ||| | |||||| || |||  ||| |
Sbjct: 391 ccaccacggggccggaaatgatgtactccaccaacccggggaagaaaggcttgtcggaaa 332

                                                                       
Query: 463 gatcggcgtagtgctgctcggcgaacgacttctccacgttctggagcttcatgcctttaa 522
           | || |||||||||||||  ||||| ||| |||||||||||  || |||||| || || |
Sbjct: 331 ggtcagcgtagtgctgctgcgcgaaggacctctccacgttcatgaacttcatccccttga 272

                                                                       
Query: 523 ggtagaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgc 582
           ||||||| || |||||||||||||| |||||||  || ||||| ||||||| ||||||||
Sbjct: 271 ggtagaaccctttcttctcgaagcgactgatgatgtccccgatcaggccccgctggacgc 212

                                           
Query: 583 cgtcgggcttgatcatgatgaaggtctgctcc 614
           ||||||||||||||||||||||||||||||||
Sbjct: 211 cgtcgggcttgatcatgatgaaggtctgctcc 180



 Score =  101 bits (51), Expect = 3e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 278
           |||||||||||||| |||||||||||| |  | ||||| || ||||||||||||||||||
Sbjct: 575 tcagggaaccagagagcgatctccttcttcccgttctccacggagtcgcttccatggatg 516

                                                          
Query: 279 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccggg 325
           |||||||||||||  || |||||| |||| ||||| ||||| |||||
Sbjct: 515 acattcctgccgacttccacggcgtagtccccacgaatggtaccggg 469

---

>gb|DQ097723.1| Arachis hypogaea nucleoside diphosphate kinase I mRNA, complete cds
          Length = 573

 Score =  119 bits (60), Expect = 1e-23
 Identities = 159/192 (82%)
 Strand = Plus / Minus

                                                                       
Query: 209 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 268
           |||| |||||||||||||||| |  ||||| |||||  ||||| ||||||| ||||||||
Sbjct: 503 agcagggccctcagggaaccacaatgcgatttccttggtggcactctcaacagagtcgct 444

                                                                       
Query: 269 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctc 328
           ||| ||||| |||||||| || ||||| | |||||||||||||||||| || || |||||
Sbjct: 443 tccgtggatcacattccttccaatgtcaatggcgaagtcaccacggatagttccaggctc 384

                                                                       
Query: 329 ggaggccagggggttggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgcc 388
            || |||| |||||| || || ||||| | ||| || ||||| ||||| || |  |||||
Sbjct: 383 agatgccaaggggtttgttgctccaatcaactttcggccagtagcgacaacacctttgcc 324

                       
Query: 389 ctcccagaccat 400
           ||||||||||||
Sbjct: 323 ctcccagaccat 312

---

>gb|AF480463.1| Musa acuminata nucleoside diphosphate kinase mRNA, partial cds
          Length = 595

 Score =  117 bits (59), Expect = 4e-23
 Identities = 185/227 (81%)
 Strand = Plus / Minus

                                                                       
Query: 261 gagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtg 320
           |||||||||||||| ||||||||||||||||| ||||  || | ||| || |||||||||
Sbjct: 267 gagtcgcttccatgaatgacattcctgccgatctcgatcgcaaggtccccgcggatggtg 208

                                                                       
Query: 321 ccgggctcggaggccagggggttggtggcgccaatgatcttgcgtccagtggcgacgacg 380
           |||||  ||||| |    |||||||||||||| ||||||||||| |||||| | || |||
Sbjct: 207 ccgggggcggagtcagccgggttggtggcgccgatgatcttgcgaccagtgacaaccacg 148

                                                                       
Query: 381 ctcttgccctcccagaccatagcgacgaccgggccggagacgatgtactccacgagccca 440
            |||| ||| |||| ||||| ||||| || || || |||| |||||||||||| || || 
Sbjct: 147 ttcttccccgcccacaccatcgcgaccacgggacccgagatgatgtactccaccagtccc 88

                                                          
Query: 441 gcgaagaagggtttggaggacagatcggcgtagtgctgctcggcgaa 487
           || ||||| || || |  || || ||||||||||||| |||||||||
Sbjct: 87  gcaaagaaaggcttcgcagagaggtcggcgtagtgcttctcggcgaa 41

---

>gb|AY389630.1| Hyacinthus orientalis nucleoside diphosphate kinase mRNA, partial
           cds
          Length = 679

 Score =  103 bits (52), Expect = 7e-19
 Identities = 148/180 (82%)
 Strand = Plus / Minus

                                                                       
Query: 435 agcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcggcgaacgacttc 494
           |||||| ||||||||||||| |||||||| ||  | ||||||| |||||| || ||   |
Sbjct: 215 agcccaccgaagaagggttttgaggacaggtcctcatagtgcttctcggcaaaagagcgc 156

                                                                       
Query: 495 tccacgttctggagcttcatgcctttaaggtagaagcccttcttctcgaagcggctgatg 554
           |||||| |   |||||||||  |||| |||||||| ||||||||||| || || || |||
Sbjct: 155 tccacggtgatgagcttcattgctttcaggtagaaacccttcttctcaaatcgactaatg 96

                                                                       
Query: 555 acctcgccgatgaggcccctctggacgccgtcgggcttgatcatgatgaaggtctgctcc 614
           | |||||| |  ||||| ||||| ||||| ||||||||||||||||| ||||||||||||
Sbjct: 95  atctcgcccaccaggcctctctgaacgccatcgggcttgatcatgataaaggtctgctcc 36



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                       
Query: 215 gccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatg 274
           |||||| |||||||| ||  | ||||||||||| ||| ||||||| | |||||| |||||
Sbjct: 435 gccctctgggaaccacagcccaatctccttcctcgcactctcaaccgcgtcgctcccatg 376

---

>dbj|D10659.1|SPINDPKINI Spinach mRNA for nucleoside diphosphate kinase I, complete cds
          Length = 828

 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 113/134 (84%)
 Strand = Plus / Minus

                                                                       
Query: 270 ccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcg 329
           |||||||||||||| ||||| ||||||| |||||| |||||||||||||| || ||||| 
Sbjct: 380 ccatggatgacatttctgccaatgtcgatggcgaaatcaccacggatggttcctggctct 321

                                                                       
Query: 330 gaggccagggggttggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccc 389
           || || || ||||||||||| ||||||| ||| | ||| || || || || | ||| |||
Sbjct: 320 gaagcaagagggttggtggctccaatgagcttccttccggtagcaacaactcccttaccc 261

                         
Query: 390 tcccagaccatagc 403
           ||||||||||||||
Sbjct: 260 tcccagaccatagc 247



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 570 cccctctggacgccgtcgggcttgatcatgatgaaggtctgctcc 614
           ||||| ||||| || |||||||||||||||||||| || ||||||
Sbjct: 80  cccctttggacaccatcgggcttgatcatgatgaaagtttgctcc 36

---

>gb|BT013034.1| Lycopersicon esculentum clone 114282R, mRNA sequence
          Length = 727

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 151/185 (81%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 278
           ||||||||||| || |||||||||||||| ||| ||||||| |  || ||||||||||||
Sbjct: 451 tcagggaaccaaagagcgatctccttcctagcactctcaacagcatcacttccatggatg 392

                                                                       
Query: 279 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 338
           ||||||||||| ||||| |  || || ||||||||||| || || |   | ||  ||| |
Sbjct: 391 acattcctgccaatgtcaatagcaaaatcaccacggatagttccagcagcagactccaag 332

                                                                       
Query: 339 gggttggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagacc 398
           |||||||| || ||||||||||| |  |||||||| || || | ||| ||||||||||||
Sbjct: 331 gggttggttgctccaatgatcttcctgccagtggcaactacacccttaccctcccagacc 272

                
Query: 399 atagc 403
           |||||
Sbjct: 271 atagc 267



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 588 ggcttgatcatgatgaaggtctgctcc 614
           ||||||||||||||||| |||||||||
Sbjct: 82  ggcttgatcatgatgaaagtctgctcc 56

---

>emb|X75324.1|LERNADNK L.esculentum (Ailsa Craig) mRNA for nucleoside diphosphate kinase
          Length = 590

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 151/185 (81%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 278
           ||||||||||| || |||||||||||||| ||| ||||||| |  || ||||||||||||
Sbjct: 388 tcagggaaccaaagagcgatctccttcctagcactctcaacagcatcacttccatggatg 329

                                                                       
Query: 279 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 338
           ||||||||||| ||||| |  || || ||||||||||| || || |   | ||  ||| |
Sbjct: 328 acattcctgccaatgtcaatagcaaaatcaccacggatagttccagcagcagactccaag 269

                                                                       
Query: 339 gggttggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagacc 398
           |||||||| || ||||||||||| |  |||||||| || || | ||| ||||||||||||
Sbjct: 268 gggttggttgctccaatgatcttcctgccagtggcaactacacccttaccctcccagacc 209

                
Query: 399 atagc 403
           |||||
Sbjct: 208 atagc 204

---

>ref|XM_323541.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE KINASE (NDK) (NDP
           KINASE) (NCU04202.1) partial mRNA
          Length = 459

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 224 gaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatgacatt 283
           |||||||||||| ||||||||| |||| ||||| || ||||||   || |||  ||| ||
Sbjct: 402 gaaccagagggcaatctccttcttggcgttctcgacggagtcggagccgtggcagacgtt 343

                                                                       
Query: 284 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 343
            | ||| |||||||  || |||||||||||||||||||||||  ||||||| ||||||||
Sbjct: 342 gcggcccatgtcgagagcaaagtcaccacggatggtgccgggagcggaggcgagggggtt 283

                 
Query: 344 ggtggc 349
           ||||||
Sbjct: 282 ggtggc 277

---

>ref|XM_956069.1| Neurospora crassa OR74A NUCLEOSIDE DIPHOSPHATE KINASE (NDK) (NDP
           KINASE) (NCU04202.1) partial mRNA
          Length = 459

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 105/126 (83%)
 Strand = Plus / Minus

                                                                       
Query: 224 gaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatgacatt 283
           |||||||||||| ||||||||| |||| ||||| || ||||||   || |||  ||| ||
Sbjct: 402 gaaccagagggcaatctccttcttggcgttctcgacggagtcggagccgtggcagacgtt 343

                                                                       
Query: 284 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 343
            | ||| |||||||  || |||||||||||||||||||||||  ||||||| ||||||||
Sbjct: 342 gcggcccatgtcgagagcaaagtcaccacggatggtgccgggagcggaggcgagggggtt 283

                 
Query: 344 ggtggc 349
           ||||||
Sbjct: 282 ggtggc 277

---

>ref|XM_676393.1| Aspergillus nidulans FGSC A4 nucleoside diphosphate kinase
           (AN8216.2), mRNA
          Length = 486

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 287 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggt 346
           ||||| |||||  ||||||||||||||||||||||||||  ||||||| |||||||||||
Sbjct: 360 gccgacgtcgatagcgaagtcaccacggatggtgccgggggcggaggcaagggggttggt 301

                                                                       
Query: 347 ggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgac 406
           ||| || | |||  |||| || ||   |||||||  ||| |||||||||||||| |||||
Sbjct: 300 ggcaccgaggatggtgcggccggtcttgacgacgtccttaccctcccagaccatggcgac 241

             
Query: 407 ga 408
           ||
Sbjct: 240 ga 239

---

>ref|XM_570963.1| Cryptococcus neoformans var. neoformans JEC21
           nucleoside-diphosphate kinase (CNE02610) partial mRNA
          Length = 530

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                       
Query: 536 cttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggcttgat 595
           ||||||||| |||| ||| | |||||||| |||||| | |||||||||||| ||||||||
Sbjct: 105 cttctcgaatcggccgataatctcgccgacgaggcctcgctggacgccgtcaggcttgat 46

                             
Query: 596 catgatgaaggtctgctc 613
           ||||||| ||||||||||
Sbjct: 45  catgatgtaggtctgctc 28



 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 30/30 (100%)
 Strand = Plus / Minus

                                         
Query: 216 ccctcagggaaccagagggcgatctccttc 245
           ||||||||||||||||||||||||||||||
Sbjct: 425 ccctcagggaaccagagggcgatctccttc 396

---

>gb|AY057453.1| Emericella nidulans nucleoside diphosphate kinase (swoH) gene,
           complete cds
          Length = 776

 Score = 83.8 bits (42), Expect = 6e-13
 Identities = 102/122 (83%)
 Strand = Plus / Minus

                                                                       
Query: 287 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggt 346
           ||||| |||||  ||||||||||||||||||||||||||  ||||||| |||||||||||
Sbjct: 650 gccgacgtcgatagcgaagtcaccacggatggtgccgggggcggaggcaagggggttggt 591

                                                                       
Query: 347 ggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgac 406
           ||| || | |||  |||| || ||   |||||||  ||| |||||||||||||| |||||
Sbjct: 590 ggcaccgaggatggtgcggccggtcttgacgacgtccttaccctcccagaccatggcgac 531

             
Query: 407 ga 408
           ||
Sbjct: 530 ga 529

---

>dbj|AB071599.1| Brassica rapa Bc-NDPK1 mRNA for nucleoside diphosphate kinase 1,
           complete cds
          Length = 640

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 531 cccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggc 590
           |||||||||||||| | || |||||  || ||||  || |||||||||||||||||||||
Sbjct: 110 cccttcttctcgaatctgcagatgatttcaccgaccagacccctctggacgccgtcgggc 51

                                   
Query: 591 ttgatcatgatgaaggtctgctcc 614
           |||||||||||||| || ||||||
Sbjct: 50  ttgatcatgatgaaagtttgctcc 27



