ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd13m12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein,... 787 0.0
2dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 472 e-130
3dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic D... 472 e-130
4dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clon... 472 e-130
5dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clon... 472 e-130
6dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clon... 464 e-127
7gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA,... 426 e-116
8gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps... 426 e-116
9gb|BT016261.1| Zea mays clone Contig94 mRNA sequence 418 e-114
10gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds 410 e-111
11gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence 394 e-106
12ref|NM_193994.1| Oryza sativa (japonica cultivar-group), predic... 309 5e-81
13dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 309 5e-81
14dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic D... 309 5e-81
15dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clon... 309 5e-81
16ref|XM_475130.1| Oryza sativa (japonica cultivar-group), predic... 289 5e-75
17gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome... 289 5e-75
18dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 289 5e-75
19dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clon... 289 5e-75
20gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4... 232 1e-57
21emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4 224 2e-55
22gb|AF528526.1| Glycine max 40S ribosomal S4 protein mRNA, comple... 222 1e-54
23gb|AC126779.19| Medicago truncatula clone mth2-34m14, complete s... 214 2e-52
24ref|NM_001036769.1| Arabidopsis thaliana structural constituent ... 196 6e-47
25ref|NM_120791.2| Arabidopsis thaliana structural constituent of ... 196 6e-47
26gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal prote... 196 6e-47
27gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal prote... 196 6e-47
28emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, B... 196 6e-47
29gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, co... 196 6e-47
30gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, co... 196 6e-47
31emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Co... 196 6e-47
32emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Co... 196 6e-47
33emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Co... 196 6e-47
34emb|BX832253.1|CNS09ZUO Arabidopsis thaliana Full-length cDNA Co... 196 6e-47
35gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete s... 196 6e-47
36dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 196 6e-47
37ref|NM_125228.3| Arabidopsis thaliana structural constituent of ... 180 3e-42
38gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, comp... 180 3e-42
39gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, comp... 180 3e-42
40gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mR... 180 3e-42
41emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Co... 180 3e-42
42emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Co... 180 3e-42
43emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Co... 180 3e-42
44emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Co... 180 3e-42
45gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete s... 180 3e-42
46dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 180 3e-42
47emb|X76651.1|STRPS4 S.tuberosum (Desiree) mRNA for ribosomal pro... 180 3e-42
48emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Co... 174 2e-40
49emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Co... 174 2e-40
50emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Co... 172 8e-40
51gb|DQ268839.1| Solanum tuberosum clone 130D11 40S ribosomal prot... 172 8e-40
52dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, com... 170 3e-39
53gb|AY084230.1| Arabidopsis thaliana clone 10042 mRNA, complete s... 165 2e-37
54ref|NM_127291.2| Arabidopsis thaliana structural constituent of ... 157 5e-35
55gb|AY062983.1| Arabidopsis thaliana putative ribosomal protein S... 157 5e-35
56gb|AY035131.1| Arabidopsis thaliana putative ribosomal protein S... 157 5e-35
57gb|AY064625.1| Arabidopsis thaliana unknown protein mRNA, comple... 157 5e-35
58gb|AF370469.1|AF370469 Arabidopsis thaliana Unknown protein mRNA... 157 5e-35
59emb|BX818868.1|CNS0A8UP Arabidopsis thaliana Full-length cDNA Co... 157 5e-35
60emb|BX833645.1|CNS0A1VP Arabidopsis thaliana Full-length cDNA Co... 157 5e-35
61gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II sectio... 157 5e-35
62emb|X79300.1|GHRS4E G.hirsutum (DPL 62) mRNA for ribosomal prote... 155 2e-34
63emb|BX820506.1|CNS0A8QA Arabidopsis thaliana Full-length cDNA Co... 149 1e-32
64emb|BX831856.1|CNS09ZNQ Arabidopsis thaliana Full-length cDNA Co... 149 1e-32
65gb|BT014201.1| Lycopersicon esculentum clone 133378R, mRNA sequence 143 7e-31
66dbj|D21302.1|RICSS536 Oryza sativa SS536 mRNA for ribosomal prot... 111 3e-21
67emb|BX818793.1|CNS0A8YY Arabidopsis thaliana Full-length cDNA Co... 105 2e-19
68emb|CR712301.2|CNS0GCK9 Tetraodon nigroviridis full-length cDNA 76 1e-10
69emb|CR720218.2|CNS0GIO0 Tetraodon nigroviridis full-length cDNA 76 1e-10
70emb|CR720216.2|CNS0GINY Tetraodon nigroviridis full-length cDNA 76 1e-10
71emb|CR722715.2|CNS0GKLD Tetraodon nigroviridis full-length cDNA 76 1e-10
72emb|CR721883.2|CNS0GJY9 Tetraodon nigroviridis full-length cDNA 76 1e-10
73emb|CR720853.2|CNS0GJ5N Tetraodon nigroviridis full-length cDNA 76 1e-10
74emb|CR720472.2|CNS0GIV2 Tetraodon nigroviridis full-length cDNA 76 1e-10
75emb|CR719441.2|CNS0GI2F Tetraodon nigroviridis full-length cDNA 76 1e-10
76emb|CR719306.2|CNS0GHYO Tetraodon nigroviridis full-length cDNA 76 1e-10
77emb|CR717405.2|CNS0GGHV Tetraodon nigroviridis full-length cDNA 76 1e-10
78emb|CR717315.2|CNS0GGFD Tetraodon nigroviridis full-length cDNA 76 1e-10
79emb|CR716926.2|CNS0GG4N Tetraodon nigroviridis full-length cDNA 76 1e-10
80emb|CR711409.2|CNS0GBVH Tetraodon nigroviridis full-length cDNA 76 1e-10
81emb|CR714124.2|CNS0GDYW Tetraodon nigroviridis full-length cDNA 76 1e-10
82emb|CR714283.2|CNS0GE3B Tetraodon nigroviridis full-length cDNA 76 1e-10
83emb|CR712945.2|CNS0GD25 Tetraodon nigroviridis full-length cDNA 76 1e-10
84emb|CR713157.2|CNS0GD81 Tetraodon nigroviridis full-length cDNA 76 1e-10
85emb|CR710675.2|CNS0GBB3 Tetraodon nigroviridis full-length cDNA 76 1e-10
86emb|CR710088.2|CNS0GAUS Tetraodon nigroviridis full-length cDNA 76 1e-10
87emb|CR708708.2|CNS0G9SG Tetraodon nigroviridis full-length cDNA 76 1e-10
88emb|CR707417.2|CNS0G8SL Tetraodon nigroviridis full-length cDNA 76 1e-10
89emb|CR706939.2|CNS0G8FB Tetraodon nigroviridis full-length cDNA 76 1e-10
90emb|CR704562.2|CNS0G6LA Tetraodon nigroviridis full-length cDNA 76 1e-10
91emb|CR704014.2|CNS0G662 Tetraodon nigroviridis full-length cDNA 76 1e-10
92emb|CR703820.2|CNS0G60O Tetraodon nigroviridis full-length cDNA 76 1e-10
93emb|CR703584.2|CNS0G5U4 Tetraodon nigroviridis full-length cDNA 76 1e-10
94emb|CR703489.2|CNS0G5RH Tetraodon nigroviridis full-length cDNA 76 1e-10
95emb|CR702840.2|CNS0G59G Tetraodon nigroviridis full-length cDNA 76 1e-10
96emb|CR702635.2|CNS0G53R Tetraodon nigroviridis full-length cDNA 76 1e-10
97emb|CR702209.2|CNS0G4RX Tetraodon nigroviridis full-length cDNA 76 1e-10
98emb|CR702145.2|CNS0G4Q5 Tetraodon nigroviridis full-length cDNA 76 1e-10
99emb|CR700232.2|CNS0G390 Tetraodon nigroviridis full-length cDNA 76 1e-10
100emb|CR697958.2|CNS0G1HU Tetraodon nigroviridis full-length cDNA 76 1e-10
101emb|CR697195.2|CNS0G0WN Tetraodon nigroviridis full-length cDNA 76 1e-10
102emb|CR697018.2|CNS0G0RQ Tetraodon nigroviridis full-length cDNA 76 1e-10
103emb|CR696565.2|CNS0G0F5 Tetraodon nigroviridis full-length cDNA 76 1e-10
104emb|CR696312.2|CNS0G084 Tetraodon nigroviridis full-length cDNA 76 1e-10
105emb|CR694977.2|CNS0FZ71 Tetraodon nigroviridis full-length cDNA 76 1e-10
106emb|CR694101.2|CNS0FYIP Tetraodon nigroviridis full-length cDNA 76 1e-10
107emb|CR693396.2|CNS0FXZ4 Tetraodon nigroviridis full-length cDNA 76 1e-10
108emb|CR691738.2|CNS0FWP2 Tetraodon nigroviridis full-length cDNA 76 1e-10
109emb|CR688407.2|CNS0FU4J Tetraodon nigroviridis full-length cDNA 76 1e-10
110emb|CR689769.2|CNS0FV6D Tetraodon nigroviridis full-length cDNA 76 1e-10
111emb|CR687727.2|CNS0FTLN Tetraodon nigroviridis full-length cDNA 76 1e-10
112emb|CR686869.2|CNS0FSXT Tetraodon nigroviridis full-length cDNA 76 1e-10
113emb|CR685258.2|CNS0FRP2 Tetraodon nigroviridis full-length cDNA 76 1e-10
114emb|CR685076.2|CNS0FRK0 Tetraodon nigroviridis full-length cDNA 76 1e-10
115emb|CR684709.2|CNS0FR9T Tetraodon nigroviridis full-length cDNA 76 1e-10
116emb|CR684226.2|CNS0FQWE Tetraodon nigroviridis full-length cDNA 76 1e-10
117emb|CR683325.2|CNS0FQ7D Tetraodon nigroviridis full-length cDNA 76 1e-10
118emb|CR682942.2|CNS0FPWQ Tetraodon nigroviridis full-length cDNA 76 1e-10
119emb|CR682258.2|CNS0FPDQ Tetraodon nigroviridis full-length cDNA 76 1e-10
120emb|CR681455.2|CNS0FORF Tetraodon nigroviridis full-length cDNA 76 1e-10
121emb|CR681050.2|CNS0FOG6 Tetraodon nigroviridis full-length cDNA 76 1e-10
122emb|CR680145.2|CNS0FNR1 Tetraodon nigroviridis full-length cDNA 76 1e-10
123emb|CR676429.2|CNS0FKW9 Tetraodon nigroviridis full-length cDNA 76 1e-10
124emb|CR675710.2|CNS0FKCK Tetraodon nigroviridis full-length cDNA 76 1e-10
125emb|CR673595.2|CNS0FIPT Tetraodon nigroviridis full-length cDNA 76 1e-10
126emb|CR670866.2|CNS0FGM0 Tetraodon nigroviridis full-length cDNA 76 1e-10
127emb|CR669893.2|CNS0FFUZ Tetraodon nigroviridis full-length cDNA 76 1e-10
128emb|CR669083.2|CNS0FF8H Tetraodon nigroviridis full-length cDNA 76 1e-10
129emb|CR663251.2|CNS0FAQH Tetraodon nigroviridis full-length cDNA 76 1e-10
130emb|CR659804.2|CNS0F82Q Tetraodon nigroviridis full-length cDNA 76 1e-10
131emb|CR659262.2|CNS0F7NO Tetraodon nigroviridis full-length cDNA 76 1e-10
132emb|CR658566.2|CNS0F74C Tetraodon nigroviridis full-length cDNA 76 1e-10
133emb|CR657212.2|CNS0F62Q Tetraodon nigroviridis full-length cDNA 76 1e-10
134emb|CR656191.2|CNS0F5AD Tetraodon nigroviridis full-length cDNA 76 1e-10
135emb|CR655155.2|CNS0F4HL Tetraodon nigroviridis full-length cDNA 76 1e-10
136emb|CR654105.2|CNS0F3OF Tetraodon nigroviridis full-length cDNA 76 1e-10
137emb|CR652992.2|CNS0F2TI Tetraodon nigroviridis full-length cDNA 76 1e-10
138emb|CR651314.2|CNS0F1IW Tetraodon nigroviridis full-length cDNA 76 1e-10
139emb|CR647718.2|CNS0EYR0 Tetraodon nigroviridis full-length cDNA 76 1e-10
140emb|CR646899.2|CNS0EY49 Tetraodon nigroviridis full-length cDNA 76 1e-10
141emb|CR645541.2|CNS0EX2J Tetraodon nigroviridis full-length cDNA 76 1e-10
142emb|CR644913.2|CNS0EWL3 Tetraodon nigroviridis full-length cDNA 76 1e-10
143emb|CR642563.2|CNS0EURT Tetraodon nigroviridis full-length cDNA 76 1e-10
144emb|CR642362.2|CNS0EUM8 Tetraodon nigroviridis full-length cDNA 76 1e-10
145emb|CR641651.2|CNS0EU2H Tetraodon nigroviridis full-length cDNA 76 1e-10
146emb|CR641329.2|CNS0ETTJ Tetraodon nigroviridis full-length cDNA 76 1e-10
147emb|CR641017.2|CNS0ETKV Tetraodon nigroviridis full-length cDNA 76 1e-10
148emb|CR639635.2|CNS0ESIH Tetraodon nigroviridis full-length cDNA 76 1e-10
149emb|CR638530.2|CNS0ERNS Tetraodon nigroviridis full-length cDNA 76 1e-10
150emb|CR637949.2|CNS0ER7N Tetraodon nigroviridis full-length cDNA 76 1e-10
151emb|CR636021.2|CNS0EPQ3 Tetraodon nigroviridis full-length cDNA 76 1e-10
152emb|CR634987.2|CNS0EOXD Tetraodon nigroviridis full-length cDNA 76 1e-10
153emb|CR634338.2|CNS0EOFC Tetraodon nigroviridis full-length cDNA 76 1e-10
154gb|AY769318.1| Bombyx mori ribosomal protein S4 (RpS4) mRNA, com... 74 6e-10
155gb|AY190741.1| Pagrus major 40S ribosomal protein S4 mRNA, parti... 74 6e-10
156emb|CR696954.2|CNS0G0PY Tetraodon nigroviridis full-length cDNA 72 2e-09
157gb|AY130367.1| Petromyzon marinus ribosomal protein S4-like mRNA... 70 9e-09
158emb|CR671087.2|CNS0FGS5 Tetraodon nigroviridis full-length cDNA 68 3e-08
159gb|AY110862.1| Zea mays CL1882_8 mRNA sequence 68 3e-08
160gb|DQ066214.1| Ixodes scapularis isolate ISUFL21 ribosomal prote... 66 1e-07
161ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hyp... 64 5e-07
162gb|BC047994.1| Mus musculus RIKEN cDNA 1110033J19 gene, mRNA (cD... 60 8e-06
163gb|AC126683.4| Mus musculus BAC clone RP23-62G15 from 6, complet... 60 8e-06
164dbj|AK132160.1| Mus musculus 17 days embryo head cDNA, RIKEN ful... 60 8e-06
165dbj|AK012382.1| Mus musculus 11 days embryo whole body cDNA, RIK... 60 8e-06
166dbj|AK004068.1| Mus musculus 18-day embryo whole body cDNA, RIKE... 60 8e-06
167gb|BC028445.1| Mus musculus, clone IMAGE:963029, mRNA 60 8e-06
168gb|AC142274.3| Mus musculus BAC clone RP23-251M14 from 6, comple... 60 8e-06
169ref|NM_025405.2| Mus musculus RIKEN cDNA 1110033J19 gene (111003... 60 8e-06
170dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 58 3e-05
171ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothe... 56 1e-04
172gb|AC084630.1|CBRG45E13 Caenorhabditis briggsae cosmid G45E13, c... 56 1e-04
173gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-lik... 56 1e-04
174gb|BT018605.1| Zea mays clone EL01N0450E04.d mRNA sequence 54 5e-04
175gb|AC024780.1| Caenorhabditis elegans cosmid Y43B11AR, complete ... 54 5e-04
176gb|BT011369.1| Drosophila melanogaster RE57333 full insert cDNA 54 5e-04
177ref|NM_168537.1| Drosophila melanogaster Ribosomal protein S4 CG... 54 5e-04
178ref|NM_079329.2| Drosophila melanogaster Ribosomal protein S4 CG... 54 5e-04
179gb|AC093546.2| Drosophila melanogaster 3L BAC RP98-8G7 (Roswell ... 54 5e-04
180ref|NM_068702.2| Caenorhabditis elegans Ribosomal Protein, Small... 54 5e-04
181dbj|D25237.1|RICSS620B Oryza sativa SS620 mRNA for scar protein,... 54 5e-04
182gb|AE003539.3| Drosophila melanogaster chromosome 3L, section 46... 54 5e-04
183dbj|D16257.1|DRORPS4 Drosophila melanogaster rpS4 mRNA for ribos... 54 5e-04
184gb|BC081584.1| Danio rerio ribosomal protein S4, X-linked, mRNA ... 52 0.002
185ref|XM_521131.1| PREDICTED: Pan troglodytes similar to 40S ribos... 52 0.002
186gb|AY389947.1| Latimeria chalumnae ribosomal protein S4 mRNA, pa... 52 0.002
187gb|BC000472.2| Homo sapiens ribosomal protein S4, X-linked, mRNA... 52 0.002
188gb|BC007308.1| Homo sapiens ribosomal protein S4, X-linked, mRNA... 52 0.002
189gb|BC000236.1| Homo sapiens translin-associated factor X, mRNA (... 52 0.002
190ref|NM_001005589.1| Danio rerio ribosomal protein S4, X-linked (... 52 0.002
191ref|NM_001007.3| Homo sapiens ribosomal protein S4, X-linked (RP... 52 0.002
192gb|DQ445520.1| Graphocephala atropunctata isolate WHGA0585 putat... 52 0.002
193gb|BC100904.1| Homo sapiens ribosomal protein S4, X-linked, mRNA... 52 0.002
194gb|BC100903.1| Homo sapiens ribosomal protein S4, X-linked, mRNA... 52 0.002
195emb|AL135749.3|HSN14 Homo sapiens chromosome X sequence from BAC... 52 0.002
196emb|CR601794.1| full-length cDNA clone CS0DI031YB06 of Placenta ... 52 0.002
197emb|CR623958.1| full-length cDNA clone CS0DE004YB10 of Placenta ... 52 0.002
198emb|CR620411.1| full-length cDNA clone CS0DE011YG15 of Placenta ... 52 0.002
199dbj|AK097914.1| Homo sapiens cDNA FLJ40595 fis, clone THYMU20107... 52 0.002
200emb|CR597791.1| full-length cDNA clone CS0DI068YM24 of Placenta ... 52 0.002
201emb|CR595707.1| full-length cDNA clone CL0BB017ZH01 of Neuroblas... 52 0.002
202emb|CR456735.1| Homo sapiens full open reading frame cDNA clone ... 52 0.002
203emb|CR391662.1| Gallus gallus finished cDNA, clone ChEST418k16 52 0.002
204dbj|AK222479.1| Homo sapiens mRNA for ribosomal protein S4, X-li... 52 0.002
205emb|BX934312.1| Gallus gallus finished cDNA, clone ChEST670k21 52 0.002
206emb|BX930717.1| Gallus gallus finished cDNA, clone ChEST374l2 52 0.002
207ref|NM_205108.1| Gallus gallus ribosomal protein S4 (LOC396001),... 52 0.002
208gb|BC071662.1| Homo sapiens ribosomal protein S4, X-linked, mRNA... 52 0.002
209gb|AF041428.1|AF041428 Homo sapiens ribosomal protein s4 X isofo... 52 0.002
210gb|L24368.1|CHKRPS4A Gallus gallus (clone pDP1435) domesticus ri... 52 0.002
211gb|M58458.1|HUMRPS4X Human ribosomal protein S4 (RPS4X) isoform ... 52 0.002
212gb|M22146.1|HUMSCAR Human scar protein mRNA, complete cds 52 0.002
213dbj|AB024285.1| Macaca fuscata mRNA for ribosomal protein S4X (R... 52 0.002
214dbj|D50104.1| Macaca fuscata mRNA for ribosomal protein S4, part... 52 0.002
215dbj|AB015610.1| Chlorocebus aethiops mRNA for ribosomal protein ... 52 0.002
216ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predi... 50 0.008
217emb|AL116727.1|CNS01DEN Botrytis cinerea strain T4 cDNA library 50 0.008
218emb|AL116316.1|CNS01D38 Botrytis cinerea strain T4 cDNA library 50 0.008
219emb|AL113012.1|CNS01AJG Botrytis cinerea strain T4 cDNA library 50 0.008
220gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 ... 50 0.008
221emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB1... 50 0.008
222gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chr... 48 0.032
223ref|XM_591678.2| PREDICTED: Bos taurus ribosomal protein S4, X-l... 48 0.032
224ref|XM_567206.1| Cryptococcus neoformans var. neoformans JEC21 h... 48 0.032
225gb|AC146554.5| Medicago truncatula clone mth2-9l7, complete sequ... 48 0.032
226ref|XM_783401.1| PREDICTED: Strongylocentrotus purpuratus simila... 48 0.032
227dbj|D50109.1| Equus caballus mRNA for ribosomal protein S4, part... 48 0.032
228dbj|D50107.1| Bos taurus mRNA for ribosomal protein S4, partial cds 48 0.032
229ref|XM_753768.1| Ustilago maydis 521 hypothetical protein (UM027... 46 0.13
230ref|XM_537399.2| PREDICTED: Canis familiaris similar to 40S ribo... 46 0.13
231ref|XM_775416.1| PREDICTED: Strongylocentrotus purpuratus simila... 46 0.13
232gb|AC008087.11| Homo sapiens chromosome 17, clone RP5-1127L24, c... 46 0.13
233gb|AC027455.22| Homo sapiens chromosome 17, clone RP11-411G7, co... 46 0.13
234gb|AY224232.1|AY224229S4 Pongo pygmaeus ribosomal protein S4 (RP... 46 0.13
235emb|BX067601.1|CNS09OBP Single read from an extremity of a full-... 44 0.50
236emb|BX067600.1|CNS09OBO Single read from an extremity of a full-... 44 0.50
237dbj|AB226297.1| Aspergillus oryzae cDNA, contig sequence: AoEST3159 44 0.50
238gb|DQ362415.1| Shigella dysenteriae strain G1274 GcvT (gcvT) gen... 44 0.50
239gb|AF429978.1| Spodoptera frugiperda ribosomal protein S4 mRNA, ... 44 0.50
240gb|AY439895.1| Armigeres subalbatus ASAP ID: 38941 cytosolic sma... 42 2.0
241gb|AY433736.1| Aedes aegypti ASAP ID: 34407 cytosolic small ribo... 42 2.0
242gb|DQ440018.1| Aedes aegypti clone AE-221 40S ribosomal protein ... 42 2.0
243gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosom... 42 2.0
244ref|XM_657306.1| Aspergillus nidulans FGSC A4 hypothetical prote... 42 2.0
245emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 42 2.0
246ref|XM_749829.1| Aspergillus fumigatus Af293 cytosolic small rib... 42 2.0
247ref|XM_446360.1| Candida glabrata CBS138, CAGL0F09031g partial mRNA 42 2.0
248emb|AM048930.1| Mycetophagus quadripustulatus mRNA for ribosomal... 42 2.0
249gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, compl... 42 2.0
250emb|CR380952.1| Candida glabrata strain CBS138 chromosome F comp... 42 2.0
251emb|CR938551.1| Single read from an extremity of a full-length c... 42 2.0
252emb|CR938407.1| Single read from an extremity of a full-length c... 42 2.0
253emb|CR938406.1| Single read from an extremity of a full-length c... 42 2.0
254emb|CR938380.1| Single read from an extremity of a full-length c... 42 2.0
255emb|CR938366.1| Single read from an extremity of a full-length c... 42 2.0
256gb|AC149492.14| Medicago truncatula clone mth2-99d10, complete s... 42 2.0
257gb|AE012037.1| Xanthomonas axonopodis pv. citri str. 306, secti... 42 2.0
258dbj|AP007167.1| Aspergillus oryzae RIB40 genomic DNA, SC020 42 2.0
259dbj|D50110.1| Porcine mRNA for ribosomal protein S4, partial cds 42 2.0
260ref|NM_001030954.1| Gallus gallus metastasis suppressor 1 (MTSS1... 40 7.8
261gb|AC101844.7| Mus musculus chromosome 7, clone RP23-257M22, com... 40 7.8
262gb|AC147681.8| Canis Familiaris, clone XX-10A1, complete sequence 40 7.8
263gb|AF359361.3| Gibberella zeae strain GZ3639 trichothecene gene ... 40 7.8
264gb|AC154910.3| Mus musculus BAC clone RP23-70L9 from chromosome ... 40 7.8
265ref|XM_383708.1| Gibberella zeae PH-1 chromosome 2 hypothetical ... 40 7.8
266gb|AC132320.4| Mus musculus BAC clone RP24-259L9 from chromosome... 40 7.8
267emb|AL591785.1|SME591785 Sinorhizobium meliloti 1021 complete ch... 40 7.8
268gb|AY231807.1| Drosophila yakuba clone yak-em_RpS4 mRNA sequence 40 7.8
269gb|BC025658.1| Homo sapiens glycine/arginine rich protein 1, mRN... 40 7.8
270emb|Z68908.1|HSU227D1 Human DNA sequence from clone LL0XNC01-227... 40 7.8
271emb|AL731567.6| Human DNA sequence from clone RP11-67C2 on chrom... 40 7.8
272ref|XM_505600.1| Yarrowia lipolytica CLIB122, YALI0F18920g predi... 40 7.8
273emb|BX066422.1|CNS09NEY Single read from an extremity of a full-... 40 7.8
274emb|BX055169.1|CNS09EQD Single read from an extremity of a full-... 40 7.8
275ref|XM_795025.1| PREDICTED: Strongylocentrotus purpuratus hypoth... 40 7.8
276gb|AE008899.1| Salmonella typhimurium LT2, section 203 of 220 of... 40 7.8
277emb|AJ719272.1| Gallus gallus mRNA for hypothetical protein, clo... 40 7.8
278emb|AJ576316.1|STY576316 Salmonella typhimurium Salmonella Patho... 40 7.8
279gb|AF402812.1| Ictalurus punctatus 40S ribosomal protein S4 mRNA... 40 7.8
280emb|BX293994.28| Zebrafish DNA sequence from clone DKEY-256K14 i... 40 7.8
281gb|AC009806.9| Homo sapiens chromosome 11, clone RP11-51B23, com... 40 7.8
282gb|AF336366.2| Gibberella zeae H-11 trichothecene biosynthesis g... 40 7.8
283gb|AC007437.16| Homo sapiens 12q22 BAC RPCI11-541G9 (Roswell Par... 40 7.8
284gb|AC007656.2| Homo sapiens 12q22 BAC RPCI11-534P6 (Rowswell Par... 40 7.8
285gb|AY857461.1| Suberites domuncula S4 mRNA, complete cds 40 7.8
286gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 40 7.8
287gb|AC150660.4| Mus musculus BAC clone RP23-41F9 from chromosome ... 40 7.8
288gb|AC133282.7| Mus musculus chromosome 15, clone RP24-408B1, com... 40 7.8
289gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 40 7.8
290dbj|BS000205.2| Pan troglodytes chromosome 22 clone:RP43-093B21,... 40 7.8
291ref|NM_209058.1| Eremothecium gossypii ADL391Cp (ADL391C), mRNA 40 7.8
292emb|AL096869.8|CNS00YVH Human chromosome 14 DNA sequence BAC R-1... 40 7.8
293gb|AY919674.1| Homo sapiens amyloid beta (A4) precursor protein ... 40 7.8
294gb|AC151990.6| Mus musculus BAC clone RP23-299K14 from chromosom... 40 7.8
295gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 40 7.8
296dbj|AP001694.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 7.8
297gb|AF060869.1|AF060869 Salmonella typhimurium excision nuclease ... 40 7.8
298gb|AC140464.3| Mus musculus BAC clone RP24-383H6 from 12, comple... 40 7.8
299gb|AC102003.5| Mus musculus chromosome 7, clone RP24-488I10, com... 40 7.8
300emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 40 7.8
301emb|AL603836.13| Mouse DNA sequence from clone RP23-56A14 on chr... 40 7.8
302emb|AL139193.4|CNS01DXA Human chromosome 14 DNA sequence BAC R-6... 40 7.8
303dbj|AP000141.1| Homo sapiens genomic DNA, chromosome 21q21.2, LL... 40 7.8
304dbj|D87675.1| Homo sapiens DNA for amyloid precursor protein, co... 40 7.8
305dbj|AP001442.1| Homo sapiens genomic DNA, chromosome 21q21.1-q21... 40 7.8
306dbj|AP000088.1| Homo sapiens genomic DNA of 21q22.1, APP related... 40 7.8

