ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd14g11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete ... 42 2.3
2emb|X69969.1|CRALDCHL C.reinhardtii mRNA for fructose-1,6-bispho... 42 2.3
3gb|AC117412.6| Homo sapiens 3 BAC RP11-52L19 (Roswell Park Cance... 42 2.3
4gb|S72951.1| Chlamydomonas reinhardtii fructosediphophate aldola... 42 2.3
5gb|AC019211.6| Homo sapiens BAC clone RP11-454J11 from 2, comple... 42 2.3
6emb|X85495.1|CRALD C.reinhardtii ald gene 42 2.3
7ref|NM_115029.1| Arabidopsis thaliana unknown protein AT3G51700 ... 40 9.0
8gb|AC169984.2| Mus musculus BAC clone RP23-450I9 from chromosome... 40 9.0
9ref|XM_710986.1| Candida albicans SC5314 agglutinin-like ALS6 pr... 40 9.0
10gb|BC028927.1| Mus musculus exocyst complex component 7, mRNA (c... 40 9.0
11gb|AC121894.2| Mus musculus BAC clone RP24-157H5 from 6, complet... 40 9.0
12ref|XM_773522.1| Giardia lamblia ATCC 50803 protein kinase (GLP_... 40 9.0
13emb|AL590105.19| Human DNA sequence from clone RP11-273H7 on chr... 40 9.0
14emb|AL132968.1|ATT18N14 Arabidopsis thaliana DNA chromosome 3, B... 40 9.0
15emb|AJ621385.1| Gallus gallus RAD50 gene (partial), IL5 gene, IR... 40 9.0
16gb|AC096888.2| Homo sapiens chromosome 3 clone RP11-14D22, compl... 40 9.0
17gb|AC099500.2| Homo sapiens chromosome 19 clone RP11-209J6, comp... 40 9.0
18gb|AC111149.4| Homo sapiens chromosome 8, clone RP11-434I12, com... 40 9.0
19dbj|AK140450.1| Mus musculus 10 days neonate medulla oblongata c... 40 9.0
20gb|AC103557.1| Homo sapiens chromosome 3 clone RP11-9A1, complet... 40 9.0
21dbj|AK167769.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 40 9.0
22dbj|AK169928.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 40 9.0
23dbj|AK162868.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 40 9.0
24dbj|AK087601.1| Mus musculus 2 days pregnant adult female oviduc... 40 9.0
25gb|AY225310.1| Candida albicans agglutinin-like protein 6 (ALS6)... 40 9.0
26gb|AC139769.1| Homo sapiens chromosome 19 clone RP11-255H23, com... 40 9.0
27ref|NM_016857.1| Mus musculus exocyst complex component 7 (Exoc7... 40 9.0
28gb|AY089206.1| Arabidopsis thaliana clone 94549 mRNA, complete s... 40 9.0
29gb|AF075293.1|AF075293 Candida albicans strain 1161 agglutinin-l... 40 9.0
30gb|AC138126.1| Homo sapiens chromosome 19 clone RP11-274A19, com... 40 9.0
31dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome 40 9.0
32dbj|AK173094.1| Mus musculus premature mRNA for mKIAA1067 protein 40 9.0
33gb|BC053710.1| Mus musculus exocyst complex component 7, mRNA (c... 40 9.0
34ref|XM_319833.2| Anopheles gambiae str. PEST ENSANGP00000005228 ... 40 9.0
35gb|AC159985.2| Gallus gallus BAC clone CH261-18F10 from chromoso... 40 9.0
36gb|AF014461.1|AF014461 Mus musculus EXO70 protein (Exo70) mRNA, ... 40 9.0
37emb|AL645861.12| Mouse DNA sequence from clone RP23-184G6 on chr... 40 9.0

>gb|CP000090.1| Ralstonia eutropha JMP134 chromosome 1, complete sequence
          Length = 3806533