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 253 tctcaactgagtcgcttccatggatgacattcctgccgatgtc 295
           |||| ||||||||||| |||||||| || |||||||| |||||
Sbjct: 388 tctccactgagtcgctcccatggatcacgttcctgccaatgtc 346

---

>gb|AF072289.1|AF072289 Mesembryanthemum crystallinum nucleoside diphosphate kinase I (NDK
           I) mRNA, complete cds
          Length = 724

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 151/188 (80%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatgg 275
           |||||||||||||| ||||| ||||| ||  | ||| | ||||| |  |||||||| |||
Sbjct: 432 ccctcagggaaccacagggcaatctcttttgttgcactttcaacagcatcgcttccgtgg 373

                                                                       
Query: 276 atgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggcc 335
           || || || ||||| ||||||| ||| || || ||||||||||| || ||||| || || 
Sbjct: 372 ataacgtttctgccaatgtcgatggcaaaatctccacggatggtaccaggctctgaagct 313

                                                                       
Query: 336 agggggttggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccag 395
           || ||||||||||| ||||||||||| |  |||||    || || | |||||||||||||
Sbjct: 312 agagggttggtggctccaatgatctttctaccagtaagaacaacacccttgccctcccag 253

                   
Query: 396 accatagc 403
           ||||||||
Sbjct: 252 accatagc 245



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 526 agaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgt 585
           |||| ||||||||||| || | |||||||| ||| || |  || || |||||||| || |
Sbjct: 122 agaaacccttcttctcaaatctgctgatgatctcaccaaccagtcctctctggactccat 63

                                        
Query: 586 cgggcttgatcatgatgaaggtctgctcc 614
           | |||||||||||||| || |||||||||
Sbjct: 62  caggcttgatcatgataaatgtctgctcc 34

---

>dbj|AB072238.1| Brassica rapa mRNA for NDPK I, complete cds
          Length = 628

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 531 cccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggc 590
           |||||||||||||| | || |||||  || ||||  || |||||||||||||||||||||
Sbjct: 116 cccttcttctcgaatctgcagatgatttcaccgaccagacccctctggacgccgtcgggc 57

                                   
Query: 591 ttgatcatgatgaaggtctgctcc 614
           |||||||||||||| || ||||||
Sbjct: 56  ttgatcatgatgaaagtttgctcc 33



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                      
Query: 253 tctcaactgagtcgcttccatggatgacattcctgccgatgtc 295
           |||| ||||||||||| |||||||| || |||||||| |||||
Sbjct: 394 tctccactgagtcgctcccatggatcacgttcctgccaatgtc 352

---

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                            
Query: 196      tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 255
                |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 18281744 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 18281803

                                               
Query: 256      caactgagtcgcttccatggatgacattcct 286
                | || |||||||| |||||||||||||||||
Sbjct: 18281804 ccacggagtcgctcccatggatgacattcct 18281834



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 113/138 (81%)
 Strand = Plus / Plus

                                                                            
Query: 343      tggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatag 402
                ||||||| ||||||||| |||| |||||||| || ||   ||| || ||||| ||||| |
Sbjct: 18282332 tggtggccccaatgatcctgcggccagtggcaacaacatccttcccttcccaaaccatcg 18282391

                                                                            
Query: 403      cgacgaccgggccggagacgatgtactccacgagcccagcgaagaagggtttggaggaca 462
                | ||||| ||||| |||| |||||||||||| | ||||| ||||||||| |||  ||| |
Sbjct: 18282392 caacgacggggccagagatgatgtactccaccaacccagggaagaagggcttgtcggaaa 18282451

                                  
Query: 463      gatcggcgtagtgctgct 480
                | ||||| ||||||||||
Sbjct: 18282452 ggtcggcatagtgctgct 18282469



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                                
Query: 567      aggcccctctggacgccgtcgggcttgatcatgatgaaggtctgctcc 614
                ||||| |||||||||||||| ||||||||||||||||||| |||||||
Sbjct: 18283734 aggcctctctggacgccgtcaggcttgatcatgatgaaggactgctcc 18283781

---

>dbj|D10431.1|RICT164 Oryza sativa mRNA for NDP kinase (T164 gene), partial sequence
          Length = 255

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 159/198 (80%), Gaps = 1/198 (0%)
 Strand = Plus / Minus

                                                                       
Query: 417 gagacgatgtactccacgagcccagcgaagaagggtttggaggacagatcggcgtagtgc 476
           |||| |||||||||||| | |||||  |||||||| |||  ||| || ||||| ||||||
Sbjct: 254 gagatgatgtactccaccaacccaggnaagaagggcttgtcggaaaggtcggcatagtgc 195

                                                                       
Query: 477 tgctcggcgaacgacttctccacgttctggagcttcatgcctttaaggtagaagcccttc 536
            |||  || || ||| ||||||| |||  || |||||| ||  | |||||||| || |||
Sbjct: 194 -gctgtgcaaaggacctctccacattcatgaacttcatccccctcaggtagaatcctttc 136

                                                                       
Query: 537 ttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggcttgatc 596
           |||||||| | ||||||||  || || || ||||| ||||  |||||||| |||||||||
Sbjct: 135 ttctcgaacctgctgatgatgtctccaatcaggcctctctccacgccgtcaggcttgatc 76

                             
Query: 597 atgatgaaggtctgctcc 614
           |||||||||| |||||||
Sbjct: 75  atgatgaaggactgctcc 58

---

>dbj|AP004051.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1218_C12
          Length = 105861

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                         
Query: 196   tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 255
             |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 84987 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 85046

                                            
Query: 256   caactgagtcgcttccatggatgacattcct 286
             | || |||||||| |||||||||||||||||
Sbjct: 85047 ccacggagtcgctcccatggatgacattcct 85077



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 113/138 (81%)
 Strand = Plus / Plus

                                                                         
Query: 343   tggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatag 402
             ||||||| ||||||||| |||| |||||||| || ||   ||| || ||||| ||||| |
Sbjct: 85575 tggtggccccaatgatcctgcggccagtggcaacaacatccttcccttcccaaaccatcg 85634

                                                                         
Query: 403   cgacgaccgggccggagacgatgtactccacgagcccagcgaagaagggtttggaggaca 462
             | ||||| ||||| |||| |||||||||||| | ||||| ||||||||| |||  ||| |
Sbjct: 85635 caacgacggggccagagatgatgtactccaccaacccagggaagaagggcttgtcggaaa 85694

                               
Query: 463   gatcggcgtagtgctgct 480
             | ||||| ||||||||||
Sbjct: 85695 ggtcggcatagtgctgct 85712



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                             
Query: 567   aggcccctctggacgccgtcgggcttgatcatgatgaaggtctgctcc 614
             ||||| |||||||||||||| ||||||||||||||||||| |||||||
Sbjct: 86977 aggcctctctggacgccgtcaggcttgatcatgatgaaggactgctcc 87024

---

>dbj|AP004266.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0038F10
          Length = 153929

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 78/91 (85%)
 Strand = Plus / Plus

                                                                         
Query: 196   tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcattct 255
             |||||||||||||||| |  || |||||||||||||| |||||||||||| |  | || |
Sbjct: 11239 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttcttcccgttgt 11298

                                            
Query: 256   caactgagtcgcttccatggatgacattcct 286
             | || |||||||| |||||||||||||||||
Sbjct: 11299 ccacggagtcgctcccatggatgacattcct 11329



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 113/138 (81%)
 Strand = Plus / Plus

                                                                         
Query: 343   tggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatag 402
             ||||||| ||||||||| |||| |||||||| || ||   ||| || ||||| ||||| |
Sbjct: 11827 tggtggccccaatgatcctgcggccagtggcaacaacatccttcccttcccaaaccatcg 11886

                                                                         
Query: 403   cgacgaccgggccggagacgatgtactccacgagcccagcgaagaagggtttggaggaca 462
             | ||||| ||||| |||| |||||||||||| | ||||| ||||||||| |||  ||| |
Sbjct: 11887 caacgacggggccagagatgatgtactccaccaacccagggaagaagggcttgtcggaaa 11946

                               
Query: 463   gatcggcgtagtgctgct 480
             | ||||| ||||||||||
Sbjct: 11947 ggtcggcatagtgctgct 11964



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 45/48 (93%)
 Strand = Plus / Plus

                                                             
Query: 567   aggcccctctggacgccgtcgggcttgatcatgatgaaggtctgctcc 614
             ||||| |||||||||||||| ||||||||||||||||||| |||||||
Sbjct: 13229 aggcctctctggacgccgtcaggcttgatcatgatgaaggactgctcc 13276

---

>ref|XM_742902.1| Aspergillus fumigatus Af293 nucleoside diphosphate kinase
           (Afu5g03490) partial mRNA
          Length = 462

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 287 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggt 346
           ||||| |||||  ||||||||||||||||||||||||||  ||||||| || ||||||||
Sbjct: 336 gccgacgtcgatagcgaagtcaccacggatggtgccgggagcggaggcaagagggttggt 277

              
Query: 347 ggc 349
           |||
Sbjct: 276 ggc 274

---

>emb|AL807368.1|NC62D11 Neurospora crassa DNA linkage group V cosmid contig 62D11
          Length = 102165

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 44/47 (93%)
 Strand = Plus / Plus

                                                            
Query: 303   aagtcaccacggatggtgccgggctcggaggccagggggttggtggc 349
             |||||||||||||||||||||||  ||||||| ||||||||||||||
Sbjct: 14775 aagtcaccacggatggtgccgggagcggaggcgagggggttggtggc 14821



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                        
Query: 224   gaaccagagggcgatctccttcctggcattctcaactgagtcg 266
             |||||||||||| ||||||||| |||| ||||| || ||||||
Sbjct: 14630 gaaccagagggcaatctccttcttggcgttctcgacggagtcg 14672

---

>emb|AL807373.1|NC21D9 Neurospora crassa DNA linkage group V cosmid contig 21D9
          Length = 55380

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                           
Query: 303  aagtcaccacggatggtgccgggctcggaggccagggggttggtggc 349
            |||||||||||||||||||||||  ||||||| ||||||||||||||
Sbjct: 4628 aagtcaccacggatggtgccgggagcggaggcgagggggttggtggc 4582



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 224  gaaccagagggcgatctccttcctggcattctcaactgagtcg 266
            |||||||||||| ||||||||| |||| ||||| || ||||||
Sbjct: 4773 gaaccagagggcaatctccttcttggcgttctcgacggagtcg 4731

---

>dbj|D88148.1| Neurospora crassa mRNA for nucleoside diphosphate kinase, complete
            cds
          Length = 4240

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 44/47 (93%)
 Strand = Plus / Minus

                                                           
Query: 303  aagtcaccacggatggtgccgggctcggaggccagggggttggtggc 349
            |||||||||||||||||||||||  ||||||| ||||||||||||||
Sbjct: 3268 aagtcaccacggatggtgccgggagcggaggcgagggggttggtggc 3222



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 38/43 (88%)
 Strand = Plus / Minus

                                                       
Query: 224  gaaccagagggcgatctccttcctggcattctcaactgagtcg 266
            |||||||||||| ||||||||| |||| ||||| || ||||||
Sbjct: 3413 gaaccagagggcaatctccttcttggcgttctcgacggagtcg 3371

---

>gb|AY324230.1| Aspergillus fumigatus nucleoside diphosphate kinase (NDK) gene,
           complete cds
          Length = 928

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 300 gcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 349
           ||||||||||||||||||||||||||  ||||||| || |||||||||||
Sbjct: 737 gcgaagtcaccacggatggtgccgggagcggaggcaagagggttggtggc 688



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 224 gaaccagagggcgatctccttcctggcattctc 256
           |||||||||||| ||||||||| |||| |||||
Sbjct: 865 gaaccagagggcaatctccttcttggcgttctc 833

---

>gb|U50150.1|GMU50150 Glycine max nucleoside diphosphate kinase mRNA, complete cds
          Length = 771

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 76/90 (84%)
 Strand = Plus / Minus

                                                                       
Query: 524 gtagaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgcc 583
           |||||| || |||||||| || | ||| |||| |||||| || ||||| || ||||||||
Sbjct: 130 gtagaaacctttcttctcaaatctgctaatgatctcgccaataaggcctctttggacgcc 71

                                         
Query: 584 gtcgggcttgatcatgatgaaggtctgctc 613
            || |||||||||||||||||||| |||||
Sbjct: 70  atcaggcttgatcatgatgaaggtttgctc 41



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 88/108 (81%)
 Strand = Plus / Minus

                                                                       
Query: 209 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 268
           |||| |||||||||||||||| |  || || |||||  | ||| | |||||||  || ||
Sbjct: 445 agcagggccctcagggaaccacaatgcaatttccttgttagcactttcaactgcatcact 386

                                                           
Query: 269 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 316
           ||||||||| |||||||| || ||||| | ||| ||||||||||||||
Sbjct: 385 tccatggataacattccttccaatgtcaatggcaaagtcaccacggat 338

---

>gb|U72142.1|HAU72142 Helianthus annuus nucleoside diphosphate kinase mRNA, complete cds
          Length = 653

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 174/217 (80%), Gaps = 4/217 (1%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatgg 275
           |||||||||||||| ||  | ||||||||| | ||| | ||||| |  || |||||||| 
Sbjct: 428 ccctcagggaaccacagaccaatctccttctttgcactttcaacagcatcacttccatga 369

                                                                       
Query: 276 atgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggc- 334
           || ||||| ||||| |||||||  || || ||||||||||||||||| ||   |||| | 
Sbjct: 368 atcacatttctgccaatgtcgattgcaaaatcaccacggatggtgccagga--ggagact 311