>dbj|AB181482.1| Bromus inermis BiRP1 mRNA for ribosomal protein, complete cds
          Length = 1053

 Score =  787 bits (397), Expect = 0.0
 Identities = 513/549 (93%), Gaps = 2/549 (0%)
 Strand = Plus / Minus

                                                                        
Query: 22   taaacatcc-cattacatctagcagcatccatgggttcgcaaatcaacaaacatcaggca 80
            ||||||||| ||||||||||||||||| |||||||||| ||| |||||||||||||||||
Sbjct: 1036 taaacatccacattacatctagcagcaaccatgggttcacaattcaacaaacatcaggca 977

                                                                        
Query: 81   aaacttaaaaaagatggttccaggaacatagttctatatccttgcagataactggctata 140
            ||| ||||||| ||||||||||| ||||||||||||||||||| ||||||||||||||||
Sbjct: 976  aaatttaaaaacgatggttccagaaacatagttctatatcctt-cagataactggctata 918

                                                                        
Query: 141  gcaaaacgactcaatgcctcagaatcaggccttggcagcagcctgagctgcggcatccct 200
            ||||||||| |||| |||||||||||||||||||||||| ||||| || |||||||||||
Sbjct: 917  gcaaaacgaatcaacgcctcagaatcaggccttggcagctgcctgggcagcggcatccct 858

                                                                        
Query: 201  cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 260
            |||||||||||||||||||||||| ||||||||||| ||||||||||||||| |||||||
Sbjct: 857  cttcctctgctcctcaatgatggtcagcttgatacctttgcccttggggagggtcaccca 798

                                                                        
Query: 261  aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgacc 320
             ||||||||||||||||| ||||||||||| ||||| ||||||||||| |||||||||||
Sbjct: 797  cggcttggtgcccttgccgatggtgaacacattgcctagacgggtggcgaactggtgacc 738

                                                                        
Query: 321  ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 380
            ||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
Sbjct: 737  ctgagcatcctcaacgtggatggtctcgaaggttcccttatgcttctccctgttcttgat 678

                                                                        
Query: 381  cacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaa 440
            |||||||||||| |||||||| ||||||||||| |||||||| || ||||| || |||||
Sbjct: 677  cacaccaacacggccagtgttacgcccaccagtaaccatgacaacattgccaacatcaaa 618

                                                                        
Query: 441  cttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcctt 500
            ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 617  cttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcattggcctt 558

                                                                        
Query: 501  gatgagtgggtctgggtagcggatggtgcggccatcataggtgttcaggtatgggatgcc 560
            |||||||||||| ||||||||||||||||| ||||||| |||||| ||||||||||| ||
Sbjct: 557  gatgagtgggtcagggtagcggatggtgcgaccatcattggtgttgaggtatgggatacc 498

                     
Query: 561  cttctggcc 569
            |||||||||
Sbjct: 497  cttctggcc 489



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2,
              complete sequence
          Length = 35954743

 Score =  472 bits (238), Expect = e-130
 Identities = 358/398 (89%)
 Strand = Plus / Plus

                                                                          
Query: 172    ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 231
              |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 316967 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 317026

                                                                          
Query: 232    atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 291
              || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 317027 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 317086

                                                                          
Query: 292    ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 351
              ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| |||
Sbjct: 317087 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 317146

                                                                          
Query: 352    gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 411
               | || ||||||||||||||||||||||||||||||||||| || ||||| |  || |||
Sbjct: 317147 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 317206

                                                                          
Query: 412    gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 471
              ||||||||||| || ||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 317207 gtcaccatgacaacattgccaacatcaaacttgatgaagtcgacaatcttgttggtctcc 317266

                                                                          
Query: 472    aggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
              || |||| |||||| |||||||| ||||||||||  ||||| ||||||||||||||||| 
Sbjct: 317267 agatcgatcttgattgtgtcgtttgccttgatgatcgggtcagggtagcggatggtgcga 317326

                                                    
Query: 532    ccatcataggtgttcaggtatgggatgcccttctggcc 569
              |||||||||||||||||||| ||||| |||||||||||
Sbjct: 317327 ccatcataggtgttcaggtaggggattcccttctggcc 317364



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                      
Query: 108    atagttctatatccttgcagataactggctatagcaaaac 147
              ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 316896 atagttctatatccttgcaaacaactcgctatagcaaaac 316935



to top

>dbj|AP004851.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1359_D06
          Length = 146805

 Score =  472 bits (238), Expect = e-130
 Identities = 358/398 (89%)
 Strand = Plus / Plus

                                                                         
Query: 172   ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 231
             |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 45751 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 45810

                                                                         
Query: 232   atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 291
             || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 45811 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 45870

                                                                         
Query: 292   ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 351
             ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| |||
Sbjct: 45871 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 45930

                                                                         
Query: 352   gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 411
              | || ||||||||||||||||||||||||||||||||||| || ||||| |  || |||
Sbjct: 45931 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 45990

                                                                         
Query: 412   gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 471
             ||||||||||| || ||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 45991 gtcaccatgacaacattgccaacatcaaacttgatgaagtcgacaatcttgttggtctcc 46050

                                                                         
Query: 472   aggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
             || |||| |||||| |||||||| ||||||||||  ||||| ||||||||||||||||| 
Sbjct: 46051 agatcgatcttgattgtgtcgtttgccttgatgatcgggtcagggtagcggatggtgcga 46110

                                                   
Query: 532   ccatcataggtgttcaggtatgggatgcccttctggcc 569
             |||||||||||||||||||| ||||| |||||||||||
Sbjct: 46111 ccatcataggtgttcaggtaggggattcccttctggcc 46148



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 108   atagttctatatccttgcagataactggctatagcaaaac 147
             ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 45680 atagttctatatccttgcaaacaactcgctatagcaaaac 45719



to top

>dbj|AK103949.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B09, full
           insert sequence
          Length = 1016

 Score =  472 bits (238), Expect = e-130
 Identities = 358/398 (89%)
 Strand = Plus / Minus

                                                                       
Query: 172 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 231
           |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 886 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 827

                                                                       
Query: 232 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 291
           || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 826 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 767

                                                                       
Query: 292 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 351
           ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| |||
Sbjct: 766 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 707

                                                                       
Query: 352 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 411
            | || ||||||||||||||||||||||||||||||||||| || ||||| |  || |||
Sbjct: 706 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 647

                                                                       
Query: 412 gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 471
           ||||||||||| || ||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 646 gtcaccatgacaacattgccaacatcaaacttgatgaagtcgacaatcttgttggtctcc 587

                                                                       
Query: 472 aggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           || |||| |||||| |||||||| ||||||||||  ||||| ||||||||||||||||| 
Sbjct: 586 agatcgatcttgattgtgtcgtttgccttgatgatcgggtcagggtagcggatggtgcga 527

                                                 
Query: 532 ccatcataggtgttcaggtatgggatgcccttctggcc 569
           |||||||||||||||||||| ||||| |||||||||||
Sbjct: 526 ccatcataggtgttcaggtaggggattcccttctggcc 489



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 108 atagttctatatccttgcagataactggctatagcaaaac 147
           ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 957 atagttctatatccttgcaaacaactcgctatagcaaaac 918



to top

>dbj|AK102423.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033093E13, full
           insert sequence
          Length = 1157

 Score =  472 bits (238), Expect = e-130
 Identities = 358/398 (89%)
 Strand = Plus / Minus

                                                                       
Query: 172 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 231
           |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 890 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 831

                                                                       
Query: 232 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 291
           || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||| 
Sbjct: 830 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaca 771

                                                                       
Query: 292 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 351
           ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| |||
Sbjct: 770 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 711

                                                                       
Query: 352 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 411
            | || ||||||||||||||||||||||||||||||||||| || ||||| |  || |||
Sbjct: 710 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 651

                                                                       
Query: 412 gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 471
           ||||||||||| || ||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 650 gtcaccatgacaacattgccaacatcaaacttgatgaagtcgacaatcttgttggtctcc 591

                                                                       
Query: 472 aggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           || |||| |||||| |||||||| ||||||||||  ||||| ||||||||||||||||| 
Sbjct: 590 agatcgatcttgattgtgtcgtttgccttgatgatcgggtcagggtagcggatggtgcga 531

                                                 
Query: 532 ccatcataggtgttcaggtatgggatgcccttctggcc 569
           |||||||||||||||||||| ||||| |||||||||||
Sbjct: 530 ccatcataggtgttcaggtaggggattcccttctggcc 493



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 108 atagttctatatccttgcagataactggctatagcaaaac 147
           ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 961 atagttctatatccttgcaaacaactcgctatagcaaaac 922



to top

>dbj|AK061776.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-D06, full
           insert sequence
          Length = 1079

 Score =  464 bits (234), Expect = e-127
 Identities = 357/398 (89%)
 Strand = Plus / Minus

