Clone Name | rbasd13m23 |
---|---|
Clone Library Name | barley_pub |
>dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein, complete cds Length = 1053 Score = 353 bits (178), Expect = 2e-94 Identities = 230/246 (93%), Gaps = 1/246 (0%) Strand = Plus / Minus Query: 1 attacatctagcagcatccatgggttcgcaaatcaacaaacatcaggcaaaacttaaaaa 60 |||||||||||||||| |||||||||| ||| |||||||||||||||||||| ||||||| Sbjct: 1025 attacatctagcagcaaccatgggttcacaattcaacaaacatcaggcaaaatttaaaaa 966 Query: 61 agatggttccaggaacatagttctatatccttgcagataactggctatagcaaaacgact 120 ||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| | Sbjct: 965 cgatggttccagaaacatagttctatatcctt-cagataactggctatagcaaaacgaat 907 Query: 121 caatgcctcagaatcaggccttggcagcagcctgagctgcggcatccctcttcctctgct 180 ||| |||||||||||||||||||||||| ||||| || |||||||||||||||||||||| Sbjct: 906 caacgcctcagaatcaggccttggcagctgcctgggcagcggcatccctcttcctctgct 847 Query: 181 cctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggtgc 240 ||||||||||||| ||||||||||| ||||||||||||||| ||||||| |||||||||| Sbjct: 846 cctcaatgatggtcagcttgatacctttgcccttggggagggtcacccacggcttggtgc 787 Query: 241 ccttgc 246 |||||| Sbjct: 786 ccttgc 781
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 131 bits (66), Expect = 1e-27 Identities = 96/106 (90%) Strand = Plus / Plus Query: 141 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 200 |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||||| Sbjct: 316967 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 317026 Query: 201 atacccttgcccttggggaggctcacccaaggcttggtgcccttgc 246 || |||||||||||||| |||||||||||||||||| ||||||||| Sbjct: 317027 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgc 317072 Score = 56.0 bits (28), Expect = 5e-05 Identities = 37/40 (92%) Strand = Plus / Plus Query: 77 atagttctatatccttgcagataactggctatagcaaaac 116 ||||||||||||||||||| | |||| ||||||||||||| Sbjct: 316896 atagttctatatccttgcaaacaactcgctatagcaaaac 316935
>dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1359_D06 Length = 146805 Score = 131 bits (66), Expect = 1e-27 Identities = 96/106 (90%) Strand = Plus / Plus Query: 141 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 200 |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||||| Sbjct: 45751 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 45810 Query: 201 atacccttgcccttggggaggctcacccaaggcttggtgcccttgc 246 || |||||||||||||| |||||||||||||||||| ||||||||| Sbjct: 45811 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgc 45856 Score = 56.0 bits (28), Expect = 5e-05 Identities = 37/40 (92%) Strand = Plus / Plus Query: 77 atagttctatatccttgcagataactggctatagcaaaac 116 ||||||||||||||||||| | |||| ||||||||||||| Sbjct: 45680 atagttctatatccttgcaaacaactcgctatagcaaaac 45719
>dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B09, full insert sequence Length = 1016 Score = 131 bits (66), Expect = 1e-27 Identities = 96/106 (90%) Strand = Plus / Minus Query: 141 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 200 |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||||| Sbjct: 886 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 827 Query: 201 atacccttgcccttggggaggctcacccaaggcttggtgcccttgc 246 || |||||||||||||| |||||||||||||||||| ||||||||| Sbjct: 826 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgc 781 Score = 56.0 bits (28), Expect = 5e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 77 atagttctatatccttgcagataactggctatagcaaaac 116 ||||||||||||||||||| | |||| ||||||||||||| Sbjct: 957 atagttctatatccttgcaaacaactcgctatagcaaaac 918
>dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033093E13, full insert sequence Length = 1157 Score = 131 bits (66), Expect = 1e-27 Identities = 96/106 (90%) Strand = Plus / Minus Query: 141 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 200 |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||||| Sbjct: 890 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 831 Query: 201 atacccttgcccttggggaggctcacccaaggcttggtgcccttgc 246 || |||||||||||||| |||||||||||||||||| ||||||||| Sbjct: 830 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgc 785 Score = 56.0 bits (28), Expect = 5e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 77 atagttctatatccttgcagataactggctatagcaaaac 116 ||||||||||||||||||| | |||| ||||||||||||| Sbjct: 961 atagttctatatccttgcaaacaactcgctatagcaaaac 922
>dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D06, full insert sequence Length = 1079 Score = 131 bits (66), Expect = 1e-27 Identities = 96/106 (90%) Strand = Plus / Minus Query: 141 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 200 |||||||||||||| || || ||||||| |||||| |||||||| |||||| |||||||| Sbjct: 882 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 823 Query: 201 atacccttgcccttggggaggctcacccaaggcttggtgcccttgc 246 || |||||||||||||| |||||||||||||||||| ||||||||| Sbjct: 822 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgc 777 Score = 56.0 bits (28), Expect = 5e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 77 atagttctatatccttgcagataactggctatagcaaaac 116 ||||||||||||||||||| | |||| ||||||||||||| Sbjct: 953 atagttctatatccttgcaaacaactcgctatagcaaaac 914
>gb|BT016261.1| Zea mays clone Contig94 mRNA sequence Length = 1116 Score = 109 bits (55), Expect = 4e-21 Identities = 70/75 (93%) Strand = Plus / Minus Query: 172 tcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaag 231 ||||||||||||| |||||| ||||||||||||||||||||||||| ||||||||||| | Sbjct: 865 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 806 Query: 232 gcttggtgcccttgc 246 ||||| ||||||||| Sbjct: 805 gcttgttgcccttgc 791
>gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA, complete cds Length = 1090 Score = 109 bits (55), Expect = 4e-21 Identities = 70/75 (93%) Strand = Plus / Minus Query: 172 tcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaag 231 ||||||||||||| |||||| ||||||||||||||||||||||||| ||||||||||| | Sbjct: 844 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 785 Query: 232 gcttggtgcccttgc 246 ||||| ||||||||| Sbjct: 784 gcttgttgcccttgc 770
>ref|NM_193994.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 768 Score = 101 bits (51), Expect = 1e-18 Identities = 90/103 (87%) Strand = Plus / Minus Query: 144 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 203 |||||||||||||| || ||||| | ||||||||| ||||| |||||| ||||||||||| Sbjct: 758 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 699 Query: 204 cccttgcccttggggaggctcacccaaggcttggtgcccttgc 246 ||||||||||| ||||| |||||| |||||| ||||||||| Sbjct: 698 cccttgcccttagggagagacacccatggcttgttgcccttgc 656
>gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds Length = 1037 Score = 101 bits (51), Expect = 1e-18 Identities = 84/95 (88%) Strand = Plus / Minus Query: 141 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 200 |||||||||||||| || |||||||||| |||||| ||||| || |||||| | |||||| Sbjct: 862 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 803 Query: 201 atacccttgcccttggggaggctcacccaaggctt 235 || |||||||||||||| ||||||||||| ||||| Sbjct: 802 attcccttgcccttgggcaggctcacccacggctt 768 Score = 42.1 bits (21), Expect = 0.80 Identities = 24/25 (96%) Strand = Plus / Minus Query: 73 gaacatagttctatatccttgcaga 97 |||||| |||||||||||||||||| Sbjct: 934 gaacattgttctatatccttgcaga 910
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 101 bits (51), Expect = 1e-18 Identities = 90/103 (87%) Strand = Plus / Minus Query: 144 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 203 |||||||||||||| || ||||| | ||||||||| ||||| |||||| ||||||||||| Sbjct: 14497969 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 14497910 Query: 204 cccttgcccttggggaggctcacccaaggcttggtgcccttgc 246 ||||||||||| ||||| |||||| |||||| ||||||||| Sbjct: 14497909 cccttgcccttagggagagacacccatggcttgttgcccttgc 14497867
>dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0514H03 Length = 167230 Score = 101 bits (51), Expect = 1e-18 Identities = 90/103 (87%) Strand = Plus / Minus Query: 144 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 203 |||||||||||||| || ||||| | ||||||||| ||||| |||||| ||||||||||| Sbjct: 57282 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 57223 Query: 204 cccttgcccttggggaggctcacccaaggcttggtgcccttgc 246 ||||||||||| ||||| |||||| |||||| ||||||||| Sbjct: 57222 cccttgcccttagggagagacacccatggcttgttgcccttgc 57180
>emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4 Length = 1148 Score = 101 bits (51), Expect = 1e-18 Identities = 95/107 (88%), Gaps = 2/107 (1%) Strand = Plus / Minus Query: 141 ttggcagcagcctgagctgcggcatccctcttcctctgctcct-caatgatggtgagctt 199 |||||||||||||| || || || |||| |||||| ||||||| | |||||| ||||||| Sbjct: 865 ttggcagcagcctgggcggccgc-tcccgcttcctttgctccttcgatgatgctgagctt 807 Query: 200 gatacccttgcccttggggaggctcacccaaggcttggtgcccttgc 246 ||| |||||||||||||| |||||||||||||||||| ||||||||| Sbjct: 806 gatgcccttgcccttgggcaggctcacccaaggcttgttgcccttgc 760 Score = 42.1 bits (21), Expect = 0.80 Identities = 37/41 (90%), Gaps = 1/41 (2%) Strand = Plus / Minus Query: 77 atagttctatatcc-ttgcagataactggctatagcaaaac 116 |||||||||||||| ||||| | |||| ||||||||||||| Sbjct: 937 atagttctatatcctttgcaaacaactcgctatagcaaaac 897
>dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C06, full insert sequence Length = 1035 Score = 101 bits (51), Expect = 1e-18 Identities = 90/103 (87%) Strand = Plus / Minus Query: 144 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 203 |||||||||||||| || ||||| | ||||||||| ||||| |||||| ||||||||||| Sbjct: 875 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 816 Query: 204 cccttgcccttggggaggctcacccaaggcttggtgcccttgc 246 ||||||||||| ||||| |||||| |||||| ||||||||| Sbjct: 815 cccttgcccttagggagagacacccatggcttgttgcccttgc 773
>gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps4) mRNA, complete cds Length = 1013 Score = 101 bits (51), Expect = 1e-18 Identities = 84/95 (88%) Strand = Plus / Minus Query: 141 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 200 |||||||||||||| || |||||||||| |||||| ||||| || |||||| | |||||| Sbjct: 864 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 805 Query: 201 atacccttgcccttggggaggctcacccaaggctt 235 || |||||||||||||| ||||||||||| ||||| Sbjct: 804 attcccttgcccttgggcaggctcacccacggctt 770 Score = 42.1 bits (21), Expect = 0.80 Identities = 24/25 (96%) Strand = Plus / Minus Query: 73 gaacatagttctatatccttgcaga 97 |||||| |||||||||||||||||| Sbjct: 936 gaacattgttctatatccttgcaga 912
>gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence Length = 1145 Score = 85.7 bits (43), Expect = 6e-14 Identities = 82/95 (86%) Strand = Plus / Plus Query: 141 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 200 |||||||||||||| || || ||||||| |||||| ||||| || |||||| | |||||| Sbjct: 178 ttggcagcagcctgggcagcagcatcccgcttcctttgctcttctatgatgctcagcttg 237 Query: 201 atacccttgcccttggggaggctcacccaaggctt 235 || ||||| |||||||| ||||||||||| ||||| Sbjct: 238 attcccttacccttgggcaggctcacccacggctt 272 Score = 44.1 bits (22), Expect = 0.20 Identities = 25/26 (96%) Strand = Plus / Plus Query: 72 ggaacatagttctatatccttgcaga 97 ||||||| |||||||||||||||||| Sbjct: 105 ggaacattgttctatatccttgcaga 130
>ref|XM_475130.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 738 Score = 69.9 bits (35), Expect = 4e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 170 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggag 220 ||||||| ||||||||||||| |||||||||| ||||||||||||||||| Sbjct: 708 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggag 658
>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07, complete sequence Length = 159932 Score = 69.9 bits (35), Expect = 4e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 170 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggag 220 ||||||| ||||||||||||| |||||||||| ||||||||||||||||| Sbjct: 81033 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggag 80983
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 69.9 bits (35), Expect = 4e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 170 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggag 220 ||||||| ||||||||||||| |||||||||| ||||||||||||||||| Sbjct: 17551228 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggag 17551178
>dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023123J20, full insert sequence Length = 1162 Score = 69.9 bits (35), Expect = 4e-09 Identities = 47/51 (92%) Strand = Plus / Minus Query: 170 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggag 220 ||||||| ||||||||||||| |||||||||| ||||||||||||||||| Sbjct: 860 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggag 810
>ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein (MG02747.4) partial mRNA Length = 735 Score = 56.0 bits (28), Expect = 5e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 178 gctcctcaatgatggtgagcttgatacccttgcccttggg 217 |||||||| |||||||||||||| ||||||||||||||| Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658
>ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hypothetical protein (FG08714.1) partial mRNA Length = 732 Score = 56.0 bits (28), Expect = 5e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 178 gctcctcaatgatggtgagcttgatacccttgcccttggg 217 |||||||| |||||||||||||| ||||||||||||||| Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658
>gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-like protein mRNA, complete cds Length = 1024 Score = 56.0 bits (28), Expect = 5e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 178 gctcctcaatgatggtgagcttgatacccttgcccttggg 217 |||||||| |||||||||||||| ||||||||||||||| Sbjct: 766 gctcctcagcgatggtgagcttgacacccttgcccttggg 727
>dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, complete cds Length = 1105 Score = 54.0 bits (27), Expect = 2e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 179 ctcctcaatgatggtgagcttgatacccttgcccttggg 217 ||||||||||||||| | |||||||||||||||||||| Sbjct: 840 ctcctcaatgatggttaatttgatacccttgcccttggg 802
>ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predicted mRNA Length = 783 Score = 50.1 bits (25), Expect = 0.003 Identities = 28/29 (96%) Strand = Plus / Minus Query: 189 atggtgagcttgatacccttgcccttggg 217 |||| |||||||||||||||||||||||| Sbjct: 743 atggagagcttgatacccttgcccttggg 715
>gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 (RPS7) mRNA, complete cds Length = 852 Score = 50.1 bits (25), Expect = 0.003 Identities = 28/29 (96%) Strand = Plus / Minus Query: 189 atggtgagcttgatacccttgcccttggg 217 |||| |||||||||||||||||||||||| Sbjct: 745 atggagagcttgatacccttgcccttggg 717
>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica Length = 3633272 Score = 50.1 bits (25), Expect = 0.003 Identities = 28/29 (96%) Strand = Plus / Plus Query: 189 atggtgagcttgatacccttgcccttggg 217 |||| |||||||||||||||||||||||| Sbjct: 1601891 atggagagcttgatacccttgcccttggg 1601919
>ref|NM_125228.3| Arabidopsis thaliana structural constituent of ribosome AT5G58420 mRNA, complete cds Length = 1080 Score = 46.1 bits (23), Expect = 0.051 Identities = 35/39 (89%) Strand = Plus / Minus Query: 179 ctcctcaatgatggtgagcttgatacccttgcccttggg 217 |||||| ||||| || ||||||||||| ||||||||||| Sbjct: 846 ctcctcgatgatagtcagcttgatacctttgcccttggg 808
>ref|NM_001036769.1| Arabidopsis thaliana structural constituent of ribosome AT5G07090 transcript variant AT5G07090.2 mRNA, complete cds Length = 1174 Score = 46.1 bits (23), Expect = 0.051 Identities = 32/35 (91%) Strand = Plus / Minus Query: 180 tcctcaatgatggtgagcttgatacccttgccctt 214 |||||||||||||| ||||| ||||| |||||||| Sbjct: 864 tcctcaatgatggtcagcttaatacctttgccctt 830
>ref|NM_120791.2| Arabidopsis thaliana structural constituent of ribosome AT5G07090 transcript variant AT5G07090.1 mRNA, complete cds Length = 1088 Score = 46.1 bits (23), Expect = 0.051 Identities = 32/35 (91%) Strand = Plus / Minus Query: 180 tcctcaatgatggtgagcttgatacccttgccctt 214 |||||||||||||| ||||| ||||| |||||||| Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745
>gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, complete cds Length = 789 Score = 46.1 bits (23), Expect = 0.051 Identities = 35/39 (89%) Strand = Plus / Minus Query: 179 ctcctcaatgatggtgagcttgatacccttgcccttggg 217 |||||| ||||| || ||||||||||| ||||||||||| Sbjct: 753 ctcctcgatgatagtcagcttgatacctttgcccttggg 715
>gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090) mRNA, complete cds Length = 820 Score = 46.1 bits (23), Expect = 0.051 Identities = 32/35 (91%) Strand = Plus / Minus Query: 180 tcctcaatgatggtgagcttgatacccttgccctt 214 |||||||||||||| ||||| ||||| |||||||| Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718
>gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090) mRNA, complete cds Length = 1059 Score = 46.1 bits (23), Expect = 0.051 Identities = 32/35 (91%) Strand = Plus / Minus Query: 180 tcctcaatgatggtgagcttgatacccttgccctt 214 |||||||||||||| ||||| ||||| |||||||| Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742
>emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, BAC clone T28J14 (ESSA project) Length = 104607 Score = 46.1 bits (23), Expect = 0.051 Identities = 32/35 (91%) Strand = Plus / Minus Query: 180 tcctcaatgatggtgagcttgatacccttgccctt 214 |||||||||||||| ||||| ||||| |||||||| Sbjct: 8021 tcctcaatgatggtcagcttaatacctttgccctt 7987
>gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds Length = 789 Score = 46.1 bits (23), Expect = 0.051 Identities = 32/35 (91%) Strand = Plus / Minus Query: 180 tcctcaatgatggtgagcttgatacccttgccctt 214 |||||||||||||| ||||| ||||| |||||||| Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718
>gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds Length = 1008 Score = 46.1 bits (23), Expect = 0.051 Identities = 32/35 (91%) Strand = Plus / Minus Query: 180 tcctcaatgatggtgagcttgatacccttgccctt 214 |||||||||||||| ||||| ||||| |||||||| Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742
>gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds Length = 995 Score = 46.1 bits (23), Expect = 0.051 Identities = 35/39 (89%) Strand = Plus / Minus Query: 179 ctcctcaatgatggtgagcttgatacccttgcccttggg 217 |||||| ||||| || ||||||||||| ||||||||||| Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttggg 788
>gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds Length = 1005 Score = 46.1 bits (23), Expect = 0.051 Identities = 35/39 (89%) Strand = Plus / Minus Query: 179 ctcctcaatgatggtgagcttgatacccttgcccttggg 217 |||||| ||||| || ||||||||||| ||||||||||| Sbjct: 837 ctcctcgatgatagtcagcttgatacctttgcccttggg 799
>emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH32ZH05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1168 Score = 46.1 bits (23), Expect = 0.051 Identities = 32/35 (91%) Strand = Plus / Plus Query: 180 tcctcaatgatggtgagcttgatacccttgccctt 214 |||||||||||||| ||||| ||||| |||||||| Sbjct: 229 tcctcaatgatggtcagcttaatacctttgccctt 263
>emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH87ZG07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 976 Score = 46.1 bits (23), Expect = 0.051 Identities = 32/35 (91%) Strand = Plus / Minus Query: 180 tcctcaatgatggtgagcttgatacccttgccctt 214 |||||||||||||| ||||| ||||| |||||||| Sbjct: 746 tcctcaatgatggtcagcttaatacctttgccctt 712
>emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH74ZD04 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 942 Score = 46.1 bits (23), Expect = 0.051 Identities = 32/35 (91%) Strand = Plus / Minus Query: 180 tcctcaatgatggtgagcttgatacccttgccctt 214 |||||||||||||| ||||| ||||| |||||||| Sbjct: 750 tcctcaatgatggtcagcttaatacctttgccctt 716
>emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH62ZE09 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 978 Score = 46.1 bits (23), Expect = 0.051 Identities = 35/39 (89%) Strand = Plus / Minus Query: 179 ctcctcaatgatggtgagcttgatacccttgcccttggg 217 |||||| ||||| || ||||||||||| ||||||||||| Sbjct: 847 ctcctcgatgatagtcagcttgatacctttgcccttggg 809
>emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH61ZC05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 952 Score = 46.1 bits (23), Expect = 0.051 Identities = 32/35 (91%) Strand = Plus / Minus Query: 180 tcctcaatgatggtgagcttgatacccttgccctt 214 |||||||||||||| ||||| ||||| |||||||| Sbjct: 739 tcctcaatgatggtcagcttaatacctttgccctt 705
>emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH53ZH10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 537 Score = 46.1 bits (23), Expect = 0.051 Identities = 35/39 (89%) Strand = Plus / Minus Query: 179 ctcctcaatgatggtgagcttgatacccttgcccttggg 217 |||||| ||||| || ||||||||||| ||||||||||| Sbjct: 366 ctcctcgatgatagtcagcttgatacctttgcccttggg 328
>emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB70ZD03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 988 Score = 46.1 bits (23), Expect = 0.051 Identities = 35/39 (89%) Strand = Plus / Minus Query: 179 ctcctcaatgatggtgagcttgatacccttgcccttggg 217 |||||| ||||| || ||||||||||| ||||||||||| Sbjct: 817 ctcctcgatgatagtcagcttgatacctttgcccttggg 779
>emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB61ZG04 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 737 Score = 46.1 bits (23), Expect = 0.051 Identities = 35/39 (89%) Strand = Plus / Minus Query: 179 ctcctcaatgatggtgagcttgatacccttgcccttggg 217 |||||| ||||| || ||||||||||| ||||||||||| Sbjct: 566 ctcctcgatgatagtcagcttgatacctttgcccttggg 528
>emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB12ZD07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 566 Score = 46.1 bits (23), Expect = 0.051 Identities = 35/39 (89%) Strand = Plus / Minus Query: 179 ctcctcaatgatggtgagcttgatacccttgcccttggg 217 |||||| ||||| || ||||||||||| ||||||||||| Sbjct: 395 ctcctcgatgatagtcagcttgatacctttgcccttggg 357
>emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH61ZG11 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 997 Score = 46.1 bits (23), Expect = 0.051 Identities = 35/39 (89%) Strand = Plus / Minus Query: 179 ctcctcaatgatggtgagcttgatacccttgcccttggg 217 |||||| ||||| || ||||||||||| ||||||||||| Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttggg 788
>gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete sequence Length = 1010 Score = 46.1 bits (23), Expect = 0.051 Identities = 35/39 (89%) Strand = Plus / Minus Query: 179 ctcctcaatgatggtgagcttgatacccttgcccttggg 217 |||||| ||||| || ||||||||||| ||||||||||| Sbjct: 841 ctcctcgatgatagtcagcttgatacctttgcccttggg 803
>gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete sequence Length = 1011 Score = 46.1 bits (23), Expect = 0.051 Identities = 32/35 (91%) Strand = Plus / Minus Query: 180 tcctcaatgatggtgagcttgatacccttgccctt 214 |||||||||||||| ||||| ||||| |||||||| Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745
>dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQJ2 Length = 51440 Score = 46.1 bits (23), Expect = 0.051 Identities = 35/39 (89%) Strand = Plus / Minus Query: 179 ctcctcaatgatggtgagcttgatacccttgcccttggg 217 |||||| ||||| || ||||||||||| ||||||||||| Sbjct: 6898 ctcctcgatgatagtcagcttgatacctttgcccttggg 6860
>dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9 Length = 86380 Score = 46.1 bits (23), Expect = 0.051 Identities = 32/35 (91%) Strand = Plus / Minus Query: 180 tcctcaatgatggtgagcttgatacccttgccctt 214 |||||||||||||| ||||| ||||| |||||||| Sbjct: 82744 tcctcaatgatggtcagcttaatacctttgccctt 82710
>gb|DQ362415.1| Shigella dysenteriae strain G1274 GcvT (gcvT) gene, partial cds Length = 416 Score = 44.1 bits (22), Expect = 0.20 Identities = 25/26 (96%) Strand = Plus / Plus Query: 23 ggttcgcaaatcaacaaacatcaggc 48 |||||||||||| ||||||||||||| Sbjct: 88 ggttcgcaaatcgacaaacatcaggc 113
>gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosome 13, complete sequence Length = 149455 Score = 42.1 bits (21), Expect = 0.80 Identities = 21/21 (100%) Strand = Plus / Minus Query: 211 ccttggggaggctcacccaag 231 ||||||||||||||||||||| Sbjct: 134897 ccttggggaggctcacccaag 134877
>ref|XM_657306.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4794.2), mRNA Length = 720 Score = 42.1 bits (21), Expect = 0.80 Identities = 27/29 (93%) Strand = Plus / Minus Query: 189 atggtgagcttgatacccttgcccttggg 217 |||| |||||||| ||||||||||||||| Sbjct: 674 atggagagcttgacacccttgcccttggg 646
>ref|XM_749829.1| Aspergillus fumigatus Af293 cytosolic small ribosomal subunit S4 (Afu3g06840) partial mRNA Length = 786 Score = 42.1 bits (21), Expect = 0.80 Identities = 27/29 (93%) Strand = Plus / Minus Query: 189 atggtgagcttgatacccttgcccttggg 217 ||||||||||| | ||||||||||||||| Sbjct: 740 atggtgagcttaacacccttgcccttggg 712
>dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 Length = 1824958 Score = 42.1 bits (21), Expect = 0.80 Identities = 24/25 (96%) Strand = Plus / Plus Query: 197 cttgatacccttgcccttggggagg 221 ||||| ||||||||||||||||||| Sbjct: 775952 cttgacacccttgcccttggggagg 775976
>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete sequence Length = 2300533 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 194 gagcttgatacccttgcccttggg 217 |||||||| ||||||||||||||| Sbjct: 1677741 gagcttgacacccttgcccttggg 1677718