                                                                       
Query: 335 cagg-gggttggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctccc 393
           |||  ||||| ||||| ||||||||||||||||| ||||  || ||  ||||||| ||||
Sbjct: 310 cagcagggtttgtggcaccaatgatcttgcgtccggtggtaaccacattcttgccttccc 251

                                                
Query: 394 agaccatagcgacgaccgggccggagacgatgtactc 430
           | ||||| || ||||| || ||||||| |||||||||
Sbjct: 250 aaaccatggcaacgacgggtccggagatgatgtactc 214

---

>gb|DQ440055.1| Aedes aegypti clone AE-307 nucleoside diphosphate kinase mRNA,
           complete cds
          Length = 507

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 527 gaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
           |||||||||||  ||||||||  |||||| || ||||| ||| |||| |||||| |||||
Sbjct: 147 gaagcccttctgttcgaagcgcttgatgatcttgccgacgagtccccgctggacaccgtc 88

                                
Query: 587 gggcttgatcatgatgaaggt 607
            ||||||| ||||||||||||
Sbjct: 87  cggcttgaccatgatgaaggt 67

---

>emb|CR938691.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YA19AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 698

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 527 gaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
           |||||||||||  ||||||||  |||||| || ||||| ||| |||| |||||| |||||
Sbjct: 168 gaagcccttctgttcgaagcgcttgatgatcttgccgacgagtccccgctggacaccgtc 109

                                
Query: 587 gggcttgatcatgatgaaggt 607
            ||||||| ||||||||||||
Sbjct: 108 cggcttgaccatgatgaaggt 88

---

>emb|CR938428.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YO21AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 679

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 527 gaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
           |||||||||||  ||||||||  |||||| || ||||| ||| |||| |||||| |||||
Sbjct: 154 gaagcccttctgttcgaagcgcttgatgatcttgccgacgagtccccgctggacaccgtc 95

                                
Query: 587 gggcttgatcatgatgaaggt 607
            ||||||| ||||||||||||
Sbjct: 94  cggcttgaccatgatgaaggt 74

---

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 57/65 (87%)
 Strand = Plus / Minus

                                                                           
Query: 531     cccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggc 590
               ||||||| ||||||||||| ||||| ||  ||||||| |||| ||| |||||||||||||
Sbjct: 1868765 cccttctcctcgaagcggccgatgatcttcccgatgatgcccttctcgacgccgtcgggc 1868706

                    
Query: 591     ttgat 595
               |||||
Sbjct: 1868705 ttgat 1868701

---

>gb|AF108881.1|AF108881 Capsicum annuum nucleoside diphosphate kinase mRNA, complete cds
          Length = 755

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 135/169 (79%)
 Strand = Plus / Minus

                                                                       
Query: 193 ggctgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcat 252
           ||||||||  |||||| ||||  || || |||||||| || || ||||||||||| ||| 
Sbjct: 470 ggctgctctgccactctgcaactccttcggggaaccaaagagcaatctccttccttgcac 411

                                                                       
Query: 253 tctcaactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccac 312
           ||||||| |  || |||||||| |||||||||||||| ||||| |  ||  | |||||||
Sbjct: 410 tctcaacagcatcacttccatgaatgacattcctgccaatgtcaatagcataatcaccac 351

                                                            
Query: 313 ggatggtgccgggctcggaggccagggggttggtggcgccaatgatctt 361
           ||||||| || ||  | ||  ||| ||||||||| || |||||||||||
Sbjct: 350 ggatggtaccaggagcagattccaaggggttggttgctccaatgatctt 302

---

>ref|NM_117000.2| Arabidopsis thaliana NDPK1; ATP binding / nucleoside diphosphate
           kinase AT4G09320 (NDPK1) mRNA, complete cds
          Length = 700

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 531 cccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggc 590
           ||||||||||| || | || |||||| || |||||||| || |||||||||||||| |||
Sbjct: 170 cccttcttctcaaacctgcagatgacttcaccgatgagtcctctctggacgccgtcaggc 111

                   
Query: 591 ttgatcat 598
           ||||||||
Sbjct: 110 ttgatcat 103



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 278
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 482 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 423

                                                                       
Query: 279 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 338
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 422 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 363

                                  
Query: 339 gggttggtggcgccaatgatctt 361
           |||||||| || |||||||||||
Sbjct: 362 gggttggtagctccaatgatctt 340

---

>emb|X69373.1|ATNDK A.thaliana mRNA for nucleoside diphosphate kinase
          Length = 536

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 531 cccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggc 590
           ||||||||||| || | || |||||| || |||||||| || |||||||||||||| |||
Sbjct: 80  cccttcttctcaaatctgcagatgacttcaccgatgagtcctctctggacgccgtcaggc 21

                   
Query: 591 ttgatcat 598
           ||||||||
Sbjct: 20  ttgatcat 13



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 278
           ||||||||||| |  || |||||||| |||||| |||| || ||||| || || ||||| 
Sbjct: 392 tcagggaaccacaaagcaatctcctttctggcactctcgacagagtcactaccgtggatc 333

                                                                       
Query: 279 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 338
           |||||||| || ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 332 acattccttccaatgtcaatagcaaagtccccacggatagttcccggctcagaagctgct 273

                                  
Query: 339 gggttggtggcgccaatgatctt 361
           |||||||| || |||||||||||
Sbjct: 272 gggttggtagctccaatgatctt 250

---

>gb|AY072518.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 475

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 531 cccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggc 590
           ||||||||||| || | || |||||| || |||||||| || |||||||||||||| |||
Sbjct: 68  cccttcttctcaaacctgcagatgacttcaccgatgagtcctctctggacgccgtcaggc 9

                   
Query: 591 ttgatcat 598
           ||||||||
Sbjct: 8   ttgatcat 1



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 278
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 380 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 321

                                                                       
Query: 279 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 338
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 320 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 261

                                  
Query: 339 gggttggtggcgccaatgatctt 361
           |||||||| || |||||||||||
Sbjct: 260 gggttggtagctccaatgatctt 238

---

>gb|DQ066341.1| Ixodes scapularis isolate IS-6-12-J-cluster-432
           nucleoside-diphosphate kinase mRNA, partial cds
          Length = 513

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 527 gaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
           |||||| |||||||||||||||||||  || |  |||||||| || | ||||||||||||
Sbjct: 150 gaagccgttcttctcgaagcggctgaccactttaccgatgagtccacgctggacgccgtc 91

                   
Query: 587 gggcttga 594
           ||||||||
Sbjct: 90  gggcttga 83

---

>gb|AF370529.1|AF370529 Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 528

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 531 cccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggc 590
           ||||||||||| || | || |||||| || |||||||| || |||||||||||||| |||
Sbjct: 79  cccttcttctcaaacctgcagatgacttcaccgatgagtcctctctggacgccgtcaggc 20

                   
Query: 591 ttgatcat 598
           ||||||||
Sbjct: 19  ttgatcat 12



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 278
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 391 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 332

                                                                       
Query: 279 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 338
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 331 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 272

                                  
Query: 339 gggttggtggcgccaatgatctt 361
           |||||||| || |||||||||||
Sbjct: 271 gggttggtagctccaatgatctt 249

---

>emb|BX827107.1|CNS0A38G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZE03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 518

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 531 cccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggc 590
           ||||||||||| || | || |||||| || |||||||| || |||||||||||||| |||
Sbjct: 81  cccttcttctcaaacctgcagatgacttcaccgatgagtcctctctggacgccgtcaggc 22

                   
Query: 591 ttgatcat 598
           ||||||||
Sbjct: 21  ttgatcat 14



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 278
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 393 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 334

                                                                       
Query: 279 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 338
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 333 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 274

                                  
Query: 339 gggttggtggcgccaatgatctt 361
           |||||||| || |||||||||||
Sbjct: 273 gggttggtagctccaatgatctt 251

---

>emb|BX829087.1|CNS0A2O7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL69ZH05 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 593

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 531 cccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggc 590
           ||||||||||| || | || |||||| || |||||||| || |||||||||||||| |||
Sbjct: 81  cccttcttctcaaacctgcagatgacttcaccgatgagtcctctctggacgccgtcaggc 22

                   
Query: 591 ttgatcat 598
           ||||||||
Sbjct: 21  ttgatcat 14



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 278
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 393 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 334

                                                                       
Query: 279 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 338
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 333 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 274

                                  
Query: 339 gggttggtggcgccaatgatctt 361
           |||||||| || |||||||||||
Sbjct: 273 gggttggtagctccaatgatctt 251

---

>gb|AY089088.1| Arabidopsis thaliana clone 30158 mRNA, complete sequence
          Length = 627

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 531 cccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggc 590
           ||||||||||| || | || |||||| || |||||||| || |||||||||||||| |||
Sbjct: 171 cccttcttctcaaatctgcagatgacttcaccgatgagtcctctctggacgccgtcaggc 112

                   
Query: 591 ttgatcat 598
           ||||||||
Sbjct: 111 ttgatcat 104

---

>gb|AF017641.1|AF017641 Arabidopsis thaliana nucleoside diphosphate kinase type 1 (NDPK1)
           gene, complete cds
          Length = 450

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 531 cccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggc 590
           ||||||||||| || | || |||||| || |||||||| || |||||||||||||| |||
Sbjct: 86  cccttcttctcaaacctgcagatgacttcaccgatgagtcctctctggacgccgtcaggc 27

                   
Query: 591 ttgatcat 598
           ||||||||
Sbjct: 26  ttgatcat 19



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                       
Query: 219 tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 278
           ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 398 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 339

                                                                       
Query: 279 acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 338
           || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 338 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 279

                                  
Query: 339 gggttggtggcgccaatgatctt 361
           |||||||| || |||||||||||
Sbjct: 278 gggttggtagctccaatgatctt 256

---

>gb|DQ157699.1| Solanum chacoense cytosolic nucleoside diphosphate kinase mRNA,
           complete cds
          Length = 753

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 166/211 (78%)
 Strand = Plus / Minus

                                                                       
Query: 193 ggctgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcat 252
           ||||||||  |||||| ||||  || || |||||||| || || ||||||||||| ||| 
Sbjct: 480 ggctgctctgccactctgcaattccttcggggaaccaaagagcaatctccttcctagcac 421

                                                                       
Query: 253 tctcaactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccac 312
           ||||||| |  || |||||||| || ||||||||||| || || |  || || |||||||
Sbjct: 420 tctcaacagcatcacttccatgaataacattcctgccaatatcaatagcaaaatcaccac 361

                                                                       
Query: 313 ggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtccagtgg 372
           ||||||| || |   | ||  ||| ||||||||| || ||||||||||| |  |||||||
Sbjct: 360 ggatggtaccagcagccgactccaaggggttggttgctccaatgatcttcctgccagtgg 301

                                          
Query: 373 cgacgacgctcttgccctcccagaccatagc 403
           | || || | ||| || ||||||||||||||
Sbjct: 300 caactacacccttaccttcccagaccatagc 270



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 576 tggacgccgtcgggcttgatcatgatgaaggtctgctcc 614
           ||||| ||||| ||||||||||||||||| |||||||||
Sbjct: 97  tggacaccgtcaggcttgatcatgatgaaagtctgctcc 59

---

>emb|BX072516.1|CNS09S48 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAD1BH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 605

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 442 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 501

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 502 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 552

---

>emb|BX072515.1|CNS09S47 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAD1BH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 662

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 372 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 313

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 312 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 262



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 106 ctggactccgtcgggcttgatcatgatgaaggt 74

---

>emb|BX063953.1|CNS09LID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 433 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 492

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 493 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 543



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||| ||||||||||||||
Sbjct: 699 ctggactccgtcgggctttatcatgatgaaggt 731

---

>emb|BX051771.1|CNS09C3Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC29BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 372 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 313

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 312 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 262



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 106 ctggactccgtcgggcttgatcatgatgaaggt 74

---

>emb|BX050874.1|CNS09BF2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC27CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 408

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 340 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 281

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 280 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 230



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 73  ctggactccgtcgggcttgatcatgatgaaggt 41

---

>emb|BX048701.1|CNS099QP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24AA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 197 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 138

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 137 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 87

---

>emb|BX044675.1|CNS096MV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC18BH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 793

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 341 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 282

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 281 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 231



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 75  ctggactccgtcgggcttgatcatgatgaaggt 43

---

>emb|BX039425.1|CNS092L1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC1BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 349 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 290

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 289 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 239



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 83  ctggactccgtcgggcttgatcatgatgaaggt 51

---

>emb|BX038905.1|CNS0926L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB3CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 748

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 402 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 343

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 342 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 292



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 136 ctggactccgtcgggcttgatcatgatgaaggt 104

---

>emb|BX038259.1|CNS091ON Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 422 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 481

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 482 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 532



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 688 ctggactccgtcgggcttgatcatgatgaaggt 720

---

>emb|BX038258.1|CNS091OM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 715

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 361 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 302

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 301 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 251



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 95  ctggactccgtcgggcttgatcatgatgaaggt 63

---

>emb|BX038115.1|CNS091KN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB2BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 737

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 372 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 313

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 312 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 262



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 106 ctggactccgtcgggcttgatcatgatgaaggt 74

---

>emb|BX037581.1|CNS0915T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB1AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 703

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 429 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 488

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 489 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 539

---

>emb|BX037580.1|CNS0915S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAB1AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 718

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 372 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 313

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 312 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 262



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 106 ctggactccgtcgggcttgatcatgatgaaggt 74

---

>emb|BX036658.1|CNS090G6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA8DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 313 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 254

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 253 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 203