                                                                       
Query: 172 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 231
           |||||||||||||| || || ||||||| |||||| |||||||| |||||| ||||||||
Sbjct: 882 ttggcagcagcctgggcggcagcatcccgcttcctttgctcctcgatgatgctgagcttg 823

                                                                       
Query: 232 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 291
           || |||||||||||||| |||||||||||||||||| |||||||||||||||||||||  
Sbjct: 822 atgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacaaa 763

                                                                       
Query: 292 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 351
           ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| |||
Sbjct: 762 ttgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaag 703

                                                                       
Query: 352 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 411
            | || ||||||||||||||||||||||||||||||||||| || ||||| |  || |||
Sbjct: 702 ctgcctttatgcttctccctgttcttgatcacaccaacacggcctgtgttccttcctcca 643

                                                                       
Query: 412 gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 471
           ||||||||||| || ||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 642 gtcaccatgacaacattgccaacatcaaacttgatgaagtcgacaatcttgttggtctcc 583

                                                                       
Query: 472 aggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           || |||| |||||| |||||||| ||||||||||  ||||| ||||||||||||||||| 
Sbjct: 582 agatcgatcttgattgtgtcgtttgccttgatgatcgggtcagggtagcggatggtgcga 523

                                                 
Query: 532 ccatcataggtgttcaggtatgggatgcccttctggcc 569
           |||||||||||||||||||| ||||| |||||||||||
Sbjct: 522 ccatcataggtgttcaggtaggggattcccttctggcc 485



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 108 atagttctatatccttgcagataactggctatagcaaaac 147
           ||||||||||||||||||| | |||| |||||||||||||
Sbjct: 953 atagttctatatccttgcaaacaactcgctatagcaaaac 914



to top

>gb|AF015522.1|AF015522 Zea mays ribsomal protein S4 (rps4) mRNA, complete cds
          Length = 1090

 Score =  426 bits (215), Expect = e-116
 Identities = 329/367 (89%)
 Strand = Plus / Minus

                                                                       
Query: 203 tcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaag 262
           ||||||||||||| |||||| ||||||||||||||||||||||||| ||||||||||| |
Sbjct: 844 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 785

                                                                       
Query: 263 gcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgaccct 322
           ||||| |||||||||| |||||||||||||||||||  |||||||| |||||||| ||| 
Sbjct: 784 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 725

                                                                       
Query: 323 gggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatca 382
            ||  ||||| ||||||||||| || |||   ||||| ||||||||||||||||||||||
Sbjct: 724 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 665

                                                                       
Query: 383 caccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaact 442
           |||| |||||||| ||||| | ||| || ||||||||||| |||||||||||||||||||
Sbjct: 664 cacctacacgcccggtgttcctcccgccggtcaccatgaccacgttgccgacgtcaaact 605

                                                                       
Query: 443 tgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggccttga 502
           |||||||||| |  ||||||||||||||||| |||| |||||||||||||||||||||||
Sbjct: 604 tgatgaagtccatgatcttgttggtctccagatcgatcttgatggtgtcgttggccttga 545

                                                                       
Query: 503 tgagtgggtctgggtagcggatggtgcggccatcataggtgttcaggtatgggatgccct 562
           |||| ||||| |||||||||||||||||||| || |||||||||||||| ||||||||||
Sbjct: 544 tgagcgggtcggggtagcggatggtgcggccgtcgtaggtgttcaggtaggggatgccct 485

                  
Query: 563 tctggcc 569
           |||||||
Sbjct: 484 tctggcc 478



to top

>gb|AF013487.1|AF013487 Zea mays ribosomal protein S4 type I (rps4) mRNA, complete cds
          Length = 1013

 Score =  426 bits (215), Expect = e-116
 Identities = 350/395 (88%)
 Strand = Plus / Minus

                                                                       
Query: 172 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 231
           |||||||||||||| || |||||||||| |||||| ||||| || |||||| | ||||||
Sbjct: 864 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 805

                                                                       
Query: 232 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 291
           || |||||||||||||| ||||||||||| |||||  | |||||||| ||||||||||||
Sbjct: 804 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 745

                                                                       
Query: 292 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 351
           ||||||| ||||||||| |||||||| ||| |||  ||||| ||||| ||||||||||||
Sbjct: 744 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaaag 685

                                                                       
Query: 352 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 411
            | ||||| |||||||||||||||||||| ||||| || || |||||||| |  || |||
Sbjct: 684 ctgcccttgtgcttctccctgttcttgataacacccacgcggccagtgttccttccgcca 625

                                                                       
Query: 412 gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 471
           |||||||||||||||||||| || ||||||||||||||||| ||||||||||||||||||
Sbjct: 624 gtcaccatgacgacgttgccaacatcaaacttgatgaagtccacaatcttgttggtctcc 565

                                                                       
Query: 472 aggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           || |||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 564 agatcgatcttgatggtgtcgttggccttgatgagggggtcagggtagcggatggtgcgg 505

                                              
Query: 532 ccatcataggtgttcaggtatgggatgcccttctg 566
           || ||||| |||||||| || ||||||||||||||
Sbjct: 504 ccgtcatacgtgttcagataagggatgcccttctg 470



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 104 gaacatagttctatatccttgcaga 128
           |||||| ||||||||||||||||||
Sbjct: 936 gaacattgttctatatccttgcaga 912



to top

>gb|BT016261.1| Zea mays clone Contig94 mRNA sequence
          Length = 1116

 Score =  418 bits (211), Expect = e-114
 Identities = 328/367 (89%)
 Strand = Plus / Minus

                                                                       
Query: 203 tcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaag 262
           ||||||||||||| |||||| ||||||||||||||||||||||||| ||||||||||| |
Sbjct: 865 tcctctgctcctcgatgatgctgagcttgatacccttgcccttgggcaggctcacccacg 806

                                                                       
Query: 263 gcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgaccct 322
           ||||| |||||||||| |||||||||||||||||||  |||||||| |||||||| ||| 
Sbjct: 805 gcttgttgcccttgccgatggtgaacacgttgcccatgcgggtggcgaactggtggccca 746

                                                                       
Query: 323 gggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatca 382
            ||  ||||| ||||||||||| || |||   ||||| ||||||||||||||||||||||
Sbjct: 745 tggagtcctcgacgtggatggtatcgaagccgcccttgtgcttctccctgttcttgatca 686

                                                                       
Query: 383 caccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaact 442
           |||| |||||||| ||||| | ||| || ||||||||||| |||||||||||||||||||
Sbjct: 685 cacctacacgcccggtgttcctcccgccggtcaccatgaccacgttgccgacgtcaaact 626

                                                                       
Query: 443 tgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggccttga 502
           |||||||||| |  ||||||||||||||||| |||| |||||||||||||||||||||||
Sbjct: 625 tgatgaagtccatgatcttgttggtctccagatcgatcttgatggtgtcgttggccttga 566

                                                                       
Query: 503 tgagtgggtctgggtagcggatggtgcggccatcataggtgttcaggtatgggatgccct 562
           |||| ||||| |||||||||||||| ||||| || |||||||||||||| ||||||||||
Sbjct: 565 tgagcgggtcggggtagcggatggtacggccgtcgtaggtgttcaggtaggggatgccct 506

                  
Query: 563 tctggcc 569
           |||||||
Sbjct: 505 tctggcc 499



to top

>gb|AY525608.1| Zea mays ribosomal protein S4 mRNA, complete cds
          Length = 1037

 Score =  410 bits (207), Expect = e-111
 Identities = 348/395 (88%)
 Strand = Plus / Minus

                                                                       
Query: 172 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 231
           |||||||||||||| || |||||||||| |||||| ||||| || |||||| | ||||||
Sbjct: 862 ttggcagcagcctgggcagcggcatcccgcttcctttgctcttctatgatgctcagcttg 803

                                                                       
Query: 232 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 291
           || |||||||||||||| ||||||||||| |||||  | |||||||| ||||||||||||
Sbjct: 802 attcccttgcccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 743

                                                                       
Query: 292 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 351
           ||||||| ||||||||| |||||||| ||| |||  ||||| ||||| |||||||||| |
Sbjct: 742 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatggtctcaagg 683

                                                                       
Query: 352 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 411
            | ||||| |||||||||||||||||||| ||||| ||||| |||||||| |  || |||
Sbjct: 682 ctgcccttgtgcttctccctgttcttgataacacccacacggccagtgttccttccgcca 623

                                                                       
Query: 412 gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 471
           ||||||||||| |||||||| || ||||||||||||||||| ||||| ||||||||||||
Sbjct: 622 gtcaccatgacaacgttgccaacatcaaacttgatgaagtccacaattttgttggtctcc 563

                                                                       
Query: 472 aggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           || |||| ||||||||||||||||||||||||| | ||||| ||||||||||||||||||
Sbjct: 562 agatcgatcttgatggtgtcgttggccttgatgggcgggtcagggtagcggatggtgcgg 503

                                              
Query: 532 ccatcataggtgttcaggtatgggatgcccttctg 566
           || ||||| ||||||||||| ||||||||||||||
Sbjct: 502 ccgtcatacgtgttcaggtacgggatgcccttctg 468



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 104 gaacatagttctatatccttgcaga 128
           |||||| ||||||||||||||||||
Sbjct: 934 gaacattgttctatatccttgcaga 910



to top

>gb|BT017558.1| Zea mays clone EL01N0424H12.c mRNA sequence
          Length = 1145

 Score =  394 bits (199), Expect = e-106
 Identities = 346/395 (87%)
 Strand = Plus / Plus

                                                                       
Query: 172 ttggcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttg 231
           |||||||||||||| || || ||||||| |||||| ||||| || |||||| | ||||||
Sbjct: 178 ttggcagcagcctgggcagcagcatcccgcttcctttgctcttctatgatgctcagcttg 237

                                                                       
Query: 232 atacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacg 291
           || ||||| |||||||| ||||||||||| |||||  | |||||||| ||||||||||||
Sbjct: 238 attcccttacccttgggcaggctcacccacggcttattacccttgccgatggtgaacacg 297

                                                                       
Query: 292 ttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaag 351
           ||||||| ||||||||| |||||||| ||| |||  ||||| ||||| || |||||||||
Sbjct: 298 ttgcccatacgggtggcgaactggtggcccagggagtcctccacgtgaatagtctcaaag 357

                                                                       
Query: 352 gttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccacca 411
            | ||||| |||||||||||||||||||| ||||| |||||  ||||||| |  || |||
Sbjct: 358 ctgcccttgtgcttctccctgttcttgataacacccacacgggcagtgttccttccccca 417

                                                                       
Query: 412 gtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctcc 471
           |||||||||||||||||||| || ||||||||||||||||| |||||||||||||| |||
Sbjct: 418 gtcaccatgacgacgttgccaacatcaaacttgatgaagtccacaatcttgttggtatcc 477

                                                                       
Query: 472 aggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           || |||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 478 agatcgatcttgatggtgtcgttggccttgatgagggggtcagggtagcggatggtgcgg 537

                                              
Query: 532 ccatcataggtgttcaggtatgggatgcccttctg 566
           || ||||| |||||||| || ||||||||||||||
Sbjct: 538 ccgtcatacgtgttcagataagggatgcccttctg 572



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 103 ggaacatagttctatatccttgcaga 128
           ||||||| ||||||||||||||||||
Sbjct: 105 ggaacattgttctatatccttgcaga 130



to top

>ref|NM_193994.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 768

 Score =  309 bits (156), Expect = 5e-81
 Identities = 333/392 (84%)
 Strand = Plus / Minus

                                                                       
Query: 175 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 234
           |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 758 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 699

                                                                       
Query: 235 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 294
           ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 698 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 639

                                                                       
Query: 295 cccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaaggtt 354
           |||||||||||||| ||    || |||   || ||||| || ||||||||||||||  | 
Sbjct: 638 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 579

                                                                       
Query: 355 cccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagtc 414
           ||||| ||||||||||||||||| || || |||||||| |||||||| | ||| || || 
Sbjct: 578 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 519

                                                                       
Query: 415 accatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctccagg 474
           ||||| ||||| ||||| || ||||||||||||||||||||||||||||||||||| || 
Sbjct: 518 accataacgacattgcccacatcaaacttgatgaagtcaacaatcttgttggtctcaaga 459

                                                                       
Query: 475 tcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggcca 534
           || | |||||| |||||||| ||||| || |  ||||| ||||||||||||||||| |||
Sbjct: 458 tcaatcttgattgtgtcgttagccttaatcaaagggtccgggtagcggatggtgcgtcca 399

                                           
Query: 535 tcataggtgttcaggtatgggatgcccttctg 566
           |||||||||||||| || || |||||||||||
Sbjct: 398 tcataggtgttcagatagggaatgcccttctg 367



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score =  309 bits (156), Expect = 5e-81
 Identities = 333/392 (84%)
 Strand = Plus / Minus

                                                                            
Query: 175      gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 234
                |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 14497969 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 14497910

                                                                            
Query: 235      cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 294
                ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 14497909 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 14497850

                                                                            
Query: 295      cccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaaggtt 354
                |||||||||||||| ||    || |||   || ||||| || ||||||||||||||  | 
Sbjct: 14497849 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 14497790

                                                                            
Query: 355      cccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagtc 414
                ||||| ||||||||||||||||| || || |||||||| |||||||| | ||| || || 
Sbjct: 14497789 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 14497730

                                                                            
Query: 415      accatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctccagg 474
                ||||| ||||| ||||| || ||||||||||||||||||||||||||||||||||| || 
Sbjct: 14497729 accataacgacattgcccacatcaaacttgatgaagtcaacaatcttgttggtctcaaga 14497670

                                                                            
Query: 475      tcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggcca 534
                || | |||||| |||||||| ||||| || |  ||||| ||||||||||||||||| |||
Sbjct: 14497669 tcaatcttgattgtgtcgttagccttaatcaaagggtccgggtagcggatggtgcgtcca 14497610

                                                
Query: 535      tcataggtgttcaggtatgggatgcccttctg 566
                |||||||||||||| || || |||||||||||
Sbjct: 14497609 tcataggtgttcagatagggaatgcccttctg 14497578



to top

>dbj|AP003275.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0514H03
          Length = 167230

 Score =  309 bits (156), Expect = 5e-81
 Identities = 333/392 (84%)
 Strand = Plus / Minus

                                                                         
Query: 175   gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 234
             |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 57282 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 57223

                                                                         
Query: 235   cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 294
             ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 57222 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 57163

                                                                         
Query: 295   cccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaaggtt 354
             |||||||||||||| ||    || |||   || ||||| || ||||||||||||||  | 
Sbjct: 57162 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 57103

                                                                         
Query: 355   cccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagtc 414
             ||||| ||||||||||||||||| || || |||||||| |||||||| | ||| || || 
Sbjct: 57102 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 57043

                                                                         
Query: 415   accatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctccagg 474
             ||||| ||||| ||||| || ||||||||||||||||||||||||||||||||||| || 
Sbjct: 57042 accataacgacattgcccacatcaaacttgatgaagtcaacaatcttgttggtctcaaga 56983

                                                                         
Query: 475   tcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggcca 534
             || | |||||| |||||||| ||||| || |  ||||| ||||||||||||||||| |||
Sbjct: 56982 tcaatcttgattgtgtcgttagccttaatcaaagggtccgggtagcggatggtgcgtcca 56923

                                             
Query: 535   tcataggtgttcaggtatgggatgcccttctg 566
             |||||||||||||| || || |||||||||||
Sbjct: 56922 tcataggtgttcagatagggaatgcccttctg 56891



to top

>dbj|AK061826.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-C06, full
           insert sequence
          Length = 1035

 Score =  309 bits (156), Expect = 5e-81
 Identities = 333/392 (84%)
 Strand = Plus / Minus

                                                                       
Query: 175 gcagcagcctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgata 234
           |||||||||||||| || ||||| | ||||||||| ||||| |||||| |||||||||||
Sbjct: 875 gcagcagcctgagcagcagcatctcgcttcctctgttcctcgatgatgctgagcttgata 816

                                                                       
Query: 235 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 294
           ||||||||||| |||||   |||||| |||||| |||||||||| ||||||||||| |||
Sbjct: 815 cccttgcccttagggagagacacccatggcttgttgcccttgccgatggtgaacacattg 756

                                                                       
Query: 295 cccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaaggtt 354
           |||||||||||||| ||    || |||   || ||||| || ||||||||||||||  | 
Sbjct: 755 cccagacgggtggcgaaggcatggcccaatgcgtcctccacatggatggtctcaaaactg 696

                                                                       
Query: 355 cccttatgcttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagtc 414
           ||||| ||||||||||||||||| || || |||||||| |||||||| | ||| || || 
Sbjct: 695 cccttgtgcttctccctgttcttaattactccaacacgaccagtgttcctccctcctgtg 636

                                                                       
Query: 415 accatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctccagg 474
           ||||| ||||| ||||| || ||||||||||||||||||||||||||||||||||| || 
Sbjct: 635 accataacgacattgcccacatcaaacttgatgaagtcaacaatcttgttggtctcaaga 576

                                                                       
Query: 475 tcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggcca 534
           || | |||||| |||||||| ||||| || |  ||||| ||||||||||||||||| |||
Sbjct: 575 tcaatcttgattgtgtcgttagccttaatcaaagggtccgggtagcggatggtgcgtcca 516

                                           
Query: 535 tcataggtgttcaggtatgggatgcccttctg 566
           |||||||||||||| || || |||||||||||
Sbjct: 515 tcataggtgttcagatagggaatgcccttctg 484



to top

>ref|XM_475130.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 738

 Score =  289 bits (146), Expect = 5e-75
 Identities = 311/366 (84%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 260
           |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |||||
Sbjct: 708 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 649

                                                                       
Query: 261 aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgacc 320
            |||||  |  ||||||| |||||||| ||||||||||  || || || |||||||| ||
Sbjct: 648 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 589

                                                                       
Query: 321 ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 380
             |||||||||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 588 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 529

                                                                       
Query: 381 cacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaa 440
           ||| || || ||||| ||||| | |||||| |||||||| |||| ||| || || |||||
Sbjct: 528 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttccaacatcaaa 469

                                                                       
Query: 441 cttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcctt 500
           |||||||||||| || |||||||||||||||| ||| | |||||||||||||||||||||
Sbjct: 468 cttgatgaagtccacgatcttgttggtctccaagtcaatcttgatggtgtcgttggcctt 409

                                                                       
Query: 501 gatgagtgggtctgggtagcggatggtgcggccatcataggtgttcaggtatgggatgcc 560
           |||||||||||||||||||||||| ||||| || || | |||||||||| | || || ||
Sbjct: 408 gatgagtgggtctgggtagcggatcgtgcgcccgtcgttggtgttcaggaaaggaatacc 349

                 
Query: 561 cttctg 566
           ||||||
Sbjct: 348 cttctg 343



to top

>gb|AC104279.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1393_A07,
             complete sequence
          Length = 159932

