ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd14b14
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AE017245.1| Mycoplasma synoviae 53, complete genome 44 0.62
2emb|CT025155.9| Mouse DNA sequence from clone RP23-228F18 on chr... 44 0.62
3dbj|AK113987.1| Ciona intestinalis cDNA, clone:cicl020j05, full ... 44 0.62
4ref|XM_525855.1| PREDICTED: Pan troglodytes similar to FLJ00204 ... 42 2.5
5gb|AC136710.8| Mus musculus chromosome 19, clone RP23-35B13, com... 42 2.5
6gb|AE013082.1| Thermoanaerobacter tengcongensis MB4, section 109... 42 2.5
7gb|AC140320.2| Mus musculus BAC clone RP23-401C13 from chromosom... 42 2.5
8gb|AC109344.4| Homo sapiens BAC clone RP13-891P8 from 2, complet... 42 2.5
9gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome 40 9.7
10gb|AC166162.6| Mus musculus BAC clone RP23-436K10 from chromosom... 40 9.7
11gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chr... 40 9.7
12ref|XM_676530.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 9.7
13gb|AC156556.8| Mus musculus chromosome 7, clone RP23-92E8, compl... 40 9.7
14gb|AC159641.2| Mus musculus BAC clone RP23-465F1 from chromosome... 40 9.7
15ref|XM_570859.1| Cryptococcus neoformans var. neoformans JEC21 N... 40 9.7
16gb|AC108420.8| Mus musculus chromosome 7, clone RP23-38E14, comp... 40 9.7
17emb|Z84572.1|HS49J10 Human DNA sequence from clone RP1-49J10 on ... 40 9.7
18emb|AL138820.11| Human DNA sequence from clone RP11-380B4 on chr... 40 9.7
19emb|AL023775.1|HS497J21 Human DNA sequence from clone RP3-497J21... 40 9.7
20emb|CR861477.1| Human DNA sequence from clone XX-NCIH2171_4G20, ... 40 9.7
21emb|CR856000.1| Human DNA sequence from clone XX-NCIH2171_4H19, ... 40 9.7
22emb|CR812473.1| Human DNA sequence from clone XX-NCIH2171_18L10,... 40 9.7
23gb|AC009711.10| Homo sapiens chromosome 15, clone RP11-356B18, c... 40 9.7
24emb|CR626938.1| Human DNA sequence from clone XX-NCIH2171_5AA20,... 40 9.7
25gb|AC113143.3| Homo sapiens chromosome 8, clone RP11-33I11, comp... 40 9.7
26ref|XM_397003.2| PREDICTED: Apis mellifera similar to ENSANGP000... 40 9.7
27gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 9.7
28gb|AF019664.1|AF019664 Homo sapiens cosmids 52b3, 189g5, ICRFc10... 40 9.7
29gb|AC134529.6| Mus musculus BAC clone RP24-503A2 from chromosome... 40 9.7

>gb|AE017245.1| Mycoplasma synoviae 53, complete genome
          Length = 799476

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 197    ggtgatcctgttttcggtgcac 218
              ||||||||||||||||||||||
Sbjct: 154018 ggtgatcctgttttcggtgcac 153997



to top

>emb|CT025155.9| Mouse DNA sequence from clone RP23-228F18 on chromosome 16, complete
              sequence
          Length = 203093

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 338    ggttcaccacactgaaatcatc 359
              ||||||||||||||||||||||
Sbjct: 165658 ggttcaccacactgaaatcatc 165679



to top

>dbj|AK113987.1| Ciona intestinalis cDNA, clone:cicl020j05, full insert sequence
          Length = 2187

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 469 atgctgcatttgtagcttctgc 490
           ||||||||||||||||||||||
Sbjct: 739 atgctgcatttgtagcttctgc 718



to top

>ref|XM_525855.1| PREDICTED: Pan troglodytes similar to FLJ00204 protein (LOC470474),
            mRNA
          Length = 4731

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 415  ccaagctgtcccaaaccagca 435
            |||||||||||||||||||||
Sbjct: 2459 ccaagctgtcccaaaccagca 2439



to top

>gb|AC136710.8| Mus musculus chromosome 19, clone RP23-35B13, complete sequence
          Length = 206056