>gb|AC101844.7| Mus musculus chromosome 7, clone RP23-257M22, complete sequence Length = 197827 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 170 cttcctctgctcctcaatga 189 |||||||||||||||||||| Sbjct: 23788 cttcctctgctcctcaatga 23769
>gb|AC147681.8| Canis Familiaris, clone XX-10A1, complete sequence Length = 160031 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 165 tccctcttcctctgctcctc 184 |||||||||||||||||||| Sbjct: 75373 tccctcttcctctgctcctc 75392
>gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome 12, complete sequence Length = 243671 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 ggttccaggaacatagttct 84 |||||||||||||||||||| Sbjct: 192051 ggttccaggaacatagttct 192032
>ref|XM_567206.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein (CNA06200) partial mRNA Length = 840 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 194 gagcttgatacccttgcccttggg 217 |||||||| ||||||||||||||| Sbjct: 738 gagcttgacacccttgcccttggg 715
>gb|AC132320.4| Mus musculus BAC clone RP24-259L9 from chromosome 18, complete sequence Length = 156239 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 168 ctcttcctctgctcctcaat 187 |||||||||||||||||||| Sbjct: 47354 ctcttcctctgctcctcaat 47335
>gb|BC025658.1| Homo sapiens glycine/arginine rich protein 1, mRNA (cDNA clone MGC:34152 IMAGE:5198480), complete cds Length = 1554 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 131 gaatcaggccttggcagcagcctg 154 |||||||||||||||||| ||||| Sbjct: 421 gaatcaggccttggcagccgcctg 398
>emb|AL731567.6| Human DNA sequence from clone RP11-67C2 on chromosome 10 Contains the ALOX5 gene for arachidonate 5-lipoxygenase, a novel gene, the 3' end of a gene for cellular modulator of immune recognition (c-MIR) and five CpG islands, complete sequence Length = 129266 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 81 ttctatatccttgcagataactgg 104 |||||||||||| ||||||||||| Sbjct: 81474 ttctatatccttacagataactgg 81451
>ref|XM_505600.1| Yarrowia lipolytica CLIB122, YALI0F18920g predicted mRNA Length = 1485 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 170 cttcctctgctcctcaatga 189 |||||||||||||||||||| Sbjct: 1026 cttcctctgctcctcaatga 1007
>ref|XM_795025.1| PREDICTED: Strongylocentrotus purpuratus hypothetical protein LOC581083 (LOC581083), mRNA Length = 1197 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 165 tccctcttcctctgctcctc 184 |||||||||||||||||||| Sbjct: 764 tccctcttcctctgctcctc 745
>emb|BX293994.28| Zebrafish DNA sequence from clone DKEY-256K14 in linkage group 10, complete sequence Length = 210640 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 169 tcttcctctgctcctcaatg 188 |||||||||||||||||||| Sbjct: 25208 tcttcctctgctcctcaatg 25189
>gb|AC009806.9| Homo sapiens chromosome 11, clone RP11-51B23, complete sequence Length = 175223 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 53 cttaaaaaagatggttccag 72 |||||||||||||||||||| Sbjct: 158366 cttaaaaaagatggttccag 158385
>gb|AC007437.16| Homo sapiens 12q22 BAC RPCI11-541G9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 179854 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 216 gggaggctcacccaaggcttggtg 239 |||||||||||||||| ||||||| Sbjct: 12827 gggaggctcacccaagccttggtg 12850
>gb|AC007656.2| Homo sapiens 12q22 BAC RPCI11-534P6 (Rowswell Park Cancer Institute Human BAC Library) complete sequence Length = 171236 Score = 40.1 bits (20), Expect = 3.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 216 gggaggctcacccaaggcttggtg 239 |||||||||||||||| ||||||| Sbjct: 157441 gggaggctcacccaagccttggtg 157464
>dbj|BS000205.2| Pan troglodytes chromosome 22 clone:RP43-093B21, map 22, complete sequences Length = 203521 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 tagttctatatccttgcaga 97 |||||||||||||||||||| Sbjct: 130844 tagttctatatccttgcaga 130825
>emb|AL096869.8|CNS00YVH Human chromosome 14 DNA sequence BAC R-1078H9 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 228097 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 168 ctcttcctctgctcctcaat 187 |||||||||||||||||||| Sbjct: 63018 ctcttcctctgctcctcaat 62999