 Score =  289 bits (146), Expect = 5e-75
 Identities = 311/366 (84%)
 Strand = Plus / Minus

                                                                         
Query: 201   cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 260
             |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |||||
Sbjct: 81033 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 80974

                                                                         
Query: 261   aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgacc 320
              |||||  |  ||||||| |||||||| ||||||||||  || || || |||||||| ||
Sbjct: 80973 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 80914

                                                                         
Query: 321   ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 380
               |||||||||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 80913 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 80854

                                                                         
Query: 381   cacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaa 440
             ||| || || ||||| ||||| | |||||| |||||||| |||| ||| || || |||||
Sbjct: 80853 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttccaacatcaaa 80794

                                                                         
Query: 441   cttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcctt 500
             |||||||||||| || |||||||||||||||| ||| | |||||||||||||||||||||
Sbjct: 80793 cttgatgaagtccacgatcttgttggtctccaagtcaatcttgatggtgtcgttggcctt 80734

                                                                         
Query: 501   gatgagtgggtctgggtagcggatggtgcggccatcataggtgttcaggtatgggatgcc 560
             |||||||||||||||||||||||| ||||| || || | |||||||||| | || || ||
Sbjct: 80733 gatgagtgggtctgggtagcggatcgtgcgcccgtcgttggtgttcaggaaaggaatacc 80674

                   
Query: 561   cttctg 566
             ||||||
Sbjct: 80673 cttctg 80668



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  289 bits (146), Expect = 5e-75
 Identities = 311/366 (84%)
 Strand = Plus / Minus

                                                                            
Query: 201      cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 260
                |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |||||
Sbjct: 17551228 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 17551169

                                                                            
Query: 261      aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgacc 320
                 |||||  |  ||||||| |||||||| ||||||||||  || || || |||||||| ||
Sbjct: 17551168 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 17551109

                                                                            
Query: 321      ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 380
                  |||||||||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 17551108 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 17551049

                                                                            
Query: 381      cacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaa 440
                ||| || || ||||| ||||| | |||||| |||||||| |||| ||| || || |||||
Sbjct: 17551048 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttccaacatcaaa 17550989

                                                                            
Query: 441      cttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcctt 500
                |||||||||||| || |||||||||||||||| ||| | |||||||||||||||||||||
Sbjct: 17550988 cttgatgaagtccacgatcttgttggtctccaagtcaatcttgatggtgtcgttggcctt 17550929

                                                                            
Query: 501      gatgagtgggtctgggtagcggatggtgcggccatcataggtgttcaggtatgggatgcc 560
                |||||||||||||||||||||||| ||||| || || | |||||||||| | || || ||
Sbjct: 17550928 gatgagtgggtctgggtagcggatcgtgcgcccgtcgttggtgttcaggaaaggaatacc 17550869

                      
Query: 561      cttctg 566
                ||||||
Sbjct: 17550868 cttctg 17550863



to top

>dbj|AK071862.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023123J20, full
           insert sequence
          Length = 1162

 Score =  289 bits (146), Expect = 5e-75
 Identities = 311/366 (84%)
 Strand = Plus / Minus

                                                                       
Query: 201 cttcctctgctcctcaatgatggtgagcttgatacccttgcccttggggaggctcaccca 260
           |||||||  ||||||||||||| |||||||||| |||||||||||||||||    |||||
Sbjct: 860 cttcctcgcctcctcaatgatgctgagcttgatgcccttgcccttggggagagataccca 801

                                                                       
Query: 261 aggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgacc 320
            |||||  |  ||||||| |||||||| ||||||||||  || || || |||||||| ||
Sbjct: 800 cggcttcctctccttgccgatggtgaagacgttgcccatgcgagtcgcgaactggtggcc 741

                                                                       
Query: 321 ctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgat 380
             |||||||||| || ||||||||||||||| | ||||| |||||||||||| |||||||
Sbjct: 740 gagggcatcctcgacatggatggtctcaaagctgcccttgtgcttctccctgctcttgat 681

                                                                       
Query: 381 cacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaa 440
           ||| || || ||||| ||||| | |||||| |||||||| |||| ||| || || |||||
Sbjct: 680 caccccgacgcgccccgtgttcctcccaccggtcaccatcacgatgtttccaacatcaaa 621

                                                                       
Query: 441 cttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcctt 500
           |||||||||||| || |||||||||||||||| ||| | |||||||||||||||||||||
Sbjct: 620 cttgatgaagtccacgatcttgttggtctccaagtcaatcttgatggtgtcgttggcctt 561

                                                                       
Query: 501 gatgagtgggtctgggtagcggatggtgcggccatcataggtgttcaggtatgggatgcc 560
           |||||||||||||||||||||||| ||||| || || | |||||||||| | || || ||
Sbjct: 560 gatgagtgggtctgggtagcggatcgtgcgcccgtcgttggtgttcaggaaaggaatacc 501

                 
Query: 561 cttctg 566
           ||||||
Sbjct: 500 cttctg 495



to top

>gb|AF071891.1|AF071891 Prunus armeniaca 40S ribosomal protein S4 (RPS4) mRNA, complete cds
          Length = 1086

 Score =  232 bits (117), Expect = 1e-57
 Identities = 294/353 (83%)
 Strand = Plus / Minus

                                                                       
Query: 214 tcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggtgccc 273
           |||| |||||| ||||||||||| || |||||||| ||   ||||||||| || || |||
Sbjct: 783 tcaaggatggttagcttgatacctttccccttgggaagagacacccaaggttttgtaccc 724

                                                                       
Query: 274 ttgccaatggtgaacacgttgcccagacgggtggcaaactggtgaccctgggcatcctca 333
           ||||||||||||||||| || || || || || ||||||| ||||||   |||||||| |
Sbjct: 723 ttgccaatggtgaacacattaccaagccgagtagcaaactcgtgaccagtggcatcctga 664

                                                                       
Query: 334 acgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgc 393
           |||||||||||||||||| ||||||||||||||||||||||||| || || |||||||| 
Sbjct: 663 acgtggatggtctcaaagcttcccttatgcttctccctgttcttaatgactccaacacga 604

                                                                       
Query: 394 ccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtca 453
           ||  |||| |  ||||||||||||||||| || || || || |||||||| |||||||| 
Sbjct: 603 cctctgtttcttccaccagtcaccatgacaacatttccaacatcaaacttaatgaagtcg 544

                                                                       
Query: 454 acaatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtct 513
              |||||||| ||||||| ||| |||||||| ||||| |||||||||||||| ||||| 
Sbjct: 543 gtgatcttgtttgtctccaagtccagcttgatagtgtcattggccttgatgagggggtca 484

                                                                
Query: 514 gggtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           |||||||| ||||| |  || ||||| ||||| |  || ||||||||||||||
Sbjct: 483 gggtagcgaatggttctcccgtcataagtgttaatataggggatgcccttctg 431



to top

>emb|Y15009.1|OSY15009 Oryza sativa mRNA for ribosomal protein S4
          Length = 1148

 Score =  224 bits (113), Expect = 2e-55
 Identities = 194/217 (89%), Gaps = 3/217 (1%)
 Strand = Plus / Minus

                                                                       
Query: 172 ttggcagcagcctgagctgcggcatccctcttcctctgctcct-caatgatggtgagctt 230
           |||||||||||||| || || || |||| |||||| ||||||| | |||||| |||||||
Sbjct: 865 ttggcagcagcctgggcggccgc-tcccgcttcctttgctccttcgatgatgctgagctt 807

                                                                       
Query: 231 gatacccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacac 290
           ||| |||||||||||||| |||||||||||||||||| ||||||||||||||||||||||
Sbjct: 806 gatgcccttgcccttgggcaggctcacccaaggcttgttgcccttgccaatggtgaacac 747

                                                                       
Query: 291 gttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaa 350
            ||||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| ||
Sbjct: 746 attgcccagacgggtggcgaattggtggcccagggcatcctcaacgtggatggtctcgaa 687

                                                
Query: 351 ggttcccttatgcttctccctgttcttgatcacacca 387
            | | |||| |||||||||||||| ||||||||||||
Sbjct: 686 -gctgccttttgcttctccctgttgttgatcacacca 651



 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 79/92 (85%), Gaps = 2/92 (2%)
 Strand = Plus / Minus

                                                                       
Query: 409 ccagtcaccatgacgacgttgccgacgtcaaac-ttgatgaagtcaacaatcttgttggt 467
           |||||||||||||| || ||||| || |||||| |||||||||||   | ||||||||||
Sbjct: 632 ccagtcaccatgac-acattgccaacatcaaaccttgatgaagtcgcaattcttgttggt 574

                                           
Query: 468 ctccaggtcgagcttgatggtgtcgttggcct 499
           |||||| |||| |||||| |||||||| ||||
Sbjct: 573 ctccagatcgatcttgattgtgtcgtttgcct 542



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                             
Query: 536 cataggtgttcaggtatgggatgcccttctggcc 569
           |||||||||||||||| || || |||||||||||
Sbjct: 492 cataggtgttcaggtagggaattcccttctggcc 459



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 37/41 (90%), Gaps = 1/41 (2%)
 Strand = Plus / Minus

                                                    
Query: 108 atagttctatatcc-ttgcagataactggctatagcaaaac 147
           |||||||||||||| ||||| | |||| |||||||||||||
Sbjct: 937 atagttctatatcctttgcaaacaactcgctatagcaaaac 897



to top

>gb|AF528526.1| Glycine max 40S ribosomal S4 protein mRNA, complete cds
          Length = 1054

 Score =  222 bits (112), Expect = 1e-54
 Identities = 259/308 (84%)
 Strand = Plus / Minus

                                                                       
Query: 262 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgaccc 321
           ||||| |||||||||||||| |||||||| |||||||  || || ||||| |  || || 
Sbjct: 798 ggctttgtgcccttgccaatagtgaacacattgcccatgcgagtagcaaattcatgtcca 739

                                                                       
Query: 322 tgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatc 381
             || |||||  ||||| || ||||||||| | |||||||||||||||||||||||||||
Sbjct: 738 gtggaatcctgcacgtgaattgtctcaaagctacccttatgcttctccctgttcttgatc 679

                                                                       
Query: 382 acaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaac 441
           || |||||||||||  |||| | |||||| || ||||| || || || || || ||||| 
Sbjct: 678 actccaacacgccccctgtttctcccacctgttaccataactacattcccaacatcaaat 619

                                                                       
Query: 442 ttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggccttg 501
           ||||| || ||||||||||||||   |||||| || ||||| ||||||||||||||| ||
Sbjct: 618 ttgataaaatcaacaatcttgttttcctccagatccagcttaatggtgtcgttggccctg 559

                                                                       
Query: 502 atgagtgggtctgggtagcggatggtgcggccatcataggtgttcaggtatgggatgccc 561
           ||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||| || 
Sbjct: 558 atgagagggtctgggtaacggatggtgcgaccatcataggtgttcaggtatgggatacct 499

                   
Query: 562 ttctggcc 569
           ||||||||
Sbjct: 498 ttctggcc 491



to top

>gb|AC126779.19| Medicago truncatula clone mth2-34m14, complete sequence
          Length = 128856

 Score =  214 bits (108), Expect = 2e-52
 Identities = 315/384 (82%)
 Strand = Plus / Minus

                                                                         
Query: 183   ctgagctgcggcatccctcttcctctgctcctcaatgatggtgagcttgatacccttgcc 242
             ||||||||| ||| ||||||||||    ||||||||||  || |  || |||||||| ||
Sbjct: 83725 ctgagctgcagcagccctcttcctagcttcctcaatgacagttaatttaatacccttacc 83666

                                                                         
Query: 243   cttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttgcccagacg 302
             |||||| ||    ||||| ||||| || ||||||||||| |||||||| ||| |||||||
Sbjct: 83665 cttgggaagagatacccatggctttgtccccttgccaatagtgaacacattgaccagacg 83606

                                                                         
Query: 303   ggtggcaaactggtgaccctgggcatcctcaacgtggatggtctcaaaggttcccttatg 362
              || |||||||  |||||   |||||||| ||||||||| ||||||||||||||||||||
Sbjct: 83605 agttgcaaactcatgaccagtggcatcctgaacgtggattgtctcaaaggttcccttatg 83546

                                                                         
Query: 363   cttctccctgttcttgatcacaccaacacgcccagtgttgcgcccaccagtcaccatgac 422
             ||| || |||||||||||||| |||||||||||  | ||    |||||||| ||||| ||
Sbjct: 83545 cttttctctgttcttgatcactccaacacgccccctattcttaccaccagtaaccatcac 83486

                                                                         
Query: 423   gacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagctt 482
              || || || || || || |||||||| || |||||||||||   ||| ||||| |||||
Sbjct: 83485 tacattcccaacatcgaatttgatgaaatcgacaatcttgttttcctcaaggtccagctt 83426

                                                                         
Query: 483   gatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggccatcataggt 542
             ||| ||||| || ||| |||||| |||||| ||||||||||| ||||| |||||||||||
Sbjct: 83425 gattgtgtcattagccctgatgactgggtcagggtagcggatagtgcgaccatcataggt 83366

                                     
Query: 543   gttcaggtatgggatgcccttctg 566
             ||||||||||||||| || |||||
Sbjct: 83365 gttcaggtatgggatacctttctg 83342



to top

>ref|NM_001036769.1| Arabidopsis thaliana structural constituent of ribosome AT5G07090
           transcript variant AT5G07090.2 mRNA, complete cds
          Length = 1174

 Score =  196 bits (99), Expect = 6e-47
 Identities = 198/231 (85%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 739 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 680

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 679 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 620

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||| |||||||||||||| || | ||||||||| ||||| ||
Sbjct: 619 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 560

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| |||||||| |||||||||||||| || ||||||||
Sbjct: 559 gtaacggatggtgcgaccatcataagtgttcaggtatggaattcccttctg 509



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 211 tcctcaatgatggtgagcttgatacccttgccctt 245
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 864 tcctcaatgatggtcagcttaatacctttgccctt 830



to top

>ref|NM_120791.2| Arabidopsis thaliana structural constituent of ribosome AT5G07090
           transcript variant AT5G07090.1 mRNA, complete cds
          Length = 1088

 Score =  196 bits (99), Expect = 6e-47
 Identities = 198/231 (85%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 654 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 595

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 594 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 535

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||| |||||||||||||| || | ||||||||| ||||| ||
Sbjct: 534 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 475

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| |||||||| |||||||||||||| || ||||||||
Sbjct: 474 gtaacggatggtgcgaccatcataagtgttcaggtatggaattcccttctg 424



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 211 tcctcaatgatggtgagcttgatacccttgccctt 245
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745



to top

>gb|AY079417.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090)
           mRNA, complete cds
          Length = 820

 Score =  196 bits (99), Expect = 6e-47
 Identities = 198/231 (85%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 627 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 568

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 567 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 508

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||| |||||||||||||| || | ||||||||| ||||| ||
Sbjct: 507 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 448

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| |||||||| |||||||||||||| || ||||||||
Sbjct: 447 gtaacggatggtgcgaccatcataagtgttcaggtatggaattcccttctg 397



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 211 tcctcaatgatggtgagcttgatacccttgccctt 245
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718



to top

>gb|AY050933.1| Arabidopsis thaliana putative 40S ribosomal protein S4 (At5g07090)
           mRNA, complete cds
          Length = 1059

 Score =  196 bits (99), Expect = 6e-47
 Identities = 198/231 (85%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 651 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 592

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 591 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 532

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||| |||||||||||||| || | ||||||||| ||||| ||
Sbjct: 531 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 472

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| |||||||| |||||||||||||| || ||||||||
Sbjct: 471 gtaacggatggtgcgaccatcataagtgttcaggtatggaattcccttctg 421



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 211 tcctcaatgatggtgagcttgatacccttgccctt 245
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742



to top

>emb|AL163652.1|ATT28J14 Arabidopsis thaliana DNA chromosome 5, BAC clone T28J14 (ESSA
            project)
          Length = 104607

 Score =  196 bits (99), Expect = 6e-47
 Identities = 198/231 (85%)
 Strand = Plus / Minus

                                                                        
Query: 336  gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
            |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 7896 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 7837

                                                                        
Query: 396  agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
              |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 7836 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 7777

                                                                        
Query: 456  aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
            |||||||||   ||| ||||| |||||||||||||| || | ||||||||| ||||| ||
Sbjct: 7776 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 7717

                                                               
Query: 516  gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
            ||| ||||||||||| |||||||| |||||||||||||| || ||||||||
Sbjct: 7716 gtaacggatggtgcgaccatcataagtgttcaggtatggaattcccttctg 7666



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 211  tcctcaatgatggtgagcttgatacccttgccctt 245
            |||||||||||||| ||||| ||||| ||||||||
Sbjct: 8021 tcctcaatgatggtcagcttaatacctttgccctt 7987



to top

>gb|AY093715.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds
          Length = 789

 Score =  196 bits (99), Expect = 6e-47
 Identities = 198/231 (85%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 627 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 568

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 567 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 508

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||| |||||||||||||| || | ||||||||| ||||| ||
Sbjct: 507 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 448

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| |||||||| |||||||||||||| || ||||||||
Sbjct: 447 gtaacggatggtgcgaccatcataagtgttcaggtatggaattcccttctg 397



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 211 tcctcaatgatggtgagcttgatacccttgccctt 245
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 752 tcctcaatgatggtcagcttaatacctttgccctt 718



to top

>gb|AY070769.1| Arabidopsis thaliana AT5g07090/T28J14_30 mRNA, complete cds
          Length = 1008

 Score =  196 bits (99), Expect = 6e-47
 Identities = 198/231 (85%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 651 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 592

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 591 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 532

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||| |||||||||||||| || | ||||||||| ||||| ||
Sbjct: 531 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 472

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| |||||||| |||||||||||||| || ||||||||
Sbjct: 471 gtaacggatggtgcgaccatcataagtgttcaggtatggaattcccttctg 421



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 211 tcctcaatgatggtgagcttgatacccttgccctt 245
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 776 tcctcaatgatggtcagcttaatacctttgccctt 742



to top

>emb|BX824247.1|CNS0A6X1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH32ZH05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1168

 Score =  196 bits (99), Expect = 6e-47
 Identities = 198/231 (85%)
 Strand = Plus / Plus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 354 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 413

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 414 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 473

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||| |||||||||||||| || | ||||||||| ||||| ||
Sbjct: 474 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 533

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| |||||||| |||||||||||||| || ||||||||
Sbjct: 534 gtaacggatggtgcgaccatcataagtgttcaggtatggaattcccttctg 584



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 211 tcctcaatgatggtgagcttgatacccttgccctt 245
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 229 tcctcaatgatggtcagcttaatacctttgccctt 263



to top

>emb|BX832664.1|CNS09ZT5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH87ZG07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 976

 Score =  196 bits (99), Expect = 6e-47
 Identities = 198/231 (85%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 621 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 562

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 561 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 502

