ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd13p12 |
|---|---|
| Clone Library Name | barley_pub |
>ref|XM_464247.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2787 Score = 432 bits (218), Expect = e-118 Identities = 466/548 (85%), Gaps = 12/548 (2%) Strand = Plus / Minus Query: 196 gacatctccctgaatcttgcaattgccttcttctggattatggttttatagctgtcgccg 255 |||||||||||||||||||| || |||||||||||||| |||||||| ||||| || || Sbjct: 2783 gacatctccctgaatcttgccatagccttcttctggatgatggttttgtagctatcacca 2724 Query: 256 gctcgggcctccagcgatggatcggc---tctcttctgctgactaccaaggccagctctc 312 ||| | ||||||||||| || || | | || ||||||||| ||||| ||||| ||| Sbjct: 2723 gcttgcgcctccagcgacgggtcagaagatttccgctgctgacttccaagtccagccctc 2664 Query: 313 acatcgccaggcttggcctgcaccggctccttgatgccactaccatcctttccaagaccc 372 |||||| ||| || |||||||| || |||||||||||||||||| ||||| |||||| Sbjct: 2663 acatcgacagatttagcctgcactggttccttgatgccactaccagtttttccgagaccc 2604 Query: 373 agtccttcttgccagcccatgttgcgcagaatacgattgcccacattgttttcgtctatt 432 |||||||||||||| ||||| ||||||||||||||||||||||||||| | || |||||| Sbjct: 2603 agtccttcttgccaacccatattgcgcagaatacgattgcccacattgctctcatctatt 2544 Query: 433 gctctgtcagcagtgatcacctcataattttcagtgttgtcaatttcaccaacggaacgt 492 ||||| ||||||||||| ||||||||||||||||| ||| |||||||||| |||||| Sbjct: 2543 gctctatcagcagtgataacctcataattttcagtattgccaatttcaccgctagaacgt 2484 Query: 493 tcacccacccctggaggaaatggcattgatcccatctcacttgaaccctttcgagacgaa 552 ||||||||||||||||||||||||||||| ||||||||||||| |||| ||||| | Sbjct: 2483 tcacccacccctggaggaaatggcattgaccccatctcacttggaccccttcga---ggg 2427 Query: 553 tattcaccagttgtatccagtccatcat------tggcaagtgatgaagatgatccgtat 606 || |||||||||| |||||||||||||| | ||||||| ||||||||||| ||| Sbjct: 2426 tactcaccagttggatccagtccatcattatcacttccaagtgaagaagatgatccatat 2367 Query: 607 agacttcgtctttctgcagcccgatctctgtactgtgattgtcctggtgcctcagagaac 666 ||| |||| ||||||||||||||||||||||||||||| |||||||| |||||||| ||| Sbjct: 2366 agatttcgcctttctgcagcccgatctctgtactgtgaatgtcctggagcctcagaaaac 2307 Query: 667 cgacgcttagcactcccggaaactccaggtgaagcatatgatcctaganaggataaatct 726 ||||| ||| ||||||| |||||||||| || || ||| ||| ||||| ||||| ||| Sbjct: 2306 cgacgtttaccactccctgaaactccagatggagtataagatgctagagcagataattct 2247 Query: 727 gttttgaa 734 |||||||| Sbjct: 2246 gttttgaa 2239
>ref|XM_464248.1| Oryza sativa (japonica cultivar-group), mRNA Length = 4183 Score = 337 bits (170), Expect = 3e-89 Identities = 320/370 (86%), Gaps = 9/370 (2%) Strand = Plus / Minus Query: 371 ccagtccttcttgccagcccatgttgcgcagaatacgattgcccacattgttttcgtcta 430 |||||||||||||||| ||||| ||||||||||||||||||||||||||| | || |||| Sbjct: 3376 ccagtccttcttgccaacccatattgcgcagaatacgattgcccacattgctctcatcta 3317 Query: 431 ttgctctgtcagcagtgatcacctcataattttcagtgttgtcaatttcaccaacggaac 490 ||||||| ||||||||||| ||||||||||||||||| ||| |||||||||| |||| Sbjct: 3316 ttgctctatcagcagtgataacctcataattttcagtattgccaatttcaccgctagaac 3257 Query: 491 gttcacccacccctggaggaaatggcattgatcccatctcacttgaaccctttcgagacg 550 ||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||| | Sbjct: 3256 