>gb|AC183962.3| Pan troglodytes BAC clone CH251-711F5 from chromosome 6, complete
             sequence
          Length = 196547

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 45    gatacagtttctgtcctcaag 65
             |||||||||||||||||||||
Sbjct: 54519 gatacagtttctgtcctcaag 54499

>gb|CP000099.1| Methanosarcina barkeri str. fusaro chromosome 1, complete sequence
          Length = 4837408

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 140   tgttgctaagaatgtacatg 159
             ||||||||||||||||||||
Sbjct: 78677 tgttgctaagaatgtacatg 78658

>emb|BX005072.20| Human DNA sequence from clone XXyac-59F3 on chromosome 10 Contains the
             5' end of a novel gene, a novel gene (MGC35285) and a CpG
             island, complete sequence
          Length = 97407

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    tacagtttctgtcctcaaga 66
             ||||||||||||||||||||
Sbjct: 20929 tacagtttctgtcctcaaga 20910

>emb|AL450334.15| Human DNA sequence from clone RP11-556L1 on chromosome 10 Contains gene
             DKFZP566K0524, the gene for a novel protein similar to
             tyrosine phosphatase (MGC35285), the 3' end of a KIAA0187
             pseudogene, the 3' end of a novel gene, the gene for a
             novel protein similar to ARF GTPase-activating protein
             (MRIP2) and a CpG island, complete sequence
          Length = 171930

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    tacagtttctgtcctcaaga 66
             ||||||||||||||||||||
Sbjct: 40438 tacagtttctgtcctcaaga 40419

>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome
          Length = 3046682

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 294     aacagcaccggcagcaaaat 313
               ||||||||||||||||||||
Sbjct: 1192829 aacagcaccggcagcaaaat 1192810

>gb|AC013284.9| Homo sapiens chromosome 10 clone RP11-13E1, complete sequence
          Length = 154259

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 47     tacagtttctgtcctcaaga 66
              ||||||||||||||||||||
Sbjct: 121303 tacagtttctgtcctcaaga 121322

>gb|AC026739.7| Homo sapiens chromosome 5 clone CTD-2580L4, complete sequence
          Length = 186308

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 47    tacagtttctgtcctcaaga 66
             ||||||||||||||||||||
Sbjct: 37799 tacagtttctgtcctcaaga 37780

>emb|AJ621589.1| Tetraodon nigroviridis partial TY3/GYPSY-like LTR retrotransposon
           Barthez1_Tet
          Length = 4331

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 112 gtaccacggaccacacacac 131
           ||||||||||||||||||||
Sbjct: 515 gtaccacggaccacacacac 496

>gb|AC011547.4|AC011547 Homo sapiens chromosome 19 clone LLNLR-272C5, complete sequence
          Length = 41174

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 242  gatcgcagcacatgctgggg 261
            ||||||||||||||||||||
Sbjct: 3621 gatcgcagcacatgctgggg 3602

>emb|AL132990.4|CNS01DTY Human chromosome 14 DNA sequence BAC R-262P9 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 181004

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 47     tacagtttctgtcctcaagaccta 70
              |||||||||||||| |||||||||
Sbjct: 105870 tacagtttctgtccccaagaccta 105893

>emb|BX294167.5| Zebrafish DNA sequence from clone CH211-244O18 in linkage group 5,
             complete sequence
          Length = 191302

 Score = 40.1 bits (20), Expect = 4.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 158   tgcactttcacatgaaaatg 177
             ||||||||||||||||||||
Sbjct: 93626 tgcactttcacatgaaaatg 93607


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,219,414
Number of Sequences: 3902068
Number of extensions: 3219414
Number of successful extensions: 48669
Number of sequences better than 10.0: 11
Number of HSP's better than 10.0 without gapping: 11
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48640
Number of HSP's gapped (non-prelim): 29
length of query: 335
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 313
effective length of database: 17,147,199,772
effective search space: 5367073528636
effective search space used: 5367073528636
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)