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||| |||||||||||||| || | ||||||||| ||||| ||
Sbjct: 501 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 442

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| |||||||| |||||||||||||| || ||||||||
Sbjct: 441 gtaacggatggtgcgaccatcataagtgttcaggtatggaattcccttctg 391



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 211 tcctcaatgatggtgagcttgatacccttgccctt 245
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 746 tcctcaatgatggtcagcttaatacctttgccctt 712



to top

>emb|BX832452.1|CNS09ZTE Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH74ZD04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 942

 Score =  196 bits (99), Expect = 6e-47
 Identities = 198/231 (85%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 625 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 566

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 565 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 506

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||| |||||||||||||| || | ||||||||| ||||| ||
Sbjct: 505 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 446

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| |||||||| |||||||||||||| || ||||||||
Sbjct: 445 gtaacggatggtgcgaccatcataagtgttcaggtatggaattcccttctg 395



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 211 tcctcaatgatggtgagcttgatacccttgccctt 245
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 750 tcctcaatgatggtcagcttaatacctttgccctt 716



to top

>emb|BX832253.1|CNS09ZUO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZB04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 945

 Score =  196 bits (99), Expect = 6e-47
 Identities = 198/231 (85%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||||||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 625 gtggattgtctcaaaggttcccttatgcttttcacggttcttaatcacacccacacgccc 566

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 565 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 506

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||| |||||||||||||| || | ||||||||| ||||| ||
Sbjct: 505 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 446

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| |||||||| || ||||||||||| || ||||||||
Sbjct: 445 gtaacggatggtgcgaccatcataagttttcaggtatggaattcccttctg 395



to top

>gb|AY085205.1| Arabidopsis thaliana clone 13813 mRNA, complete sequence
          Length = 1011

 Score =  196 bits (99), Expect = 6e-47
 Identities = 198/231 (85%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 654 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 595

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 594 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 535

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||| |||||||||||||| || | ||||||||| ||||| ||
Sbjct: 534 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 475

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| |||||||| |||||||||||||| || ||||||||
Sbjct: 474 gtaacggatggtgcgaccatcataagtgttcaggtatggaattcccttctg 424



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 211 tcctcaatgatggtgagcttgatacccttgccctt 245
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 779 tcctcaatgatggtcagcttaatacctttgccctt 745



to top

>dbj|AB010697.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MOJ9
          Length = 86380

 Score =  196 bits (99), Expect = 6e-47
 Identities = 198/231 (85%)
 Strand = Plus / Minus

                                                                         
Query: 336   gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
             |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 82619 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 82560

                                                                         
Query: 396   agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
               |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 82559 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 82500

                                                                         
Query: 456   aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
             |||||||||   ||| ||||| |||||||||||||| || | ||||||||| ||||| ||
Sbjct: 82499 aatcttgttctcctcaaggtccagcttgatggtgtcatttggcttgatgagcgggtcagg 82440

                                                                
Query: 516   gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
             ||| ||||||||||| |||||||| |||||||||||||| || ||||||||
Sbjct: 82439 gtaacggatggtgcgaccatcataagtgttcaggtatggaattcccttctg 82389



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                
Query: 211   tcctcaatgatggtgagcttgatacccttgccctt 245
             |||||||||||||| ||||| ||||| ||||||||
Sbjct: 82744 tcctcaatgatggtcagcttaatacctttgccctt 82710



to top

>ref|NM_125228.3| Arabidopsis thaliana structural constituent of ribosome AT5G58420
           mRNA, complete cds
          Length = 1080

 Score =  180 bits (91), Expect = 3e-42
 Identities = 196/231 (84%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 720 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 661

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 660 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 601

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           ||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| ||
Sbjct: 600 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 541

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| ||||| || ||||||||||| || ||||| |||||
Sbjct: 540 gtaacggatggtgcgaccatcgtaagtgttcaggtaaggaatgcctttctg 490



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 210 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 269
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 846 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 787

                                
Query: 270 gcccttgccaatggtgaacac 290
            || |||||||||||| ||||
Sbjct: 786 tcctttgccaatggtgtacac 766



to top

>gb|AY143834.1| Arabidopsis thaliana At5g58420/mqj2_10 mRNA, complete cds
          Length = 789

 Score =  180 bits (91), Expect = 3e-42
 Identities = 196/231 (84%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 627 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 568

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 567 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 508

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           ||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| ||
Sbjct: 507 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 448

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| ||||| || ||||||||||| || ||||| |||||
Sbjct: 447 gtaacggatggtgcgaccatcgtaagtgttcaggtaaggaatgcctttctg 397



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 210 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 269
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 753 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 694

                                
Query: 270 gcccttgccaatggtgaacac 290
            || |||||||||||| ||||
Sbjct: 693 tcctttgccaatggtgtacac 673



to top

>gb|AY070467.1| Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds
          Length = 995

 Score =  180 bits (91), Expect = 3e-42
 Identities = 196/231 (84%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 700 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 641

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 640 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 581

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           ||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| ||
Sbjct: 580 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 521

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| ||||| || ||||||||||| || ||||| |||||
Sbjct: 520 gtaacggatggtgcgaccatcgtaagtgttcaggtaaggaatgcctttctg 470



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 210 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 269
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 767

                                
Query: 270 gcccttgccaatggtgaacac 290
            || |||||||||||| ||||
Sbjct: 766 tcctttgccaatggtgtacac 746



to top

>gb|AF428285.1|AF428285 Arabidopsis thaliana AT5g58420/mqj2_10 mRNA, complete cds
          Length = 1005

 Score =  180 bits (91), Expect = 3e-42
 Identities = 196/231 (84%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 711 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 652

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 651 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 592

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           ||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| ||
Sbjct: 591 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 532

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| ||||| || ||||||||||| || ||||| |||||
Sbjct: 531 gtaacggatggtgcgaccatcgtaagtgttcaggtaaggaatgcctttctg 481



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 210 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 269
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 837 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 778

                                
Query: 270 gcccttgccaatggtgaacac 290
            || |||||||||||| ||||
Sbjct: 777 tcctttgccaatggtgtacac 757



to top

>emb|BX832133.1|CNS09ZP1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH53ZH10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 537

 Score =  180 bits (91), Expect = 3e-42
 Identities = 196/231 (84%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 240 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 181

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 180 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 121

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           ||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| ||
Sbjct: 120 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 61

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| ||||| || ||||||||||| || ||||| |||||
Sbjct: 60  gtaacggatggtgcgaccatcgtaagtgttcaggtaaggaatgcctttctg 10



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 210 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 269
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 366 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 307

                                
Query: 270 gcccttgccaatggtgaacac 290
            || |||||||||||| ||||
Sbjct: 306 tcctttgccaatggtgtacac 286



to top

>emb|BX830283.1|CNS09ZZO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB70ZD03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 988

 Score =  180 bits (91), Expect = 3e-42
 Identities = 196/231 (84%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 691 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 632

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 631 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 572

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           ||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| ||
Sbjct: 571 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 512

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| ||||| || ||||||||||| || ||||| |||||
Sbjct: 511 gtaacggatggtgcgaccatcgtaagtgttcaggtaaggaatgcctttctg 461



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 210 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 269
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 817 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 758

                                
Query: 270 gcccttgccaatggtgaacac 290
            || |||||||||||| ||||
Sbjct: 757 tcctttgccaatggtgtacac 737



to top

>emb|BX830139.1|CNS09ZZ0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB61ZG04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 737

 Score =  180 bits (91), Expect = 3e-42
 Identities = 196/231 (84%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 440 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 381

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 380 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 321

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           ||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| ||
Sbjct: 320 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 261

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| ||||| || ||||||||||| || ||||| |||||
Sbjct: 260 gtaacggatggtgcgaccatcgtaagtgttcaggtaaggaatgcctttctg 210



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 210 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 269
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 566 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 507

                                
Query: 270 gcccttgccaatggtgaacac 290
            || |||||||||||| ||||
Sbjct: 506 tcctttgccaatggtgtacac 486



to top

>emb|BX832264.1|CNS09ZM6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZG11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 997

 Score =  180 bits (91), Expect = 3e-42
 Identities = 196/231 (84%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 700 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 641

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 640 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 581

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           ||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| ||
Sbjct: 580 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 521

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| ||||| || ||||||||||| || ||||| |||||
Sbjct: 520 gtaacggatggtgcgaccatcgtaagtgttcaggtaaggaatgcctttctg 470



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 210 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 269
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 826 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 767

                                
Query: 270 gcccttgccaatggtgaacac 290
            || |||||||||||| ||||
Sbjct: 766 tcctttgccaatggtgtacac 746



to top

>gb|AY086206.1| Arabidopsis thaliana clone 22434 mRNA, complete sequence
          Length = 1010

 Score =  180 bits (91), Expect = 3e-42
 Identities = 196/231 (84%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 715 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 656

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 655 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactccac 596

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           ||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| ||
Sbjct: 595 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 536

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| ||||| || ||||||||||| || ||||| |||||
Sbjct: 535 gtaacggatggtgcgaccatcgtaagtgttcaggtaaggaatgcctttctg 485



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 210 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 269
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 841 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 782

                                
Query: 270 gcccttgccaatggtgaacac 290
            || |||||||||||| ||||
Sbjct: 781 tcctttgccaatggtgtacac 761



to top

>dbj|AB025632.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MQJ2
          Length = 51440

 Score =  180 bits (91), Expect = 3e-42
 Identities = 196/231 (84%)
 Strand = Plus / Minus

                                                                        
Query: 336  gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
            |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 6772 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 6713

                                                                        
Query: 396  agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
              |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 6712 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 6653

                                                                        
Query: 456  aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
            ||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| ||
Sbjct: 6652 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 6593

                                                               
Query: 516  gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
            ||| ||||||||||| ||||| || ||||||||||| || ||||| |||||
Sbjct: 6592 gtaacggatggtgcgaccatcgtaagtgttcaggtaaggaatgcctttctg 6542



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                        
Query: 210  ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 269
            |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 6898 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 6839

                                 
Query: 270  gcccttgccaatggtgaacac 290
             || |||||||||||| ||||
Sbjct: 6838 tcctttgccaatggtgtacac 6818



to top

>emb|X76651.1|STRPS4 S.tuberosum (Desiree) mRNA for ribosomal protein S4
          Length = 966

 Score =  180 bits (91), Expect = 3e-42
 Identities = 256/311 (82%)
 Strand = Plus / Minus

                                                                       
Query: 256 acccaaggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactgg 315
           ||||| ||||| || ||||| ||||  |||||||| || |||| ||| || ||||| |  
Sbjct: 756 acccacggcttagtacccttaccaagagtgaacacatttcccaaacgtgtagcaaattca 697

                                                                       
Query: 316 tgaccctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttc 375
           |||||||| | ||||| || ||||| |||||||||| | |||||||||||||||||||||
Sbjct: 696 tgaccctgtgaatcctgaatgtggagggtctcaaagctacccttatgcttctccctgttc 637

                                                                       
Query: 376 ttgatcacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacg 435
           || || |||||||| || ||  |||| |  || ||||||||||| || || || || |||
Sbjct: 636 ttaataacaccaactcgtcccctgtttctacctccagtcaccatcacaacattcccaacg 577

                                                                       
Query: 436 tcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttg 495
           |||||||||||||| ||||||||||| ||||  |||| ||| ||||| ||||| ||||||
Sbjct: 576 tcaaacttgatgaaatcaacaatcttattggattccaagtccagctttatggtatcgttg 517

                                                                       
Query: 496 gccttgatgagtgggtctgggtagcggatggtgcggccatcataggtgttcaggtatggg 555
           ||||||||||| || || || |||||||| || |  ||||| || |||||||||||||||
Sbjct: 516 gccttgatgagaggatcaggatagcggattgttcttccatcgtaagtgttcaggtatggg 457

                      
Query: 556 atgcccttctg 566
           || ||||||||
Sbjct: 456 atccccttctg 446



to top

>emb|BX832274.1|CNS09ZPH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH62ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 978

 Score =  174 bits (88), Expect = 2e-40
 Identities = 184/216 (85%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 721 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 662

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 661 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 602

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           ||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||| ||
Sbjct: 601 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtcagg 542

                                               
Query: 516 gtagcggatggtgcggccatcataggtgttcaggta 551
           ||| ||||||||||| ||||| || |||||||||||
Sbjct: 541 gtaacggatggtgcgaccatcgtaagtgttcaggta 506



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 210 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 269
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 847 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 788

                                
Query: 270 gcccttgccaatggtgaacac 290
            || |||||||||||| ||||
Sbjct: 787 tcctttgccaatggtgtacac 767



to top

>emb|BX832256.1|CNS09ZVR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH61ZC05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 952

 Score =  174 bits (88), Expect = 2e-40
 Identities = 196/231 (84%), Gaps = 2/231 (0%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 614 gtggattgtctcaaagcttcccttatgcttttcacggttcttaatcacacccacacgccc 555

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||||||||| || ||||| || ||||||||||||||||| |||||
Sbjct: 554 tctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttgatgaactcaac 495

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||| |||||||||  ||| || | ||||||||| ||||| ||
Sbjct: 494 aatcttgttctcctcaaggtccagcttgatg--gtcatttggcttgatgagcgggtcagg 437

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| |||||||| |||||||||||||| || ||||||||
Sbjct: 436 gtaacggatggtgcgaccatcataagtgttcaggtatggaattcccttctg 386



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 211 tcctcaatgatggtgagcttgatacccttgccctt 245
           |||||||||||||| ||||| ||||| ||||||||
Sbjct: 739 tcctcaatgatggtcagcttaatacctttgccctt 705



to top

>emb|BX829418.1|CNS09ZZ4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB12ZD07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 566

 Score =  172 bits (87), Expect = 8e-40
 Identities = 195/231 (84%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||||| |||||||||||||||| | ||| || |||||||||||||||||
Sbjct: 269 gtggattgtctcaaagcttcccttatgcttctcacggtttttaatcacaccaacacgccc 210

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || || || ||||| || || ||||| || |||||||||||||| || ||
Sbjct: 209 tctgtttctacctcctgtaaccatcacaacattgccaacatcaaacttgatgaactcgac 150

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           ||||||||||| ||| |||||||||||||||||||| || | ||||||||| ||||  ||
Sbjct: 149 aatcttgttggcctcaaggtcgagcttgatggtgtcattaggcttgatgagcgggtgagg 90

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| ||||| || ||||||||||| || ||||| |||||
Sbjct: 89  gtaacggatggtgcgaccatcgtaagtgttcaggtaaggaatgcctttctg 39



 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 68/81 (83%)
 Strand = Plus / Minus

                                                                       
Query: 210 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 269
           |||||| ||||| || ||||||||||| ||||||||||| ||   |||||| ||||| ||
Sbjct: 395 ctcctcgatgatagtcagcttgatacctttgcccttgggaagagacacccatggctttgt 336

                                
Query: 270 gcccttgccaatggtgaacac 290
            || |||||||||||| ||||
Sbjct: 335 tcctttgccaatggtgtacac 315



to top

>gb|DQ268839.1| Solanum tuberosum clone 130D11 40S ribosomal protein S4-like
           protein mRNA, complete cds
          Length = 1052

 Score =  172 bits (87), Expect = 8e-40
 Identities = 255/311 (81%)
 Strand = Plus / Minus

                                                                       
Query: 256 acccaaggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggcaaactgg 315
           ||||| ||||| || ||||| ||||  |||||||| || |||| ||| || ||||| |  
Sbjct: 739 acccacggcttagtacccttaccaagagtgaacacatttcccaaacgtgtagcaaattca 680

                                                                       
Query: 316 tgaccctgggcatcctcaacgtggatggtctcaaaggttcccttatgcttctccctgttc 375
           |||||||| | ||| | || ||||| |||||||||| | |||||||||||||||||||||
Sbjct: 679 tgaccctgtgaatcttgaatgtggagggtctcaaagctacccttatgcttctccctgttc 620

                                                                       
Query: 376 ttgatcacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacg 435
           || || |||||||| || ||  |||| |  || ||||||||||| || || || || |||
Sbjct: 619 ttaataacaccaactcgtcccctgtttctacctccagtcaccatcacaacattcccaacg 560

                                                                       
Query: 436 tcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttg 495
           |||||||||||||| ||||||||||| ||||  |||| ||| ||||| ||||| ||||||
Sbjct: 559 tcaaacttgatgaaatcaacaatcttattggattccaagtccagctttatggtatcgttg 500

                                                                       
Query: 496 gccttgatgagtgggtctgggtagcggatggtgcggccatcataggtgttcaggtatggg 555
           ||||||||||| || || || |||||||| || |  ||||| || |||||||||||||||
Sbjct: 499 gccttgatgagaggatcaggatagcggattgttcttccatcgtaagtgttcaggtatggg 440

                      
Query: 556 atgcccttctg 566
           || ||||||||
Sbjct: 439 atccccttctg 429



to top

>dbj|AB232685.1| Panax ginseng mRNA for ribosomal protein S4, complete cds
          Length = 1105

 Score =  170 bits (86), Expect = 3e-39
 Identities = 293/362 (80%)
 Strand = Plus / Minus

                                                                       
Query: 210 ctcctcaatgatggtgagcttgatacccttgcccttggggaggctcacccaaggcttggt 269
           ||||||||||||||| |  |||||||||||||||||||| ||   |||||| ||||| ||
Sbjct: 840 ctcctcaatgatggttaatttgatacccttgcccttgggaagagacacccatggctttgt 781

                                                                       
Query: 270 gcccttgccaatggtgaacacgttgcccagacgggtggcaaactggtgaccctgggcatc 329
            || || || ||||| || || ||||| ||||| || ||||||| ||||||  ||| |||
Sbjct: 780 accttttccgatggtaaaaacattgcctagacgagtagcaaactcgtgaccaagggaatc 721

                                                                       
Query: 330 ctcaacgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaac 389
           || || ||| |  ||||| ||| | |||||||| ||||||||||||||||| || |||||
Sbjct: 720 ctgaatgtgaacagtctcgaagctccccttatgtttctccctgttcttgataactccaac 661

                                                                       
Query: 390 acgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaa 449
            |||||||| || | ||| |||||||||||||| || || || || || ||||| |||||
Sbjct: 660 tcgcccagtattcctccccccagtcaccatgacaacatttccaacatcgaacttaatgaa 601

                                                                       
Query: 450 gtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgg 509
            ||| | |||||||| | ||||| ||| || ||||||||||| |||||||| ||||| ||
Sbjct: 600 atcagctatcttgtttgcctccaagtcaagtttgatggtgtcattggccttaatgagcgg 541

                                                                       
Query: 510 gtctgggtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctggcc 569
           |||||| || ||||| || || ||||||||||| || | ||| || ||||| ||||| ||
Sbjct: 540 gtctggataacggatagtacgcccatcataggtattgatgtacggaatgcctttctgacc 481