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 463    tctgcaatgctgcatttgtag 483
              |||||||||||||||||||||
Sbjct: 109774 tctgcaatgctgcatttgtag 109754



to top

>gb|AE013082.1| Thermoanaerobacter tengcongensis MB4, section 109 of 244 of the
             complete genome
          Length = 14022

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 87    aacagcaagtgataatggtgc 107
             |||||||||||||||||||||
Sbjct: 13692 aacagcaagtgataatggtgc 13672



to top

>gb|AC140320.2| Mus musculus BAC clone RP23-401C13 from chromosome 19, complete sequence
          Length = 197365

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 463    tctgcaatgctgcatttgtag 483
              |||||||||||||||||||||
Sbjct: 146723 tctgcaatgctgcatttgtag 146743



to top

>gb|AC109344.4| Homo sapiens BAC clone RP13-891P8 from 2, complete sequence
          Length = 87097

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 415   ccaagctgtcccaaaccagca 435
             |||||||||||||||||||||
Sbjct: 77543 ccaagctgtcccaaaccagca 77523



to top

>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome
          Length = 4109442

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 196     cggtgatcctgttttcggtg 215
               ||||||||||||||||||||
Sbjct: 4037976 cggtgatcctgttttcggtg 4037995



to top

>gb|AC166162.6| Mus musculus BAC clone RP23-436K10 from chromosome 6, complete sequence
          Length = 181038

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 177   gcttgcttccatctctctcc 196
             ||||||||||||||||||||
Sbjct: 28969 gcttgcttccatctctctcc 28988



to top

>gb|AE017345.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 5, complete
              sequence
          Length = 1507550

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 231    ggcaaagagctgggaataga 250
              ||||||||||||||||||||
Sbjct: 879025 ggcaaagagctgggaataga 879006



to top

>ref|XM_676530.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN8353.2), mRNA
          Length = 429

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 177 gcttgcttccatctctctccggtg 200
           |||||| |||||||||||||||||
Sbjct: 375 gcttgcctccatctctctccggtg 352



to top

>gb|AC156556.8| Mus musculus chromosome 7, clone RP23-92E8, complete sequence
          Length = 250903

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 255   cctttgcctctgtttacaga 274
             ||||||||||||||||||||
Sbjct: 26254 cctttgcctctgtttacaga 26235



to top

>gb|AC159641.2| Mus musculus BAC clone RP23-465F1 from chromosome 12, complete sequence
          Length = 176949

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 235    aagagctgggaatagatatg 254
              ||||||||||||||||||||
Sbjct: 100223 aagagctgggaatagatatg 100242



to top

>ref|XM_570859.1| Cryptococcus neoformans var. neoformans JEC21 NBP35 (CNE03090)
           partial mRNA
          Length = 1011

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 231 ggcaaagagctgggaataga 250
           ||||||||||||||||||||
Sbjct: 844 ggcaaagagctgggaataga 863



to top

>gb|AC108420.8| Mus musculus chromosome 7, clone RP23-38E14, complete sequence
          Length = 134825

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 255  cctttgcctctgtttacaga 274
            ||||||||||||||||||||
Sbjct: 8538 cctttgcctctgtttacaga 8557



to top

>emb|Z84572.1|HS49J10 Human DNA sequence from clone RP1-49J10 on chromosome 13 Contains the 3'
              end of the gene for androgen-induced prostate proliferative
              shutoff associated protein (AS3) (CG008, FLJ23236,
              KIAA0979), complete sequence
          Length = 137246

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 240    ctgggaatagatatgccttt 259
              ||||||||||||||||||||
Sbjct: 130547 ctgggaatagatatgccttt 130566



to top

>emb|AL138820.11| Human DNA sequence from clone RP11-380B4 on chromosome 13 Contains the 3'
              end of the KIAA0979 gene and part of a novel gene, complete
              sequence
          Length = 168487