>gb|AY919674.1| Homo sapiens amyloid beta (A4) precursor protein (protease nexin-II, Alzheimer disease) (APP) gene, complete cds Length = 293960 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 tagttctatatccttgcaga 97 |||||||||||||||||||| Sbjct: 254416 tagttctatatccttgcaga 254435
>gb|AC151990.6| Mus musculus BAC clone RP23-299K14 from chromosome 18, complete sequence Length = 205253 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 168 ctcttcctctgctcctcaat 187 |||||||||||||||||||| Sbjct: 62232 ctcttcctctgctcctcaat 62251
>dbj|AP001694.1| Homo sapiens genomic DNA, chromosome 21q, section 38/105 Length = 340000 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 tagttctatatccttgcaga 97 |||||||||||||||||||| Sbjct: 325187 tagttctatatccttgcaga 325168
>gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4 (RPS4) mRNA, complete cds Length = 1086 Score = 40.1 bits (20), Expect = 3.2 Identities = 53/64 (82%) Strand = Plus / Minus Query: 183 tcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggtgccc 242 |||| |||||| ||||||||||| || |||||||| || ||||||||| || || ||| Sbjct: 783 tcaaggatggttagcttgatacctttccccttgggaagagacacccaaggttttgtaccc 724 Query: 243 ttgc 246 |||| Sbjct: 723 ttgc 720
>gb|AC140464.3| Mus musculus BAC clone RP24-383H6 from 12, complete sequence Length = 113482 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 65 ggttccaggaacatagttct 84 |||||||||||||||||||| Sbjct: 64196 ggttccaggaacatagttct 64177
>gb|AC102003.5| Mus musculus chromosome 7, clone RP24-488I10, complete sequence Length = 150428 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 170 cttcctctgctcctcaatga 189 |||||||||||||||||||| Sbjct: 147440 cttcctctgctcctcaatga 147421
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica Length = 4003362 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 170 cttcctctgctcctcaatga 189 |||||||||||||||||||| Sbjct: 2525910 cttcctctgctcctcaatga 2525929
>emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chromosome 7, complete sequence Length = 215366 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 208 tgcccttggggaggctcacc 227 |||||||||||||||||||| Sbjct: 213316 tgcccttggggaggctcacc 213297
>emb|AL139193.4|CNS01DXA Human chromosome 14 DNA sequence BAC R-661G16 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 162691 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 168 ctcttcctctgctcctcaat 187 |||||||||||||||||||| Sbjct: 27574 ctcttcctctgctcctcaat 27593
>dbj|AP000141.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL56-APP region, clone B2291C14-R44F3, segment 6/10, complete sequence Length = 100000 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 tagttctatatccttgcaga 97 |||||||||||||||||||| Sbjct: 24483 tagttctatatccttgcaga 24464
>dbj|D87675.1| Homo sapiens DNA for amyloid precursor protein, complete cds Length = 301692 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 78 tagttctatatccttgcaga 97 |||||||||||||||||||| Sbjct: 258129 tagttctatatccttgcaga 258148
>dbj|AP001442.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21.2, clone:T1715, LL56-APP region, complete sequence Length = 68001 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 tagttctatatccttgcaga 97 |||||||||||||||||||| Sbjct: 7611 tagttctatatccttgcaga 7592
>dbj|AP000088.1| Homo sapiens genomic DNA of 21q22.1, APP related, B2291C14-T1533 region, segment 5/7 Length = 161014 Score = 40.1 bits (20), Expect = 3.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 78 tagttctatatccttgcaga 97 |||||||||||||||||||| Sbjct: 124483 tagttctatatccttgcaga 124464 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,539,013 Number of Sequences: 3902068 Number of extensions: 2539013 Number of successful extensions: 54247 Number of sequences better than 10.0: 86 Number of HSP's better than 10.0 without gapping: 86 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 54050 Number of HSP's gapped (non-prelim): 194 length of query: 246 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 224 effective length of database: 17,147,199,772 effective search space: 3840972748928 effective search space used: 3840972748928 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)