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 582 ccgtcgggcttgatcatgatgaaggt 607
           ||||||||||||||||||||||||||
Sbjct: 41  ccgtcgggcttgatcatgatgaaggt 16

---

>emb|BX032742.1|CNS08XFE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 203

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 202 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 152

---

>emb|BX031659.1|CNS08WLB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 805

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 400 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 459

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 460 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 510



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 666 ctggactccgtcgggcttgatcatgatgaaggt 698

---

>emb|BX031658.1|CNS08WLA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA47AG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 346 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 287

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 286 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 236



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 80  ctggactccgtcgggcttgatcatgatgaaggt 48

---

>emb|BX025663.1|CNS08RYR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 669

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 425 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 484

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 485 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 535

---

>emb|BX025662.1|CNS08RYQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 581

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 363 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 304

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 303 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 253



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 97  ctggactccgtcgggcttgatcatgatgaaggt 65

---

>emb|BX025230.1|CNS08RMQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA38CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 532

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 203

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 202 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 152

---

>emb|BX024508.1|CNS08R2O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 419 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 478

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 479 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 529



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||| | ||||||||||||
Sbjct: 685 ctggactccgtcgggctttaacatgatgaaggt 717

---

>emb|BX024507.1|CNS08R2N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA37BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 365 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 306

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 305 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 255



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 99  ctggactccgtcgggcttgatcatgatgaaggt 67

---

>emb|BX023654.1|CNS08QEY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 418 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 477

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 478 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 528



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 684 ctggactccgtcgggcttgatcatgatgaaggt 716

---

>emb|BX022916.1|CNS08PUG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA35AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 541

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 344 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 403

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 404 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 454

---

>emb|BX022915.1|CNS08PUF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA35AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 585

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 379 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 320

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 319 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 269



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 113 ctggactccgtcgggcttgatcatgatgaaggt 81

---

>emb|BX021481.1|CNS08OQL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 845

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 410 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 469

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 470 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 520



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 676 ctggactccgtcgggcttgatcatgatgaaggt 708

---

>emb|BX021480.1|CNS08OQK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31DD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 659

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 390 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 331

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 330 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 280



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 124 ctggactccgtcgggcttgatcatgatgaaggt 92

---

>emb|BX021192.1|CNS08OIK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31BF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 787

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 339 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 280

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 279 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 229



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 582 ccgtcgggcttgatcatgatgaaggt 607
           ||||||||||||||||||||||||||
Sbjct: 68  ccgtcgggcttgatcatgatgaaggt 43

---

>emb|BX021174.1|CNS08OI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 608

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 203

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 202 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 152

---

>emb|BX018153.1|CNS08M65 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 347 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 288

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 287 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 237



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 78  ctggactccgtcgggcttgatcatgatgaaggt 46

---

>emb|BX018054.1|CNS08M3E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA27BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 652

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 203

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 202 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 152

---

>emb|BX017467.1|CNS08LN3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 691

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 405 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 464

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 465 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 515

---

>emb|BX017466.1|CNS08LN2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA26BE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 735

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 360 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 301

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 300 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 250



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 94  ctggactccgtcgggcttgatcatgatgaaggt 62

---

>emb|BX017206.1|CNS08LFU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA25DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 354 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 295

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 294 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 244



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 88  ctggactccgtcgggcttgatcatgatgaaggt 56

---

>emb|BX016645.1|CNS08L09 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 846

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 409 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 468

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 469 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 519



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 675 ctggactccgtcgggcttgatcatgatgaaggt 707

---

>emb|BX014282.1|CNS08J6M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA21BH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 347 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 288

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 287 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 237



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 80  ctggactccgtcgggcttgatcatgatgaaggt 48

---

>emb|BX009575.1|CNS08FJV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 387 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 328

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 327 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 277



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 121 ctggactccgtcgggcttgatcatgatgaaggt 89

---

>emb|BX009569.1|CNS08FJP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 605

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 203

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 202 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 152

---

>emb|BX009487.1|CNS08FHF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA15BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 818

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 357 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 298

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 297 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 247



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 91  ctggactccgtcgggcttgatcatgatgaaggt 59

---

>emb|BX007945.1|CNS08EAL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 407 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 466

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 467 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 517



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 673 ctggactccgtcgggcttgatcatgatgaaggt 705

---

>emb|BX007944.1|CNS08EAK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 730

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 203

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 202 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 152

---

>emb|BX006734.1|CNS08DCY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 394 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 453

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 454 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 504



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Plus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 661 ctggactccgtcgggcttgatcatgatgaaggt 693

---

>emb|BX006733.1|CNS08DCX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 804

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 348 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 289

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 288 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 238



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 82  ctggactccgtcgggcttgatcatgatgaaggt 50

---

>emb|BX006020.1|CNS08CT4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 711

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 262 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 203

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 202 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 152

---

>dbj|AB226030.1| Aspergillus oryzae cDNA, contig sequence: AoEST2886
          Length = 635

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 299 ggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 349
           |||||||||||||||||||||||| ||  ||||||| || |||||||||||
Sbjct: 361 ggcgaagtcaccacggatggtgccaggggcggaggcaagagggttggtggc 311

---

>dbj|AP007162.1| Aspergillus oryzae RIB40 genomic DNA, SC102
          Length = 1779707

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 46/51 (90%)
 Strand = Plus / Plus

                                                                  
Query: 299     ggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 349
               |||||||||||||||||||||||| ||  ||||||| || |||||||||||
Sbjct: 1532690 ggcgaagtcaccacggatggtgccaggggcggaggcaagagggttggtggc 1532740



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 224     gaaccagagggcgatctccttcctggcattctc 256
               |||||||||||| ||||||||| |||| |||||
Sbjct: 1532554 gaaccagagggcaatctccttcttggcgttctc 1532586

---

>ref|XM_308641.2| Anopheles gambiae str. PEST ENSANGP00000011253
           (ENSANGG00000008764), mRNA
          Length = 873

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 91/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 467 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 408

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 407 gtcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 357



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 201 ctggactccgtcgggcttgatcatgatgaaggt 169

---

>gb|AY231961.1| Drosophila yakuba clone yak-em_awd mRNA sequence
          Length = 450

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                       
Query: 527 gaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
           ||||||||||| |||||||||   ||||| || ||||| ||| || | ||||||||| ||
Sbjct: 93  gaagcccttctgctcgaagcgctcgatgatcttgccgacgagtccgcgctggacgccatc 34

                             
Query: 587 gggcttgatcatgatgaa 604
           |||||||| |||||||||
Sbjct: 33  gggcttgaccatgatgaa 16



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 302 gaagtcaccacggatggtgccgggctcggaggccagggggttggtggcgcc 352
           ||||||||| |||||||||||||||  |||| |   |||||||||||||||
Sbjct: 318 gaagtcaccgcggatggtgccgggcagggagtcggcggggttggtggcgcc 268



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 458 ggacagatcggcgtagtgct 477
           ||||||||||||||||||||
Sbjct: 162 ggacagatcggcgtagtgct 143

---

>emb|BX025692.1|CNS08RZK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA39BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 508

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 90/110 (81%)
 Strand = Plus / Minus

                                                                       
Query: 310 cacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtccag 369
           ||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || |
Sbjct: 369 cacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccgg 310

                                                             
Query: 370 tggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           |   |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 309 tcttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 260



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 104 ctggactccgtcgggcttgatcatgatgaaggt 72

---

>emb|X13107.1|DMAWDR Drosophila melanogaster awd mRNA ( abnormal wing disc )
          Length = 573

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                       
Query: 527 gaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
           ||||||||||| |||||||||   ||||| || ||||| ||| || | ||||||||| ||
Sbjct: 127 gaagcccttctgctcgaagcgctcgatgatcttgccgacgagcccgcgctggacgccatc 68

                             
Query: 587 gggcttgatcatgatgaa 604
           |||||||| |||||||||
Sbjct: 67  gggcttgaccatgatgaa 50



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 302 gaagtcaccacggatggtgccgggc 326
           ||||||||| |||||||||||||||
Sbjct: 352 gaagtcaccgcggatggtgccgggc 328

---

>gb|AY113576.1| Drosophila melanogaster RH27794 full insert cDNA
          Length = 650

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                       
Query: 527 gaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
           ||||||||||| |||||||||   ||||| || ||||| ||| || | ||||||||| ||
Sbjct: 188 gaagcccttctgctcgaagcgctcgatgatcttgccgacgagcccgcgctggacgccatc 129

                             
Query: 587 gggcttgatcatgatgaa 604
           |||||||| |||||||||
Sbjct: 128 gggcttgaccatgatgaa 111



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 302 gaagtcaccacggatggtgccgggc 326
           ||||||||| |||||||||||||||
Sbjct: 413 gaagtcaccgcggatggtgccgggc 389

---

>ref|NM_057413.3| Drosophila melanogaster abnormal wing discs CG2210-RA (awd), mRNA
          Length = 683

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                       
Query: 527 gaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
           ||||||||||| |||||||||   ||||| || ||||| ||| || | ||||||||| ||
Sbjct: 237 gaagcccttctgctcgaagcgctcgatgatcttgccgacgagcccgcgctggacgccatc 178

                             
Query: 587 gggcttgatcatgatgaa 604
           |||||||| |||||||||
Sbjct: 177 gggcttgaccatgatgaa 160



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 302 gaagtcaccacggatggtgccgggc 326
           ||||||||| |||||||||||||||
Sbjct: 462 gaagtcaccgcggatggtgccgggc 438

---

>gb|AC007469.7|AC007469 Drosophila melanogaster, chromosome 3R, region 100D1-100F2, BAC clone
              BACR48C22, complete sequence
          Length = 181446

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                          
Query: 527    gaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
              ||||||||||| |||||||||   ||||| || ||||| ||| || | ||||||||| ||
Sbjct: 116002 gaagcccttctgctcgaagcgctcgatgatcttgccgacgagcccgcgctggacgccatc 116061

                                
Query: 587    gggcttgatcatgatgaa 604
              |||||||| |||||||||
Sbjct: 116062 gggcttgaccatgatgaa 116079



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 302    gaagtcaccacggatggtgccgggc 326
              ||||||||| |||||||||||||||
Sbjct: 115598 gaagtcaccgcggatggtgccgggc 115622

---

>gb|AY157739.1| Glycine max nucleoside diphosphate kinase mRNA, complete cds
          Length = 655

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 75/90 (83%)
 Strand = Plus / Minus

                                                                       
Query: 524 gtagaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgcc 583
           |||||| || |||||||| || | ||| |||| |||||| || ||||| || ||||||||
Sbjct: 121 gtagaaacctttcttctccaatctgctaatgatctcgccaataaggcctctttggacgcc 62

                                         
Query: 584 gtcgggcttgatcatgatgaaggtctgctc 613
            || ||||||||||||||| |||| |||||
Sbjct: 61  atcaggcttgatcatgatggaggtttgctc 32



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 88/108 (81%)
 Strand = Plus / Minus

                                                                       
Query: 209 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 268
           |||| |||||||||||||||| |  || || |||||  | ||| | |||||||  || ||
Sbjct: 436 agcagggccctcagggaaccacaatgcaatttccttgttagcactttcaactgcatcact 377

                                                           
Query: 269 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 316
           ||||||||| |||||||| || ||||| | ||| ||||||||||||||
Sbjct: 376 tccatggataacattccttccaatgtcaatggcaaagtcaccacggat 329

---

>dbj|AK065933.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013043K17, full
            insert sequence
          Length = 2012

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 196  tgctcctccactcagcaaggccctcagggaaccagagggcgatctccttc 245
            |||||||||||||||| |  || |||||||||||||| ||||||||||||
Sbjct: 1752 tgctcctccactcagctaaaccttcagggaaccagagagcgatctccttc 1703

---

>emb|AM055942.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ia
          Length = 1923819

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                       
Query: 567   aggcccctctggacgccgtcgggcttgatcatgatgaaggtc 608
             ||||||| |||||||||||||||||||| ||||||| |||||
Sbjct: 47017 aggccccgctggacgccgtcgggcttgaccatgatgtaggtc 46976

---

>gb|AE003779.2| Drosophila melanogaster chromosome 3R, section 117 of 118 of the complete
              sequence
          Length = 232050

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 66/78 (84%)
 Strand = Plus / Plus

                                                                          
Query: 527    gaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
              ||||||||||| |||||||||   ||||| || ||||| ||| || | ||||||||| ||
Sbjct: 155274 gaagcccttctgctcgaagcgctcgatgatcttgccgacgagcccgcgctggacgccatc 155333

                                
Query: 587    gggcttgatcatgatgaa 604
              |||||||| |||||||||
Sbjct: 155334 gggcttgaccatgatgaa 155351



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 302    gaagtcaccacggatggtgccgggc 326
              ||||||||| |||||||||||||||
Sbjct: 154870 gaagtcaccgcggatggtgccgggc 154894

---

>gb|BT001459.1| Drosophila melanogaster GM19775 full insert cDNA
          Length = 421

 Score = 60.0 bits (30), Expect = 9e-06
 Identities = 66/78 (84%)
 Strand = Plus / Minus

                                                                       
Query: 527 gaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
           ||||||||||| |||||||||   ||||| || ||||| ||| || | ||||||||| ||
Sbjct: 101 gaagcccttctgctcgaagcgctcgatgatcttgccgacgagcccgcgctggacgccatc 42

                             
Query: 587 gggcttgatcatgatgaa 604
           |||||||| |||||||||
Sbjct: 41  gggcttgaccatgatgaa 24

---

>ref|XM_363038.1| Magnaporthe grisea 70-15 hypothetical protein (MG08622.4) partial
           cds
          Length = 726