             
Query: 570 ga 571
           ||
Sbjct: 480 ga 479



to top

>gb|AY084230.1| Arabidopsis thaliana clone 10042 mRNA, complete sequence
          Length = 1023

 Score =  165 bits (83), Expect = 2e-37
 Identities = 194/231 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 740 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 681

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 680 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 621

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||||||||||||||||||||| | ||||||||| ||||| ||
Sbjct: 620 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 561

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| |||||||| ||||||| ||| || || ||||||||
Sbjct: 560 gtaacggatggtgcgaccatcatatgtgttcaagtagggaatacccttctg 510



to top

>ref|NM_127291.2| Arabidopsis thaliana structural constituent of ribosome AT2G17360
           mRNA, complete cds
          Length = 1074

 Score =  157 bits (79), Expect = 5e-35
 Identities = 193/231 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 740 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 681

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 680 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 621

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||||||||||||||||||||| | ||||||||| ||||| ||
Sbjct: 620 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 561

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
            || ||||||||||| |||||||| ||||||| ||| || || ||||||||
Sbjct: 560 ataacggatggtgcgaccatcatatgtgttcaagtagggaatacccttctg 510



to top

>gb|AY062983.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360)
           mRNA, complete cds
          Length = 817

 Score =  157 bits (79), Expect = 5e-35
 Identities = 193/231 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 627 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 568

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 567 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 508

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||||||||||||||||||||| | ||||||||| ||||| ||
Sbjct: 507 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 448

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
            || ||||||||||| |||||||| ||||||| ||| || || ||||||||
Sbjct: 447 ataacggatggtgcgaccatcatatgtgttcaagtagggaatacccttctg 397



to top

>gb|AY035131.1| Arabidopsis thaliana putative ribosomal protein S4 (At2g17360)
           mRNA, complete cds
          Length = 1032

 Score =  157 bits (79), Expect = 5e-35
 Identities = 193/231 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 699 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 640

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 639 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 580

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||||||||||||||||||||| | ||||||||| ||||| ||
Sbjct: 579 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 520

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
            || ||||||||||| |||||||| ||||||| ||| || || ||||||||
Sbjct: 519 ataacggatggtgcgaccatcatatgtgttcaagtagggaatacccttctg 469



to top

>gb|AY064625.1| Arabidopsis thaliana unknown protein mRNA, complete cds
          Length = 813

 Score =  157 bits (79), Expect = 5e-35
 Identities = 193/231 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 627 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 568

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 567 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 508

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||||||||||||||||||||| | ||||||||| ||||| ||
Sbjct: 507 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 448

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
            || ||||||||||| |||||||| ||||||| ||| || || ||||||||
Sbjct: 447 ataacggatggtgcgaccatcatatgtgttcaagtagggaatacccttctg 397



to top

>gb|AF370469.1|AF370469 Arabidopsis thaliana Unknown protein mRNA, complete cds
          Length = 1034

 Score =  157 bits (79), Expect = 5e-35
 Identities = 193/231 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 700 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 641

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 640 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 581

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||||||||||||||||||||| | ||||||||| ||||| ||
Sbjct: 580 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 521

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
            || ||||||||||| |||||||| ||||||| ||| || || ||||||||
Sbjct: 520 ataacggatggtgcgaccatcatatgtgttcaagtagggaatacccttctg 470



to top

>emb|BX818868.1|CNS0A8UP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB21ZB04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1007

 Score =  157 bits (79), Expect = 5e-35
 Identities = 193/231 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 692 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 633

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 632 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 573

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||||||||||||||||||||| | ||||||||| ||||| ||
Sbjct: 572 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 513

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
            || ||||||||||| |||||||| ||||||| ||| || || ||||||||
Sbjct: 512 ataacggatggtgcgaccatcatatgtgttcaagtagggaatacccttctg 462



to top

>emb|BX833645.1|CNS0A1VP Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL68ZB07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 984

 Score =  157 bits (79), Expect = 5e-35
 Identities = 193/231 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||| | ||||||||||||| || | |||||| |||||||| ||||||||
Sbjct: 625 gtggattgtctcaaggcttcccttatgcttttcacggttcttaatcacacccacacgccc 566

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || || |||||||| || ||||| || ||||||||||||||||| || ||
Sbjct: 565 tctgtttctgcctccggtcaccatcacaacgttacccacgtcaaacttgatgaactcgac 506

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| |||||  ||||||||||||| || | ||||||||| ||||| ||
Sbjct: 505 aatcttgttctcctcaaggtccggcttgatggtgtcttttggcttgatgagcgggtcagg 446

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||| ||||||| || ||||| ||||||||||||||||| ||||||||
Sbjct: 445 gtaacggttggtgcgaccgtcataagtgttcaggtatgggattcccttctg 395



to top

>gb|AC002329.2|AC002329 Arabidopsis thaliana chromosome II section 100 of 255 of the complete
             sequence. Sequence from clones T23A1, F5J6, MJB20
          Length = 76170

 Score =  157 bits (79), Expect = 5e-35
 Identities = 193/231 (83%)
 Strand = Plus / Minus

                                                                         
Query: 336   gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
             ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 48796 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 48737

                                                                         
Query: 396   agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
               |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 48736 tctgtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccac 48677

                                                                         
Query: 456   aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
             |||||||||   ||| ||||||||||||||||||||||| | ||||||||| ||||| ||
Sbjct: 48676 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 48617

                                                                
Query: 516   gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
              || ||||||||||| |||||||| ||||||| ||| || || ||||||||
Sbjct: 48616 ataacggatggtgcgaccatcatatgtgttcaagtagggaatacccttctg 48566



to top

>emb|X79300.1|GHRS4E G.hirsutum (DPL 62) mRNA for ribosomal protein small subunit 4e
          Length = 1090

 Score =  155 bits (78), Expect = 2e-34
 Identities = 192/230 (83%)
 Strand = Plus / Minus

                                                                       
Query: 340 atggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccagtg 399
           |||||||||||| | |||||||||||||||||||| || || || |||||||| ||  ||
Sbjct: 678 atggtctcaaagctacccttatgcttctccctgtttttaattactccaacacgacctctg 619

                                                                       
Query: 400 ttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatc 459
           || |  || || || |||||||| || || || ||||||||||||||||| || ||||||
Sbjct: 618 ttccttcctccggtgaccatgacaacattcccaacgtcaaacttgatgaaatcgacaatc 559

                                                                       
Query: 460 ttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtag 519
           |||||| |||| ||||| ||||| |||||||| || |||||||| |  ||||||||||||
Sbjct: 558 ttgttgctctcaaggtccagcttaatggtgtcatttgccttgatcaaggggtctgggtag 499

                                                             
Query: 520 cggatggtgcggccatcataggtgttcaggtatgggatgcccttctggcc 569
           || || || || || || || |||||||||||||| ||||||||||||||
Sbjct: 498 cgaatagtacgcccgtcgtatgtgttcaggtatggaatgcccttctggcc 449



to top

>emb|BX820506.1|CNS0A8QA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH41ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1000

 Score =  149 bits (75), Expect = 1e-32
 Identities = 192/231 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           ||||||||| |||||| | ||||| || ||||| | |||||| |||||||||||||||||
Sbjct: 685 gtggatggtttcaaagctacccttgtgtttctcacggttcttaatcacaccaacacgccc 626

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || ||
Sbjct: 625 tctgtttcttcctccagttaccataactacgttgcccacatcaaacttaatgaactccac 566

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||||||||||||||||||||| | ||||||||| ||||| ||
Sbjct: 565 aatcttgttctcctcaaggtcgagcttgatggtgtcgttaggcttgatgagcgggtcagg 506

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
            || ||||||||||| |||| ||| ||||||| ||| || || ||||||||
Sbjct: 505 ataacggatggtgcgaccataatatgtgttcaagtagggaatacccttctg 455



to top

>emb|BX831856.1|CNS09ZNQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH34ZE09 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 934

 Score =  149 bits (75), Expect = 1e-32
 Identities = 192/231 (83%)
 Strand = Plus / Minus

                                                                       
Query: 336 gtggatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgccc 395
           |||||| ||||||| | |||||||||||||||| | |||||  |||||||| ||||||||
Sbjct: 625 gtggattgtctcaacgcttcccttatgcttctcacggttctgaatcacacccacacgccc 566

                                                                       
Query: 396 agtgttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaac 455
             |||| |  || ||||||||||| || ||||| || ||||||||||| ||||| |||||
Sbjct: 565 gctgtttctgcctccagtcaccatcacaacgttacccacgtcaaacttcatgaactcaac 506

                                                                       
Query: 456 aatcttgttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgg 515
           |||||||||   ||| ||||| |||||||||||||  || | ||| ||||| ||||  ||
Sbjct: 505 aatcttgttctcctcaaggtccagcttgatggtgtgatttggcttcatgagcgggtgagg 446

                                                              
Query: 516 gtagcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           ||| ||||||||||| |||||||| |||| ||||||||| || ||||||||
Sbjct: 445 gtaacggatggtgcgaccatcataagtgtgcaggtatggcattcccttctg 395



to top

>gb|BT014201.1| Lycopersicon esculentum clone 133378R, mRNA sequence
          Length = 1292

 Score =  143 bits (72), Expect = 7e-31
 Identities = 231/284 (81%)
 Strand = Plus / Minus

                                                                       
Query: 283 gtgaacacgttgcccagacgggtggcaaactggtgaccctgggcatcctcaacgtggatg 342
           |||||||| || |||| |||||| |||||||  || ||| ||| ||||| || ||| |  
Sbjct: 760 gtgaacacatttcccaaacgggtagcaaactcatgccccagggaatcctgaatgtgaact 701

                                                                       
Query: 343 gtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccagtgttg 402
           ||||||||| | ||||| ||||||||||||||||| |  |  |||||||| ||  |||| 
Sbjct: 700 gtctcaaagctacccttgtgcttctccctgttcttaagaattccaacacgtcccctgttt 641

                                                                       
Query: 403 cgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttg 462
           |  |||||||||| ||| || || || || || |||||||||||||||||||||||||| 
Sbjct: 640 ctaccaccagtcaacataaccacattaccaacatcaaacttgatgaagtcaacaatctta 581

                                                                       
Query: 463 ttggtctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcgg 522
           ||||  || | ||| |||||||||||||| |||||||||||||| || || |||||||||
Sbjct: 580 ttggaatctaagtccagcttgatggtgtcattggccttgatgaggggatcggggtagcgg 521

                                                       
Query: 523 atggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           || || |  |||||||| ||||| || |||||||| ||||||||
Sbjct: 520 attgttcttccatcatacgtgttgagatatgggatacccttctg 477



to top

>dbj|D21302.1|RICSS536 Oryza sativa SS536 mRNA for ribosomal protein S4, partial sequence
          Length = 347

 Score =  111 bits (56), Expect = 3e-21
 Identities = 108/128 (84%)
 Strand = Plus / Minus

                                                                       
Query: 441 cttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcctt 500
           |||||| ||| | | ||||||||||||||| ||  ||| |||||  ||| |||| |||||
Sbjct: 330 cttgatnaagncganaatcttgttggtctcnagancgatcttgantgtgccgtttgcctt 271

                                                                       
Query: 501 gatgagtgggtctgggtagcggatggtgcggccatcataggtgttcaggtatgggatgcc 560
           |||||  ||||| ||||| ||||||||||| ||||||||||||| |||||| ||||| ||
Sbjct: 270 gatgatcgggtcagggtancggatggtgcgaccatcataggtgtncaggtaggggattcc 211

                   
Query: 561 cttctggc 568
           ||||||||
Sbjct: 210 cttctggc 203



to top

>emb|BX818793.1|CNS0A8YY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 966

 Score =  105 bits (53), Expect = 2e-19
 Identities = 186/229 (81%), Gaps = 1/229 (0%)
 Strand = Plus / Minus

                                                                       
Query: 339 gatggtctcaaaggttcccttatgcttctccctgttcttgatcacaccaacacgcccagt 398
           |||||| |||||| | ||||| |  ||||| | |||||| |||||||||||||||||  |
Sbjct: 689 gatggtttcaaagctacccttgtttttctcacggttcttaatcacaccaacacgccctct 630

                                                                       
Query: 399 gttgcgcccaccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaat 458
           ||| |  || ||||| ||||| || |||||||| || |||||||| ||||| || |||||
Sbjct: 629 gtttcttcctccagtgaccataactacgttgcccacatcaaacttaatgaactccacaat 570

                                                                       
Query: 459 cttgttggtctccaggtcgagcttgatggtg-tcgttggccttgatgagtgggtctgggt 517
           ||||||   ||| |||||||||||||||||| | ||| | ||||||||| ||||  || |
Sbjct: 569 cttgttctcctcaaggtcgagcttgatggtgtttgttaggcttgatgagcgggtgaggat 510

                                                            
Query: 518 agcggatggtgcggccatcataggtgttcaggtatgggatgcccttctg 566
           | ||||||||||| |||| ||| ||||||| ||| || || ||||||||
Sbjct: 509 aacggatggtgcgaccatgatatgtgttcaagtagggaatacccttctg 461



to top

>emb|CR712301.2|CNS0GCK9 Tetraodon nigroviridis full-length cDNA
          Length = 868

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 496 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 451



to top

>emb|CR720218.2|CNS0GIO0 Tetraodon nigroviridis full-length cDNA
          Length = 845

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 471 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 426



to top

>emb|CR720216.2|CNS0GINY Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR722715.2|CNS0GKLD Tetraodon nigroviridis full-length cDNA
          Length = 848

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 476 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 431



to top

>emb|CR721883.2|CNS0GJY9 Tetraodon nigroviridis full-length cDNA
          Length = 869

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452



to top

>emb|CR720853.2|CNS0GJ5N Tetraodon nigroviridis full-length cDNA
          Length = 756

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 383 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 338



to top

>emb|CR720472.2|CNS0GIV2 Tetraodon nigroviridis full-length cDNA
          Length = 842

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR719441.2|CNS0GI2F Tetraodon nigroviridis full-length cDNA
          Length = 848

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 476 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 431



to top

>emb|CR719306.2|CNS0GHYO Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR717405.2|CNS0GGHV Tetraodon nigroviridis full-length cDNA
          Length = 869

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 452



to top

>emb|CR717315.2|CNS0GGFD Tetraodon nigroviridis full-length cDNA
          Length = 587

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430



to top

>emb|CR716926.2|CNS0GG4N Tetraodon nigroviridis full-length cDNA
          Length = 574

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 462 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 417



to top

>emb|CR711409.2|CNS0GBVH Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453



to top

>emb|CR714124.2|CNS0GDYW Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453



to top

>emb|CR714283.2|CNS0GE3B Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453



to top

>emb|CR712945.2|CNS0GD25 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430



to top

>emb|CR713157.2|CNS0GD81 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430



to top

>emb|CR710675.2|CNS0GBB3 Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453



to top

>emb|CR710088.2|CNS0GAUS Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430



to top

>emb|CR708708.2|CNS0G9SG Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453



to top

>emb|CR707417.2|CNS0G8SL Tetraodon nigroviridis full-length cDNA
          Length = 920

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 551 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 506



to top

>emb|CR706939.2|CNS0G8FB Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430



to top

>emb|CR704562.2|CNS0G6LA Tetraodon nigroviridis full-length cDNA
          Length = 868

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452



to top

>emb|CR704014.2|CNS0G662 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR703820.2|CNS0G60O Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR703584.2|CNS0G5U4 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR703489.2|CNS0G5RH Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR702840.2|CNS0G59G Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR702635.2|CNS0G53R Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454



to top

>emb|CR702209.2|CNS0G4RX Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR702145.2|CNS0G4Q5 Tetraodon nigroviridis full-length cDNA
          Length = 868

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 496 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 451



to top

>emb|CR700232.2|CNS0G390 Tetraodon nigroviridis full-length cDNA
          Length = 842

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR697958.2|CNS0G1HU Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453



to top

>emb|CR697195.2|CNS0G0WN Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454



to top

>emb|CR697018.2|CNS0G0RQ Tetraodon nigroviridis full-length cDNA
          Length = 828

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 474 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 429



to top

>emb|CR696565.2|CNS0G0F5 Tetraodon nigroviridis full-length cDNA
          Length = 846

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR696312.2|CNS0G084 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR694977.2|CNS0FZ71 Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR694101.2|CNS0FYIP Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR693396.2|CNS0FXZ4 Tetraodon nigroviridis full-length cDNA
          Length = 869

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452



to top

>emb|CR691738.2|CNS0FWP2 Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453



to top

>emb|CR688407.2|CNS0FU4J Tetraodon nigroviridis full-length cDNA
          Length = 848

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 430



to top

>emb|CR689769.2|CNS0FV6D Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454



to top

>emb|CR687727.2|CNS0FTLN Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 453



to top

>emb|CR686869.2|CNS0FSXT Tetraodon nigroviridis full-length cDNA
          Length = 868

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 496 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 451



to top

>emb|CR685258.2|CNS0FRP2 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454



to top

>emb|CR685076.2|CNS0FRK0 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR684709.2|CNS0FR9T Tetraodon nigroviridis full-length cDNA
          Length = 869

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagcgggtctgggtagcggatggtgcgg 452



to top

>emb|CR684226.2|CNS0FQWE Tetraodon nigroviridis full-length cDNA
          Length = 872

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454



to top

>emb|CR683325.2|CNS0FQ7D Tetraodon nigroviridis full-length cDNA
          Length = 868

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452



to top

>emb|CR682942.2|CNS0FPWQ Tetraodon nigroviridis full-length cDNA
          Length = 763

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 391 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 346



to top

>emb|CR682258.2|CNS0FPDQ Tetraodon nigroviridis full-length cDNA
          Length = 869

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452



to top

>emb|CR681455.2|CNS0FORF Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR681050.2|CNS0FOG6 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR680145.2|CNS0FNR1 Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454



to top

>emb|CR676429.2|CNS0FKW9 Tetraodon nigroviridis full-length cDNA
          Length = 609

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452



to top

>emb|CR675710.2|CNS0FKCK Tetraodon nigroviridis full-length cDNA
          Length = 835

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 476 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 431



to top

>emb|CR673595.2|CNS0FIPT Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR670866.2|CNS0FGM0 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR669893.2|CNS0FFUZ Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454



to top

>emb|CR669083.2|CNS0FF8H Tetraodon nigroviridis full-length cDNA
          Length = 831

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 476 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 431



to top

>emb|CR663251.2|CNS0FAQH Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454



to top

>emb|CR659804.2|CNS0F82Q Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454



to top

>emb|CR659262.2|CNS0F7NO Tetraodon nigroviridis full-length cDNA
          Length = 872

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454



to top

>emb|CR658566.2|CNS0F74C Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR657212.2|CNS0F62Q Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR656191.2|CNS0F5AD Tetraodon nigroviridis full-length cDNA
          Length = 869

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452



to top

>emb|CR655155.2|CNS0F4HL Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR654105.2|CNS0F3OF Tetraodon nigroviridis full-length cDNA
          Length = 610