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 390    cgagctggaggtgcaggaggccatcaatg 418
              ||||| ||||||||||| |||||||||||
Sbjct: 623710 cgagcaggaggtgcaggcggccatcaatg 623682



to top

>emb|X69969.1|CRALDCHL C.reinhardtii mRNA for fructose-1,6-bisphosphate aldolase
          Length = 1737

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 394 ctggaggtgcaggaggccatc 414
           |||||||||||||||||||||
Sbjct: 722 ctggaggtgcaggaggccatc 742



to top

>gb|AC117412.6| Homo sapiens 3 BAC RP11-52L19 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 52982

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 287   aacaacaacagttgctgttga 307
             |||||||||||||||||||||
Sbjct: 21091 aacaacaacagttgctgttga 21111



to top

>gb|S72951.1| Chlamydomonas reinhardtii fructosediphophate aldolase gene,
           complete cds; and unknown gene; nuclear genes for
           chloroplast products
          Length = 1717

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 394 ctggaggtgcaggaggccatc 414
           |||||||||||||||||||||
Sbjct: 721 ctggaggtgcaggaggccatc 741



to top

>gb|AC019211.6| Homo sapiens BAC clone RP11-454J11 from 2, complete sequence
          Length = 167471

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 303   gttgacagagggctggcgagg 323
             |||||||||||||||||||||
Sbjct: 22573 gttgacagagggctggcgagg 22593



to top

>emb|X85495.1|CRALD C.reinhardtii ald gene
          Length = 3676

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 394  ctggaggtgcaggaggccatc 414
            |||||||||||||||||||||
Sbjct: 1895 ctggaggtgcaggaggccatc 1915



to top

>ref|NM_115029.1| Arabidopsis thaliana unknown protein AT3G51700 mRNA, complete cds
          Length = 1256

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 236 tcaagactttctcaccatga 255
           ||||||||||||||||||||
Sbjct: 756 tcaagactttctcaccatga 737



to top

>gb|AC169984.2| Mus musculus BAC clone RP23-450I9 from chromosome 6, complete sequence
          Length = 181976

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 396    ggaggtgcaggaggccatca 415
              ||||||||||||||||||||
Sbjct: 107025 ggaggtgcaggaggccatca 107044



to top

>ref|XM_710986.1| Candida albicans SC5314 agglutinin-like ALS6 protein (CaO19_7414),
            mRNA
          Length = 4101

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 286  caacaacaacagttgctgtt 305
            ||||||||||||||||||||
Sbjct: 1189 caacaacaacagttgctgtt 1170



to top

>gb|BC028927.1| Mus musculus exocyst complex component 7, mRNA (cDNA clone
           MGC:30390 IMAGE:4208803), complete cds
          Length = 2102

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 390 cgagctggaggtgcaggagg 409
           ||||||||||||||||||||
Sbjct: 575 cgagctggaggtgcaggagg 594



to top

>gb|AC121894.2| Mus musculus BAC clone RP24-157H5 from 6, complete sequence
          Length = 148613

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 396  ggaggtgcaggaggccatca 415
            ||||||||||||||||||||
Sbjct: 2368 ggaggtgcaggaggccatca 2387



to top

>ref|XM_773522.1| Giardia lamblia ATCC 50803 protein kinase (GLP_111_73516_78324)
            partial mRNA
          Length = 4809

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 181  ctgcgtgtgcttgtgcaaaa 200
            ||||||||||||||||||||
Sbjct: 2533 ctgcgtgtgcttgtgcaaaa 2552



to top

>emb|AL590105.19| Human DNA sequence from clone RP11-273H7 on chromosome 10 Contains the
             5' end of the gene for protein kinase (PKE), gene
             KIAA1674, gene LOC170394, the 5' end of a novel gene and
             six CpG islands, complete sequence
          Length = 132772