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 293 gtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 349
           ||||| |||| ||||||||||||||||||| ||  | ||||| ||||||||||||||
Sbjct: 594 gtcgatggcgtagtcaccacggatggtgccaggggccgaggcaagggggttggtggc 538



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggtctgctc 613
           |||||||||||||||||||||    ||||||||||||||
Sbjct: 300 ctggacgccgtcgggcttgatggcaatgaaggtctgctc 262



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 49/58 (84%)
 Strand = Plus / Minus

                                                                     
Query: 425 gtactccacgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 482
           |||||| ||||| |||||||||||||| |||     ||| ||||||||||||||||||
Sbjct: 450 gtactcaacgaggccagcgaagaagggcttgtccttcaggtcggcgtagtgctgctcg 393

---

>gb|AY194364.1| Vitis vinifera nucleoside-diphosphate kinase (Ndpk) mRNA, partial
           cds
          Length = 178

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 95/117 (81%)
 Strand = Plus / Minus

                                                                       
Query: 173 ctcatagatccagttgtgctggctgctcctccactcagcaaggccctcagggaaccagag 232
           |||||||||||||| ||   ||||||| |||||  || || |||| || |||||||| ||
Sbjct: 119 ctcatagatccagtggttaaggctgctgctccaggcaacagggccttctgggaaccacag 60

                                                                    
Query: 233 ggcgatctccttcctggcattctcaactgagtcgcttccatggatgacattcctgcc 289
            || ||||||||||| ||| || | |||||||| || ||||| || |||||||||||
Sbjct: 59  tgctatctccttccttgcactccccactgagtcactcccatgaatcacattcctgcc 3

---

>emb|BX049071.1|CNS09A0Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC24DA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 324

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 120 ctggactccgtcgggcttgatcatgatgaaggt 88



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 386 gccctcccagaccatagcgacgaccgggccggag 419
           ||||||||||||||| |  |||||||||||||||
Sbjct: 309 gccctcccagaccatcggcacgaccgggccggag 276

---

>emb|BX021302.1|CNS08OLM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA31CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 106 ctggactccgtcgggcttgatcatgatgaaggt 74



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 309 ccacggatggtgccgggctcggag 332
           ||||||||||||||||||||||||
Sbjct: 613 ccacggatggtgccgggctcggag 590

---

>emb|BX013424.1|CNS08IIS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 798

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||||||||||||||||
Sbjct: 84  ctggactccgtcgggcttgatcatgatgaaggt 52



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 352
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 350 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 307

---

>ref|XM_780291.1| PREDICTED: Strongylocentrotus purpuratus similar to
           nucleoside-diphosphate kinase 1 isoform a (LOC580218),
           mRNA
          Length = 546

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 287 gccgatgtcgacggcgaagtcaccacggatggtgccgggct 327
           |||||||||||||| | ||||||||||||||||||| ||||
Sbjct: 420 gccgatgtcgacggagtagtcaccacggatggtgccaggct 380

---

>gb|AY157740.1| Glycine max nucleoside diphosphate kinase mRNA, complete cds
          Length = 661

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 86/105 (81%)
 Strand = Plus / Minus

                                                                       
Query: 209 agcaaggccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgct 268
           |||| |||||||||||||||| |  || || |||||  | ||| |||||||||| || ||
Sbjct: 430 agcagggccctcagggaaccacaatgcaatttccttgttagcactctcaactgaatcact 371

                                                        
Query: 269 tccatggatgacattcctgccgatgtcgacggcgaagtcaccacg 313
           ||||||||| |||||||| || ||||| |  || |||||||||||
Sbjct: 370 tccatggataacattccttccaatgtcaatagcaaagtcaccacg 326



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 579 acgccgtcgggcttgatcatgatgaaggt 607
           ||||| || ||||||||||||||||||||
Sbjct: 63  acgccatctggcttgatcatgatgaaggt 35

---

>emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segment 7/7
          Length = 344615

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                      
Query: 273    tggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctc 328
              |||||||| || | |||||||| |||||| |  |||||||||||||||||||||||
Sbjct: 172638 tggatgacgttgcggccgatgttgacggccagatcaccacggatggtgccgggctc 172693



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 575    ctggacgccgtcgggcttgat 595
              |||||||||||||||||||||
Sbjct: 172940 ctggacgccgtcgggcttgat 172960

---

>dbj|AP008226.1| Thermus thermophilus HB8 genomic DNA, complete genome
          Length = 1849742

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                  
Query: 579    acgccgtcgggcttgatcatgatgaaggtctgctcc 614
              |||||||||||||||||||||| ||||||| |||||
Sbjct: 185008 acgccgtcgggcttgatcatgacgaaggtccgctcc 184973

---

>dbj|AB107688.1| Thermus thermophilus ndk gene for nucleoside diphosphate kinase,
           complete cds
          Length = 414

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 579 acgccgtcgggcttgatcatgatgaaggtctgctcc 614
           |||||||||||||||||||||| ||||||| |||||
Sbjct: 38  acgccgtcgggcttgatcatgacgaaggtccgctcc 3

---

>gb|AE017221.1| Thermus thermophilus HB27, complete genome
          Length = 1894877

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Plus

                                                   
Query: 579     acgccgtcgggcttgatcatgatgaaggtctgctcc 614
               |||||||||||||||||||||| ||||||| |||||
Sbjct: 1704792 acgccgtcgggcttgatcatgacgaaggtccgctcc 1704827

---

>gb|AY440076.1| Armigeres subalbatus ASAP ID: 39023 nucleoside diphosphate kinase
           mRNA sequence
          Length = 657

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 67/79 (84%), Gaps = 1/79 (1%)
 Strand = Plus / Minus

                                                                       
Query: 527 gaagcccttcttctcgaa-gcggctgatgacctcgccgatgaggcccctctggacgccgt 585
           ||||||||||| |||||| |||  |||||| || ||||| ||| |||| |||||| ||||
Sbjct: 170 gaagcccttctgctcgaaggcgtttgatgatcttgccgacgagcccccgctggacaccgt 111

                              
Query: 586 cgggcttgatcatgatgaa 604
           | ||||||| |||||||||
Sbjct: 110 ccggcttgaccatgatgaa 92

---

>ref|XM_386148.1| Gibberella zeae PH-1 chromosome 3 hypothetical protein (FG05972.1)
           partial mRNA
          Length = 717

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 54/63 (85%)
 Strand = Plus / Minus

                                                                       
Query: 287 gccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggt 346
           ||||| ||||| |||| |||||||||||||||| |||||    ||||| |||||||||||
Sbjct: 591 gccgacgtcgatggcgtagtcaccacggatggtaccgggggaagaggcaagggggttggt 532

              
Query: 347 ggc 349
           |||
Sbjct: 531 ggc 529



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggtctgctc 613
           |||||| ||||||||||||||   |||||||||||||||
Sbjct: 303 ctggacaccgtcgggcttgatggcgatgaaggtctgctc 265

---

>emb|BX062211.1|CNS09K5Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 250

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 90/111 (81%)
 Strand = Plus / Minus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 225 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 166

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||    ||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 165 gtcttaacggcgttcaggccctcccagaccatcggcacgaccgggccggag 115

---

>emb|BX022612.1|CNS08PM0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA34CD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 390

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 27/27 (100%)
 Strand = Plus / Minus

                                      
Query: 581 gccgtcgggcttgatcatgatgaaggt 607
           |||||||||||||||||||||||||||
Sbjct: 135 gccgtcgggcttgatcatgatgaaggt 109

---

>emb|BX017207.1|CNS08LFV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 590

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 90/111 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 223 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 282

                                                              
Query: 369 gtggcgacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||   |||| || ||  ||||||||| ||||| |  |||||||||||||||
Sbjct: 283 gtcttgacggcgttcaggccctcccaaaccatcggcacgaccgggccggag 333



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| |||| |||||||| ||||||||||||
Sbjct: 489 ctggactccgtggggcttgaacatgatgaaggt 521

---

>gb|DQ215035.1| Taeniopygia guttata clone 0058P0031C09 nucleoside diphosphate
           kinase-like mRNA, complete sequence
          Length = 645

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 534 ttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggcttg 593
           |||| |||||||||  |||||| ||| ||||  ||||| | |||||||||||||||||||
Sbjct: 146 ttctgctcgaagcgcttgatgatctccccgaccaggccgcgctggacgccgtcgggcttg 87

             
Query: 594 at 595
           ||
Sbjct: 86  at 85

---

>gb|DQ215034.1| Taeniopygia guttata clone 0058P0024B11 nucleoside diphosphate
           kinase-like mRNA, complete sequence
          Length = 677

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 534 ttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggcttg 593
           |||| |||||||||  |||||| ||| ||||  ||||| | |||||||||||||||||||
Sbjct: 177 ttctgctcgaagcgcttgatgatctccccgaccaggccgcgctggacgccgtcgggcttg 118

             
Query: 594 at 595
           ||
Sbjct: 117 at 116

---

>gb|DQ215039.1| Taeniopygia guttata clone 0058P0028E06 nucleoside diphosphate
           kinase-like mRNA, complete sequence
          Length = 646

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 534 ttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggcttg 593
           |||| |||||||||  |||||| ||| ||||  ||||| | |||||||||||||||||||
Sbjct: 146 ttctgctcgaagcgcttgatgatctccccgaccaggccgcgctggacgccgtcgggcttg 87

             
Query: 594 at 595
           ||
Sbjct: 86  at 85

---

>gb|DQ215038.1| Taeniopygia guttata clone 0058P0001H07 nucleoside diphosphate
           kinase-like mRNA, complete sequence
          Length = 658

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 534 ttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggcttg 593
           |||| |||||||||  |||||| ||| ||||  ||||| | |||||||||||||||||||
Sbjct: 143 ttctgctcgaagcgcttgatgatctccccgaccaggccgcgctggacgccgtcgggcttg 84

             
Query: 594 at 595
           ||
Sbjct: 83  at 82

---

>gb|DQ215037.1| Taeniopygia guttata clone 0065P0005G12 nucleoside diphosphate
           kinase-like mRNA, complete sequence
          Length = 624

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 534 ttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggcttg 593
           |||| |||||||||  |||||| ||| ||||  ||||| | |||||||||||||||||||
Sbjct: 124 ttctgctcgaagcgcttgatgatctccccgaccaggccgcgctggacgccgtcgggcttg 65

             
Query: 594 at 595
           ||
Sbjct: 64  at 63

---

>gb|DQ215036.1| Taeniopygia guttata clone 0061P0021A02 nucleoside diphosphate
           kinase-like mRNA, complete sequence
          Length = 642

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 534 ttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggcttg 593
           |||| |||||||||  |||||| ||| ||||  ||||| | |||||||||||||||||||
Sbjct: 142 ttctgctcgaagcgcttgatgatctccccgaccaggccgcgctggacgccgtcgggcttg 83

             
Query: 594 at 595
           ||
Sbjct: 82  at 81

---

>emb|X71388.1|PSNDKP1 P.sativum ndk-p1 mRNA for nucleoside diphosphate kinase
          Length = 639

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 267 cttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 316
           |||||||| || ||||||||||| ||||| | ||| ||||||||||||||
Sbjct: 377 cttccatgaataacattcctgccaatgtcaatggcaaagtcaccacggat 328



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 566 gaggcccctctggacgccgtcgggcttgatcatgatgaaggtctgctc 613
           |||||| || || ||||| |||||||||||||||||||| || |||||
Sbjct: 78  gaggcctctttgaacgccatcgggcttgatcatgatgaaagtttgctc 31

---

>gb|AY130398.1| Petromyzon marinus nucleoside diphosphate kinase mRNA, partial cds
          Length = 355

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                       
Query: 261 gagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtg 320
           ||||||||||||||||| || || |  |||||||||| |  |||||| || |||||||||
Sbjct: 324 gagtcgcttccatggatcacgtttcgcccgatgtcgatgcagaagtccccgcggatggtg 265

                 
Query: 321 ccgggc 326
           ||||||
Sbjct: 264 ccgggc 259

---

>dbj|AB121067.1| Halogeometricum borinquense ndk gene for nucleoside diphosphate
           kinase, partial cds
          Length = 423

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 557 ctcgccgatgaggcccctctggacgccgtcgggcttga 594
           ||||||||||||||| | |||||||||||| |||||||
Sbjct: 57  ctcgccgatgaggccgcgctggacgccgtccggcttga 20

---

>dbj|D86052.1|PEAPNDKN1 Pisum sativum mRNA for PNDKN1, complete cds
          Length = 629

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 267 cttccatggatgacattcctgccgatgtcgacggcgaagtcaccacggat 316
           |||||||| || ||||||||||| ||||| | ||| ||||||||||||||
Sbjct: 365 cttccatgaataacattcctgccaatgtcaatggcaaagtcaccacggat 316



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 74/90 (82%)
 Strand = Plus / Minus

                                                                       
Query: 524 gtagaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgcc 583
           |||||| ||||||||||| || | ||| || | ||| || | |||||| || || |||||
Sbjct: 108 gtagaaacccttcttctcaaacctgctaataatctccccaacgaggcctctttgaacgcc 49

                                         
Query: 584 gtcgggcttgatcatgatgaaggtctgctc 613
            |||||||||||||||||||| || |||||
Sbjct: 48  atcgggcttgatcatgatgaaagtttgctc 19

---

>ref|XM_753830.1| Ustilago maydis 521 hypothetical protein (UM02776.1) partial mRNA
          Length = 609

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 288 ccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtg 347
           |||| ||||| ||||||||| ||||||||||| |||||  | ||| | || |||||||||
Sbjct: 485 ccgacgtcgatggcgaagtcgccacggatggttccgggggcagagtcgagcgggttggtg 426