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 240    ctgggaatagatatgccttt 259
              ||||||||||||||||||||
Sbjct: 130038 ctgggaatagatatgccttt 130057



to top

>emb|AL023775.1|HS497J21 Human DNA sequence from clone RP3-497J21 on chromosome 6q26-27 Contains
             part of a variant of the RPS6KA2 gene for ribosomal
             protein S6 kinase, 90kD, polypeptide 2 (RSK3) and a IGF-II
             mRNA-binding protein 3 (KOC1) pseudogene, complete
             sequence
          Length = 129432

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 676   ggcagctcaatgaagctgaa 695
             ||||||||||||||||||||
Sbjct: 17597 ggcagctcaatgaagctgaa 17578



to top

>emb|CR861477.1| Human DNA sequence from clone XX-NCIH2171_4G20, complete sequence
          Length = 121004

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 453   tgcccagatgtctgcaatgctgca 476
             |||||||||||||||||| |||||
Sbjct: 35587 tgcccagatgtctgcaatcctgca 35564



to top

>emb|CR856000.1| Human DNA sequence from clone XX-NCIH2171_4H19, complete sequence
          Length = 121005

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 453   tgcccagatgtctgcaatgctgca 476
             |||||||||||||||||| |||||
Sbjct: 35587 tgcccagatgtctgcaatcctgca 35564



to top

>emb|CR812473.1| Human DNA sequence from clone XX-NCIH2171_18L10, complete sequence
          Length = 128736

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 453   tgcccagatgtctgcaatgctgca 476
             |||||||||||||||||| |||||
Sbjct: 39458 tgcccagatgtctgcaatcctgca 39435



to top

>gb|AC009711.10| Homo sapiens chromosome 15, clone RP11-356B18, complete sequence
          Length = 205925

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 255   cctttgcctctgtttacaga 274
             ||||||||||||||||||||
Sbjct: 10838 cctttgcctctgtttacaga 10857



to top

>emb|CR626938.1| Human DNA sequence from clone XX-NCIH2171_5AA20, complete sequence
          Length = 111651

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 453   tgcccagatgtctgcaatgctgca 476
             |||||||||||||||||| |||||
Sbjct: 64187 tgcccagatgtctgcaatcctgca 64210



to top

>gb|AC113143.3| Homo sapiens chromosome 8, clone RP11-33I11, complete sequence
          Length = 157672

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 453   tgcccagatgtctgcaatgctgca 476
             |||||||||||||||||| |||||
Sbjct: 34258 tgcccagatgtctgcaatcctgca 34235



to top

>ref|XM_397003.2| PREDICTED: Apis mellifera similar to ENSANGP00000005626
           (LOC413562), mRNA
          Length = 5088

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 75  gtggacctatgcaacagcaa 94
           ||||||||||||||||||||
Sbjct: 328 gtggacctatgcaacagcaa 309



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 572     aggcgaggaacttgatggag 591
               ||||||||||||||||||||
Sbjct: 4632725 aggcgaggaacttgatggag 4632744



to top

>gb|AF019664.1|AF019664 Homo sapiens cosmids 52b3, 189g5, ICRFc109N244QD2, P1 255h6, and PAC
            pDJ84g15 from chromosome 6q27 encompassing markers D6S193
            and D6S297, complete sequence
          Length = 68940

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 676  ggcagctcaatgaagctgaa 695
            ||||||||||||||||||||
Sbjct: 2155 ggcagctcaatgaagctgaa 2174



to top

>gb|AC134529.6| Mus musculus BAC clone RP24-503A2 from chromosome 6, complete sequence
          Length = 166392

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 177   gcttgcttccatctctctcc 196
             ||||||||||||||||||||
Sbjct: 99675 gcttgcttccatctctctcc 99694


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,478,817
Number of Sequences: 3902068
Number of extensions: 5478817
Number of successful extensions: 93736
Number of sequences better than 10.0: 29
Number of HSP's better than 10.0 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 93639
Number of HSP's gapped (non-prelim): 97
length of query: 711
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 688
effective length of database: 17,143,297,704
effective search space: 11794588820352
effective search space used: 11794588820352
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top