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 322   gggcagttggggatggacag 341
             ||||||||||||||||||||
Sbjct: 23504 gggcagttggggatggacag 23523



to top

>emb|AL132968.1|ATT18N14 Arabidopsis thaliana DNA chromosome 3, BAC clone T18N14
          Length = 79867

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 236   tcaagactttctcaccatga 255
             ||||||||||||||||||||
Sbjct: 60966 tcaagactttctcaccatga 60985



to top

>emb|AJ621385.1| Gallus gallus RAD50 gene (partial), IL5 gene, IRF1 gene, OCTN2 gene and
             OCTN1 gene (partial)
          Length = 113629

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 392   agctggaggtgcaggaggcc 411
             ||||||||||||||||||||
Sbjct: 64399 agctggaggtgcaggaggcc 64380



to top

>gb|AC096888.2| Homo sapiens chromosome 3 clone RP11-14D22, complete sequence
          Length = 176421

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 167  tctactctgcgctactgcgtgtgc 190
            |||||||||| |||||||||||||
Sbjct: 1547 tctactctgctctactgcgtgtgc 1570



to top

>gb|AC099500.2| Homo sapiens chromosome 19 clone RP11-209J6, complete sequence
          Length = 138627

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 244    ttctcaccatgaattcgtga 263
              ||||||||||||||||||||
Sbjct: 111065 ttctcaccatgaattcgtga 111084



to top

>gb|AC111149.4| Homo sapiens chromosome 8, clone RP11-434I12, complete sequence
          Length = 135213

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 466   ggtgcgcagaggaggcggcacggg 489
             ||||||||| ||||||||||||||
Sbjct: 98810 ggtgcgcagcggaggcggcacggg 98833



to top

>dbj|AK140450.1| Mus musculus 10 days neonate medulla oblongata cDNA, RIKEN
           full-length enriched library, clone:B830030O19
           product:exocyst complex component 7, full insert
           sequence
          Length = 3313

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 390 cgagctggaggtgcaggagg 409
           ||||||||||||||||||||
Sbjct: 573 cgagctggaggtgcaggagg 592



to top

>gb|AC103557.1| Homo sapiens chromosome 3 clone RP11-9A1, complete sequence
          Length = 159066

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 167    tctactctgcgctactgcgtgtgc 190
              |||||||||| |||||||||||||
Sbjct: 155285 tctactctgctctactgcgtgtgc 155308



to top

>dbj|AK167769.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length enriched library,
           clone:I730011M14 product:exocyst complex component 7,
           full insert sequence
          Length = 2083

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 390 cgagctggaggtgcaggagg 409
           ||||||||||||||||||||
Sbjct: 582 cgagctggaggtgcaggagg 601



to top

>dbj|AK169928.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630004J16
           product:exocyst complex component 7, full insert
           sequence
          Length = 2085

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 390 cgagctggaggtgcaggagg 409
           ||||||||||||||||||||
Sbjct: 586 cgagctggaggtgcaggagg 605



to top

>dbj|AK162868.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length
           enriched library, clone:A230067I15 product:exocyst
           complex component 7, full insert sequence
          Length = 3738

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 390 cgagctggaggtgcaggagg 409
           ||||||||||||||||||||
Sbjct: 585 cgagctggaggtgcaggagg 604



to top

>dbj|AK087601.1| Mus musculus 2 days pregnant adult female oviduct cDNA, RIKEN
           full-length enriched library, clone:E230023C22
           product:exocyst component protein 70 kDa homolog (S.
           cerevisiae), full insert sequence
          Length = 2088

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 390 cgagctggaggtgcaggagg 409
           ||||||||||||||||||||
Sbjct: 587 cgagctggaggtgcaggagg 606



to top

>gb|AY225310.1| Candida albicans agglutinin-like protein 6 (ALS6) gene, complete cds
          Length = 4101