                
Query: 348 gcgcc 352
           |||||
Sbjct: 425 gcgcc 421



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 579 acgccgtcgggcttgatcatgatgaaggtctgctc 613
           |||||||||||||||||||| ||| | ||||||||
Sbjct: 194 acgccgtcgggcttgatcataatgtaagtctgctc 160

---

>emb|BX009576.1|CNS08FJW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 575 ctggacgccgtcgggcttgatcatgatgaaggt 607
           |||||| ||||||||||||| ||||||||||||
Sbjct: 663 ctggactccgtcgggcttgaacatgatgaaggt 695



 Score = 48.1 bits (24), Expect = 0.034
 Identities = 91/112 (81%), Gaps = 1/112 (0%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 396 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 455

                                                               
Query: 369 gtggc-gacgacgctcttgccctcccagaccatagcgacgaccgggccggag 419
           ||    |||| || ||  ||||||||||||||| |  |||||||||||||||
Sbjct: 456 gtctttgacggcgttcaggccctcccagaccatcggcacgaccgggccggag 507

---

>ref|NM_205047.1| Gallus gallus non-metastatic cells 2, protein (NM23B) expressed in
           (NME2), mRNA
          Length = 638

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 527 gaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
           ||||||||||| |||||||||  |||||| ||| || |  || |||| ||| ||||||||
Sbjct: 153 gaagcccttctgctcgaagcgtttgatgatctcccccaccagcccccgctgcacgccgtc 94

                    
Query: 587 gggcttgat 595
           |||||||||
Sbjct: 93  gggcttgat 85

---

>gb|DQ372081.1| Sus scrofa nm23-H2 mRNA, complete cds
          Length = 459

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 531 cccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggc 590
           ||||||| |||||||||  |||||| |||||| | ||| || | |||||||||||| |||
Sbjct: 95  cccttctgctcgaagcgcttgatgatctcgcccacgagaccgcgctggacgccgtccggc 36

                            
Query: 591 ttgatcatgatgaaggt 607
           |||| |  |||||||||
Sbjct: 35  ttgaccgcgatgaaggt 19

---

>gb|AE005044.1| Halobacterium sp. NRC-1 section 75 of 170 of the complete genome
          Length = 13431

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                  
Query: 558   tcgccgatgaggcccctctggacgccgtcgggcttga 594
             ||||||||||| || | ||||||||||||||||||||
Sbjct: 10379 tcgccgatgagcccgcgctggacgccgtcgggcttga 10343

---

>dbj|AB126060.1| Codonopsis lanceolata NDPK 1 mRNA for nucloeside diphosphate kinase
           1, complete cds
          Length = 635

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 270 ccatggatgacattcctgccgatgtcgacggcgaagtcaccacggatggtgcc 322
           ||||| |||||||||||||| ||||| |  || || |||||||||||||||||
Sbjct: 417 ccatgaatgacattcctgccaatgtcaatagcaaaatcaccacggatggtgcc 365

---

>gb|AF043542.1|AF043542 Gallus gallus nucleoside diphosphate kinase (cNDPK) mRNA, complete
           cds
          Length = 638

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 527 gaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
           ||||||||||| |||||||||  |||||| ||| || |  || |||| ||| ||||||||
Sbjct: 153 gaagcccttctgctcgaagcgtttgatgatctcccccaccagcccccgctgcacgccgtc 94

                    
Query: 587 gggcttgat 595
           |||||||||
Sbjct: 93  gggcttgat 85

---

>gb|J05207.1|MXANDK M.xanthus nucleoside 5'-diphosphate phosphotransferase (ndk) gene,
           complete cds
          Length = 789

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 531 cccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtcgggc 590
           ||||||| ||||||||||||||||| ||  ||||||| |||| |||  | |||||| |||
Sbjct: 179 cccttctcctcgaagcggctgatgatcttcccgatgacgcccttctccaggccgtccggc 120

                
Query: 591 ttgat 595
           |||||
Sbjct: 119 ttgat 115

---

>gb|U10283.1|FBU10283 Flaveria bidentis clone pNDK-b nucleoside diphosphate kinase mRNA,
           complete cds
          Length = 573

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 82/101 (81%)
 Strand = Plus / Minus

                                                                       
Query: 339 gggttggtggcgccaatgatcttgcgtccagtggcgacgacgctcttgccctcccagacc 398
           ||||| ||||| |||||||||||||| |||||||  || ||  ||||||| ||||| |||
Sbjct: 283 gggtttgtggcaccaatgatcttgcgcccagtggtaaccacattcttgccttcccaaacc 224

                                                    
Query: 399 atagcgacgaccgggccggagacgatgtactccacgagccc 439
           || || || || || || |||| ||||||||| || |||||
Sbjct: 223 atggcaacaacgggtccagagatgatgtactcaactagccc 183



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 579 acgccgtcgggcttgatcatgatgaaggtctgctcc 614
           ||||| || |||||||||||||| ||||| ||||||
Sbjct: 43  acgccatcaggcttgatcatgataaaggtatgctcc 8

---

>gb|U10282.1|FBU10282 Flaveria bidentis clone pNDK-a nucleoside diphosphate kinase mRNA,
           complete cds
          Length = 601

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 64/77 (83%)
 Strand = Plus / Minus

                                                                       
Query: 354 atgatcttgcgtccagtggcgacgacgctcttgccctcccagaccatagcgacgaccggg 413
           ||||||| ||| ||||||| ||| ||  ||||||||||||| ||||| || || || || 
Sbjct: 268 atgatctcgcggccagtggtgaccacattcttgccctcccaaaccatggcaacaacggga 209

                            
Query: 414 ccggagacgatgtactc 430
           || ||||||||||||||
Sbjct: 208 ccagagacgatgtactc 192



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 566 gaggcccctctggacgccgtcgggcttgatcatgatgaaggtctgctcc 614
           |||||| || || ||||| ||||| ||||||||||| ||||| ||||||
Sbjct: 56  gaggccgctttgaacgccatcgggtttgatcatgataaaggtttgctcc 8



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 83/104 (79%)
 Strand = Plus / Minus

                                                                       
Query: 216 ccctcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatgg 275
           ||||| |||||||| ||  ||||| ||||||| ||  ||||||| |  || || ||||| 
Sbjct: 406 ccctcggggaaccacagaccgatcaccttcctcgcgctctcaaccgcatcactaccatga 347

                                                       
Query: 276 atgacattcctgccgatgtcgacggcgaagtcaccacggatggt 319
           || ||||| ||||| |||||||  || || ||||||||||||||
Sbjct: 346 atcacatttctgccaatgtcgattgcaaaatcaccacggatggt 303

---

>dbj|AB036344.1| Halobacterium cutirubrum rpl7AE, rps28E, rpl24E, ndk genes for LSU
           ribosomal protein L7AE, SSU ribosomal protein S28E, LSU
           ribosomal protein L24E, nucleoside diphosphate kinase,
           partial and complete cds
          Length = 1270

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                
Query: 558 tcgccgatgaggcccctctggacgccgtcgggcttga 594
           ||||||||||| || | ||||||||||||||||||||
Sbjct: 753 tcgccgatgagcccgcgctggacgccgtcgggcttga 717

---

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
              sequence
          Length = 1507550

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 222    gggaaccagagggcgatctccttc 245
              ||||||||||||||||||||||||
Sbjct: 701410 gggaaccagagggcgatctccttc 701433



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                                 
Query: 536    cttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
              ||||||||| |||| ||| | |||||||| |||||| | ||||||||||||
Sbjct: 701940 cttctcgaatcggccgataatctcgccgacgaggcctcgctggacgccgtc 701990



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 590    cttgatcatgatgaaggtctgctc 613
              ||||||||||||| ||||||||||
Sbjct: 702208 cttgatcatgatgtaggtctgctc 702231

---

>emb|BX038906.1|CNS0926M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB3CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 298

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 352
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 243 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 286

---

>emb|BX038116.1|CNS091KO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAB2BD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 345

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 75/92 (81%)
 Strand = Plus / Plus

                                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgccaatgatcttgcgtcca 368
           |||||||||||||||||||||||| |    |||||||||||||| |  |||||||| || 
Sbjct: 247 ccacggatggtgccgggctcggagtcggccgggttggtggcgcccagcatcttgcggccg 306

                                           
Query: 369 gtggcgacgacgctcttgccctcccagaccat 400
           ||   |||| || ||  |||||||||||||||
Sbjct: 307 gtcttgacggcgttcaggccctcccagaccat 338

---

>emb|BX021303.1|CNS08OLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31CD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 352
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 347 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 390

---

>emb|BX021175.1|CNS08OI3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 149

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 309 ccacggatggtgccgggctcggaggccagggggttggtggcgcc 352
           |||||||||||||||||||||||| |    ||||||||||||||
Sbjct: 103 ccacggatggtgccgggctcggagtcggccgggttggtggcgcc 146

---

>emb|AJ308817.1|CAR308817 Coffea arabica microsatellite DNA, clone 120-5CTG
          Length = 284

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 579 acgccgtcgggcttgatcatgatgaaggtctgctcc 614
           ||||| || ||||||||||||||||| |||||||||
Sbjct: 50  acgccatcaggcttgatcatgatgaatgtctgctcc 85

---

>emb|X69376.1|ATNDK13 A.thaliana gene for nucleoside diphosphate kinase, exons 1-3
          Length = 3132

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                        
Query: 219  tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 278
            ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 1191 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 1132

                                                                        
Query: 279  acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 338
            || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 1131 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 1072

                                   
Query: 339  gggttggtggcgccaatgatctt 361
            |||||||| || |||||||||||
Sbjct: 1071 gggttggtagctccaatgatctt 1049



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 573 ctctggacgccgtcgggcttgatcat 598
           |||||||||||||| |||||||||||
Sbjct: 404 ctctggacgccgtcaggcttgatcat 379

---

>emb|AL161514.2|ATCHRIV26 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 26
          Length = 199754

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                          
Query: 219    tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 278
              ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 136684 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 136625

                                                                          
Query: 279    acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 338
              || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 136624 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 136565

                                     
Query: 339    gggttggtggcgccaatgatctt 361
              |||||||| || |||||||||||
Sbjct: 136564 gggttggtagctccaatgatctt 136542



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 573    ctctggacgccgtcgggcttgatcat 598
              |||||||||||||| |||||||||||
Sbjct: 135897 ctctggacgccgtcaggcttgatcat 135872

---

>emb|AL117386.1|ATT30A10 Arabidopsis thaliana DNA chromosome 4, BAC clone T30A10 (ESSA project)
          Length = 83369

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 113/143 (79%)
 Strand = Plus / Minus

                                                                         
Query: 219   tcagggaaccagagggcgatctccttcctggcattctcaactgagtcgcttccatggatg 278
             ||||||||||| |  || |||||||| || ||| |||| || ||||| || |||||||| 
Sbjct: 69413 tcagggaaccacaaagcaatctcctttcttgcactctcgacagagtcactaccatggatc 69354

                                                                         
Query: 279   acattcctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagg 338
             || |||||||| ||||| |  || ||||| |||||||| || || ||||| || ||    
Sbjct: 69353 acgttcctgccaatgtcaatagcaaagtccccacggatagttccaggctcagaagctgct 69294

                                    
Query: 339   gggttggtggcgccaatgatctt 361
             |||||||| || |||||||||||
Sbjct: 69293 gggttggtagctccaatgatctt 69271



 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 573   ctctggacgccgtcgggcttgatcat 598
             |||||||||||||| |||||||||||
Sbjct: 68626 ctctggacgccgtcaggcttgatcat 68601

---

>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome
          Length = 7074893

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 298     cggcgaagtcaccacggatggtgccgg 324
               ||||||||||| |||||||||||||||
Sbjct: 5713180 cggcgaagtcagcacggatggtgccgg 5713206

---

>gb|DQ413209.1| Acyrthosiphon pisum isolate WHAP0107 abnormal wing disks-like
           protein mRNA, complete cds
          Length = 465

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 582 ccgtcgggcttgatcatgatgaa 604
           |||||||||||||||||||||||
Sbjct: 50  ccgtcgggcttgatcatgatgaa 28

---

>emb|AL116259.1|CNS01D1N Botrytis cinerea strain T4 cDNA library
          Length = 650

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 432 acgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 482
           ||||| ||||||||||| || |||  ||| ||||| |||||||||||||||
Sbjct: 284 acgagaccagcgaagaatggcttgtcggagagatcagcgtagtgctgctcg 234



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 294 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 349
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 422 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 367

---

>emb|AL116136.1|CNS01CY8 Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 432 acgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 482
           ||||| ||||||||||| || |||  ||| ||||| |||||||||||||||
Sbjct: 238 acgagaccagcgaagaatggcttgtcggagagatcagcgtagtgctgctcg 188



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 294 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 349
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 376 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 321

---

>emb|AL115859.1|CNS01CQJ Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 432 acgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 482
           ||||| ||||||||||| || |||  ||| ||||| |||||||||||||||
Sbjct: 226 acgagaccagcgaagaatggcttgtcggagagatcagcgtagtgctgctcg 176



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 294 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 349
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 364 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 309

---

>emb|AL115323.1|CNS01CBN Botrytis cinerea strain T4 cDNA library
          Length = 696

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 432 acgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 482
           ||||| ||||||||||| || |||  ||| ||||| |||||||||||||||
Sbjct: 252 acgagaccagcgaagaatggcttgtcggagagatcagcgtagtgctgctcg 202



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 294 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 349
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 390 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 335

---

>emb|AL114869.1|CNS01BZ1 Botrytis cinerea strain T4 cDNA library
          Length = 650