gttcacccacccctggaggaaatggcattgaccccatctcacttggaccccttcga---g 3200 Query: 551 aatattcaccagttgtatccagtccatcat------tggcaagtgatgaagatgatccgt 604 || |||||||||| |||||||||||||| | ||||||| ||||||||||| | Sbjct: 3199 ggtactcaccagttggatccagtccatcattatcacttccaagtgaagaagatgatccat 3140 Query: 605 atagacttcgtctttctgcagcccgatctctgtactgtgattgtcctggtgcctcagaga 664 ||||| |||| ||||||||||||||||||||||||||||| |||||||| |||||||| | Sbjct: 3139 atagatttcgcctttctgcagcccgatctctgtactgtgaatgtcctggagcctcagaaa 3080 Query: 665 accgacgcttagcactcccggaaactccaggtgaagcatatgatcctaganaggataaat 724 ||||||| ||| ||||||| |||||||||| || || ||| ||| ||||| ||||| | Sbjct: 3079 accgacgtttaccactccctgaaactccagatggagtataagatgctagagcagataatt 3020 Query: 725 ctgttttgaa 734 |||||||||| Sbjct: 3019 ctgttttgaa 3010 Score = 101 bits (51), Expect = 3e-18 Identities = 137/165 (83%), Gaps = 3/165 (1%) Strand = Plus / Minus Query: 196 gacatctccctgaatcttgcaattgccttcttctggattatggttttatagctgtcgccg 255 |||||||||||||||||||| || |||||||||||||| |||||||| ||||| || || Sbjct: 4125 gacatctccctgaatcttgccatagccttcttctggatgatggttttgtagctatcacca 4066 Query: 256 gctcgggcctccagcgatggatc---ggctctcttctgctgactaccaaggccagctctc 312 ||| | ||||||||||| || || | | || ||||||||| ||||| ||||| ||| Sbjct: 4065 gcttgcgcctccagcgacgggtcagaagatttccgctgctgacttccaagtccagccctc 4006 Query: 313 acatcgccaggcttggcctgcaccggctccttgatgccactacca 357 |||||| ||| || |||||||| || |||||||||||||||||| Sbjct: 4005 acatcgacagatttagcctgcactggttccttgatgccactacca 3961
>dbj|AK069161.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023008A08, full insert sequence Length = 4183 Score = 337 bits (170), Expect = 3e-89 Identities = 320/370 (86%), Gaps = 9/370 (2%) Strand = Plus / Minus Query: 371 ccagtccttcttgccagcccatgttgcgcagaatacgattgcccacattgttttcgtcta 430 |||||||||||||||| ||||| ||||||||||||||||||||||||||| | || |||| Sbjct: 3376 ccagtccttcttgccaacccatattgcgcagaatacgattgcccacattgctctcatcta 3317 Query: 431 ttgctctgtcagcagtgatcacctcataattttcagtgttgtcaatttcaccaacggaac 490 ||||||| ||||||||||| ||||||||||||||||| ||| |||||||||| |||| Sbjct: 3316 ttgctctatcagcagtgataacctcataattttcagtattgccaatttcaccgctagaac 3257 Query: 491 gttcacccacccctggaggaaatggcattgatcccatctcacttgaaccctttcgagacg 550 ||||||||||||||||||||||||||||||| ||||||||||||| |||| ||||| | Sbjct: 3256 gttcacccacccctggaggaaatggcattgaccccatctcacttggaccccttcga---g 3200 Query: 551 aatattcaccagttgtatccagtccatcat------tggcaagtgatgaagatgatccgt 604 || |||||||||| |||||||||||||| | ||||||| ||||||||||| | Sbjct: 3199 ggtactcaccagttggatccagtccatcattatcacttccaagtgaagaagatgatccat 3140 Query: 605 atagacttcgtctttctgcagcccgatctctgtactgtgattgtcctggtgcctcagaga 664 ||||| |||| ||||||||||||||||||||||||||||| |||||||| |||||||| | Sbjct: 3139 atagatttcgcctttctgcagcccgatctctgtactgtgaatgtcctggagcctcagaaa 3080 Query: 665 accgacgcttagcactcccggaaactccaggtgaagcatatgatcctaganaggataaat 724 ||||||| ||| ||||||| |||||||||| || || ||| ||| ||||| ||||| | Sbjct: 3079 accgacgtttaccactccctgaaactccagatggagtataagatgctagagcagataatt 3020 Query: 725 ctgttttgaa 734 |||||||||| Sbjct: 3019 ctgttttgaa 