Clone Name | rbasd14g10 |
---|---|
Clone Library Name | barley_pub |
No. | Definition | Score (bits) |
E Value |
1 | gb|U49482.1|HVU49482 Hordeum vulgare low temperature-responsive ... | 404 | e-110 | 2 | dbj|AB207971.1| Lolium perenne gene for glycine-rich RNA-binding... | 42 | 0.73 | 3 | gb|AC122900.3| Mus musculus BAC clone RP23-39N24 from 15, comple... | 40 | 2.9 |
---|
>gb|U49482.1|HVU49482 Hordeum vulgare low temperature-responsive RNA-binding protein (blt801) mRNA, complete cds Length = 806 Score = 404 bits (204), Expect = e-110 Identities = 221/226 (97%), Gaps = 2/226 (0%) Strand = Plus / Minus Query: 3 gcgaacggaacaggggaacggtaacaagtagcacggaacggtagcgtcacatctaacggt 62 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 750 gcgaacggaacaggggaacggtaacaagtagcacggaacggtagcgtcacatctaacggt 691 Query: 63 agccagagcatctcagaacctaagcgatggagcgagatctagggttactcgggagcgagc 122 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 690 agccagagcatctcagaacctaagcgatggagcgagatctagggttactcgggagcgagc 631 Query: 123 gataacacggt--acaggtaaacgaaaaggatggatcgataactaggataactggccgac 180 ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 630 gataacacggtagacaggtaaacgaaaaggatagatcgataactaggataactggccgac 571 Query: 181 aaggggccccaccattcactccctccagttgccgncgccgaagccg 226 |||||||||||||||||||||||||||||||||| ||||| ||||| Sbjct: 570 aaggggccccaccattcactccctccagttgccgccgccggagccg 525
>dbj|AB207971.1| Lolium perenne gene for glycine-rich RNA-binding protein, complete cds Length = 2129 Score = 42.1 bits (21), Expect = 0.73 Identities = 24/25 (96%) Strand = Plus / Minus Query: 81 cctaagcgatggagcgagatctagg 105 ||||||||||||||||||| ||||| Sbjct: 1884 cctaagcgatggagcgagacctagg 1860 Score = 42.1 bits (21), Expect = 0.73 Identities = 49/57 (85%), Gaps = 1/57 (1%) Strand = Plus / Minus Query: 158 gataactaggataactggccgacaaggggccccaccattcactccctccagttgccg 214 |||| ||||||||||||||| || | |||||||||| ||| | ||||||||||||| Sbjct: 1813 gatagctaggataactggcc-actcgtggccccaccaatcagttcctccagttgccg 1758
>gb|AC122900.3| Mus musculus BAC clone RP23-39N24 from 15, complete sequence Length = 203855 Score = 40.1 bits (20), Expect = 2.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 188 cccaccattcactccctcca 207 |||||||||||||||||||| Sbjct: 86463 cccaccattcactccctcca 86482 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 974,455 Number of Sequences: 3902068 Number of extensions: 974455 Number of successful extensions: 54593 Number of sequences better than 10.0: 3 Number of HSP's better than 10.0 without gapping: 3 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 54584 Number of HSP's gapped (non-prelim): 7 length of query: 226 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 204 effective length of database: 17,147,199,772 effective search space: 3498028753488 effective search space used: 3498028753488 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)