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 432 acgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 482
           ||||| ||||||||||| || |||  ||| ||||| |||||||||||||||
Sbjct: 270 acgagaccagcgaagaatggcttgtcggagagatcagcgtagtgctgctcg 220



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 294 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 349
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 408 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 353

---

>emb|AL114309.1|CNS01BJH Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 432 acgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 482
           ||||| ||||||||||| || |||  ||| ||||| |||||||||||||||
Sbjct: 256 acgagaccagcgaagaatggcttgtcggagagatcagcgtagtgctgctcg 206



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 294 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 349
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 394 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 339

---

>emb|AL111481.1|CNS019CX Botrytis cinerea strain T4 cDNA library
          Length = 576

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 432 acgagcccagcgaagaagggtttggaggacagatcggcgtagtgctgctcg 482
           ||||| ||||||||||| || |||  ||| ||||| |||||||||||||||
Sbjct: 242 acgagaccagcgaagaatggcttgtcggagagatcagcgtagtgctgctcg 192



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 294 tcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggttggtggc 349
           |||| |||| |||||||||||||||| || ||  | |||||||  |||||||||||
Sbjct: 380 tcgatggcgtagtcaccacggatggtacctggggcagaggccaatgggttggtggc 325

---

>gb|AY962601.1| Nicotiana tabacum nucleoside diphosphate kinase mRNA, complete cds
          Length = 704

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 101/127 (79%)
 Strand = Plus / Minus

                                                                       
Query: 193 ggctgctcctccactcagcaaggccctcagggaaccagagggcgatctccttcctggcat 252
           ||||||||  |||||| ||||  || || |||||||| || || || |||||||| ||| 
Sbjct: 480 ggctgctctgccactctgcaactccttcggggaaccaaagagcaatttccttccttgcac 421

                                                                       
Query: 253 tctcaactgagtcgcttccatggatgacattcctgccgatgtcgacggcgaagtcaccac 312
           |||||||||  || |||||||| || || |||||||| ||||| |  ||  | |||||||
Sbjct: 420 tctcaactgcatcacttccatgaataacgttcctgccaatgtcaatagcataatcaccac 361

                  
Query: 313 ggatggt 319
           |||||||
Sbjct: 360 ggatggt 354



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 588 ggcttgatcatgatgaaggtctgctcc 614
           ||||||||||||||||| |||||||||
Sbjct: 85  ggcttgatcatgatgaaagtctgctcc 59

---

>dbj|AB121070.1| Natronomonas pharaonis ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 420

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 301 cgaagtcaccacggatggtgccgggctcgga 331
           |||||||||| ||||||||||||||| ||||
Sbjct: 313 cgaagtcaccgcggatggtgccgggcgcgga 283



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 558 tcgccgatgaggcccctctggacgccgtcgggcttga 594
           |||||||||||||| | |||||| ||||| |||||||
Sbjct: 56  tcgccgatgaggccgcgctggaccccgtccggcttga 20

---

>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome
          Length = 2595221

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                              
Query: 301     cgaagtcaccacggatggtgccgggctcgga 331
               |||||||||| ||||||||||||||| ||||
Sbjct: 1771041 cgaagtcaccgcggatggtgccgggcgcgga 1771011

---

>gb|AF069544.1|AF069544 Mycobacterium smegmatis nucleoside diphosphate kinase (ndk) gene,
           complete cds
          Length = 608

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 299 ggcgaagtcaccacggatggtgccggg 325
           |||||||||||| ||||||||||||||
Sbjct: 464 ggcgaagtcaccgcggatggtgccggg 438

---

>gb|BT019474.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|BT019438.1| Homo sapiens non-metastatic cells 4, protein expressed in mRNA,
           complete cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|BT019437.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|BT019436.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|BT019435.1| Synthetic construct Homo sapiens non-metastatic cells 4, protein
           expressed in mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|BC004880.2| Homo sapiens non-metastatic cells 4, protein expressed in, mRNA
           (cDNA clone MGC:11088 IMAGE:3830205), complete cds
          Length = 1045

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 466 tggatgacattcctgctgatgtggacgctgaagtcacc 429

---

>ref|NM_005009.2| Homo sapiens non-metastatic cells 4, protein expressed in (NME4),
           mRNA
          Length = 1059

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 483 tggatgacattcctgctgatgtggacgctgaagtcacc 446

---

>ref|XM_824577.1| Trypanosoma brucei TREU927 nucleoside diphosphate kinase
           (Tb11.01.7800) partial mRNA
          Length = 462

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 297 acggcgaagtcaccacggatggtgcc 322
           ||||||||||||||||| ||||||||
Sbjct: 326 acggcgaagtcaccacgaatggtgcc 301

---

>ref|XM_809769.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053503697.100) partial mRNA
          Length = 5331

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 289  cgatgtcgacggcgaagtcacc 310
            ||||||||||||||||||||||
Sbjct: 3261 cgatgtcgacggcgaagtcacc 3240

---

>ref|XM_814613.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053504105.200) partial mRNA
          Length = 5334

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 289  cgatgtcgacggcgaagtcacc 310
            ||||||||||||||||||||||
Sbjct: 3261 cgatgtcgacggcgaagtcacc 3240

---

>emb|CR857184.1| Pongo pygmaeus mRNA; cDNA DKFZp468E0516 (from clone DKFZp468E0516)
          Length = 696

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccctcccagaccatagcgacgaccgggccggagacgatgtactccacgagcccagcgaag 446
           |||||||||||||| || |||||||| || |||   ||||||| ||| ||||||| ||||
Sbjct: 314 ccctcccagaccatggccacgaccggccctgagttcatgtacttcaccagcccagggaag 255

             
Query: 447 aa 448
           ||
Sbjct: 254 aa 253

---

>emb|CR621504.1| full-length cDNA clone CS0DC014YN11 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 600

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 182 tggatgacattcctgctgatgtggacgctgaagtcacc 145

---

>emb|CR613066.1| full-length cDNA clone CS0DF035YK02 of Fetal brain of Homo sapiens
           (human)
          Length = 873

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 353 tggatgacattcctgctgatgtggacgctgaagtcacc 316

---

>dbj|AK094439.1| Homo sapiens cDNA FLJ37120 fis, clone BRACE2022389, highly similar to
            NUCLEOSIDE DIPHOSPHATE KINASE, MITOCHONDRIAL PRECURSOR
            (EC 2.7.4.6)
          Length = 1861

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 273  tggatgacattcctgccgatgtcgacggcgaagtcacc 310
            |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 1342 tggatgacattcctgctgatgtggacgctgaagtcacc 1305

---

>emb|CR597313.1| full-length cDNA clone CS0DC018YA06 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 879

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 467 tggatgacattcctgctgatgtggacgctgaagtcacc 430

---

>emb|CR595773.1| full-length cDNA clone CS0DC003YM19 of Neuroblastoma Cot
           25-normalized of Homo sapiens (human)
          Length = 1082

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 566 tggatgacattcctgctgatgtggacgctgaagtcacc 529

---

>emb|CR592051.1| full-length cDNA clone CS0DF021YM10 of Fetal brain of Homo sapiens
            (human)
          Length = 1652

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 273  tggatgacattcctgccgatgtcgacggcgaagtcacc 310
            |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 1249 tggatgacattcctgctgatgtggacgctgaagtcacc 1212

---

>gb|AF295650.1| Beta vulgaris nucleotide diphosphate kinase (ndk) gene, partial cds
          Length = 806

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 64/78 (82%)
 Strand = Plus / Minus

                                                                       
Query: 284 cctgccgatgtcgacggcgaagtcaccacggatggtgccgggctcggaggccagggggtt 343
           |||||| ||||| | ||| || || ||||||||||| || ||||| || || || |||||
Sbjct: 126 cctgccaatgtcaatggcaaaatcgccacggatggtaccaggctcagaagcaagagggtt 67

                             
Query: 344 ggtggcgccaatgatctt 361
           |||||| || ||||||||
Sbjct: 66  ggtggctccgatgatctt 49

---

>ref|NR_001577.1| Homo sapiens non-metastatic cells 2, protein (NM23B) expressed in,
           pseudogene 1 (NME2P1) on chromosome 12
          Length = 693

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccctcccagaccatagcgacgaccgggccggagacgatgtactccacgagcccagcgaag 446
           |||||||||||||| || |||||||| || |||   ||||||| ||| ||||||| ||||
Sbjct: 360 ccctcccagaccatggccacgaccggccctgagttcatgtacttcaccagcccagggaag 301

             
Query: 447 aa 448
           ||
Sbjct: 300 aa 299

---

>gb|AY335611.1| Synthetic construct Homo sapiens non-metastatic cells
           nucleoside-diphosphate kinase 6 (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>dbj|AB232529.1| Haloarcula quadrata ndk gene for nucleoside diphosphate kinase,
           complete cds, strain:JCM 11048
          Length = 689

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 304 agtcaccacggatggtgccggg 325
           ||||||||||||||||||||||
Sbjct: 440 agtcaccacggatggtgccggg 419

---

>dbj|AB232528.1| Haloarcula sinaiiensis ndk gene for nucleoside diphosphate kinase,
           complete cds, strain:ATCC 33800
          Length = 689

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 304 agtcaccacggatggtgccggg 325
           ||||||||||||||||||||||
Sbjct: 440 agtcaccacggatggtgccggg 419

---

>gb|U85976.1|HSU85976 Human nucleoside diphosphate kinase (NDK) pseudogene, partial cds
          Length = 770

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 387 ccctcccagaccatagcgacgaccgggccggagacgatgtactccacgagcccagcgaag 446
           |||||||||||||| || |||||||| || |||   ||||||| ||| ||||||| ||||
Sbjct: 413 ccctcccagaccatggccacgaccggccctgagttcatgtacttcaccagcccagggaag 354

             
Query: 447 aa 448
           ||
Sbjct: 353 aa 352

---

>gb|AF164200.1|AF164200 Trypanosoma brucei putative DNA replication protein CDC47 (CDC47) and
            nucleoside diphosphate kinase (NDPK) genes, complete cds
          Length = 3852

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 297  acggcgaagtcaccacggatggtgcc 322
            ||||||||||||||||| ||||||||
Sbjct: 3427 acggcgaagtcaccacgaatggtgcc 3402

---

>gb|AY888350.1| Synthetic construct Homo sapiens clone FLH008002.01X non-metastatic
           cells 4 protein (NME4) mRNA, complete cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|AY888349.1| Synthetic construct Homo sapiens clone FLH008001.01X non-metastatic
           cells 4 protein (NME4) mRNA, complete cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|AY890948.1| Synthetic construct Homo sapiens clone FLH008000.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|AY890947.1| Synthetic construct Homo sapiens clone FLH007999.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|AY890946.1| Synthetic construct Homo sapiens clone FLH007998.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>gb|AY890945.1| Synthetic construct Homo sapiens clone FLH007997.01L non-metastatic
           cells 4 protein expressed in (NME4) mRNA, partial cds
          Length = 564

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 452 tggatgacattcctgctgatgtggacgctgaagtcacc 415

---

>dbj|AB126343.1| Haloarcula sinaiiensis ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 591

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 304 agtcaccacggatggtgccggg 325
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289

---

>dbj|AB126342.1| Haloarcula quadrata ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 590

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 304 agtcaccacggatggtgccggg 325
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289

---

>dbj|AB126341.1| Haloarcula japonica ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 591

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 561 ccgatgaggcccctctggacgccgtcgggcttga 594
           ||||||||||| | |||||||||||| |||||||
Sbjct: 53  ccgatgaggccgcgctggacgccgtccggcttga 20

---

>dbj|AB126340.1| Haloarcula hispanica ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 591

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 561 ccgatgaggcccctctggacgccgtcgggcttga 594
           ||||||||||| | |||||||||||| |||||||
Sbjct: 53  ccgatgaggccgcgctggacgccgtccggcttga 20

---

>dbj|AB126339.1| Haloarcula californiae ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 590

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 304 agtcaccacggatggtgccggg 325
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289

---

>dbj|AB126338.1| Haloarcula argentinensis ndk gene for nucleoside diphosphate
           kinase, partial cds
          Length = 592

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 561 ccgatgaggcccctctggacgccgtcgggcttga 594
           ||||||||||| | |||||||||||| |||||||
Sbjct: 53  ccgatgaggccgcgctggacgccgtccggcttga 20

---

>dbj|AB121068.1| Halorubrum saccharovorum ndk gene for nucleoside diphosphate
           kinase, partial cds
          Length = 423

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 557 ctcgccgatgaggcccctctggacgccgtcgggcttga 594
           ||||||||||||||| | ||| |||||||| |||||||
Sbjct: 57  ctcgccgatgaggccgcgctgcacgccgtccggcttga 20

---

>dbj|AB121064.1| Haloarcula sinaiiensis ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 423

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 304 agtcaccacggatggtgccggg 325
           ||||||||||||||||||||||
Sbjct: 310 agtcaccacggatggtgccggg 289

---

>dbj|AB121063.1| Haloarcula hispanica ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 423

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 561 ccgatgaggcccctctggacgccgtcgggcttga 594
           ||||||||||| | |||||||||||| |||||||
Sbjct: 53  ccgatgaggccgcgctggacgccgtccggcttga 20

---

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 304   agtcaccacggatggtgccggg 325
             ||||||||||||||||||||||
Sbjct: 89088 agtcaccacggatggtgccggg 89067

---

>gb|AC004263.1|AC004263 Homo sapiens PAC clone 278C19 from 12q, complete sequence
          Length = 106921

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                         
Query: 387   ccctcccagaccatagcgacgaccgggccggagacgatgtactccacgagcccagcgaag 446
             |||||||||||||| || |||||||| || |||   ||||||| ||| ||||||| ||||
Sbjct: 90215 ccctcccagaccatggccacgaccggccctgagttcatgtacttcaccagcccagggaag 90156