3010 Score = 101 bits (51), Expect = 3e-18 Identities = 137/165 (83%), Gaps = 3/165 (1%) Strand = Plus / Minus Query: 196 gacatctccctgaatcttgcaattgccttcttctggattatggttttatagctgtcgccg 255 |||||||||||||||||||| || |||||||||||||| |||||||| ||||| || || Sbjct: 4125 gacatctccctgaatcttgccatagccttcttctggatgatggttttgtagctatcacca 4066 Query: 256 gctcgggcctccagcgatggatc---ggctctcttctgctgactaccaaggccagctctc 312 ||| | ||||||||||| || || | | || ||||||||| ||||| ||||| ||| Sbjct: 4065 gcttgcgcctccagcgacgggtcagaagatttccgctgctgacttccaagtccagccctc 4006 Query: 313 acatcgccaggcttggcctgcaccggctccttgatgccactacca 357 |||||| ||| || |||||||| || |||||||||||||||||| Sbjct: 4005 acatcgacagatttagcctgcactggttccttgatgccactacca 3961
>gb|AY107956.1| Zea mays PCO086166 mRNA sequence Length = 761 Score = 246 bits (124), Expect = 9e-62 Identities = 288/339 (84%), Gaps = 4/339 (1%) Strand = Plus / Minus Query: 356 catcctttccaagacccagtccttcttgccagcccatgttgcgcagaatacgattgccca 415 |||||||||| ||||||||||| || ||||| ||||||||||| ||||| || ||||||| Sbjct: 436 catcctttccgagacccagtccctcctgccaccccatgttgcgtagaatgcggttgccca 377 Query: 416 cattgttttcgtctattgctctgtcagcagtgatcacctcataattttcagtgttgtcaa 475 ||||| |||| || |||||||| ||||| || || || ||||| ||||| ||||| ||| Sbjct: 376 cattgctttcatcgattgctctatcagcggtaataacttcatagttttcgctgttgccaa 317 Query: 476 tttcaccaacggaacgttcacccacccctggaggaaatggcattgatcccatctcacttg 535 |||||||| ||||||||||||||| || |||||||| ||||| || || |||||||||| Sbjct: 316 tttcaccactggaacgttcacccacaccaggaggaaacggcatcgaccctatctcacttg 257 Query: 536 aaccctttcgagacgaatattcaccagttgtatccagtccatcattggcaagtg--atga 593 |||||||||| |||| ||| |||||||||| ||||| |||| || | | |||| ||| Sbjct: 256 aaccctttcgggacggatagtcaccagttgaatccaatccaacagtatc-agtgccatg- 199 Query: 594 agatgatccgtatagacttcgtctttctgcagcccgatctctgtactgtgattgtcctgg 653 ||||||||| || ||| |||||||||||||||| ||||| |||||||| |||||||| || Sbjct: 198 agatgatccatacagatttcgtctttctgcagctcgatccctgtactgggattgtcccgg 139 Query: 654 tgcctcagagaaccgacgcttagcactcccggaaactcc 692 ||||||||| |||||||| ||| ||||||| |||||||| Sbjct: 138 tgcctcagaaaaccgacgtttaccactcccagaaactcc 100 Score = 85.7 bits (43), Expect = 2e-13 Identities = 73/83 (87%) Strand = Plus / Minus Query: 196 gacatctccctgaatcttgcaattgccttcttctggattatggttttatagctgtcgccg 255 ||||||||| |||||||||| || |||||||||||||| |||||||| |||||||| ||| Sbjct: 596 gacatctccttgaatcttgccatggccttcttctggatgatggttttgtagctgtccccg 537 Query: 256 gctcgggcctccagcgatggatc 278 ||| |||| || || |||||||| Sbjct: 536 gcttgggcttcaagggatggatc 514
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 224 bits (113), Expect = 3e-55 Identities = 161/177 (90%) Strand = Plus / Plus Query: 371 ccagtccttcttgccagcccatgttgcgcagaatacgattgcccacattgttttcgtcta 430 |||||||||||||||| ||||| ||||||||||||||||||||||||||| | || |||| Sbjct: 3624590 ccagtccttcttgccaacccatattgcgcagaatacgattgcccacattgctctcatcta 3624649 Query: 431 ttgctctgtcagcagtgatcacctcataattttcagtgttgtcaatttcaccaacggaac 490 ||||||| ||||||||||| ||||||||||||||||| ||| |||||||||| |||| Sbjct: 3624650 ttgctctatcagcagtgataacctcataattttcagtattgccaatttcaccgctagaac 