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR652992.2|CNS0F2TI Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454



to top

>emb|CR651314.2|CNS0F1IW Tetraodon nigroviridis full-length cDNA
          Length = 609

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452



to top

>emb|CR647718.2|CNS0EYR0 Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR646899.2|CNS0EY49 Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR645541.2|CNS0EX2J Tetraodon nigroviridis full-length cDNA
          Length = 862

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452



to top

>emb|CR644913.2|CNS0EWL3 Tetraodon nigroviridis full-length cDNA
          Length = 609

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452



to top

>emb|CR642563.2|CNS0EURT Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR642362.2|CNS0EUM8 Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR641651.2|CNS0EU2H Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR641329.2|CNS0ETTJ Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR641017.2|CNS0ETKV Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR639635.2|CNS0ESIH Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 430



to top

>emb|CR638530.2|CNS0ERNS Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR637949.2|CNS0ER7N Tetraodon nigroviridis full-length cDNA
          Length = 870

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR636021.2|CNS0EPQ3 Tetraodon nigroviridis full-length cDNA
          Length = 869

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 497 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 452



to top

>emb|CR634987.2|CNS0EOXD Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 498 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 453



to top

>emb|CR634338.2|CNS0EOFC Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 44/46 (95%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 454



to top

>gb|AY769318.1| Bombyx mori ribosomal protein S4 (RpS4) mRNA, complete cds
          Length = 908

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 46/49 (93%)
 Strand = Plus / Minus

                                                            
Query: 490 tcgttggccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||| | ||||| ||||||||||||||||||||||||||||||||||
Sbjct: 541 tcgttgactttgataagtgggtctgggtagcggatggtgcggccatcat 493



to top

>gb|AY190741.1| Pagrus major 40S ribosomal protein S4 mRNA, partial cds
          Length = 703

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 43/45 (95%)
 Strand = Plus / Minus

                                                        
Query: 487 gtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           ||||||||| |||||||||| ||||||||||||||||||||||||
Sbjct: 503 gtgtcgttgaccttgatgagggggtctgggtagcggatggtgcgg 459



to top

>emb|CR696954.2|CNS0G0PY Tetraodon nigroviridis full-length cDNA
          Length = 846

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                       
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgc 529
           |||||||||| |||||||||| ||||||||||||||||||||||
Sbjct: 475 ggtgtcgttgaccttgatgagggggtctgggtagcggatggtgc 432



to top

>gb|AY130367.1| Petromyzon marinus ribosomal protein S4-like mRNA, partial sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 468 ctccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggt 527
           ||||||||||||||  | |||||||||| |||||||||| || || ||||||||||||||
Sbjct: 466 ctccaggtcgagctgcacggtgtcgttgaccttgatgaggggatcagggtagcggatggt 407

              
Query: 528 gcg 530
           |||
Sbjct: 406 gcg 404



to top

>emb|CR671087.2|CNS0FGS5 Tetraodon nigroviridis full-length cDNA
          Length = 871

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 43/46 (93%)
 Strand = Plus / Minus

                                                         
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcgg 531
           |||||||||| || ||||||| ||||||||||||||||||||||||
Sbjct: 499 ggtgtcgttgaccatgatgagggggtctgggtagcggatggtgcgg 454



to top

>gb|AY110862.1| Zea mays CL1882_8 mRNA sequence
          Length = 728

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                             
Query: 334 acgtggatggtctcaaaggttcccttatgcttctccctgttcttgatcac 383
           |||||||||||||| ||| | ||||| |||||||||||||||||||||||
Sbjct: 491 acgtggatggtctcgaagctgcccttgtgcttctccctgttcttgatcac 442



 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 36/39 (92%)
 Strand = Plus / Minus

                                                  
Query: 363 cttctccctgttcttgatcacaccaacacgcccagtgtt 401
           ||||||||||||||||||||| || |||||||| |||||
Sbjct: 429 cttctccctgttcttgatcactcctacacgcccggtgtt 391



to top

>gb|DQ066214.1| Ixodes scapularis isolate ISUFL21 ribosomal protein S4 mRNA,
           complete cds
          Length = 789

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 54/61 (88%)
 Strand = Plus / Minus

                                                                       
Query: 470 ccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgc 529
           ||||||| | ||||| |||||||||  |||||||||| ||||| ||||||||||||||||
Sbjct: 493 ccaggtccaccttgacggtgtcgttcaccttgatgagggggtccgggtagcggatggtgc 434

            
Query: 530 g 530
           |
Sbjct: 433 g 433



to top

>ref|XM_388890.1| Gibberella zeae PH-1 chromosome 2 conserved hypothetical protein
           (FG08714.1) partial mRNA
          Length = 732

 Score = 63.9 bits (32), Expect = 5e-07
 Identities = 65/76 (85%)
 Strand = Plus / Minus

                                                                       
Query: 377 tgatcacaccaacacgcccagtgttgcgcccaccagtcaccatgacgacgttgccgacgt 436
           |||| ||||||||||| ||  ||||||| |||||||| ||||||||||||  ||||  ||
Sbjct: 532 tgatgacaccaacacgacccatgttgcgaccaccagtgaccatgacgacggcgccggtgt 473

                           
Query: 437 caaacttgatgaagtc 452
           | ||||||||||||||
Sbjct: 472 cgaacttgatgaagtc 457



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 209 gctcctcaatgatggtgagcttgatacccttgcccttggg 248
           ||||||||  |||||||||||||| |||||||||||||||
Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658



to top

>gb|BC047994.1| Mus musculus RIKEN cDNA 1110033J19 gene, mRNA (cDNA clone MGC:59460
           IMAGE:6518866), complete cds
          Length = 935

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 527
           |||||||||| |||||||||| ||||| ||||||||||||||
Sbjct: 503 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 462



to top

>gb|AC126683.4| Mus musculus BAC clone RP23-62G15 from 6, complete sequence
          Length = 167297

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                      
Query: 486  ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 527
            |||||||||| |||||||||| ||||| ||||||||||||||
Sbjct: 3544 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 3503



to top

>dbj|AK132160.1| Mus musculus 17 days embryo head cDNA, RIKEN full-length enriched
           library, clone:3300002H24 product:Similar to ribosomal
           protein S4, X-linked, full insert sequence
          Length = 944

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 527
           |||||||||| |||||||||| ||||| ||||||||||||||
Sbjct: 532 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 491



to top

>dbj|AK012382.1| Mus musculus 11 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:2700046B19 product:RIBOSOMAL
           PROTEIN S4X homolog [Cercopithecus aethiops], full
           insert sequence
          Length = 918

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 527
           |||||||||| |||||||||| ||||| ||||||||||||||
Sbjct: 531 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 490



to top

>dbj|AK004068.1| Mus musculus 18-day embryo whole body cDNA, RIKEN full-length
           enriched library, clone:1110033J19 product:Similar to
           ribosomal protein S4, X-linked, full insert sequence
          Length = 944

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 527
           |||||||||| |||||||||| ||||| ||||||||||||||
Sbjct: 532 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 491



to top

>gb|BC028445.1| Mus musculus, clone IMAGE:963029, mRNA
          Length = 707

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Plus

                                                     
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 527
           |||||||||| |||||||||| ||||| ||||||||||||||
Sbjct: 434 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 475



to top

>gb|AC142274.3| Mus musculus BAC clone RP23-251M14 from 6, complete sequence
          Length = 179732

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                        
Query: 486    ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 527
              |||||||||| |||||||||| ||||| ||||||||||||||
Sbjct: 150352 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 150311



to top

>ref|NM_025405.2| Mus musculus RIKEN cDNA 1110033J19 gene (1110033J19Rik), mRNA
          Length = 935

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 39/42 (92%)
 Strand = Plus / Minus

                                                     
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 527
           |||||||||| |||||||||| ||||| ||||||||||||||
Sbjct: 503 ggtgtcgttgaccttgatgagcgggtcagggtagcggatggt 462



to top

>dbj|AB017068.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJG14
          Length = 86121

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 54/61 (88%), Gaps = 1/61 (1%)
 Strand = Plus / Plus

                                                                         
Query: 336   gtggatggtctcaaaggttcccttatgcttctcc-ctgttcttgatcacaccaacacgcc 394
             |||||||||||||||| ||||||| || || | | | |||||||||||||||||||||||
Sbjct: 15623 gtggatggtctcaaagcttcccttttgttttttcacggttcttgatcacaccaacacgcc 15682

              
Query: 395   c 395
             |
Sbjct: 15683 c 15683



to top

>ref|XM_366671.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein
           (MG02747.4) partial mRNA
          Length = 735

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 209 gctcctcaatgatggtgagcttgatacccttgcccttggg 248
           ||||||||  |||||||||||||| |||||||||||||||
Sbjct: 697 gctcctcagcgatggtgagcttgacacccttgcccttggg 658



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 487 gtgtcgttggccttgatgagtgggtctgggtagcggatggt 527
           ||||||||| ||||||| || ||||| ||||||||||||||
Sbjct: 422 gtgtcgttgaccttgatcagagggtcggggtagcggatggt 382



to top

>gb|AC084630.1|CBRG45E13 Caenorhabditis briggsae cosmid G45E13, complete sequence
          Length = 39246

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                         
Query: 484   atggtgtcgttggccttgatgagtgggtctgggtagcggatggt 527
             |||||||||||| ||||||   ||||||||||||||||||||||
Sbjct: 29232 atggtgtcgttgaccttgacatgtgggtctgggtagcggatggt 29275



to top

>gb|AY850339.1| Magnaporthe grisea 40S ribosomal protein S4-A-like protein mRNA,
           complete cds
          Length = 1024

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                   
Query: 209 gctcctcaatgatggtgagcttgatacccttgcccttggg 248
           ||||||||  |||||||||||||| |||||||||||||||
Sbjct: 766 gctcctcagcgatggtgagcttgacacccttgcccttggg 727



 Score = 50.1 bits (25), Expect = 0.008
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                    
Query: 487 gtgtcgttggccttgatgagtgggtctgggtagcggatggt 527
           ||||||||| ||||||| || ||||| ||||||||||||||
Sbjct: 491 gtgtcgttgaccttgatcagagggtcggggtagcggatggt 451



to top

>gb|BT018605.1| Zea mays clone EL01N0450E04.d mRNA sequence
          Length = 1698

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 30/31 (96%)
 Strand = Plus / Minus

                                           
Query: 412  gtcaccatgacgacgttgccgacgtcaaact 442
            ||||||||||| |||||||||||||||||||
Sbjct: 1356 gtcaccatgaccacgttgccgacgtcaaact 1326



to top

>gb|AC024780.1| Caenorhabditis elegans cosmid Y43B11AR, complete sequence
          Length = 15768

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Plus

                                                            
Query: 484   atggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 530
             |||||||||||  ||||||   |||||||||||||||||||||||||
Sbjct: 13463 atggtgtcgttaaccttgacatgtgggtctgggtagcggatggtgcg 13509



to top

>gb|BT011369.1| Drosophila melanogaster RE57333 full insert cDNA
          Length = 992

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 262 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 308
           |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 767



to top

>ref|NM_168537.1| Drosophila melanogaster Ribosomal protein S4 CG11276-RA, transcript
           variant A (RpS4), mRNA
          Length = 983

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 262 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 308
           |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 813 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 767



to top

>ref|NM_079329.2| Drosophila melanogaster Ribosomal protein S4 CG11276-RB, transcript
           variant B (RpS4), mRNA
          Length = 969

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 262 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 308
           |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 799 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 753



to top

>gb|AC093546.2| Drosophila melanogaster 3L BAC RP98-8G7 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 207761

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 262    ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 308
              |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 141932 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 141886



to top

>ref|NM_068702.2| Caenorhabditis elegans Ribosomal Protein, Small subunit family
           member (rps-4) (rps-4) mRNA, complete cds
          Length = 845

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 484 atggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 530
           |||||||||||  ||||||   |||||||||||||||||||||||||
Sbjct: 499 atggtgtcgttaaccttgacatgtgggtctgggtagcggatggtgcg 453



to top

>dbj|D25237.1|RICSS620B Oryza sativa SS620 mRNA for scar protein, partial cds
          Length = 293

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 49/55 (89%), Gaps = 1/55 (1%)
 Strand = Plus / Minus

                                                                  
Query: 516 gtagcggatggtgcggccatcat-aggtgttcaggtatgggatgcccttctggcc 569
           ||||||||||||||| ||||||| || ||||||||||  |||| |||||||||||
Sbjct: 293 gtagcggatggtgcgaccatcataagttgttcaggtagcggattcccttctggcc 239



to top

>gb|AE003539.3| Drosophila melanogaster chromosome 3L, section 46 of 83 of the complete
              sequence
          Length = 272016

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 262    ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 308
              |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 169866 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 169820



to top

>dbj|D16257.1|DRORPS4 Drosophila melanogaster rpS4 mRNA for ribosomal protein S4,
           complete cds
          Length = 870

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 262 ggcttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 308
           |||||| |||||||||||||| |||||||||||  || |||||||||
Sbjct: 713 ggcttgttgcccttgccaatgatgaacacgttggtcaaacgggtggc 667



to top

>gb|BC081584.1| Danio rerio ribosomal protein S4, X-linked, mRNA (cDNA clone
           MGC:92076 IMAGE:7046733), complete cds
          Length = 888

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 483 gatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggccatc 536
           ||||||||||||| ||||||| || || || ||||| |||||||||||| ||||
Sbjct: 487 gatggtgtcgttgaccttgatcagaggatcagggtaacggatggtgcgggcatc 434



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 255 cacccaaggcttggtgcccttgccaatg 282
           |||||| |||||| ||||||||||||||
Sbjct: 715 cacccatggcttgttgcccttgccaatg 688



to top

>ref|XM_521131.1| PREDICTED: Pan troglodytes similar to 40S ribosomal protein S4, X
           isoform (LOC465710), mRNA
          Length = 863

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 475 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 434



to top

>gb|AY389947.1| Latimeria chalumnae ribosomal protein S4 mRNA, partial cds
          Length = 715

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| |||||||| || |||||||||||| ||||||
Sbjct: 437 ccttgatgagggggtctggataccggatggtgcgggcatcat 396



to top

>gb|BC000472.2| Homo sapiens ribosomal protein S4, X-linked, mRNA (cDNA clone
           MGC:8636 IMAGE:2961540), complete cds
          Length = 889

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 474 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 433



to top

>gb|BC007308.1| Homo sapiens ribosomal protein S4, X-linked, mRNA (cDNA clone
           IMAGE:3352599), partial cds
          Length = 822

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 406 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 365



to top

>gb|BC000236.1| Homo sapiens translin-associated factor X, mRNA (cDNA clone
            IMAGE:3351964), **** WARNING: chimeric clone ****
          Length = 2323

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 497  ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
            |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 1891 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 1850



to top

>ref|NM_001005589.1| Danio rerio ribosomal protein S4, X-linked (rps4x), mRNA
          Length = 888

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 47/54 (87%)
 Strand = Plus / Minus

                                                                 
Query: 483 gatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggccatc 536
           ||||||||||||| ||||||| || || || ||||| |||||||||||| ||||
Sbjct: 487 gatggtgtcgttgaccttgatcagaggatcagggtaacggatggtgcgggcatc 434



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 255 cacccaaggcttggtgcccttgccaatg 282
           |||||| |||||| ||||||||||||||
Sbjct: 715 cacccatggcttgttgcccttgccaatg 688



to top

>ref|NM_001007.3| Homo sapiens ribosomal protein S4, X-linked (RPS4X), mRNA
          Length = 977

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 562 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 521



to top

>gb|DQ445520.1| Graphocephala atropunctata isolate WHGA0585 putative ribosomal
           protein S4e mRNA, complete cds
          Length = 792

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 483 gatggtgtcgttggccttgatgagtgggtctgggtagcggat 524
           ||||||||| ||| |||||||||| ||||| |||||||||||
Sbjct: 480 gatggtgtcattgaccttgatgagagggtcagggtagcggat 439



 Score = 48.1 bits (24), Expect = 0.032
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 262 ggcttggtgcccttgccaatggtgaacacgtt 293
           ||||||||||||||||||||| |||| |||||
Sbjct: 701 ggcttggtgcccttgccaatgatgaagacgtt 670



to top

>gb|BC100904.1| Homo sapiens ribosomal protein S4, X-linked, mRNA (cDNA clone
           MGC:119099 IMAGE:40003601), complete cds
          Length = 792

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 466 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 425



to top

>gb|BC100903.1| Homo sapiens ribosomal protein S4, X-linked, mRNA (cDNA clone
           MGC:119098 IMAGE:40003600), complete cds
          Length = 792

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 466 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 425



to top

>emb|AL135749.3|HSN14 Homo sapiens chromosome X sequence from BAC CEPHB197N14 region
             PHKA1-DXS227 map Xq13, complete sequence
          Length = 156655

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                       
Query: 497   ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
             |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 87756 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 87797



to top

>emb|CR601794.1| full-length cDNA clone CS0DI031YB06 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 858

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 464 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 423



to top

>emb|CR623958.1| full-length cDNA clone CS0DE004YB10 of Placenta of Homo sapiens
            (human)
          Length = 1896

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 497  ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
            |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 1544 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 1503



to top

>emb|CR620411.1| full-length cDNA clone CS0DE011YG15 of Placenta of Homo sapiens
           (human)
          Length = 1386

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 464 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 423



to top

>dbj|AK097914.1| Homo sapiens cDNA FLJ40595 fis, clone THYMU2010705, highly similar to
            40S RIBOSOMAL PROTEIN S4, X ISOFORM
          Length = 2747

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 497  ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
            |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 2363 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 2322



to top

>emb|CR597791.1| full-length cDNA clone CS0DI068YM24 of Placenta Cot 25-normalized
           of Homo sapiens (human)
          Length = 848

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 464 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 423



to top

>emb|CR595707.1| full-length cDNA clone CL0BB017ZH01 of Neuroblastoma of Homo
           sapiens (human)
          Length = 858

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 464 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 423



to top

>emb|CR456735.1| Homo sapiens full open reading frame cDNA clone RZPDo834G036D for
           gene RPS4X, ribosomal protein S4, X-linked; complete
           cds, incl. stopcodon
          Length = 792

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 466 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 425



to top

>emb|CR391662.1| Gallus gallus finished cDNA, clone ChEST418k16
          Length = 856

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Minus

                                                                       
Query: 435 gtcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgtt 494
           ||||||||||||||||||    ||||||   ||||||||||| | || ||| || |||||
Sbjct: 536 gtcaaacttgatgaagtctgtgatcttgcccgtctccaggtcaatctggatcgtatcgtt 477

                                                     
Query: 495 ggccttgatgagtgggtctgggtagcggatggtgcggccatc 536
             |||||||||| || || || ||||||||||||||| ||||
Sbjct: 476 caccttgatgaggggatccggatagcggatggtgcgggcatc 435



to top

>dbj|AK222479.1| Homo sapiens mRNA for ribosomal protein S4, X-linked X isoform
           variant, clone: adKA01615
          Length = 900