               
Query: 447   aa 448
             ||
Sbjct: 90155 aa 90154

---

>gb|AF086133.1|HUMZA87H07 Homo sapiens full length insert cDNA clone ZA87H07
          Length = 714

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 181 tggatgacattcctgctgatgtggacgctgaagtcacc 144

---

>gb|BC017067.1| Homo sapiens non-metastatic cells 4, protein expressed in, mRNA
           (cDNA clone MGC:9630 IMAGE:3913604), complete cds
          Length = 973

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 483 tggatgacattcctgctgatgtggacgctgaagtcacc 446

---

>emb|CT033698.1| Platynereis dumerilii EST IB0AAA15DD08EM1
          Length = 831

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 224 gaaccagagggcgatctccttc 245
           ||||||||||||||||||||||
Sbjct: 483 gaaccagagggcgatctccttc 462



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 576 tggacgccgtcgggcttgatcatgatgaa 604
           ||||| || ||||||||||||||||||||
Sbjct: 131 tggaccccatcgggcttgatcatgatgaa 103

---

>emb|CT032612.1| Platynereis dumerilii EST IB0AAA35BD04EM1
          Length = 853

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 224 gaaccagagggcgatctccttc 245
           ||||||||||||||||||||||
Sbjct: 480 gaaccagagggcgatctccttc 459



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 576 tggacgccgtcgggcttgatcatgatgaa 604
           ||||| || ||||||||||||||||||||
Sbjct: 128 tggaccccatcgggcttgatcatgatgaa 100

---

>emb|CT032450.1| Platynereis dumerilii EST IB0AAA38AD09EM1
          Length = 851

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 224 gaaccagagggcgatctccttc 245
           ||||||||||||||||||||||
Sbjct: 470 gaaccagagggcgatctccttc 449



 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 576 tggacgccgtcgggcttgatcatgatgaa 604
           ||||| || ||||||||||||||||||||
Sbjct: 118 tggaccccatcgggcttgatcatgatgaa 90

---

>emb|Y07604.1|HSNM23H4 H.sapiens mRNA for nucleoside-diphosphate kinase
          Length = 879

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 273 tggatgacattcctgccgatgtcgacggcgaagtcacc 310
           |||||||||||||||| ||||| ||||  |||||||||
Sbjct: 463 tggatgacattcctgctgatgtggacgctgaagtcacc 426

---

>ref|XM_476035.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 720

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 567 aggcccctctggacgccgtcgggcttgat 595
           |||||||| ||||||||||| ||||||||
Sbjct: 314 aggcccctttggacgccgtcaggcttgat 286

---

>gb|AC136217.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0030I14, complete sequence
          Length = 159035

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 567   aggcccctctggacgccgtcgggcttgat 595
             |||||||| ||||||||||| ||||||||
Sbjct: 90367 aggcccctttggacgccgtcaggcttgat 90395

---

>gb|BT017115.1| Zea mays clone EL01N0363H10.c mRNA sequence
          Length = 822

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 567 aggcccctctggacgccgtcgggcttgat 595
           ||||| || ||||||||||||||||||||
Sbjct: 533 aggcctctttggacgccgtcgggcttgat 561

---

>gb|AC119951.12| Mus musculus chromosome 9, clone RP24-448C4, complete sequence
          Length = 215131

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 266    gcttccatggatgacattcct 286
              |||||||||||||||||||||
Sbjct: 175569 gcttccatggatgacattcct 175589

---

>ref|XM_420097.1| PREDICTED: Gallus gallus similar to nucleoside diphosphate kinase
           (LOC422094), mRNA
          Length = 1871

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 57/69 (82%)
 Strand = Plus / Minus

                                                                       
Query: 527 gaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
           ||||||||||| ||||||||| | |||||  || || |  || |||| ||| ||||||||
Sbjct: 336 gaagcccttctgctcgaagcgccggatgatttctcccaccagcccccgctgcacgccgtc 277

                    
Query: 587 gggcttgat 595
           |||||||||
Sbjct: 276 gggcttgat 268

---

>gb|CP000075.1| Pseudomonas syringae pv. syringae B728a, complete genome
          Length = 6093698

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 300     gcgaagtcaccacggatggtgccgg 324
               ||||||||| |||||||||||||||
Sbjct: 1400267 gcgaagtcagcacggatggtgccgg 1400243

---

>gb|AC120386.12| Mus musculus chromosome 9, clone RP24-294A16, complete sequence
          Length = 207310

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 266    gcttccatggatgacattcct 286
              |||||||||||||||||||||
Sbjct: 205795 gcttccatggatgacattcct 205775

---

>emb|CR685311.2|CNS0FRQJ Tetraodon nigroviridis full-length cDNA
          Length = 758

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 57/69 (82%)
 Strand = Plus / Minus

                                                                       
Query: 527 gaagcccttcttctcgaagcggctgatgacctcgccgatgaggcccctctggacgccgtc 586
           |||||||||| ||||||| |   |||||| ||| || | || ||||||||| ||||| ||
Sbjct: 167 gaagcccttcatctcgaatctcttgatgatctctccaacgatgcccctctgcacgccatc 108

                    
Query: 587 gggcttgat 595
           |||||||||
Sbjct: 107 gggcttgat 99

---

>emb|AL583826.16| Human DNA sequence from clone RP11-434B7 on chromosome 1 Contains the
             3' end of the RPS6KC1 gene for ribosomal protein S6 kinase
             52kDa polypeptide 1, complete sequence
          Length = 122208

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 183   cagttgtgctggctgctcctc 203
             |||||||||||||||||||||
Sbjct: 42834 cagttgtgctggctgctcctc 42854

---

>emb|AL355483.14| Human DNA sequence from clone RP4-784A16 on chromosome 1 Contains the
             3' end of the LRP8 gene for low density lipoprotein
             receptor-related protein 8 apolipoprotein e receptor, five
             novel genes and a CpG island, complete sequence
          Length = 80255

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 440   agcgaagaagggtttggaggacaga 464
             |||||||| ||||||||||||||||
Sbjct: 49839 agcgaagatgggtttggaggacaga 49863

---

>ref|XM_962410.1| PREDICTED: Tribolium castaneum similar to CG2210-PA (LOC655847),
           mRNA
          Length = 751

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 567 aggcccctctggacgccgtcgggcttgatcatgatgaaggt 607
           ||||||||||||||||| || ||||||| ||| || |||||
Sbjct: 302 aggcccctctggacgccatcaggcttgaccataataaaggt 262

---

>ref|XM_780229.1| PREDICTED: Strongylocentrotus purpuratus similar to Nucleoside
           diphosphate kinase A (NDK A) (NDP kinase A) (Tumor
           metastatic process-associated protein) (Metastasis
           inhibition factor nm23) (nm23-H1) (Granzyme A-activated
           DNase) (GAAD) (LOC580157), mRNA
          Length = 537

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                            
Query: 290 gatgtcgacggcgaagtcaccacggatggtgcc 322
           ||||||||| | | |||||||||||||||||||
Sbjct: 408 gatgtcgacagagtagtcaccacggatggtgcc 376

---

>gb|DQ445499.1| Graphocephala atropunctata isolate WHGA0016 putative nucleoside
           diphosphate kinase mRNA, complete cds
          Length = 513

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 579 acgccgtcgggcttgatcatgatgaaggt 607
           |||||||||||||||| |||||| |||||
Sbjct: 98  acgccgtcgggcttgaccatgataaaggt 70

---

>dbj|AK061858.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-G07, full
           insert sequence
          Length = 1080

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 567 aggcccctctggacgccgtcgggcttgat 595
           |||||||| ||||||||||| ||||||||
Sbjct: 394 aggcccctttggacgccgtcaggcttgat 366

---

>gb|AY585937.1| Paxillus involutus strain ATCC 200175 nucleoside diphosphate kinase
           (ndkA) mRNA, complete cds
          Length = 591

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 222 gggaaccagagggcgatctccttcctggcattctcaactgagtcg 266
           |||||||| |||||||||||||||  ||| ||||| || ||||||
Sbjct: 455 gggaaccaaagggcgatctccttctcggcgttctcgacggagtcg 411

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                             
Query: 567      aggcccctctggacgccgtcgggcttgat 595
                |||||||| ||||||||||| ||||||||
Sbjct: 29442342 aggcccctttggacgccgtcaggcttgat 29442370

---

>dbj|AB121066.1| Halobacterium salinarum ndk gene for nucleoside diphosphate kinase,
           partial cds
          Length = 423

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 558 tcgccgatgaggcccctctggacgccgtcgggcttga 594
           ||||||||||| || | |||||||||||| |||||||
Sbjct: 56  tcgccgatgagcccgcgctggacgccgtccggcttga 20

---

>dbj|AK066391.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013067E14, full
           insert sequence
          Length = 1213

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 567 aggcccctctggacgccgtcgggcttgat 595
           |||||||| ||||||||||| ||||||||
Sbjct: 531 aggcccctttggacgccgtcaggcttgat 503

---

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 579     acgccgtcgggcttgatcatg 599
               |||||||||||||||||||||
Sbjct: 2498416 acgccgtcgggcttgatcatg 2498436



 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 415     cggagacgatgtactccacg 434
               ||||||||||||||||||||
Sbjct: 2569365 cggagacgatgtactccacg 2569346

---

>emb|CT032611.1| Platynereis dumerilii EST IB0AAA35BD04FM1
          Length = 759

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 576 tggacgccgtcgggcttgatcatgatgaa 604
           ||||| || ||||||||||||||||||||
Sbjct: 725 tggaccccatcgggcttgatcatgatgaa 753

---

>gb|AC144455.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBb0086G17, complete sequence
          Length = 134631

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 567   aggcccctctggacgccgtcgggcttgat 595
             |||||||| ||||||||||| ||||||||
Sbjct: 26612 aggcccctttggacgccgtcaggcttgat 26640

---

>emb|AL845442.7| Mouse DNA sequence from clone RP23-392D9 on chromosome 2, complete
             sequence
          Length = 192013

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 444   aagaagggtttggaggacaga 464
             |||||||||||||||||||||
Sbjct: 53685 aagaagggtttggaggacaga 53705

---

>gb|CP000097.1| Synechococcus sp. CC9902, complete genome
          Length = 2234828

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 309     ccacggatggtgccgggctc 328
               ||||||||||||||||||||
Sbjct: 2073845 ccacggatggtgccgggctc 2073864

---

>gb|AE017283.1| Propionibacterium acnes KPA171202, complete genome
          Length = 2560265

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 547    ggctgatgacctcgccgatg 566
              ||||||||||||||||||||
Sbjct: 630613 ggctgatgacctcgccgatg 630632

---

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 402     gcgacgaccgggccggagac 421
               ||||||||||||||||||||
Sbjct: 4819297 gcgacgaccgggccggagac 4819278

---

>gb|AC126023.3| Mus musculus BAC clone RP24-422I18 from chromosome 16, complete
             sequence
          Length = 198296

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 193   ggctgctcctccactcagca 212
             ||||||||||||||||||||
Sbjct: 12027 ggctgctcctccactcagca 12008

---

>gb|AC130843.3| Mus musculus BAC clone RP24-501N9 from chromosome 1, complete sequence
          Length = 141921

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 84    aatacaaatctcaaaactgt 103
             ||||||||||||||||||||
Sbjct: 50683 aatacaaatctcaaaactgt 50702

---

>ref|XM_753334.1| Ustilago maydis 521 hypothetical protein (UM02280.1) partial mRNA
          Length = 2751

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                        
Query: 359  cttgcgtccagtggcgacgacgctcttg 386
            ||||||||||| ||||||| ||||||||
Sbjct: 1372 cttgcgtccaggggcgacgccgctcttg 1399

---

>emb|CT025688.6| Mouse DNA sequence from clone RP24-310A8 on chromosome 9, complete
              sequence
          Length = 233365

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 82     gaaatacaaatctcaaaactgtaa 105
              |||||||||||||||| |||||||
Sbjct: 161004 gaaatacaaatctcaatactgtaa 161027

---

>gb|AC122026.3| Mus musculus BAC clone RP24-390D21 from chromosome 1, complete sequence
          Length = 205642

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 271    catggatgacattcctgccgatgt 294
              |||||||||||||||||| |||||
Sbjct: 161801 catggatgacattcctgctgatgt 161778

---

>gb|AC113272.11| Mus musculus chromosome 1, clone RP23-379C24, complete sequence
          Length = 170622

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 84   aatacaaatctcaaaactgt 103
            ||||||||||||||||||||
Sbjct: 5137 aatacaaatctcaaaactgt 5118

---

>emb|BX248409.5| Human DNA sequence from clone RP11-360D2 on chromosome 1 Contains the 5'
              end of a novel gene (FLJ45235), a novel gene, the 5' end of
              the gene for Kelch motif containing protein, a ribosomal
              protein S27 (metallopanstimulin 1)  (RPS27) pseudogene and
              a CpG island, complete sequence
          Length = 127227

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 83     aaatacaaatctcaaaactgtaaa 106
              |||||||||||||||||| |||||
Sbjct: 118372 aaatacaaatctcaaaacagtaaa 118349


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,783,412
Number of Sequences: 3902068
Number of extensions: 4783412
Number of successful extensions: 85328
Number of sequences better than 10.0: 277
Number of HSP's better than 10.0 without gapping: 274
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 83736
Number of HSP's gapped (non-prelim): 1463
length of query: 614
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 591
effective length of database: 17,143,297,704
effective search space: 10131688943064
effective search space used: 10131688943064
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---