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 286  caacaacaacagttgctgtt 305
            ||||||||||||||||||||
Sbjct: 1189 caacaacaacagttgctgtt 1170



to top

>gb|AC139769.1| Homo sapiens chromosome 19 clone RP11-255H23, complete sequence
          Length = 136449

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 244   ttctcaccatgaattcgtga 263
             ||||||||||||||||||||
Sbjct: 62116 ttctcaccatgaattcgtga 62135



to top

>ref|NM_016857.1| Mus musculus exocyst complex component 7 (Exoc7), mRNA
          Length = 2094

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 390 cgagctggaggtgcaggagg 409
           ||||||||||||||||||||
Sbjct: 534 cgagctggaggtgcaggagg 553



to top

>gb|AY089206.1| Arabidopsis thaliana clone 94549 mRNA, complete sequence
          Length = 1256

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 236 tcaagactttctcaccatga 255
           ||||||||||||||||||||
Sbjct: 757 tcaagactttctcaccatga 738



to top

>gb|AF075293.1|AF075293 Candida albicans strain 1161 agglutinin-like protein 6 (ALS6) gene,
            complete cds
          Length = 4332

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 286  caacaacaacagttgctgtt 305
            ||||||||||||||||||||
Sbjct: 1189 caacaacaacagttgctgtt 1170



to top

>gb|AC138126.1| Homo sapiens chromosome 19 clone RP11-274A19, complete sequence
          Length = 169063

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 244    ttctcaccatgaattcgtga 263
              ||||||||||||||||||||
Sbjct: 141943 ttctcaccatgaattcgtga 141962



to top

>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome
          Length = 4659019

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 510     ccggatctggtcggtggcgc 529
               ||||||||||||||||||||
Sbjct: 2042563 ccggatctggtcggtggcgc 2042544



to top

>dbj|AK173094.1| Mus musculus premature mRNA for mKIAA1067 protein
          Length = 6719

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 390 cgagctggaggtgcaggagg 409
           ||||||||||||||||||||
Sbjct: 575 cgagctggaggtgcaggagg 594



to top

>gb|BC053710.1| Mus musculus exocyst complex component 7, mRNA (cDNA clone
           MGC:60517 IMAGE:30056570), complete cds
          Length = 2111

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 390 cgagctggaggtgcaggagg 409
           ||||||||||||||||||||
Sbjct: 586 cgagctggaggtgcaggagg 605



to top

>ref|XM_319833.2| Anopheles gambiae str. PEST ENSANGP00000005228
           (ENSANGG00000004028), partial mRNA
          Length = 660

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 389 tcgagctggaggtgcaggag 408
           ||||||||||||||||||||
Sbjct: 464 tcgagctggaggtgcaggag 483



to top

>gb|AC159985.2| Gallus gallus BAC clone CH261-18F10 from chromosome unknown, complete
              sequence
          Length = 211288

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 392    agctggaggtgcaggaggcc 411
              ||||||||||||||||||||
Sbjct: 197373 agctggaggtgcaggaggcc 197354



to top

>gb|AF014461.1|AF014461 Mus musculus EXO70 protein (Exo70) mRNA, complete cds
          Length = 2094

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 390 cgagctggaggtgcaggagg 409
           ||||||||||||||||||||
Sbjct: 534 cgagctggaggtgcaggagg 553



to top

>emb|AL645861.12| Mouse DNA sequence from clone RP23-184G6 on chromosome 11, complete
             sequence
          Length = 212385

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 390   cgagctggaggtgcaggagg 409
             ||||||||||||||||||||
Sbjct: 49205 cgagctggaggtgcaggagg 49186


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,436,640
Number of Sequences: 3902068
Number of extensions: 4436640
Number of successful extensions: 69036
Number of sequences better than 10.0: 37
Number of HSP's better than 10.0 without gapping: 37
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 68930
Number of HSP's gapped (non-prelim): 106
length of query: 660
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 637
effective length of database: 17,143,297,704
effective search space: 10920280637448
effective search space used: 10920280637448
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top