3624709 Query: 491 gttcacccacccctggaggaaatggcattgatcccatctcacttgaaccctttcgag 547 ||||||||||||||||||||||||||||||| ||||||||||||| |||| |||||| Sbjct: 3624710 gttcacccacccctggaggaaatggcattgaccccatctcacttggaccccttcgag 3624766 Score = 151 bits (76), Expect = 4e-33 Identities = 132/151 (87%) Strand = Plus / Plus Query: 584 caagtgatgaagatgatccgtatagacttcgtctttctgcagcccgatctctgtactgtg 643 ||||||| ||||||||||| |||||| |||| |||||||||||||||||||||||||||| Sbjct: 3625236 caagtgaagaagatgatccatatagatttcgcctttctgcagcccgatctctgtactgtg 3625295 Query: 644 attgtcctggtgcctcagagaaccgacgcttagcactcccggaaactccaggtgaagcat 703 | |||||||| |||||||| |||||||| ||| ||||||| |||||||||| || || || Sbjct: 3625296 aatgtcctggagcctcagaaaaccgacgtttaccactccctgaaactccagatggagtat 3625355 Query: 704 atgatcctaganaggataaatctgttttgaa 734 | ||| ||||| ||||| ||||||||||| Sbjct: 3625356 aagatgctagagcagataattctgttttgaa 3625386 Score = 101 bits (51), Expect = 3e-18 Identities = 137/165 (83%), Gaps = 3/165 (1%) Strand = Plus / Plus Query: 196 gacatctccctgaatcttgcaattgccttcttctggattatggttttatagctgtcgccg 255 |||||||||||||||||||| || |||||||||||||| |||||||| ||||| || || Sbjct: 3623841 gacatctccctgaatcttgccatagccttcttctggatgatggttttgtagctatcacca 3623900 Query: 256 gctcgggcctccagcgatggatc---ggctctcttctgctgactaccaaggccagctctc 312 ||| | ||||||||||| || || | | || ||||||||| ||||| ||||| ||| Sbjct: 3623901 gcttgcgcctccagcgacgggtcagaagatttccgctgctgacttccaagtccagccctc 3623960 Query: 313 acatcgccaggcttggcctgcaccggctccttgatgccactacca 357 |||||| ||| || |||||||| || |||||||||||||||||| Sbjct: 3623961 acatcgacagatttagcctgcactggttccttgatgccactacca 3624005
>dbj|AP005804.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0085K21 Length = 180714 Score = 224 bits (113), Expect = 3e-55 Identities = 161/177 (90%) Strand = Plus / Plus Query: 371 ccagtccttcttgccagcccatgttgcgcagaatacgattgcccacattgttttcgtcta 430 |||||||||||||||| ||||| ||||||||||||||||||||||||||| | || |||| Sbjct: 105880 ccagtccttcttgccaacccatattgcgcagaatacgattgcccacattgctctcatcta 105939 Query: 431 ttgctctgtcagcagtgatcacctcataattttcagtgttgtcaatttcaccaacggaac 490 ||||||| ||||||||||| ||||||||||||||||| ||| |||||||||| |||| Sbjct: 105940 ttgctctatcagcagtgataacctcataattttcagtattgccaatttcaccgctagaac 105999 Query: 491 gttcacccacccctggaggaaatggcattgatcccatctcacttgaaccctttcgag 547 ||||||||||||||||||||||||||||||| ||||||||||||| |||| |||||| Sbjct: 106000 gttcacccacccctggaggaaatggcattgaccccatctcacttggaccccttcgag 106056 Score = 151 bits (76), Expect = 4e-33 Identities = 132/151 (87%) Strand = Plus / Plus Query: 584 caagtgatgaagatgatccgtatagacttcgtctttctgcagcccgatctctgtactgtg 643 ||||||| ||||||||||| |||||| |||| |||||||||||||||||||||||||||| Sbjct: 106526 caagtgaagaagatgatccatatagatttcgcctttctgcagcccgatctctgtactgtg 106585 Query: 644 attgtcctggtgcctcagagaaccgacgcttagcactcccggaaactccaggtgaagcat 703 | |||||||| |||||||| |||||||| ||| ||||||| |||||||||| || || || Sbjct: 106586 aatgtcctggagcctcagaaaaccgacgtttaccactccctgaaactccagatggagtat 106645 Query: 704 atgatcctaganaggataaatctgttttgaa 734 | ||| ||||| ||||| ||||||||||| Sbjct: 106646 aagatgctagagcagataattctgttttgaa 106676 Score = 101 bits (51), Expect = 3e-18 Identities = 137/165 (83%), Gaps = 3/165 (1%) Strand = Plus / Plus Query: 196 gacatctccctgaatcttgcaattgccttcttctggattatggttttatagctgtcgccg 255 |||||||||||||||||||| || |||||||||||||| |||||||| ||||| || || Sbjct: 105131 gacatctccctgaatcttgccatagccttcttctggatgatggttttgtagctatcacca 105190 Query: 256 gctcgggcctccagcgatggatc---ggctctcttctgctgactaccaaggccagctctc 312 ||| | ||||||||||| || || | | || ||||||||| ||||| ||||| ||| Sbjct: 105191 gcttgcgcctccagcgacgggtcagaagatttccgctgctgacttccaagtccagccctc 105250 Query: 313 acatcgccaggcttggcctgcaccggctccttgatgccactacca 357 |||||| ||| || |||||||| || |||||||||||||||||| Sbjct: 105251 acatcgacagatttagcctgcactggttccttgatgccactacca 105295
>gb|AY110876.1| Zea mays CL9110_-1 mRNA sequence Length = 635 Score = 143 bits (72), Expect = 1e-30 Identities = 153/180 (85%) Strand = Plus / Plus Query: 371 ccagtccttcttgccagcccatgttgcgcagaatacgattgcccacattgttttcgtcta 430 ||||||| |||||||| ||||||||||| |||||||| || ||||||||| ||||||| | Sbjct: 369 ccagtccctcttgccaacccatgttgcgtagaatacggttacccacattgctttcgtcga 428 Query: 431 ttgctctgtcagcagtgatcacctcataattttcagtgttgtcaatttcaccaacggaac 490 |||| || ||||| || || || ||||| ||||| ||||| ||||||||||| |||| Sbjct: 429 ttgcgctatcagcggtaataacttcatagttttcgttgttgccaatttcaccattagaac 488 Query: 491 gttcacccacccctggaggaaatggcattgatcccatctcacttgaaccctttcgagacg 550 |||||||||| || |||||||||||||| || || |||||||||| ||||||||| |||| Sbjct: 489 gttcacccacgccaggaggaaatggcatcgaccctatctcacttggaccctttcgggacg 548
>gb|CP000057.1| Haemophilus influenzae strain 86-028NP, complete genome Length = 1913428 Score = 42.1 bits (21), Expect = 2.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 51 ttgaattacaccaagaaatat 71 ||||||||||||||||||||| Sbjct: 1620749 ttgaattacaccaagaaatat 1620729
>gb|AC006970.6| Homo sapiens PAC clone RP4-725G10 from 7, complete sequence Length = 136098 Score = 42.1 bits (21), Expect = 2.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 430 attgctctgtcagcagtgatc 450 ||||||||||||||||||||| Sbjct: 103607 attgctctgtcagcagtgatc 103587
>gb|L42023.1| Haemophilus influenzae Rd KW20, complete genome Length = 1830138 Score = 42.1 bits (21), Expect = 2.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 51 ttgaattacaccaagaaatat 71 ||||||||||||||||||||| Sbjct: 1475280 ttgaattacaccaagaaatat 1475300 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 6,320,214 Number of Sequences: 3902068 Number of extensions: 6320214 Number of successful extensions: 113082 Number of sequences better than 10.0: 10 Number of HSP's better than 10.0 without gapping: 10 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 112993 Number of HSP's gapped (non-prelim): 84 length of query: 755 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 732 effective length of database: 17,143,297,704 effective search space: 12548893919328 effective search space used: 12548893919328 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 21 (42.1 bits)