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 491 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 450



to top

>emb|BX934312.1| Gallus gallus finished cDNA, clone ChEST670k21
          Length = 764

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Minus

                                                                       
Query: 435 gtcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgtt 494
           ||||||||||||||||||    ||||||   ||||||||||| | || ||| || |||||
Sbjct: 444 gtcaaacttgatgaagtctgtgatcttgcccgtctccaggtcaatctggatcgtatcgtt 385

                                                     
Query: 495 ggccttgatgagtgggtctgggtagcggatggtgcggccatc 536
             |||||||||| || || || ||||||||||||||| ||||
Sbjct: 384 caccttgatgaggggatccggatagcggatggtgcgggcatc 343



to top

>emb|BX930717.1| Gallus gallus finished cDNA, clone ChEST374l2
          Length = 805

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Minus

                                                                       
Query: 435 gtcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgtt 494
           ||||||||||||||||||    ||||||   ||||||||||| | || ||| || |||||
Sbjct: 485 gtcaaacttgatgaagtctgtgatcttgcccgtctccaggtcaatctggatcgtatcgtt 426

                                                     
Query: 495 ggccttgatgagtgggtctgggtagcggatggtgcggccatc 536
             |||||||||| || || || ||||||||||||||| ||||
Sbjct: 425 caccttgatgaggggatccggatagcggatggtgcgggcatc 384



to top

>ref|NM_205108.1| Gallus gallus ribosomal protein S4 (LOC396001), mRNA
          Length = 852

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Minus

                                                                       
Query: 435 gtcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgtt 494
           ||||||||||||||||||    ||||||   ||||||||||| | || ||| || |||||
Sbjct: 532 gtcaaacttgatgaagtctgtgatcttgcccgtctccaggtcaatctggatcgtatcgtt 473

                                                     
Query: 495 ggccttgatgagtgggtctgggtagcggatggtgcggccatc 536
             |||||||||| || || || ||||||||||||||| ||||
Sbjct: 472 caccttgatgaggggatccggatagcggatggtgcgggcatc 431



to top

>gb|BC071662.1| Homo sapiens ribosomal protein S4, X-linked, mRNA (cDNA clone
           MGC:87857 IMAGE:5505465), complete cds
          Length = 905

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 503 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 462



to top

>gb|AF041428.1|AF041428 Homo sapiens ribosomal protein s4 X isoform gene, complete cds
          Length = 8542

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                      
Query: 497  ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
            |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 5195 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 5154



to top

>gb|L24368.1|CHKRPS4A Gallus gallus (clone pDP1435) domesticus ribosomal protein S4 mRNA,
           complete cds
          Length = 852

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 83/102 (81%)
 Strand = Plus / Minus

                                                                       
Query: 435 gtcaaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgtt 494
           ||||||||||||||||||    ||||||   ||||||||||| | || ||| || |||||
Sbjct: 532 gtcaaacttgatgaagtctgtgatcttgcccgtctccaggtcaatctggatcgtatcgtt 473

                                                     
Query: 495 ggccttgatgagtgggtctgggtagcggatggtgcggccatc 536
             |||||||||| || || || ||||||||||||||| ||||
Sbjct: 472 caccttgatgaggggatccggatagcggatggtgcgggcatc 431



to top

>gb|M58458.1|HUMRPS4X Human ribosomal protein S4 (RPS4X) isoform mRNA, complete cds
          Length = 888

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 501 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 460



to top

>gb|M22146.1|HUMSCAR Human scar protein mRNA, complete cds
          Length = 864

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 471 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 430



to top

>dbj|AB024285.1| Macaca fuscata mRNA for ribosomal protein S4X (RPS4X), complete cds
          Length = 853

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 466 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 425



to top

>dbj|D50104.1| Macaca fuscata mRNA for ribosomal protein S4, partial cds
          Length = 581

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 409 ccttgatgaggggatcggggtagcggatggtgcgggcatcat 368



to top

>dbj|AB015610.1| Chlorocebus aethiops mRNA for ribosomal protein S4X, complete cds
          Length = 878

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 497 ccttgatgagtgggtctgggtagcggatggtgcggccatcat 538
           |||||||||| || || |||||||||||||||||| ||||||
Sbjct: 489 ccttgatgaggggatcagggtagcggatggtgcgggcatcat 448



to top

>ref|XM_502766.1| Yarrowia lipolytica CLIB122, YALI0D12903g predicted mRNA
          Length = 783

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 220 atggtgagcttgatacccttgcccttggg 248
           |||| ||||||||||||||||||||||||
Sbjct: 743 atggagagcttgatacccttgcccttggg 715



to top

>emb|AL116727.1|CNS01DEN Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 480 cttgatggtgtcgttggccttgatgagtgggtctgggtagcggat 524
           ||||| |||||||||| ||||||||  |||||||||||| |||||
Sbjct: 522 cttgacggtgtcgttgaccttgatggatgggtctgggtaacggat 478



to top

>emb|AL116316.1|CNS01D38 Botrytis cinerea strain T4 cDNA library
          Length = 540

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 480 cttgatggtgtcgttggccttgatgagtgggtctgggtagcggat 524
           ||||| |||||||||| ||||||||  |||||||||||| |||||
Sbjct: 108 cttgacggtgtcgttgaccttgatggatgggtctgggtaacggat 64



to top

>emb|AL113012.1|CNS01AJG Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 480 cttgatggtgtcgttggccttgatgagtgggtctgggtagcggat 524
           ||||| |||||||||| ||||||||  |||||||||||| |||||
Sbjct: 211 cttgacggtgtcgttgaccttgatggatgggtctgggtaacggat 167



to top

>gb|AF054511.1|AF054511 Yarrowia lipolytica ribosomal protein S7 (RPS7) mRNA, complete cds
          Length = 852

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                        
Query: 220 atggtgagcttgatacccttgcccttggg 248
           |||| ||||||||||||||||||||||||
Sbjct: 745 atggagagcttgatacccttgcccttggg 717



to top

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 220     atggtgagcttgatacccttgcccttggg 248
               |||| ||||||||||||||||||||||||
Sbjct: 1601891 atggagagcttgatacccttgcccttggg 1601919



to top

>gb|AE017341.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 1, complete
               sequence
          Length = 2300533

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 102/128 (79%)
 Strand = Plus / Minus

                                                                           
Query: 409     ccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtc 468
               ||||| |||||||||||||| |||   ||||||||||||  |||||| || |||||    
Sbjct: 1677506 ccagtaaccatgacgacgtttccgggctcaaacttgatgtggtcaacgattttgttctga 1677447

                                                                           
Query: 469     tccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtg 528
                | | ||||| |||||  ||||||||| ||||||||   ||||| ||||| |||||||| 
Sbjct: 1677446 acgaagtcgaacttgacagtgtcgttgaccttgatggcagggtcggggtatcggatggtt 1677387

                       
Query: 529     cggccatc 536
               ||||||||
Sbjct: 1677386 cggccatc 1677379



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 225     gagcttgatacccttgcccttggg 248
               |||||||| |||||||||||||||
Sbjct: 1677741 gagcttgacacccttgcccttggg 1677718



to top

>ref|XM_591678.2| PREDICTED: Bos taurus ribosomal protein S4, X-linked (RPS4X), mRNA
          Length = 899

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 439 aacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcc 498
           ||||||||||| |||  |||||||  ||||||||| || | ||  |||||||| ||  ||
Sbjct: 538 aacttgatgaaatcagtaatcttgccggtctccagatcaatctgaatggtgtcattcacc 479

                                           
Query: 499 ttgatgagtgggtctgggtagcggatggtgcg 530
           |||||||| || || ||||| |||||||||||
Sbjct: 478 ttgatgaggggatcagggtaacggatggtgcg 447



to top

>ref|XM_567206.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
           (CNA06200) partial mRNA
          Length = 840

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 102/128 (79%)
 Strand = Plus / Minus

                                                                       
Query: 409 ccagtcaccatgacgacgttgccgacgtcaaacttgatgaagtcaacaatcttgttggtc 468
           ||||| |||||||||||||| |||   ||||||||||||  |||||| || |||||    
Sbjct: 554 ccagtaaccatgacgacgtttccgggctcaaacttgatgtggtcaacgattttgttctga 495

                                                                       
Query: 469 tccaggtcgagcttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtg 528
            | | ||||| |||||  ||||||||| ||||||||   ||||| ||||| |||||||| 
Sbjct: 494 acgaagtcgaacttgacagtgtcgttgaccttgatggcagggtcggggtatcggatggtt 435

                   
Query: 529 cggccatc 536
           ||||||||
Sbjct: 434 cggccatc 427



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 225 gagcttgatacccttgcccttggg 248
           |||||||| |||||||||||||||
Sbjct: 738 gagcttgacacccttgcccttggg 715



to top

>gb|AC146554.5| Medicago truncatula clone mth2-9l7, complete sequence
          Length = 135334

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                         
Query: 481   ttgatggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggccatcatag 540
             ||||| ||||| |||||||| || || || || || |||||||| || || |||||||||
Sbjct: 10857 ttgattgtgtcattggccttaataaggggatcaggatagcggattgtacgcccatcatag 10916

                     
Query: 541   gtgttcag 548
             ||||||||
Sbjct: 10917 gtgttcag 10924



to top

>ref|XM_783401.1| PREDICTED: Strongylocentrotus purpuratus similar to CG11276-PA,
           isoform A (LOC583495), partial mRNA
          Length = 285

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 286 aacacgttgcccagacgggtggca 309
           ||||||||||||||||||||||||
Sbjct: 179 aacacgttgcccagacgggtggca 156



to top

>dbj|D50109.1| Equus caballus mRNA for ribosomal protein S4, partial cds
          Length = 581

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 484 atggtgtcgttggccttgatgagtgggtctgggtagcggatggt 527
           |||||||| ||| |||||||||| || || ||||||||||||||
Sbjct: 422 atggtgtcattgaccttgatgagaggatcagggtagcggatggt 379



to top

>dbj|D50107.1| Bos taurus mRNA for ribosomal protein S4, partial cds
          Length = 581

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 75/92 (81%)
 Strand = Plus / Minus

                                                                       
Query: 439 aacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgatggtgtcgttggcc 498
           ||||||||||| |||  |||||||  ||||||||| || | ||  |||||||| ||  ||
Sbjct: 467 aacttgatgaaatcagtaatcttgccggtctccagatcaatctgaatggtgtcattcacc 408

                                           
Query: 499 ttgatgagtgggtctgggtagcggatggtgcg 530
           |||||||| || || ||||| |||||||||||
Sbjct: 407 ttgatgaggggatcagggtaacggatggtgcg 376



to top

>ref|XM_753768.1| Ustilago maydis 521 hypothetical protein (UM02714.1) partial mRNA
          Length = 1161

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 487 gtgtcgttggccttgatgagtgggtctgggtagcggatggtgcggcc 533
           ||||||||| ||||||||   ||||| ||||| ||||||||||||||
Sbjct: 842 gtgtcgttgaccttgatggccgggtcggggtatcggatggtgcggcc 796



to top

>ref|XM_537399.2| PREDICTED: Canis familiaris similar to 40S ribosomal protein S4, X
           isoform (LOC480276), mRNA
          Length = 854

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 484 atggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 530
           |||||||| ||  |||||||||| || ||||| ||||||||||||||
Sbjct: 498 atggtgtcattcaccttgatgaggggatctggatagcggatggtgcg 452



to top

>ref|XM_775416.1| PREDICTED: Strongylocentrotus purpuratus similar to 40S ribosomal
           protein S4, X isoform (LOC574997), mRNA
          Length = 825

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 62/75 (82%)
 Strand = Plus / Minus

                                                                       
Query: 235 cccttgcccttggggaggctcacccaaggcttggtgcccttgccaatggtgaacacgttg 294
           ||||||||||||||||||   ||  | | |||| || ||||||| |||  ||||||||||
Sbjct: 770 cccttgcccttggggagggagacgtaggccttgttggccttgccgatgacgaacacgttg 711

                          
Query: 295 cccagacgggtggca 309
           || ||||||||||||
Sbjct: 710 ccaagacgggtggca 696



to top

>gb|AC008087.11| Homo sapiens chromosome 17, clone RP5-1127L24, complete sequence
          Length = 104726

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 42/47 (89%), Gaps = 1/47 (2%)
 Strand = Plus / Plus

                                                            
Query: 484   atggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 530
             |||||||| ||  |||||||||| ||||| |||||||||||||||||
Sbjct: 33567 atggtgtcattcaccttgatgag-gggtcagggtagcggatggtgcg 33612



to top

>gb|AC027455.22| Homo sapiens chromosome 17, clone RP11-411G7, complete sequence
          Length = 145410

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 42/47 (89%), Gaps = 1/47 (2%)
 Strand = Plus / Plus

                                                            
Query: 484   atggtgtcgttggccttgatgagtgggtctgggtagcggatggtgcg 530
             |||||||| ||  |||||||||| ||||| |||||||||||||||||
Sbjct: 80071 atggtgtcattcaccttgatgag-gggtcagggtagcggatggtgcg 80116



to top

>gb|AY224232.1|AY224229S4 Pongo pygmaeus ribosomal protein S4 (RPS4Y) gene, exon 5
          Length = 172

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 497 ccttgatgagtgggtctgggtagcggatggt 527
           |||||||||| || |||||||||||||||||
Sbjct: 106 ccttgatgagaggatctgggtagcggatggt 76



to top

>emb|BX067601.1|CNS09OBP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 862

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 264 cttggtgcccttgccaatggtgaacacgtt 293
           |||||||| |||||| ||||||||||||||
Sbjct: 282 cttggtgctcttgccgatggtgaacacgtt 311



to top

>emb|BX067600.1|CNS09OBO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 264 cttggtgcccttgccaatggtgaacacgtt 293
           |||||||| |||||| ||||||||||||||
Sbjct: 712 cttggtgctcttgccgatggtgaacacgtt 683



to top

>dbj|AB226297.1| Aspergillus oryzae cDNA, contig sequence: AoEST3159
          Length = 1183

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 486 ggtgtcgttggccttgatgagtgggtctgggtagcggatggt 527
           |||||||||| ||||||||   ||||| ||||||||||||||
Sbjct: 544 ggtgtcgttgaccttgatggcagggtcggggtagcggatggt 503



to top

>gb|DQ362415.1| Shigella dysenteriae strain G1274 GcvT (gcvT) gene, partial cds
          Length = 416

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 54  ggttcgcaaatcaacaaacatcaggc 79
           |||||||||||| |||||||||||||
Sbjct: 88  ggttcgcaaatcgacaaacatcaggc 113



to top

>gb|AF429978.1| Spodoptera frugiperda ribosomal protein S4 mRNA, complete cds
          Length = 936

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 502 atgagtgggtctgggtagcggatggt 527
           ||||||||||| ||||||||||||||
Sbjct: 491 atgagtgggtcggggtagcggatggt 466



to top

>gb|AY439895.1| Armigeres subalbatus ASAP ID: 38941 cytosolic small ribosomal
           subunit S4 mRNA sequence
          Length = 960

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 264 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 308
           ||||||| ||||||| ||| ||||||||||   ||||||||||||
Sbjct: 729 cttggtggccttgccgatgatgaacacgttagtcagacgggtggc 685



to top

>gb|AY433736.1| Aedes aegypti ASAP ID: 34407 cytosolic small ribosomal subunit S4
           mRNA sequence
          Length = 755

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 264 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 308
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 444 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 400



to top

>gb|DQ440018.1| Aedes aegypti clone AE-221 40S ribosomal protein S4 mRNA, complete
           cds
          Length = 789

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 264 cttggtgcccttgccaatggtgaacacgttgcccagacgggtggc 308
           ||||||| |||| |||||| |||| ||||||  ||||||||||||
Sbjct: 699 cttggtggccttaccaatgatgaaaacgttggtcagacgggtggc 655



to top

>gb|AC148078.2| Mus musculus BAC clone RP24-186K12 from chromosome 13, complete sequence
          Length = 149455

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 242    ccttggggaggctcacccaag 262
              |||||||||||||||||||||
Sbjct: 134897 ccttggggaggctcacccaag 134877



to top

>ref|XM_657306.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN4794.2), mRNA
          Length = 720

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 220 atggtgagcttgatacccttgcccttggg 248
           |||| |||||||| |||||||||||||||
Sbjct: 674 atggagagcttgacacccttgcccttggg 646



to top

>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome
          Length = 5178466

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 314     ggtgaccctgggcatcctcaacgtg 338
               ||||||||||||||| |||||||||
Sbjct: 4589196 ggtgaccctgggcatgctcaacgtg 4589172



to top

>ref|XM_749829.1| Aspergillus fumigatus Af293 cytosolic small ribosomal subunit S4
           (Afu3g06840) partial mRNA
          Length = 786

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 220 atggtgagcttgatacccttgcccttggg 248
           ||||||||||| | |||||||||||||||
Sbjct: 740 atggtgagcttaacacccttgcccttggg 712



to top

>ref|XM_446360.1| Candida glabrata CBS138, CAGL0F09031g partial mRNA
          Length = 786

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 474 gtcgagcttgatggtgtcgttggccttgatgagtgggtctgggta 518
           ||||| ||||| |||||| ||| ||||||||  ||||||||||||
Sbjct: 489 gtcgaccttgacggtgtcattgaccttgatgtttgggtctgggta 445



to top

>emb|AM048930.1| Mycetophagus quadripustulatus mRNA for ribosomal protein S4e (rpS4e
           gene)
          Length = 786

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 508 gggtctgggtagcggatggtgcggccatc 536
           ||||||||||| ||||||||||| |||||
Sbjct: 455 gggtctgggtaacggatggtgcgtccatc 427



to top

>gb|CP000270.1| Burkholderia xenovorans LB400 chromosome 1, complete sequence
          Length = 4895836

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                        
Query: 481     ttgatggtgtcgttggccttgatga 505
               ||||||||||||||| |||||||||
Sbjct: 3708992 ttgatggtgtcgttgcccttgatga 3709016



to top

>emb|CR380952.1| Candida glabrata strain CBS138 chromosome F complete sequence
          Length = 927101

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                           
Query: 474    gtcgagcttgatggtgtcgttggccttgatgagtgggtctgggta 518
              ||||| ||||| |||||| ||| ||||||||  ||||||||||||
Sbjct: 885815 gtcgaccttgacggtgtcattgaccttgatgtttgggtctgggta 885859


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,822,213
Number of Sequences: 3902068
Number of extensions: 4822213
Number of successful extensions: 100799
Number of sequences better than 10.0: 306
Number of HSP's better than 10.0 without gapping: 303
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 99900
Number of HSP's gapped (non-prelim): 871
length of query: 571
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 548
effective length of database: 17,143,297,704
effective search space: 9394527141792
effective search space used: 9394527141792
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top